The design and synthesis of a novel compound of berberine and baicalein that inhibits the efficacy of lipid accumulation in 3T3-L1 adipocytes

Article abstract of DOI:10.1016/j.bmc.2017.08.013

The combination of berberine and baicalein may have a better therapeutic effect against disease. To explore the combined effect of baicalein and berberine in the treatment of obesity, we designed and synthesized a hybrid compound, and its biological activities were evaluated in 3T3-L1 adipocytes. The structures of the berberine-baicalein (BBS) compounds were confirmed by ¹H NMR, ¹³C NMR, ultraviolet spectroscopy and high resolution mass spectrometry (HRMS). The present study showed that the IC₅₀ values of the inhibitory effects of baicalein, berberine and BBS against 3T3-L1 cells were 29.81 ± 0.90, 21.84 ± 1.67 and 9.42 ± 0.60 μM, respectively. The expression of mRNAs related to lipolysis and lipogenesis were examined by quantitative real-time PCR. The results showed that BBS could up-regulate the expression of the Atgl gene and down-regulate the mRNA expression of Srebp-1c, Fasn, Scd1, and Acc in 3T3-L1 adipocytes. These results indicate that BBS may have a stronger effect than baicalein and berberine on the viability of 3T3-L1 preadipocytes. In addition, BBS may have therapeutic effects and pharmacological activities against obesity. This “medicine couple” may be beneficial for studies of traditional Chinese medicine.

Full text of DOI:10.1016/j.bmc.2017.08.013

Accepted Manuscript
The design and synthesis of a novel compound of berberine and baicalein that
inhibits the efficacy of lipid accumulation in 3T3-L1 adipocytes
Mengjiao Hao, Zhuoji Guan, Yan Li, Lixian Liu, Xiao Yuan, Ying Gao, Weimin
Li
PII:
S0968-0896(17)31336-6
DOI:
http://dx.doi.org/10.1016/j.bmc.2017.08.013
BMC 13916
Reference:
Bioorganic & Medicinal Chemistry
To appear in:
Received Date:
Revised Date:
Accepted Date:
29 June 2017
4 August 2017
8 August 2017
Please cite this article as: Hao, M., Guan, Z., Li, Y., Liu, L., Yuan, X., Gao, Y., Li, W., The design and synthesis
of a novel compound of berberine and baicalein that inhibits the efficacy of lipid accumulation in 3T3-L1 adipocytes,
Bioorganic & Medicinal Chemistry (2017), doi: http://dx.doi.org/10.1016/j.bmc.2017.08.013
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

The design and synthesis of a novel compound of berberine and baicalein that
inhibits the efficacy of lipid accumulation in 3T3-L1 adipocytes
∗
Mengjiao Haoa, Zhuoji Guanb, Yan Lia, Lixian Liua, Xiao Yuanc, Ying Gaoa, Weimin Lia
a School of Chinese Materia Medica, Guangzhou University of Chinese Medicine, Guangzhou 510006, People's Republic of China
b The First Clinical Medical College, Guangzhou University of Chinese Medicine, Guangzhou 510405, China
c Guangzhou Pi & Pi Technology Inc, Guangzhou 510006, People's Republic of China
The combination of berberine and baicalein may have a better therapeutic effect against disease. To explore
the combined effect of baicalein and berberine in the treatment of obesity, we designed and synthesized a hybrid
compound, and its biological activities were evaluated in 3T3-L1 adipocytes. The structures of the
berberine-baicalein (BBS) compounds were confirmed by 1H NMR, 13C NMR, ultraviolet spectroscopy and high
resolution mass sectrometry (HRMS). The present study showed that the IC50 values of the inhibitory effects of
baicalein, berberine and BBS against 3T3-L1 cells were 29.81±0.90, 21.84±1.67 and 9.42±0.60 µM,
respectively. The expression of mRNAs related to lipolysis and lipogenesis were examined by quantitative
real-time PCR. The results showed that BBS could up-regulate the expression of the Atgl gene and down-regulate
the mRNA expression of Srebp-1c, Fasn, Scd1, and Acc in 3T3-L1 adipocytes. These results indicate that BBS
may have a stronger effect than baicalein and berberine on the viability of 3T3-L1 preadipocytes. In addition, BBS
may have therapeutic effects and pharmacological activities against obesity. This "medicine couple" may be
beneficial for studies of traditional Chinese medicine.
Keywords: Obesity; Berberine; Baicalein; Synthesis
1. Introduction
Obesity is an overaccumulation of lipids and a symptom of metabolic disorders. Obesity is a major risk factor
for a number of chronic diseases, particularly cardiovascular diseases, type 2 diabetes, obstructive sleep apnea,
cancer, osteoarthritis and depression. The World Health organization (WHO) defines overweight as a body mass
index (BMI) equal to or greater than 25 and obesity as a BMI equal to or greater than 30.1 According to research
by the WHO published in May 2017, obesity has reached epidemic proportions globally, and at least 2.8 million
people die each year from being overweight or obese.1-3 Obesity is more common in women than men. Authorities
consider it one of the most serious public health problems of the 21st century.4 It is very important for the
treatment of obesity to decrease lipid accumulation and reduced triglyceride content.5
Until now, hundreds of traditional Chinese herbs and active components have been proven to be effective for
treatment against diabetes, dyslipidaemia and obesity. For instance, in Coptis chinensis, a popular traditional
Chinese medical plant used in the treatment of diabetes and infections, the major active component is berberine
(BBR). It was observed that berberine can improve metabolic syndrome, leading to decreased plasma cholesterol
and triglyceride levels in hypercholesterolemic patients.6-9 A study showed that BBR decreased the TG content in
3T3-L1 adipocytes by directly increasing the expression of adipose triglyceride lipase (Atgl). In the procession of
Atgl expression, the effect of BBR could be abolished by Compound C.This suggested that the AMP-activated
protein kinase (AMPK) pathway is involved in the effects of BBR on the pormone-sensitive lipase (p-Hsl) and
Atgl.10 BBR may act as an adjuvant medication to prevent lipid metabolism disorders caused by antipsychotic
medications by down-regulating the sterol regulatory element-binding protein (Srebp) pathway and up-regulating
the phosphorylation of AMPK.11-12 Many published studies consistently demonstrate that BBR is a strong inducer
of Thr-172 phosphorylation in AMPK.13-18
∗ Corresponding author. Tel.: +020-39358290; fax: +86 20 39358290; e-mail: liweimin@gzucm.edu.cn

In Scutellaria baicalensis, the major active component is baicalein; Scutellaria baicalensis is widely used in
traditional Chinese medicine. It has previously been shown that extracts of S. baicalensis improved obesity and
hypertriglyceridemia in a type 2 diabetic animal model.19-23 Baicalein may be used as a treatment to prevent
metabolic disorders. Its major mechanism is through the up-regulation of AMPK and its related signal
pathway.23-26 Baicalein may be a promising complementary therapy for weight management or obesity.27 Baicalein
inhibits lipid accumulation during adipogenesis in 3T3-L1 cells.28
Using prescriptions called "formulae" as combination therapy has a history of 2500 years. The combination of
some different traditional Chinese medicine may increase the therapeutic effect.29-30 Huanghousu was synthesized
by magnolol and berberine, it is reported that its efficacy in improving lipid metabolism was better than that of a
single component.31 Coptis chinensis and Scutellaria baicalensis are a well-known "medicine couple" in China.
This combination is believed to produce enhanced therapeutic effect and is very frequently co-prescribed in
Chinese Medicinal formulae.32-33 The process and efficacy of a new compound for synthesizing berberine and
baicalein have been questioned. To synthesize highly effective new compounds for the treatment of obesity, we
designed and synthesized berberine and baicalein. Here the structures of all compounds in the synthesis process
were confirmed by spectroscopy (1H NMR, 13C NMR and HRMS spectra). We evaluated BBS inhibit Lipid
accumulation efficacy in 3T3-L1 adipocytes, which measured mRNA expression of lipolysis and lipogenesis
associated genes using quantitative real-time PCR.
2. Materials and methods
2.1. Chemicals and reagents
Berberine and baicalein (purityꢀ98%) were purchased from the China Drugs and Biological Products Inspection
Institute (Beijing, China). Phosphate-buffered saline (PBS), Dulbecco's modified Eagle's medium (DMEM) and
foetal bovine serum (FBS) were purchased from Gibco BRL (Grand Island, NY, USA). Newborn calf serum (CS)
was purchased from Bovogen (Melbourne, Australia). 3-Isobutyl-1-methylxanthine (IBMX), insulin (INS),
dexamethasone (DEX) and Oil Red O were purchased from Sigma Aldrich (St Louis, MO). A Cell Counting Kit-8
(CCK8) was bought from Dojindo (Kyushu, Japan). A triglyceride GPO-POD assay kit and a BCA protein assay
kit were from Applygen (Beijing, China). RNAiso Plus, the PrimeScriptTM RT Reagent Kit with gDNA Eraser
(Perfect Real Time), and SYBR® Premix Ex TaqTM II (Tli RNaseH Plus) were purchased from Takara (Tokyo,
Japan). The mass spectra were recorded using a DSQ mass spectrometer (Thermo, USA).
2.2. Berberine-baicalein (BBS) synthesis
2.2.1. Synthesis of berberrubine34
The synthesis of berberrubine utilized a microwave synthesis method as described in the literature.34 Berberine (1
g, 2.07 mmol) was dissolved in N,N-dimethylformamide (DMF, 25 ml). Several zeolites were added and refluxed.
The reaction mixture was microwave irradiated for 15 min at 400 W. The completion of the reaction was diluted
with water (40 ml) and refrigerated until crystallization was complete. The crystals were washed with petroleum
ether and evaporated in a vacuum to obtain compound 1 (berberrubine) with a 72% yield. The filtrate was purified
using PIPO-02 macroporous resin, filtered and evaporated to isolate compound 1 with a 21% yield. Compound 1
was obtained with 93% yield (purityꢀ98%).
2.2.2. Synthesis of 9-(6-bromoethyl)berberine hydrochloride
Compound 1 (15 g, 46.55 mmol) in acetonitrile (600 ml) was added to 1,6-dibromoethane (80 ml) and stirred at
86 for 1 h. The reaction mixture was evaporated to obtain the crude compound, which was washed with
acetonitrile and aceticether to afford compound 2 (9-(6-bromoethyl)berberine hydrochloride) with a 93% yield.

9-(6-Bromoethyl)berberine hydrochloride 2. Yellow crystals; UV: ꢁmax 202.8, 229.4, 266.3, 346.8, and 430.3nm;
1H NMR (CDCl3, 300 MHz) ꢂ: 7.80 (1H, s, H-1), 7.09 (1H, s, H-4), 3.57 (2H, t, J = 5.8, H-5), 4.96 (2H, t, J = 5.8,
H-6), 9.76 (1H, s, H-8), 8.00 (1H, d, J = 9.1, H-11), 8.19 (1H, d, J = 9.1, H-12), 8.95 (1H, s, H-13), 6.17 (2H, s,
H-15), 4.05 (3H, s, H-16), 4.28 (2H, t, H-17), 1.84-1.89 (2H, m, H-18 H-21), 1.49-1.51 (2H, m, H-19 H-20), and
3.19 (2H, t, H-22); 13C NMR (CDCl3, 300 MHz) ꢂ: 105.32 (C-1), 150.29 (C-2), 149.71 (C-3), 108.31 (C-4),
130.58 (C-4a), 27.22 (C-5), 56.95 (C-6), 145.18 (C-8), 137.35 (C-8a), 120.12 (C-9), 147.57 (C-10), 120.35 (C-11),
123.21 (C-12), 132.92 (C-12a), 126.57 (C-13), 142.71 (C-14), 121.55 (C-14a), 101.98 (C-15), 55.20 (C-16), 73.97
(C-17), 29.20 (C-18), 24.31 (C-19), 26.22 (C-20), 32.07 (C-21), and 35.11 (C-22); ESI-MS: m/z, [C25H27BrNO4]+,
484.11[M-Br]+.
2.2.3. Synthesis of berberine-baicalein(BBS)
Compound 2 (0.5 g, 1.03 mmol) was added to DMF (35 ml) and triethylamine (6 ml), Baicalein (0.18 g, 0.67
mmol) and several zeolites and then refluxed under sonication for 30 s. Then, the reaction mixture was microwave
irradiated for 10 min at 240 W. At the completion of the reaction, the reaction was cooled to room temperature,
and the pH value of the solution was adjusted to 2–3 by adding HCl. The reaction mixture was diluted with water
and refrigerated until crystallization was complete. The crystals were washed with distilled water to neutral pH.
The crude product was washed with acetic ether and evaporated in a vacuum at 80 to obtain compound 3.
Compound 3 (BBS) was obtained with a 47% yield (purityꢀ96%).
Berberine-baicalein 3. Yellow solid; UV: ꢁmax 217.7, 271.8, 334.2, and 436.7 nm; 1H NMR (CDCl3, 300 MHz) ꢂ:
7.73 (1H, s, H-1), 7.01 (1H, s, H-4), 3.18 (2H, t, J = 5.8, H-5), 4.95 (2H, t, J = 5.8, H-6), 9.74 (1H, s, H-8), 7.94
(1H, d, J = 9.1, H-11), 8.15 (1H, d, J = 9.1, H-12), 8.90 (1H, s, H-13), 6.14 (2H, s, H-15), 4.04 (3H, s, H-16), 4.30
(2H, t, H-17), 1.84-1.92 (2H, m, H-18 H-21), 1.57 (2H, m, H-19 H-20), 4.13 (2H, t, H-22), 8.67 (1H, s, H-23),
12.48 (1H, s, H-24), 6.94 (1H, s, H-27), 6.89 (1H, s, H-30), 8.05-8.06 (2H, m, H-33 H-37), and 7.54-7.61 (3H, m,
H-34 H-35 H-36); 13C NMR (CDCl3, 300 MHz) ꢂ: 105.29 (C-1), 150.20 (C-2), 149.61 (C-3), 108.24 (C-4), 130.47
(C-4a), 28.31 (C-5), 56.94 (C-6), 145.06 (C-8), 137.26 (C-8a), 120.12 (C-9), 147.54 (C-10), 120.28 (C-11), 123.16
(C-12), 132.90 (C-12a), 126.50 (C-13), 142.70 (C-14), 121.47 (C-14a), 101.98 (C-15), 55.17 (C-16), 74.03 (C-17),
25.05 (C-18), 24.89 (C-19), 26.23 (C-20), 29.33 (C-21), 68.66 (C-22), 131.84 (C-23), 149.61 (C-24), 105.01
(C-25), 145.95 (C-26), 91.79 (C-27), 153.86 (C-28), 182.13 (C-29), 104.51 (C-30), 162.93 (C-31), 130.69 (C-32),
126.17 (C-33 C-37), 129.00 (C-34 C-6), and 130.03 (C-35); ESI-MS: m/z, [C40H36NO9]+, 674.24.
2.3. Cell culture and treatment
2.3.1. Cell culture and adipocyte differentiation
3T3-L1 cells were purchased from the cell bank of the Chinese Academy of Sciences (Shanghai, China) and were
maintained in DMEM supplemented with 10% CS and 1% penicillin-streptomycin in a humidified 5% CO2
incubator at 37 . For the experiments, cells were seeded at a density of 2×105 cells/well in 6-well plates with
DMEM supplemented with 10% FBS. Two days after confluency was reached, the culture medium was switched
to differentiation medium (DMEM, 10% FBS, 0.5 mmol/L IBMX, 1.0 ꢃmol/L DEX and 10 mg/L insulin) for 3
days. Then, the cells were maintained in differentiation medium containing only 10 mg/L of insulin for 2 days. The
cells were replenished with DMEM containing 10% FBS every other day. On day 10, 80% of the 3T3-L1 cells had
differentiated into mature adipocytes.
2.3.2. Cytotoxicity assay

The cell viability was assayed using the Cell Counting Kit-8 (CCK8) according to the manufacturer’s protocol.
The cells were seeded in a 96-well plate at a density of 5×103 cells/well. The cells were incubated for 24 h and then
treated with medium containing various concentrations of berberine, baicalein and BBS (0-80 ꢃM) for 48 h. After
incubation, 10 ꢃl of CCK8 solution were added to each well, and the plate incubated for 2 h at 37°C. The
absorbance of the solution was then measured at 450 nm using a microplate reader (Thermo Fisher, USA). The
IC50 value was defined as the half-maximal inhibitory concentration of cell viability, and it was quantitative
measured by the logit method.
2.3.3. Oil Red O staining and lipid accumulation
Differentiated adipocytes were rinsed twice with PBS (pH 7.4) and were fixed in 10% buffered formalin for 30
min at room temperature. Then, the cells were washed with distilled water twice and stained with freshly diluted
Oil Red O solution (six parts of 0.5% Oil Red O solution and four parts of distilled water) for 1 h at room
temperature. Then, the Oil Red O-stained cells were washed twice with distilled water and visualized under thane
inverted microscope (TS100, Nikon, Tokyo, Japan). For the quantitative determinations of the accumulated lipids,
the Oil Red O-stained cells were washed twice with 60% isopropanol and destained with isopropanol. Then, the
absorbance was measured at 510 nm with a spectrophotometer.35
2.3.4. Triglyceride quantification
The cells were washed with PBS and dissolved in Cell lysates. The cell lysates were heated at 70℃ for 10 min.
The mixture was centrifuged at 2000 rpm for 5 min, and the supernatant was collected. 10 ꢃl of the supernatant
and 200 ꢃl of working fluid were mixed together at 37℃ for 10 min. The absorbance was quantified at 550 nm
with a spectrophotometer. The protein content of the remainder of the mixture was measured according to the
BCA method. The TG values were expressed as TG/protein.
2.3.5. Quantitative Real-Time Polymerase Chain Reaction (qPCR)
The total RNA was extracted from differentiated adipocytes using RNAiso Plus according to the manufacturer’s
instructions. The RT reaction was carried out using 1 ꢃg of total RNA. The RNA was reverse transcribed into
cDNA using a reverse transcription kit. The gene expression levels were measured with qRT-PCR using the
CFX96™ Real-Time PCR Detection System (Bio-Rad) and SYBR® Premix Ex TaqTM II. The primers that were
used are shown in Table 1. The relative gene expression quantification was normalized to the β-actin mRNA
expression using the 2-ꢄꢄCt analysis method.
Table 1 Primers used for quantitative real-time PCR.
Gene
Forward Primer
Reverse Primer
Annealing Temperature (°C)
GTCCTGCTTGATGCACACAT
GTCCTGCTTGATGCACACAT
55.5
Ampk
AGACACCAGCCAACGGATAC
GGAATGGCCTACTGAACCAA
GCCTCCAACCTCAACCACTA
TGCTCCAGCTCATCAACAAC
GCTGGCACGGAAGAAGATAC
GCAATTGATCCTCCTCTCCA
AAGGTCCGGAAAGAGACCAT
GGCCAGAGAAGCAGAAGAGA
57.4
54.5
56
HSL
Atgl
Acc
56
Srebp-1c
Fasn
CTGAAGAGCCTGGAAGATCG
GCTGGAGTACGTCTGGAGGA
GGAGATTACTGCCCTGGCTCCT
CGGAGCTTGTGGTAGAAGGA
CCGAAGAGGCAGGTGTAGAG
GACTCATCGTACTCCTGCTTGCT
55.5
57.4
60
Scd1
β-actin
Abbreviations: Ampk (PRKAA1), AMP-activated protein kinase; HSL, Hormone-sensitive lipase; Atgl, Adipose triglyceride lipase; ACC,
acetyl-CoA carboxylase; Srebp-1c, Sterol regulatory element-binding protein 1; Fasn, Fatty acid synthase; Scd1, Stearoyl-CoA
desaturase-1.

2.4. Statistical analysis
The data are expressed as the means±SD. Statistical analysis was performed using the SPSS 20.0 statistical
software. The significant differences between groups were statistically analysed using one-way analysis of
variance (ANOVA) followed by a post hoc test (LSD). All differences were considered statistically significant at p
< 0.05.
3. Results and discussion
3.1. Optimization of the conditions used for berberrubine synthesis
In a previous work, it was reported that berberrubine was obtained by vacuum pyrolysis. Because of uneven
heating, the product had a low purity and yield.36 To obtain high purity berberrubine, berberrubine was synthesized
by microwave irradiation under different power conditions, BBR-DMF ratios, and times, which are described in
Table 2. Berberine was converted into berberrubine at the critical temperature of 160℃. Microwave radiation was
efficient in polar medium. The reaction medium had a high boiling point and used DMF. The optimal protocol is
that berberine was dissolved in DMF (25 ml) and irradiated 15 min at 400 W. Under these conditions, berberrubine
was obtained with a 93% yield (purity≥98%).
Table 2 The microwave irradiation synthesis of berberrubine under different conditions.
Entr
1
Ratio(BBR:DMF)
1:50
Time(min.)
15
Power(W)
240
400
640
800
400
400
400
400
400
400
400
400
400
400
400
400
400
Yield(%)
80.1
95.4
88.5
83.5
81.6
83.2
93.3
94.7
98.4
94.9
95.2
75.9
87.6
98.4
96.8
97
2
1:50
15
3
1:50
15
4
1:50
15
5
1:5
15
6
1:10
15
7
1:15
15
8
1:20
15
9
1:25
15
10
11
12
13
14
15
16
17
1:30
15
1:50
15
1:25
5
1:25
10
1:25
15
1:25
20
1:25
25
1:25
30
96.7
3.2. Design of Berberine-baicalein hybrid compound (BBS)
The synthesis of the berberine-baicalein hybrid compounds was prepared according to the synthetic scheme in
Scheme 1. Berberine was microwave irradiated to obtain berberrubine 1, which carried a hydroxyl group at the
9-position, with 93% yield. Treatment of berberrubine 1 with 1,6-dibromoethane in acetonitrile at 86℃ for 1 h
enabled the formation of the key intermediate 9-(6-bromoethyl)berberine hydrochloride 2 with 93% yield. The
reaction of 9-(6-bromoethyl)berberine hydrochloride 2 with DMF, triethylamine and baicalein were refluxed and
microwave irradiated to produce berberine-baicalein hybrid compound 3 with a 47% yield. The structures of the
synthesized compounds were confirmed by1H NMR, 13C NMR, ultraviolet spectroscopy and HRMS spectroscopy.
9-(6-bromoethyl)berberine hydrochloride 2 was synthesized using acetonitrile as the solvent. The crystals of 1,6-
dibromethane were removed using acetic ether. The results indicate that two different bioactive molecules were
synthesized into a hybrid compound by chemical bonding.

Scheme 1. The synthesis of berberine-baicalein (BBS) compounds. Reagents and conditions: (a) DMF, microwave irradiation (400 W),
reflux, 15 min, (93% yield); (b) acetonitrile, 1,6-dibromoethane, 86 , 1 h, (93% yield); (c) DMF, triethylamine, reflux, microwave
irradiate (240 W), 10 min, (47% yield).
3.3. Cytotoxicity of BBS in 3T3-L1 Preadipocytes
To examine cell viability, 3T3-L1 cells were treated with various concentrations (1.25, 2.5, 5, 10, 20, 40, and 80
µM) of baicalein, berberine and BBS for 48 h. Then, the cell viability was measured using a CCK8 assay. As
shown in Fig. 1, we found that 3T3-L1 cells exhibited different susceptibilities to baicalein, berberine and BBS in
a dose-dependent manner. The results indicate that baicalein did not affect cell viability at concentrations between
1.25 and 5 µM, while greater than 10 µM was toxic (Fig. 1A). Compared to the control, the number of cells was
reduced by 45% with treatment with 20 µM berberine (Fig. 1B). BBS did not cause significant cytotoxicity below
5 µM (Fig. 1C). We found that baicalein had no effect on cell viability at 100 µM; thus, the inhibitory effect of
baicalein on fat accumulation is not due to its cytotoxicity. The IC50 values of inhibitory effects of baicalein,
berberine and BBS against 3T3-L1 cells were 29.81±0.90, 21.84±1.67 and 9.42±0.60 µM, respectively.
Therefore, the nontoxic concentrations of baicalein, berberine and BBS selected for treatment in 3T3-L1 cells were
at 2.5 and 5 µM.
Fig. 1. The effects of baicalein (A), berberine (B), BBS (C) on cell viability. Cell viability was measured using a CCK8 assay. The cells
were plated in 96-well plates at a density of 5×103 cells/well for 24 h. Then, the cells were treated with different concentrations of
baicalein, berberine and BBS for 48 h. The control group of cells (con) was treated with 0.1% DMSO. Each value is the mean±SD of the
results from six different plates (n = 6) and is representative of the results from at least three different experiments.
3.4. Effect of BBS on the lipid accumulation and triglyceride content in 3T3-L1 adipocytes
3T3-L1 preadipocytes were differentiated for 10 days into mature adipocytes. To assess the effect of BBS on lipid
accumulation in 3T3-L1 adipocytes, Oil Red O staining and its subsequent quantification were performed to

observe the intracellular lipid accumulation. As shown in Fig. 2A, 3T3-L1 cells have a fibroblast-like morphology.
In the microscopic observation of Oil Red O staining in 3T3-L1 adipocytes (Fig. 2B), we found that a large
number of lipid droplets in 3T3-L1 adipocytes were stained red by Oil Red O staining. The results from the Oil
Red O quantification showed that the lipid accumulation in 3T3-L1 adipocytes treated with BBS was significantly
lower than the lipid accumulation in the mature adipocyte group (CON) (Fig. 2C). To understand the effect of the
BBS compound on TG content in 3T3-L1 adipocytes, we used the Triglyceride GPO-POD Assay Kit. BBS at 2.5
µM and 5 µM significantly decreased the TG contents by 27.3% and 37.4%, respectively, compared to untreated
3T3-L1 adipocytes (CON), as shown in Fig. 2D. These results indicated that the metabolism of TG in 3T3-L1
adipocytes was regulated by BBS.
Fig. 2. (A) 3T3-L1 preadipocyte morphology. (B) Oil Red O staining of 3T3-L1 mature adipocytes. (C) A graphical representation of the
percentages of intracellular lipids after Oil Red O staining. (D) A TG content assay of 3T3-L1 mature adipocytes after treatment with
different concentrations (0, 2.5, and 5 µM) of baicalein, berberine and BBS for 48 h. The TG content was normalized by assessing the
total protein levels. The 3T3-L1 mature adipocytes group (CON) and the 3T3-L1 preadipocyte cells (Pre) were treated with 0.1% DMSO.
Each value is the mean±SD of results from at least three different experiments. *P < 0.05, **P < 0.01 compared with the CON group.
3.5. Effect of BBS on the expression of AMPK and lipolysis-associated genes
AMP-activated protein kinase (Ampk) plays a crucial role in energy metabolism and is the master switch of lipid
metabolism.37 ATGL and HSL are pivotal enzymes that limit the rate of lipolysis. To understand the effect of BBS
on the lipolytic enzyme in 3T3-L1 adipocytes, 3T3-L1 adipocytes were treated with different concentrations (0,
2.5, and 5 µM) of baicalein, berberine and BBS for 48 h. We examined the mRNA expression of Ampk, Atgl and
Hsl using qPCR. As shown in Fig. 3A, when compared with the mature adipocyte group (CON), we found that the
expression levels of Ampk were up-regulated in the preadipocyte group (Pre) and the groups treated with 5 µM of
baicalein and BBS (P < 0.05). The Atgl mRNA level was significantly increased compared with the CON group
(Fig. 3B). The expression of the Hsl gene was decreased in response to treatment with 2.5 µM of baicalein and
berberine (Fig. 3C). These results indicate that baicalein, berberine and BBS increased adipocyte lipolysis by
increasing the expression of the Atgl gene. However, there was no significant effect caused by BBS on the
expression of Hsl.

Fig. 3. The effect of baicalein, berberine and BBS on the mRNA expression of Ampk (A), Atgl (B), and Hsl (C) in 3T3-L1 adipocytes.
3T3-L1 adipocytes were treated with different concentrations (0, 2.5, and 5 µM) of baicalein, berberine and BBS for 48 h. The total RNA
was extracted and subjected to qPCR. The mRNA levels were quantified and normalized to that of β-actin. The data are presented as the
mean±SD of three independent experiments. *P < 0.05, **P < 0.01 indicates statistically significant differences compared to the mature
adipocyte group (CON). The 3T3-L1 preadipocyte cells were treated with 0.1% DMSO (Pre).
3.6. Effect of BBS on the mRNA expression of lipogenesis associated genes
Srebp-1c is a key transcription factor that controls the expression of the genes of triglyceride synthesis. Fasn, Acc
and Scd1 are the genes of the major enzymes controlling the lipogenic pathway.38 To investigate the effect of
baicalein, berberine and BBS on lipogenesis in 3T3-L1 adipocytes, the mRNA expression of the lipogenesis genes
(Srebp-1c, Fasn, Acc,and Scd1) were examined by qPCR. As shown in Fig. 4A, most interestingly, the results
revealed that baicalein, berberine and BBS significantly decreased the expression of Srebp-1c in a dose-dependent
fashion. The expression level of the Fasn gene also decreased in response to treatment with 5 µM of baicalein,
berberine and BBS (Fig. 4B). The Scd1 mRNA level was significantly down-regulated compared with the CON
group (Fig. 4C). BBS treatment at 5 µM markedly decreased the expression of the Acc mRNA level (Fig. 4D).
These observations indicate that BBS reduces lipid accumulation by suppressing the expression of of lipogenesis
genes. Particularly, BBS exhibited a strong effect on the mRNA expression of lipogenesis-associated genes in
3T3-L1 adipocytes than baicalein and berberine.
Fig. 4. The effect of baicalein, berberine and BBS on the mRNA expression levels of Srebp-1c (A), Fasn (B), Scd1 (C), and Acc (D) in
3T3-L1 adipocytes. 3T3-L1 adipocytes were treated with different concentrations (0, 2.5, and 5 µM) of baicalein, berberine and BBS for
48 h. The total RNA was extracted and subjected to qPCR. The mRNA levels were quantified and normalized to β-actin. The data are
presented as the mean±SD of three independent experiments. *P < 0.05, **P < 0.01 indicates a statistically significant difference to the
mature adipocyte group (CON). The 3T3-L1 preadipocyte cells were treated with 0.1% DMSO (Pre).

4. Conclusion
In this study, we successfully designed and synthesized a hybrid compound of berberine and baicalin. We
optimized the synthesis process for berberrubine by microwave synthesis using DMF as a reaction medium. This
berberrubine synthetic method is simple and suitable for industrial production. Most interestingly, BBS reduced
the lipid accumulation and triglyceride content in 3T3-L1 adipocytes. BBS increased adipocyte lipolysis by
up-regulating the expression of the Atgl gene and reduced lipogenesis by down-regulating the mRNA expression
of Srebp-1c, Fasn, Scd, and Acc in 3T3-L1 adipocytes. The inhibitory effect of baicalein and berberine on lipid
accumulation is consistent with the results reported in the past.11, 21 Our findings suggest that BBS acts better than
baicalein and berberine in reducing lipid accumulation. From these data, we conclude that BBS is a new compound
with anti-obesity biological activity. The synthesis of BBS had an obtained purity of 96%. The purity should be
improved in upcoming studies. In summary, our work revealed a new compound with therapeutic effects and
pharmacological activities on obesity. Our results are beneficial to studies of traditional Chinese medicine.
5. References
1. World Health Organization. 10 facts on obesity. http://www.who.int/features/factfiles/obesity/en/; 2017
Retrieved 2016.
2. Floyd ZE, Gawronska-Kozak B, Tam CS, et al. Mechanisms of metabolism, aging and obesity. Biochimie.
2016;124:1-2.
3. Heymsfield SB, Wadden TA. Mechanisms, pathophysiology,and management of obesity. N Engl J Med.
2017;376:254-266.
4. DiBaise JK, Foxx-Orenstein AE. Role of the gastroenterologist in managing obesity. Expert Rev Gastroent.
2013;7:439-451.
5. Yao F, Zhang M, Chen L. Adipose Tissue-Specialized Immunologic Features Might Be the Potential
Therapeutic Target of Prospective Medicines for Obesity. J Diabetes Res. 2017;2017:4504612.
6. Xia X, Wengt JP. Targeting metabolic syndrome: Candidate natural agents. J Diabetes. 2010;2:243-249.
7. Chow YL, Sogame M, Sato F. 13-Methylberberine, a berberine analogue with stronger antiadipogenic effects
on mouse 3T3-L1 cells. Sci Rep. 2016;6:38129.
8. Zhen Z, Chang B, Li M, et al. Anti-Diabetic Effects of a Coptis chinensis Containing New Traditional Chinese
Medicine Formula in Type 2 Diabetic Rats. Am J Chinese Med. 2011;39:53-63.
9. Zhang C, Zhao R, Yan WQ, et al. Compositions, Formation Mechanism, and Neuroprotective Effect of
Compound Precipitation from the Traditional Chinese Prescription Huang-Lian-Jie-Du-Tang. Molecules.
2016;21:1094.
10. Jiang DQ, Wang DH, Zhuang XH, et al. Berberine increases adipose triglyceride lipase in 3T3-L1 adipocytes
through the AMPK pathway. Lipids Health Dis. 2016;15:214.
11. Li YJ, Zhao XM, Feng XY, et al. Berberine Alleviates Olanzapine-Induced Adipogenesis via the
AMPKα-SREBP Pathway in 3T3-L1 Cells. Int J Mol Sci. 2016;17:1865.
12. Hu YS, Kutscher E, E. Davies G. Berberine Inhibits SREBP-1-related Clozapine and Risperidone induced
Adipogenesis in 3T3-L1 Cells. P Soc Exp Biol Med. 2010;24:1831-1838.

13. Yin J, Zhang HJ, Ye JP. Traditional Chinese Medicine in Treatment of Metabolic Syndrome. Endocr Metab
Immune. 2016;8:99-111.
14. Jang J, Jung Y, Seo SJ, et al. Berberine activates AMPK to suppress proteolytic processing, nuclear
translocation and target DNA binding of SREBP-1c in 3T3-L1 adipocytes. Mol Med Rep. 2017;15:4139-4147.
15. Kim SH, Shin EJ, Kim ED, et al. Berberine Activates GLUT1-Mediated Glucose Uptake in 3T3-L1
Adipocytes. Biol Pharm Bull. 2007;30:2120-2125.
16. Li Y, Wang PC, Zhuang Y, et al. Activation of AMPK by berberine promotes adiponectin multimerization in
3T3-L1 adipocytes. Febs Lett. 2011;585:1735-1740.
17. Lee YS, Kim WS, Kim KH, et al. Berberine, a natural plant product, activates AMP-activated protein kinase
with beneficial metabolic effects in diabetic and insulin-resistant states. Diabetes. 2006;55:2256-2264.
18. Zhou LB, Wang X, Yang Y, et al. Berberine attenuates cAMP-induced lipolysis via reducing the inhibition of
phosphodiesterase in 3T3-L1 adipocytes. Bba-Mol Cell Res. 2011;1812:527-535.
19. Kim BY, Song KH, Lim CY, et al. Therapeutic properties of Scutellaria baicalensis in db/db mice evaluated
using Connectivity Map and network pharmacology. Sci Rep.2017;7:41711.
20. Song KH, Lee SH, Kim BY, et al. Extracts of Scutellaria baicalensis Reduced Body Weight and Blood
Triglyceride in db/db Mice. Phytother Res. 2013;27:244-250.
21. Lu KH, Han MM, Ting HL, et al.Scutellarin from Scutellaria baicalensis Suppresses Adipogenesis by
Upregulating PPARα in 3T3-L1 Cells. J Nat Prod. 2013;76:672-678.
22. Bak EJ, Kim J, Choi YH, et al. Wogonin ameliorates hyperglycemia and dyslipidemia via PPARα activation
in db/db mice. Clin Nutr. 2014;33:156-163.
23. Cha MH, Kim IC, Lee BH, et al. Baicalein Inhibits Adipocyte Differentiation by Enhancing COX-2
Expression. J Med Food. 2006;9:145-153.
24. Pu P, Wang XA, Salim M, et al. Baicalein, a natural product, selectively activating AMPKα2 and ameliorates
metabolic disorder in diet-induced mice. Mol Cell Endocrinol. 2012;362:128-138.
25. Yang LL, Xiao N, Liu JF, et al. Differential regulation of baicalin and scutellarin on AMPK and Akt in
promoting adipose cell glucose disposal. Bba-Mol Cell Res. 2017;1863:598-606.
26. Guo HX, Liu DH, MA Y, et al. Long-term baicalin administration ameliorates metabolic disorders and
hepatic steatosis in rats given a high-fat diet. Acta Pharmacol Sin. 2009;30:1505-1512.
27. Tsai KL, Hung CH, Chan SH, et al. Baicalein protects against oxLDL-caused oxidative stress and
inflammation by modulation of AMPK- alpha. Oncotarget. 2016;7:72458-72468.
28. Dunkhunthod B, Thumanu K, Eumkeb G. Application of FTIR microspectroscopy for monitoring and
discrimination of the anti-adipogenesis activity of baicalein in 3T3-L1 adipocytes. Vib Spectrosc. 2017;89:92-101.
29. Seo MJ, Choi HS, Jeon HJ, et al. Baicalein inhibits lipid accumulation by regulating early adipogenesis and
m-TOR signaling. Food Chem Toxicol. 2014;67:57-64.
30. Zhang CH, Yu RY, Liu YH, et al. Interaction of baicalin with berberine for glucose uptake in 3T3-L1
adipocytes and HepG2 hepatocytes. J Ethnopharmacol. 2014;151:864-872.
31. Pang JY, Qin Y, Chen WH, et al. Synthesis and DNA-binding affinities of monomodified berberines.
Bioorgan Med Chem. 2005;13:5835-5840.

32. Ma Y, Ou TM, Hou JQ, et al. 9-N-Substituted berberine derivatives: stabilization of G-quadruplex DNA and
down-regulation of oncogene c-myc. Bioorgan Med Chem. 2008;16:7582-7591.
33. Wang JR, Tanaka T, Zhang H, et al. Formation and Conformation of Baicalin–Berberine and Wogonoside–
Berberine Complexes. Chem Pharm Bull. 2012;60:706-711.
34. Li Y, Yuan X, Rong XL, et al. Design, synthesis and biological evaluation of a hybrid compound of
berberine and magnolol for improvement of glucose and lipid metabolism. RSC Adv. 2016;6:81924-81931.
35. Blumberg JM, Tzameli I, Astapova I, et al. Complex role of the vitamin D receptor and its ligand in
adipogenesis in 3T3-L1 cells. J Biol Chem. 2006;281:11205-11213.
36. Bodiwala HS, Sabde S, Mitra D, et al. Synthesis of 9-substituted derivatives of berberine as anti-HIV agents.
Eur J Med Chem. 2011;46:1045-1049.
37. Winder WW, Hardie DG. AMP-activated protein kinase, a metabolic master switch:possible roles in Type 2
diabetes. Am J Physiol-Endoc M. 1999;40:E1-E10.
38. Xue M, Zhang L, Yang MX, et al. Berberine-loaded solid lipid nanoparticles are concentrated in the liver and
ameliorate hepatosteatosis in db/db mice. Int J Nanomed. 2015;10:5049-5057.

Graphical Abstract
The design and synthesis of a novel compound of berberine and baicalein
that inhibits the efficacy of lipid accumulation in 3T3-L1 adipocytes
Leave this area blank for abstract info.
Mengjiao Haoa, Zhuoji Guanb, Yan Lia, Lixian Liua, Xiao Yuanc, Ying Gaoa, Weimin Lia
a School of Chinese Materia Medica, Guangzhou University of Chinese Medicine, Guangzhou 510006, People's Republic of China
b The First Clinical Medical College, Guangzhou University of Chinese Medicine, Guangzhou 510405, China
c Guangzhou Pi & Pi Technology Inc, Guangzhou 510006, People's Republic of China