Immortalizing a transient electrophile for DNA cross-linking

Article abstract of DOI:10.1002/anie.200704137

(Chemical Equation Presented) Who wants to live forever? Compounds that act as strong nucleophiles and good leaving groups repeatedly capture and release a transient quinone methide to extend its effective lifetime under aqueous conditions and promote DNA

Full text of DOI:10.1002/anie.200704137

Angewandte
Chemie
DOI: 10.1002/anie.200704137
Quinone Methides
Immortalizing a Transient Electrophile for DNA Cross-Linking**
Huan Wang, Manvinder S. Wahi, and Steven E. Rokita*
Quinone methide intermediates (QMs) are integral to the
activity of numerous natural products and synthetic com-
pounds that, for example, may function as anticancer drugs,
mechanism-based inactivators, or self-immolative dendrim-
reversibly may overcome such trapping at nonproductive sites
by regenerating their reactive intermediate for subsequent
reaction at other sites, ultimately leading to cross-linking. This
feature most likely explains the higher ratio of DNA cross-
linking vs. monoalkylation generated by a bisQMP–acridine
conjugate relative to that generated by an equivalent aniline
[
1]
ers. The potential for these intermediates to act reversibly
has a significant influence on their effective longevity, the
resulting product distribution, and their general utility. For
example, a parent ortho-QM forms adducts with strong DNA
nucleophiles under kinetic control, but ultimately only
adducts of weak nucleophiles persist under thermodynamic
[
6,9]
mustard conjugate.
Both conjugates use acridine for their
association to DNA and both favor alkylation of dG N7, but
only the QM product remains reversible. Examining the
cross-linking by this bisQMP conjugate serves here as the
most stringent test for its persistent activity since both sites of
QM formation are required for cross-linking.
[
2–4]
control (Scheme 1).
Conversion of these products from
In the absence of nucleophiles that act reversibly, QM
intermediates formed under aqueous conditions are vulner-
able to irreversible quenching by water. For example, the
bisQMP–acridine conjugate eliminates acetate spontaneously
after deprotection of the phenolic oxygen to yield its QM
intermediate and then a final benzyl alcohol derivative
(Scheme 2). This alcohol is unable to regenerate the QM
Scheme 1. Generation and regeneration of a quinone methide.
and hence no longer has the capacity to cross-link DNA even
though its remaining QM equivalent may still alkylate DNA.
Time-dependent loss of cross-linking then provides a measure
for the effective longevity of the QM equivalents under
aqueous conditions. As expected, DNA cross-linking by the
bisQMP conjugate is maximum (25%) when irreversible
trapping is minimized by initiating reaction in the presence of
duplex DNA formed in this experiment by 5’-d(CAGAT-
TACGCGCAGAAAAAAAGGATCTCAAG) (OD1) and
their kinetic to thermodynamic distribution has recently been
shown to involve competition between repeated capture and
release of the intermediate QM in a process that is sensitive to
the electronics of its p system and the strength of the
[5]
departing leaving group and/or incoming nucleophile. This
covalent, yet dynamic, process has also been essential for
QMs to participate in target-promoted alkylation and effi-
[6,7]
cient cross-linking of DNA.
Continual capture and release
5’-d(CTTGAGATCCTTTTTTTCTGCGCGTAA)
(OD2)
of QM should also nearly immortalize this fleeting inter-
mediate by extending its effective lifetime from milliseconds
(Figure 1A, lane 1). However, the yield of DNA cross-linking
dissipates quickly when the QM is allowed to react with water
prior to addition of duplex DNA. The half-life for this
quenching is ꢀ 0.5 h, and cross-linking is no longer detected
after a pre-incubation of 2 hours (Figure 1A, lanes 1–6 and
Figure S2 in the Supporting Information).
The cross-linking activity of the bisQMP–acridine con-
jugate can nonetheless persist within an aqueous environment
if strong nucleophiles are present to capture and release the
QM reversibly and prevent its quenching by water. Although
dA (20 mm) competes with DNA for reaction with the QM
intermediate and lowers the maximum yield of DNA cross-
linking to 17% (Figure 1A, lane 7), the resulting dA adduct
also provides a continual source of the QM intermediate
[8]
to hours or even days. The consequence of this is now
illustrated below with a bis-functionalized QM–acridine
[
6]
conjugate (bisQMP) that retains its potential for cross-
linking DNA under aqueous conditions when nucleophiles
are present to preserve rather than quench its activity.
The efficiency of DNA cross-linking is often compromised
by the irreversibility of the reagentꢀs chemistry. Under these
circumstances, the first link to DNA permanently anchors the
reagent to sites that are not necessarily susceptible to a second
link needed for cross-linking. In contrast, reagents that act
[
*] H. Wang, M. S. Wahi, Prof. S. E. Rokita
Department of Chemistry and Biochemistry
University of Maryland
(Scheme 2). The cross-linking activity of the bisQMP–acri-
dine conjugate is preserved beyond at least 49 hours under
aqueous conditions in the presence of dA (Figure 1A,
lane 12). The effective lifetime of QM and its equivalents is
consequently increased by almost 100-fold by the ability of
dA to forestall irreversible trapping by water (Figure 1B).
This observation is consistent with the efficient and reversible
College Park, MD 20742 (USA)
Fax: (+1)301-405-9376
E-mail: rokita@umd.edu
Homepage: http://www.chem.umd.edu/faculty/rokita/
[**] This work was supported by the National Science Foundation.
[
2–4]
reaction of dA N1.
The expected symmetric dA N1 bis-
Supporting information for this article is available on the WWW
under http://www.angewandte.org or from the author.
adduct was confirmed by two-dimensional NMR spectrosco-
Angew. Chem. Int. Ed. 2008, 47, 1291 –1293
ꢀ 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
1291

Communications
Scheme 2. Extending the lifetime of a DNA cross-linking agent depends on its partitioning between reversible and irreversible reactions.
[
2]
conditions, and thus dA N1 likely captures and releases the
bisQMP–acridine conjugate repeatedly in order to maintain
cross-linking activity throughout incubations of 49 hours prior
to addition of duplex DNA (Figure 1B).
An adenine derivative was selected in these experiments
as a mediator of QM activity since its N1 position is both
accessible and abundant in vivo within ATP, NAD(P)(H),
mRNA etc. Concentrations of ATP in human cells typically
[10]
range between 1 mm and 5 mm but can rise as high as 9 mm.
ATP levels also tend to be greater in tumor than in normal
[
10]
cells,
and thus it may selectively prolong the biological
lifetime of electrophiles acting reversibly in these cells. In our
model above, persistence of the cross-linking activity
depended on dA concentration and saturated at approxi-
mately 5 mm (see Figure S3 in the Supporting Information).
Trapping the QM with an alternative nucleophile such as
2
-mercaptoethanol that acts irreversibly has the opposite
effect of dA and suppresses cross-linking. When the reaction
Figure 1. The presence of dA extends the effective lifetime of a quinone
of the bisQMP conjugate is initiated in the presence of dA,
methide for cross-linking DNA under aqueous conditions. A) Reaction
of the bisQMP–acridine conjugate (100 mm) was initiated by addition
of KF (100 mm) in 10 mm b-morpholinoethanesulfonic acid (MES,
pH 7) and 20% acetonitrile under ambient conditions for the indicated
time in the absence (lanes 1–6) and presence of 20 mm dA (lanes 7–
32
2
-mercaptoethanol, and OD1/[ P]OD2, DNA cross-linking
decreases by 90%, and no cross-linking is observed if the
DNA is added 4 hours after initial generation of the QM
intermediate (see Figure S4 in the Supporting Information).
Single-stranded DNA is also capable of extending the
effective lifetime of QM equivalents. Most interestingly, the
resulting products formed between the bisQMP–acridine
conjugate and single-stranded DNA do not prevent strand
hybridization to form duplex DNA nor block interstrand
transfer of the QM to form DNA cross-linking (Figure 2A).
This is evident from the cross-linking observed after OD2
(3 mm) was added in place of dA (20 mm) to trap the bisQMP
conjugate reversibly during a pre-incubation of 0–72 hours
prior to addition of OD1 (Figure 2B, lanes 1–5). The same
cross-linked species was detected regardless of which strand
1
2). The persistent ability of these samples to cross-link DNA was
3
2
measured by subsequent addition of OD1/5’-[ P]OD2 (3.0 mm, 30 nCi
annealed with 10% excess OD1). Samples were then further incubated
for 48 hours under ambient conditions. Each solution was then frozen,
lyophilized, and analyzed by denaturing 20% polyacrylamide gel
electrophoresis. Cross-linked products were quantified by phospho-
image analysis and reported (%) relative to total DNA. B) The average
of these data and an independent repetition is summarized graphically
as well for reaction in the absence (*) and presence of dA (~). The
range of data is indicated by the error bars, and the line represents a
fit to a first order rate of decomposition in the absence of dA (see
also, Figure S2 in the Supporting Information).
3
2
(
OD1 or OD2) was labeled with a 5’-[ P] (see Figure S5 in the
py using an aprotic solvent that suppresses its decomposition
and a model bisQMP derivative lacking the acridine linker for
simplicity (see Figure S1 in the Supporting Information).
Previous studies suggest that the half-life of the reversible dA
N1 adduct is only approximately 2 hours under aqueous
Supporting Information).
The persistence of cross-linking activity again suggests
that QM intermediates are trapped and released multiple
times during the pre-incubation period. While dA might
appear to extend the longevity of cross-linking to a greater
1
292
www.angewandte.org
ꢀ 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Angew. Chem. Int. Ed. 2008, 47, 1291 –1293

Angewandte
Chemie
5
0% when the thiol was added along with OD1 after 24 hours
of pre-incubation of OD2 and the bisQMP–acridine con-
jugate (see Figure S7 in the Supporting Information).
The reversibility of QM reactivity significantly expands
the potential biological activity of this intermediate based on
its repeated capture and release to forestall irreversible
trapping. The dynamics of QM adduct formation also allows
for covalent reorganization in response to changing constit-
uents in solution as demonstrated by QM transfer from intra-
to interstrand positions for generating the observed DNA
cross-links. An equivalent activity had previously been
described for an oligodeoxynucleotide self-adduct formed
by a monofunctional QM extended from a 5’-hexamethy-
[7]
leneamino linker, but obviously such a highly defined
system is not necessary for supporting selective cross-linking
that can distinguish between complementary and noncom-
plementary DNA (Figure 2). A role for a reversible adduct
now also deserves consideration in the therapeutic activity of
a recent and highly promising anticancer drug that releases
Figure 2. Single-stranded DNA extends the lifetime of a quinone
methide and promotes its selective interstrand transfer for cross-
linking DNA under aqueous conditions. A) Reaction of the bisQMP–
acridine conjugate (30 mm) was initiated by addition of KF (10 mm) in
[12]
simple QMs in vivo.
Received: September 7, 2007
Published online: January 3, 2008
3
2
1
0 mm MES (pH 7), 20% acetonitrile, and 5’-[ P]OD2 (3.0 mm, 30 nCi)
under ambient conditions. After the indicated time, either the comple-
mentary strand OD1 (3.3 mm) (B, lanes 1–5) or a noncomplementary
strand OD3 (3.3 mm) (B, lanes 6–10) was added, and the samples
were further incubated for an additional 48 hours under ambient
conditions. B) DNA cross-linking was determined by gel electrophore-
sis and phosphoimage analysis as described in Figure 1.
Keywords: DNA alkylation · nucleobases · nucleophilic addition ·
.
quinone methide · retro reactions
[
1] a) M. Tomasz, Chem. Biol. 1995, 2, 575 – 579; b) P. W. Fan, F.
Zhang, J. L. Bolton, Chem. Res. Toxicol. 2000, 13, 45 – 52; c) D.
Cabaret, S. A. Adediran, M. J. Garcia Gonzalez, R. F. Pratt, M.
Wakselman, J. Org. Chem. 1999, 64, 713 – 720; d) D. Shabat, M.
Shamis, Chem. Eur. J. 2007, 13, 4523 – 4528.
extent than OD2, this phenomenon is concentration depen-
dent and the effect of OD2 is still remarkable. A low
concentration of dA (0.5 mm) had a rather weak effect and
helped to maintain a DNA cross-linking yield of only ꢀ 6%
after a pre-incubation for 8 hours (see FigureS3 in the
Supporting Information). However, this concentration of
dA is still ten times greater than the equivalents used in
Figure 2. An OD2 concentration of 3 mm corresponds to a
[
2] W. F. Veldhuyzen, A. J. Shallop, R. A. Jones, S. E. Rokita, J. Am.
Chem. Soc. 2001, 123, 11126 – 11132.
[
3] a) M. Freccero, C. Di Valentin, M. Sarzi-Amad›, J. Am. Chem.
Soc. 2003, 125, 3544 – 3553; b) M. Freccero, R. Gandolfi, M.
Sarzi-Amad›, J. Org. Chem. 2003, 68, 6411 – 6423.
[
4] E. E. Weinert, K. N. Frankenfield, S. E. Rokita, Chem. Res.
Toxicol. 2005, 18, 1364 – 1370.
4
5 mm solution of nucleophiles (dA N1,dC N3, dG N7) that
[
4]
can act reversibly.
[5] E. E. Weinert, R. Dondi, S. Colloredo-Melz, K. N. Frankenfield,
C. H. Mitchell, M. Freccero, S. E. Rokita, J. Am. Chem. Soc.
The efficiency of intrastrand trapping of the bisQMP–
acridine conjugate by OD2 may in part be driven by
nonspecific association between the attached acridine and
2
006, 128, 11940 – 11947.
6] W. F. Veldhuyzen, P. Pande, S. E. Rokita, J. Am. Chem. Soc.
003, 125, 14005 – 14013.
7] Q. Zhou, S. E. Rokita, Proc. Natl. Acad. Sci. USA 2003, 100,
5452 – 15457.
[
[
2
[
11]
the compact structure of single-stranded DNA. However,
subsequent transfer of QM to form interstrand cross-linking
requires specific association between complementary strands
of DNA. QM adducts formed between OD2 and the bisQMP
conjugate during the pre-incubation period of 0–72 hours did
not subsequently produce more than background levels of
cross-linking to 5’-d(GGTACACATAGAGATAGAGAGA-
TACACACAC) (OD3), which has the same deoxynucleotide
composition, but not sequence, as OD1 (Figure 2B, lanes 6–
1
[8] a) E. Modica, R. Zanaletti, M. Freccero, M. Mella, J. Org. Chem.
2001, 66, 41 – 52;b) Y. Chiang, A. J. Kresge, Y. Zhu, J. Am. Chem.
Soc. 2001, 123, 8089 – 8094.
[
9] A. S. Prakash, W. A. Denny, T. A. Gourdie, K. K. Valu, P. D.
Woodgate, L. P. G. Wakelin, Biochemistry 1990, 29, 9799 – 9807.
[
10] T. W. Traut,Mol. Cell. Biochem. 1994, 140, 1 – 22.
[
11] a) G. M. Clore, A. M. Gronenborn, Eur. Biophys. J. 1984, 11, 95 –
102; b) G. Vesnaver, K. J. Breslauer, Proc. Natl. Acad. Sci. USA
1991, 88, 3569 – 3573; c) J. Isaksson, S. Acharya, J. Barman, P.
Cheruku, J. Chattopadhyaya, Biochemistry 2004, 43, 15996 –
1
0). Initial formation of adducts between the bisQMP
conjugate and OD2 also revealed a sensitivity to the presence
of 2-mercaptoethanol similar to that described previously
with dA (see Figure S6 in the Supporting Information).
Interstrand transfer of QM to form DNA cross-links,
however, was surprisingly insensitive to nucleophilic compe-
tition by the same thiol. Cross-linking was suppressed by only
1
6010.
12] a) K. Kashfi, B. Rigas, Biochem. Biophys. Res. Commun. 2007,
58, 1096 – 1101; b) N. Hulsman, J. P. Medema, C. Bos, A.
[
3
Jongejan, R. Luers, M. J. Smit, I. J. P. de Esch, D. Richel, M.
Witjmans, J. Med. Chem. 2007, 50, 2424 – 2431.
Angew. Chem. Int. Ed. 2008, 47, 1291 –1293
ꢀ 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.angewandte.org
1293