Transglucosylation potential of six sucrose phosphorylases toward different classes of acceptors

Article abstract of DOI:10.1016/j.carres.2011.06.024

In this study, the transglucosylation potential of six sucrose phosphorylase (SP) enzymes has been compared using eighty putative acceptors from different structural classes. To increase the solubility of hydrophobic acceptors, the addition of various co-solvents was first evaluated. All enzymes were found to retain at least 50% of their activity in 25% dimethylsulfoxide, with the enzymes from Bifidobacterium adolescentis and Streptococcus mutans being the most stable. Screening of the enzymes' specificity then revealed that the vast majority of acceptors are transglucosylated very slowly by SP, at a rate that is comparable to the contaminating hydrolytic reaction. The enzyme from S. mutans displayed the narrowest acceptor specificity and the one from Leuconostoc mesenteroides NRRL B1355 the broadest. However, high activity could only be detected on L-sorbose and L-arabinose, besides the native acceptors D-fructose and phosphate. Improving the affinity for alternative acceptors by means of enzyme engineeringwill, therefore, be a major challenge for the commercial exploitation of the transglucosylation potential of sucrose phosphorylase.

Full text of DOI:10.1016/j.carres.2011.06.024

Carbohydrate Research 346 (2011) 1860–1867
Contents lists available at ScienceDirect
Carbohydrate Research
journal homepage: www.elsevier.com/locate/carres
Transglucosylation potential of six sucrose phosphorylases toward different
classes of acceptors
Dirk Aerts a, Tom F. Verhaeghe a, Bart I. Roman b, Christian V. Stevens b, Tom Desmet a, , Wim Soetaert a
⇑
a Centre of Expertise for Industrial Biotechnology and Biocatalysis, Department of Biochemical and Microbial Technology, Ghent University, Coupure Links 653, B-9000 Ghent, Belgium
b Department of Organic Chemistry, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, B-9000 Ghent, Belgium
a r t i c l e i n f o
a b s t r a c t
Article history:
In this study, the transglucosylation potential of six sucrose phosphorylase (SP) enzymes has been com-
pared using eighty putative acceptors from different structural classes. To increase the solubility of hydro-
phobic acceptors, the addition of various co-solvents was first evaluated. All enzymes were found to retain
at least 50% of their activity in 25% dimethylsulfoxide, with the enzymes from Bifidobacterium adolescentis
and Streptococcus mutans being the most stable. Screening of the enzymes’ specificity then revealed that
the vast majority of acceptors are transglucosylated very slowly by SP, at a rate that is comparable to
the contaminating hydrolytic reaction. The enzyme from S. mutans displayed the narrowest acceptor spec-
ificity and the one from Leuconostoc mesenteroides NRRL B1355 the broadest. However, high activity could
Received 22 March 2011
Accepted 20 June 2011
Available online 24 June 2011
Keywords:
Sucrose phosphorylase
Glycosylation
Substrate promiscuity
Solvent stability
Glycoside
only be detected on L-sorbose and L-arabinose, besides the native acceptors D-fructose and phosphate.
Improving the affinity for alternative acceptors by means of enzyme engineering will, therefore, be a major
challenge for the commercial exploitation of the transglucosylation potential of sucrose phosphorylase.
Ó 2011 Elsevier Ltd. All rights reserved.
Transglucosylation
1. Introduction
shown that SP can transfer a glucosyl moiety to a wide variety of
mono-, di- and trisaccharides.19,20 Furthermore, non-carbohydrate
Glycosylation can significantly influence the properties of a
chemical compound.1 Indeed, a glycosyl moiety can improve the
solubility, stability, flavor, and pharmacokinetic behavior of a mol-
ecule, or can simply be crucial for its biological activity. Glycosides
are synthesized either chemically or by enzymatic glycosylation
with glycosyl transferases, transglycosidases, glycoside phospho-
rylases, and glycoside hydrolases.2 Among the glycoside phospho-
rylases, sucrose phosphorylase (SP, E.C. 2.4.1.7) is an attractive
biocatalyst because of its broad acceptor promiscuity. The enzyme
molecules like phenolic compounds and furanones can also be
used as an acceptor.21,22 In contrast to its broad range of acceptors,
SP is highly specific for the transfer of a glucosyl moiety and does
not tolerate structural modifications on the glucopyranosyl ring.23
Besides sucrose and
a-Glc-1-P, only a-D-glucose-1-fluoride is
known to be an efficient glucosyl donor for this enzyme.8,24
A major limitation of the already reported data about the acceptor
promiscuity of sucrose phosphorylase is that the transglucosylation
activity is usually expressed as transfer ratio or yield, which is the ra-
tio of the transfer product (mol) formed against the initial amount of
acceptor (mol).25 This parameter does, however, reflect the thermo-
dynamic equilibrium of the substrate and product, and does not pro-
vide any information about the efficiency of the enzyme itself. To
address this problem, the initial reaction rate of SP on a variety of
acceptors has been determined in this study. Six different enzymes
have been compared to allow an evaluation of their respective accep-
tor promiscuities. Because several of the acceptors do not dissolve
well in water, the activity of the SP enzymes in the presence of var-
ious co-solvents has also been determined.
is classified in the
reversible phosphorolysis of sucrose into
-Glc-1-P) and
-fructose.3–6 Biochemical studies have revealed
a-amylase family (GH-13) and catalyzes the
a
-D
-glucose-1-phosphate
(a
D
that SP follows a double displacement mechanism, passing through
a covalent glucosyl-enzyme intermediate with final retention of the
anomeric configuration.7–10 In addition, the crystal structure of the
SP from Bifidobacterium adolescentis has been elucidated11,12 and the
catalytic residues have been identified by mutational analysis.13–17
The acceptor promiscuity of SP was first recognized in 1944 by
Doudoroff and colleagues, who could use the enzyme for the syn-
thesis of
a-glucopyranosyl L
-sorboside.18 Since then, it has been
2. Results and discussion
Abbreviations: SP, sucrose phosphorylase; LmSP1, L. mesenteroides NRRL B1149
SP; LmSP2, L. mesenteroides ATTC 12291 SP; LmSP3, L. mesenteroides NRRL B1355
SP; SmSP, S. mutans SP; LaSP, L. acidophilus SP; BaSP, B. adolescentis SP.
2.1. Enzyme expression and characterization
In the carbohydrate-active enzyme (CAzy) database, around 280
putative sucrose phosphorylases have been assigned to the family
⇑
Corresponding author. Tel.: +32 9 264 99 20; fax: +32 9 264 62 31.
E-mail address: t.desmet@Ugent.be (T. Desmet).
0008-6215/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.carres.2011.06.024

D. Aerts et al. / Carbohydrate Research 346 (2011) 1860–1867
1861
Table 1
ity of SP has been investigated (Fig. 2). In accordance with their
higher temperature optima,25,29–31 BaSP and SmSP were found to
be the most stable enzymes in the majority of solvents. The addi-
tion of increasing amounts of DMF and acetonitrile generally re-
sulted in the sharpest drop in activity, while ethanol,
isopropanol, and DMSO seem to have a less drastic effect. For
DMSO, all enzymes except BaSP display a similar C50-value of
around 25%, which is the concentration at which the enzymes re-
tain half of their initial activity. Furthermore, the decrease in activ-
ity is more gradual in this solvent, which renders the screening
more robust and less sensitive to errors. In addition, DMSO has
the highest boiling point, mixes well with water, and does not
interfere with the assay procedures. Therefore, 25% DMSO has been
selected as the reaction medium to test the lipophilic acceptors.
The UniProt IDs for the different SP enzymes
Enzyme Strain
UniProt ID Reference
LaSP
SmSP
BaSP
LmSP1
LmSP2
LmSP3
Lactobacillus acidophilus LMG 9433
Streptococcus mutans LMG 14558T
Q7WWP8
P10249
51
52
38
20
53
—
Bifidobacterium adolescentis LMG 10502T Q84HQ2
Leuconostoc mesenteroides NRRL B1149
Leuconostoc mesenteroides ATTC 12291
Leuconostoc mesenteroides NRRL B1355
Q14EH6
Q59495
—
GH-13, subfamily 18.26 These mainly originate from lactic acid bac-
teria, but also include soil bacteria and inhabitants of the gastro
intestinal tract like Bifidobacterium. Six of them have been recom-
binantly expressed in Escherichia coli and purified by His6-tag chro-
matography (Table 1). To the best of our knowledge, LmSP3 is
described here for the first time, although its sequence differs in
only five amino acids (K138R, G225D, P236S, S390Y and M488N)
from the SP isolated from Leuconostoc mesenteroides NRRL B742
(UniProt ID: B2BS85).27 The enzymes from the five lactic acid bac-
teria share a sequence identity of more than 65%, which even in-
creases to 86% for the three LmSP enzymes. In contrast, the
similarity between BaSP and the other SP enzymes is only 35% (
Fig. 1).
For all six enzymes, the apparent kinetic parameters have been
determined for sucrose in the phosphorolytic reaction and for fruc-
tose in the synthetic reaction (Table 2). All of these experiments
were performed at 37 °C and pH 7 because these conditions will
also be used for the screening of the acceptor promiscuity. In gen-
eral, Km for the acceptor fructose is significantly larger than that for
the donor sucrose, which could be explained by the different sizes
of the molecules. The highest acceptor affinity is observed in SmSP
and BaSP, with a Km for fructose of 8.3 and 10.1 mM, respectively.
2.3. Acceptor screening
2.3.1. Setup of the screening procedure
Sucrose phosphorylase is able to transfer a glucosyl moiety
from either sucrose or
a-Glc-1-P, resulting in the release of fruc-
tose or inorganic phosphate, respectively (Fig. 3). Because of the
different properties of the screened acceptors, two different assays
had to be developed by exploiting both glycosyl donors. Indeed, the
detection of released phosphate cannot be applied to aromatic
acceptors because these precipitate under the acidic conditions
of the Gawronski-assay. In turn, the detection of released fructose
cannot be applied to reducing acceptors because these interfere
with the BCA-assay.
During transfer reactions, the glucosyl-enzyme intermediate
can also be intercepted by water, resulting in hydrolysis instead
of transglucosylation of the substrates (Fig. 3). As found by the
Nidetzky group, the rate of hydrolysis and consequently the trans-
glucosylation efficiency is influenced dramatically by the concen-
tration of both the donor and acceptor substrates. By increasing
the donor concentration from 0.3 to 0.8 M, they could reduce the
hydrolysis from 44% to 9% for the transglucosylation of R-glycerate,
and similar results were obtained for 3-ethoxy-1,2-propane-
diol.32,33 In addition, a linear relationship was observed between
the rate ratio of transglucosylation/hydrolysis and the concentra-
tion of glycerol, arabitol and sorbitol as acceptors.34,35 The result-
2.2. Solvent stability
Many of the interesting targets for glycosylation do not dissolve
well in water, a problem that can be alleviated by the addition of
organic co-solvents.28 To identify the most suitable medium for
these reactions, the effect of five different co-solvents on the activ-
ing kinetic partition coefficient is
a good measure of the
enzyme’s preference for an acceptor over water. Although high do-
nor and acceptor concentrations favor transglucosylation, several
limitations had to be taken into account in our experiments. On
the one hand, the concentration of
a-Glc-1-P could not exceed
30 mM because the traces of inorganic phosphate generated a con-
siderable background in the screening assay. On the other hand,
aromatic acceptors do not dissolve at high concentrations in aque-
ous media, even when 25% DMSO is added as co-solvent. Therefore,
the acceptor concentration has been set to 65 mM for all acceptors,
to allow an unambiguous comparison.
Figure 1. Phylogenetic tree of the different SP enzymes.
As the different SP enzymes display different specific activities
(Table 2), the transglucosylation rates are not reported here as
absolute values but with reference to the hydrolysis rate (vAcceptor
/
Table 2
vWater). Although the kinetic partition coefficient, that is, the slope
of the linear regression between the rate ratio vFru/vGlc (sucrose) or
vPi/vGlc (Glc-1-P) and the acceptor concentration, would be the
most complete measure of an enzyme’s transglucosylation effi-
ciency,35 that would require too much measurements for a screen-
ing experiment. We have, therefore, performed our tests at a single
acceptor concentration and have used the activity in the absence of
any acceptor besides water as single reference. The rate of hydro-
lysis was found to be 2–5% of the native activity for all enzymes.
Interestingly, a linear correlation could be observed between the
ratios obtained by measuring the hydrolysis in the absence
(vAcceptor/vWater) and presence (vFru/vGlc) of the acceptor (Fig. 4).
Apparent kinetic parameters for sucrose and fructose at 37 °C and pH 7
Enzyme
Sucrosea
Fructoseb
Km (mM)
kcat (sꢀ1
)
kcat/Km Km (mM)
kcat (sꢀ1
)
kcat/Km
LmSP1
LmSP2
LmSP3
SmSP
LaSP
14.1 0.9 28
5
2.0
8.5
22.7 1.9 14 2.5
0.6
1.0
0.05
0.6
0.4
1.6
7.3 0.5 62 13
21.9 2.0 22
5
3.0 0.2
4
1
1
3
1.4
20.3
0.6
17.4 2.0
8.3 1.0
17.4 1.3
1
5
7
0.3
1
1
0.8 0.1 16
2.3 0.2 14
BaSP
1.4 0.1 78 14
55.9
10.1 0.6 16
3
a
Using 75 mM phosphate as co-substrate.
Using 50 mM Glc-1-P as co-substrate.
b

1862
D. Aerts et al. / Carbohydrate Research 346 (2011) 1860–1867
Figure 2. Relative activities for the different SP enzymes in 0–40% (v/v) solvent/water mixture for ethanol, isopropanol, DMF, acetonitrile and DMSO.
The concurrent detection of glucose and either fructose or phos-
phate is thus not necessary for the evaluation of the acceptor pro-
miscuity of SP, which drastically reduces the screening effort.
2.3.2. Acceptor promiscuity
The acceptor promiscuity of different SP enzymes has been
determined previously by different research groups. Although this
information is valuable and excellently reviewed by Goedl et al.,25
the data are heterogeneous and difficult to compare since the
experiments were performed with varying concentrations of en-
zyme, donor, and acceptor, or at a different pH and temperature.
In this study, we have compared the transglucosylation activity
of six different SP enzymes on 80 putative acceptors under the
same reaction conditions. To the best of our knowledge, the accep-
tor specificity of LaSP and LmSP3 has not yet been analyzed and is
Figure 3. Reaction scheme for SP with the four possible reactions: (1) phospho-
rolysis, (2) synthesis, (3) transglucosylation, and (4) hydrolysis. Suc: sucrose, Glc-1-
P:
a-glucose-1-phosphate, E: enzyme, Fru: fructose, Pi: inorganic phosphate, A:
acceptor.
Figure 4. Comparison of different methods to describe the transglucosylation of gluconic acid by BaSP. (A) (d) vFru/vGlc and (s) vAcceptor/vwater in function of acceptor
concentration; (B) relationship between vAcceptor/vwater and vFru/vGlc. The experiments have been performed at pH 7.0 and 37 °C, using 50 mM sucrose as donor.

D. Aerts et al. / Carbohydrate Research 346 (2011) 1860–1867
1863
thus described here for the first time. For SmSP, a detailed evalua-
tion was only available for carboxylic acceptors.36,37
groups can be efficiently accommodated at the anomeric carbon
of glucose, although the result depends on the size of the substitu-
ent as well as on the configuration of the glucosidic bond. Indeed,
In contrast to what might be assumed from the high transfer ra-
tios that have previously been published,19,20,38 most acceptors are
poor substrates in terms of catalytic activity (Table 3). As can be seen
from the box plots in Figure 5, at least 75% of the tested acceptors do
not result in a transglucosylation activity that is considerably higher
than the hydrolytic activity (<1.5 ꢁ vwater). It can also be seen that
SmSP has the narrowest acceptor specificity and LmSP3 the broad-
est. Besides fructose, only two good acceptors could be identified
for SmSP. Interestingly, this enzyme was also found to have the low-
est Km-value for fructose of all sucrose phosphorylases (Table 2),
which might be correlated with its strict specificity. In contrast,
the LmSP enzymes display a higher Km-value and looser specificity,
which could indicate a more ‘relaxed’ +1 subsite.
lower activity is observed on methyl b-glucoside than on methyl a-
glucoside and the activity further decreases when octyl b-glucoside
is used as acceptor. The presence of an aminogroup at the C2-
position of galactose lowers the activity of all SP enzymes, but
the effect is more variable for glucose and mannose.
Among the tested disaccharides, four showed significant trans-
glucosylation rates, that is, difructose anhydride III, trehalose, iso-
maltose, and turanose (Table 3). Difructose anhydride III (
a-D-
fructofuranose-b-
D
-fructofuranose-20,1:2,30-dianhydride) is a cyclic
disaccharide consisting of two fructose moieties linked at their
anomeric carbons,41 and can serve as acceptor for LmSP3 with a
reaction rate that is only six times slower than for D-fructose. In
In some cases, the addition of acceptor to the reaction was
found to lower the overall activity of the SP enzymes, which seems
strange at first sight. These compounds must, therefore, interact
with the enzyme either as inhibitor or as substrate of very low
reactivity. To gain a better understanding of their mode of action,
addition to these disaccharides, LmSP1 and especially LmSP3 also
display good activity toward several trisaccharides (Table 3), which
could indicate that these enzymes have a more spacious active site.
In general, sugar alcohols can be transglucosylated at a rate sig-
nificantly higher than 1, although SmSP seems to be less efficient
in that respect (Table 3). For LmSP1, the transfer of a glucosyl moiety
to glycerol proceeds only slightly faster than the transfer to water.
Nevertheless, this reaction has been developed into a commercial
process by the careful engineering of the reaction conditions.34
Using 0.8 M sucrose and 2.0 M glycerol as substrates, the competing
hydrolytic reaction could be eliminated almost completely, result-
ing in a product yield of 90%. Interestingly, the transglucosylation
product could hardly serve as substrate, revealing that secondary
hydrolysis is neglectable during the production of glucoglycerol.
the reaction of BaSP with L-ascorbic acid (vAcceptor/vWater = 0.3)
was analyzed in more detail by HPLC. The formation of glucosylat-
ed product could be clearly observed, although the transglucosyla-
tion rate was about 100 times lower than the rate of hydrolysis. In
addition, the synthesis of sucrose was found to be hardly inhibited
by L-ascorbic acid, corresponding to a Ki of about 0.6 M, that is,
much higher than the acceptor concentrations used in our screen-
ing experiments (65 mM). Compounds with a relative transglu-
cosylation rate below
1 should thus be described as slow
acceptors and not as inhibitors. It is, however, not exactly clear
why the hydrolytic background reaction is suppressed in those
cases, but could be the result of an induced fit mechanism that
has been proposed based on crystallographic analysis of enzyme–
substrate complexes.34
2.3.4. Transfer to non-carbohydrates
Non-carbohydrate molecules have also been tested as acceptors
for the SP enzymes (Table 3). The glucosylation of such molecules
is of significant importance, as it allows to drastically increase their
solubility in water, and hence their bio-availability.28,42 For the
vast majority of aromatic acceptors, a transglucosylation activity
lower than 1 was observed, which means that they are poorer
acceptors than water. Nevertheless, a few phenolic compounds like
(+)-catechin and epigallocatechin gallate have been successfully
glucosylated by LmSP2, allowing the characterization of the corre-
sponding glucosides.22 It should, however, be mentioned that the
product yields were low, even when a large excess of donor and
a high enzyme concentration was applied. In our experiments,
the highest transglucosylation activity was detected for LmSP3
and 4-phenoxyphenol as acceptor, displaying a reaction rate that
is about 2.5 times higher than the hydrolytic reaction.
The compounds classified as specialties are glucosylated at
varying rates by the different SP enzymes. Sawangan et al.43 have
optimized the transglucosylation reaction of LmSP2 for the produc-
tion of glucosyl glycerate, obtaining a yield of 91% with 0.8 M
sucrose and 0.3 M R-glycerate as substrate. At equimolar
concentrations of sucrose and glycerate (0.3 M), however, roughly
equal activities toward glycerate and water were observed, which
is in good agreement with our result (transglycosylation activity of
1.4) under slightly different conditions. Kwon et al.44 have reported
on the synthesis of glucosyl ascorbic acid with the SP from Bifido-
bacterium longum, using a substrate solution containing 30% (w/v)
2.3.3. Transfer to carbohydrates
Sixteen monosaccharides have been tested as acceptor, using
Glc-1-P as donor substrate (Table 3). Unsurprisingly, the native
acceptor -fructose generates the highest activity, which is 16–48
times higher than the hydrolysis rate. Besides -fructose,
-arabinose and -sorbose were among the best acceptors for all
a-
D
D
L
L
SP enzymes. These measurements do, however, paint a different
picture than the transfer ratios that have previously been reported.
Indeed, with several other monosaccharides, higher yields (ther-
modynamic equilibrium) can be obtained, while we clearly show
that fructose is the best substrate (kinetic activity). For LmSP1,
for example, a transfer ratio of 67% has been obtained with galact-
ose compared to 12% with fructose,20 although the reaction is now
found to proceed almost 40 times slower (Table 3). Similarly, BaSP
displays
-arabinose than toward
A remarkable observation is that
a
higher transfer ratio but lower activity toward
D
D
-fructose.38
D-psicose and D-tagatose, the
C3- and C4-epimers of fructose, are poorly accepted by all SP en-
zymes. In contrast to fructose, tagatose mainly occurs as a pyra-
nose ring in solution but this is not the case for psicose.39
Specific interactions in the active site can thus be expected to be
responsible for this discriminative behavior. In a recent study of
BaSP, structure–activity relationships have been established for
the C1–OH and C6–OH of fructose but not for its C3–OH or C4–
OH.40 Inspection of the enzyme’s crystal structure11 has now
revealed that these hydroxyl groups are within hydrogen-bonding
distance of His234 and Asp342, respectively. Based on our kinetic
experiments, both residues should be considered to be crucial for
the native activity of SP.
sucrose and 0.5% (w/v)
enzymes tested here display a transglycosylation activity higher
than 1 on -ascorbic acid as acceptor.
L-ascorbic acid. Nevertheless, none of the
L
3. Concluding remarks
Sucrose phosphorylase is a promising biocatalyst for the glucosy-
lation of a wide variety of acceptor molecules, but was found to dis-
play a rather low transglucosylation activity toward the majority of
Substitution of the monosaccharides does not seem to have a
dramatic effect on the transglucosylation activity (Table 3). Alkyl

1864
D. Aerts et al. / Carbohydrate Research 346 (2011) 1860–1867
Table 3
Transglucosylation activity at 37 °C and pH 7, expressed with hydrolysis as reference (vAcceptor/vWater
)
Acceptor
LmSP1
LmSP2
LmSP3
SmSP
LaSP
BaSP
WaterA,B
1.00 0.06
40.39 4.87
1.00 0.07
22.47 1.32
1.00 0.11
18.14 1.03
1.00 0.13
33.77 5.4
1.00 0.14
36.77 6.08
1.00 0.12
44.4 6.05
Inorganic phosphateB
Monosacharides
L
-ArabinoseA
-ArabinoseA
-XyloseA
3.01 0.23
1.03 0.05
1.47 0.05
1.58 0.16
1.57 0.32
3.88 0.34
1.10 0.10
0.96 0.10
1.26 0.10
1.46 0.06
4.40 0.30
1.18 0.07
1.5 0.17
1.15 0.1
1.86 0.13
8.00 0.37
1.20 0.04
0.99 0.03
1.15 0.05
1.32 0.01
4.11 0.17
0.99 0.04
1.09 0.08
1.10 0.05
1.30 0.01
4.91 0.29
1.22 0.09
1.13 0.09
1.73 0.15
1.42 0.08
D
D
D
-RiboseA
L
-RiboseA
2-Deoxy-
-RhamnoseA
-LyxoseA
-FucoseA
L
-riboseA
1.84 0.20
1.19 0.19
1.23 0.18
1.00 0.07
2.19 0.23
1.26 0.08
1.21 0.06
1.00 0.02
1.19 0.06
1.01 0.03
1.20 0.06
1.16 0.07
L
1.51 0.10
1.53
1.13 0.04
1.2
1.72 0.28
NA
1.02 0.06
0.97
0.99 0.08
1.05
1.23 0.15
NA
D
L
48.64 3.06
2.01 0.26
1.34 0.09
2.64 0.04
1.20 0.08
0.93 0.04
1.59 0.10
43.50 4.58
1.30 0.12
1.54 0.14
3.06 0.11
1.31 0.07
1.06 0.09
1.37 0.07
18.53 0.95
1.75 0.15
0.43 0.04
3.26 0.11
1.27 0.08
0.84 0.05
1.50 0.10
22.90 0.89
1.06 0.04
0.92 0.07
8.86 0.26
1.55 0.13
1.02 0.05
1.07 0.07
16.7 1.46
1.25 0.05
0.88 0.08
2.99 0.06
1.33 0.18
0.96 0.08
1.10 0.05
38.36 4.29
1.27 0.13
1.01 0.07
8.17 0.36
1.36 0.03
1.03 0.13
1.43 0.06
D
D
D
-FructoseA
-PsicoseA
-TagatoseA
L
-SorboseA
D
D
D
-GalactoseA
-GlucoseA
-MannoseA
Substituted monosaccharides
Methyl
-glucopyranosideB
Methyl b-
-glucopyranosideB
Hexyl b-
-glucopyranosideB
Octyl b-
-glucopyranosideB
-GlucosamineA
Methyl
-mannopyranosideB
-MannosamineA
-GalactosamineA
a
-
D
D
1.34 0.12
1.23 0.05
0.74 0.10
0.73 0.09
0.89 0.05
1.16 0.12
0.99 0.06
0.60 0.10
0.72 0.09
1.06 0.06
1.16 0.06
1.09 0.03
0.53 0.01
0.60 0.03
1.04 0.06
0.97 0.09
0.83 0.11
1.15 0.17
0.42 0.16
1.07 0.03
0.53 0.06
0.56 0.06
0.54 0.02
0.70 0.18
1.00 0.19
1.37 0.06
0.88 0.05
0.62 0.07
0.80 0.12
1.07 0.08
D
D
D
a
-
D
1.48 0.15
0.98 0.05
1.22 0.08
1.31 0.13
1.31 0.03
1.21 0.08
1.01 0.07
1.23 0.06
0.93 0.08
1.37 0.06
1.33 0.09
1.32 0.06
D
D
0.89 0.02
1.13 0.08
1.07 0.03
1.05 0.05
1.05 0.14
1.17 0.05
Disaccharides
Difructose anhydride IIIA
KojibioseA
1.68 0.13
1.46 0.13
1.08 0.02
1.61 0.16
1.08 0.05
1.11 0.04
1.45 0.08
1.10 0.04
1.26 0.06
1.01 0.07
0.99 0.05
0.68 0.04
0.87 0.03
1.16 0.05
1.24 0.14
1.02 0.09
1.17 0.04
1.29 0.10
1.25 0.08
1.18 0.13
1.08 0.08
1.11 0.09
1.82 0.11
1.09 0.02
1.13 0.08
0.78 0.11
1.00 0.11
0.94 0.06
2.86 0.11
1.4 0.07
1.4 0.07
1.10 0.07
1.02 0.03
1.05 0.08
1.06 0.02
1.10 0.09
1.13 0.03
0.94 0.02
1.10 0.04
1.17 0.08
1.03 0.09
1.02 0.04
0.75 0.03
1.04 0.04
0.99 0.06
1.24 0.06
1.08 0.08
1.11 0.02
1.11 0.04
1.20 0.16
1.25 0.12
0.94 0.05
1.26 0.08
1.78 0.17
1.11 0.11
1.00 0.07
0.85 0.13
1.15 0.12
1.77 0.17
1.62 0.06
1.17 0.06
1.13 0.06
1.27 0.20
1.25 0.06
1.18 0.07
1.18 0.03
1.08 0.04
1.17 0.15
1.15 0.03
1.07 0.04
0.98 0.03
1.02 0.09
1.14 0.01
GentiobioseA
TrehaloseA
LactuloseA
2.93 0.04
1.21 0.06
1.18 0.07
2.17 0.09
1.23 0.02
1.21 0.05
1.05 0.05
1.09 0.04
0.63 0.04
0.93 0.13
1.45 0.24
LactoseA
IsomaltoseA
CellobioseA
SucroseA
LeucroseA
MaltuloseA
PalatinoseA
MaltoseA
TuranoseA
Trisaccharides
MaltotrioseA
RaffinoseA
1.26 0.04
1.51 0.40
1.48 0.01
1.58
1.13 0.12
1.03 0.07
1.13 0.03
1.2
2.86 0.11
2.87 0.21
3.05 0.24
NA
1.04 0.04
1.08 0.04
1.15 0.07
1.22
1.07 0.12
1.14 0.07
0.91 0.02
0.84
1.17 0.04
1.10 0.05
1.21 0.01
NA
MelezitoseA
IsomaltotrioseA
PanoseA
2.22
0.2
NA
0.96
0.87
NA
Sugar alcohols
ErythritolB
GlycerolB
1.41 0.02
1.71 0.15
1.99 0.19
1.37 0.09
1.17 0.05
1.35 0.05
1.40 0.07
1.51 0.03
2.74 0.02
0.92 0.09
1.36 0.08
1.21 0.08
1.38 0.08
1.28 0.02
1.32 0.05
2.01 0.10
1.75 0.10
1.60 0.18
D
D
D
D
-ArabitolB
-XylitolB
-RibitolB
-SorbitolB
1.03 0.10
1.43 0.09
1.24 0.10
1.26 0.07
0.99 0.11
1.83 0.08
1.17 0.04
0.66 0.23
1.24 0.04
0.93 0.09
0.75 0.06
0.90 0.04
1.29 0.05
0.67 0.12
1.69 0.09
1.51 0.12
1.48 0.15
1.10 0.16
Myo-InositolB
0.99 0.11
0.93 0.06
0.89 0.12
1.66 0.07
1.88 0.06
1.39 0.09
1.12 0.08
1.03 0.04
0.95 0.05
0.94 0.05
1.02 0.09
0.90 0.04
1.96 0.10
1.85 0.12
1.35 0.13
1.17 0.04
1.13 0.07
1.00 0.03
Meso-InositolB
D
-MannitolB
Aromatics
PhenolB
0.74 0.06
0.25 0.09
0.85 0.08
0.75 0.21
0.58 0.11
ND
0.77 0.07
0.35 0.04
0.60 0.10
0.81 0.18
1.14 0.09
0.55 0.12
1.31 0.25
0.69 0.06
ND
0.88 0.04
ND
ND
0.87 0.26
0.78 0.24
ND
0.61 0.11
ND
0.89 0.09
ND
ND
0.52 0.06
0.61 0.07
ND
CatecholB,c
ResorcinolB
0.97 0.07
0.83 0.13
0.73 0.04
1.28 0.10
1.69 0.19
1.41 0.05
0.75 0.07
0.82 0.02
0.76 0.02
0.48 .02
2-PhenylethanolB,a
2-NitrophenolB,a
p-NitrophenolB
2-PhenylphenolB,a
0.70 0.09
0.62 0.11
0.58 0.07

D. Aerts et al. / Carbohydrate Research 346 (2011) 1860–1867
1865
Table 3 (continued)
Acceptor
LmSP1
LmSP2
LmSP3
SmSP
LaSP
BaSP
4-PhenoxyphenolB,a
p-Hydroxybenzoic acid methylesterB
3-HydroxybiphenylB,a
p-Hydroxybenzoic acidB
3,4-diHydroxybenzoic acidB
Salicylic acidB
0.52 0.12
0.54 0.12
0.70 0.04
ND
0.69 0.06
0.49 0.08
0.72 0.12
1.13 0.17
ND
0.35 0.05
1.32 0.14
0.65 0.13
0.69 0.05
0.74 0.05
NA
2.53 0.07
0.58 0.04
0.76 0.03
0.47 0.10
ND
0.85 0.07
1.33 0.12
0.30 0.06
ND
0.66 0.01
0.99 0.08
1.37 0.20
0.60 0.13
0.75 0.33
1.57 0.14
0.98 0.08
0.83 0.14
ND
0.62 0.03
0.56 0.05
0.62 0.02
0.57 0.05
ND
0.67 0.03
0.86 0.08
0.18 0.15
ND
0.26 0.04
0.21 0.08
1.05 0.12
ND
0.63 0.11
0.40 0.03
0.39 0.04
ND
ND
ND
ND
0.12 0.03
1.33 0.08
ND
0.85 0.15
0.61 0.01
NA
0.90 0.11
0.70 0.11
0.70 0.08
0.82 0.07
0.99 0.05
ND
1.80 0.14
0.78 0.04
ND
Shikimic acidB,d
Gallic acidB
Ethyl GallateB,c
ND
ND
VanillinB
0.79 0.06
0.83 0.08
1.43 0.04
0.92 0.25
0.79 0.19
0.82 0.01
0.77 0.12
0.56 0.06
0.46 0.08
0.43 0.05
PyridoxineB
3,4-DimethoxybenzylalcoholB
p-Hydroxy-benzoic acid n-butyl esterB,b
DaidzeinB,d
1.51 0.08
0.87 0.12
1.09 0.12
ND
Specialties
1.28 0.15
1.31 0.02
1.06 0.05
0.57 0.14
0.74 0.09
1.04 0.08
L
-HydroxyprolineB
GlycerateB
1.31 0.14
0.76 0.06
1.78 0.20
1.40 0.07
0.77 0.31
0.80 0.09
0.87 0.06
0.81 0.10
1.74 0.08
0.47 0.15
0.87 0.24
0.47 0.02
0.55 0.16
ND
0.96 0.11
0.86 0.14
0.62 0.09
1.58 0.16
CholesterolB
D
-Gluconic acidB
RibonolactoneB
0.99 0.07
0.16 0.01
0.29 0.16
1.17 0.12
0.91 0.07
0.47 0.05
1.05 0.14
0.56 0.04
1.13 0.04
0.33 0.08
1.18 0.13
0.28 0.15
L
-Ascorbic acidB
L
-Isoascorbic acidB
0.14 0.03
0.85 0.08
1.13 0.17
1.08 0.16
0.40 0.06
0.51 0.04
0.61 0.09
0.63 0.05
0.42 0.06
0.51 0.17
0.24 0.03
ND
CyclohexanolB
Acceptor concentration: a 15 mM, b 25 mM, c 32.5 mM, d 1.5 mM.
NA: Data not available, ND: activity not detectable.
A
Using 30 mM
Using 50 mM sucrose as donor (BCA assay).
a
-Glc-1-P as donor (phosphate assay).
B
ditions, as previously described.45 Similarly, the new SP gene from
Streptococcus mutans LMG 14558T was cloned into the constitutive
expression vector pCXP22h using TAGCTAGCATGCCAATTACAAA
TAAAACAATGTTG and TCACTGCAGTTATTCAAAGCTTATTGTTTG as
forward and reverse primers, respectively. For enzyme production,
2% of an overnight culture was inoculated in 250 mL LB medium
containing 100 lg/mL ampicillin and 25 lg/mL chloramphenicol
in a 1 L shake flask and incubated at 37 °C with continuous shaking
at 200 rpm until the beginning of exponential phase (OD600 = 0.6).
Further expression of the SP enzymes was then performed for 2
hours at the optimal temperature,45 with 30 °C being optimal for
the SP from S. mutans. The produced biomass was harvested by
centrifugation for 20 min at 5000g and 4 °C, washed with 10 mL
PBS buffer (300 mM NaCl and 50 mM NaH2PO4 at pH 8) and the ob-
tained cell pellets were stored at ꢀ20 °C.
The cell pellets were then thawed and dissolved in 10 mL lysis
buffer (300 mM NaCl, 10 mM imidazole, 0.1 mM PMSF and
50 mM NaH2PO4 at pH 8) supplemented with lysozyme and DNaseI
in a final concentration of 1 mg/mL and 6 U/L, respectively. This
cell suspension was incubated on ice for 30 min and sonicated
three times for 2.5 min (Branson sonifier 250, level 3, 50% duty cy-
cle). The His6-tagged proteins were purified by Ni-NTA chromatog-
raphy as described by the supplier (Qiagen), after which the buffer
was exchanged to 50 mM MOPS pH 7 in a Centricon YM-30 (Milli-
pore). The protein content was analyzed with the Lowry method
using bovine serum albumin as standard.46
Figure 5. Boxplot of the relative transglucosylation activity (vAcceptor/vWater) of the
various SP enzymes.
compounds. Consequently, the development of production pro-
cesses for glycosides will require the optimization of reaction condi-
tions to outcompete water as acceptor. Hydrophobic acceptors,
however, cannot be used at high concentrations because of their lim-
ited solubility. We have shown here that organic co-solvents can be
added to the reaction medium in concentrations up to 25% without
too much loss of enzyme activity. Nevertheless, the solubility of sev-
eral acceptors will probably still not be high enough to allow satura-
tion of the enzyme’s active site. Improving the affinity for
hydrophobic acceptors by means of enzyme engineering will, there-
fore, be a major challenge for the commercial exploitation of the
transglucosylation potential of sucrose phosphorylase.
4.2. Assay procedures
4.2.1. Determination of inorganic phosphate
The release of inorganic phosphate from
a-Glc-1-P as glycosyl
donor was measured with the method of Gawronski.47 The color re-
agent is prepared by adding 2 parts of a solution containing 4% (w/v)
ascorbic acid in 1 N HCl, and 1 part of a solution containing 2% (w/v)
ammonium molybdate tetrahydrate (Sigma) in milliQ water. From
4. Experimental section
4.1. Enzyme production and purification
the color reagent, 150
lowed by 5 min incubation at room temperature. Subsequently,
150 L stop solution composed of 2% (w/v) sodium citrate tribasic
lL is added to 50 lL sample or standard, fol-
The SP enzymes, containing
constitutively expressed in E. coli Rosetta 2 under the optimal con-
a N-terminal His6-tag, were
l

1866
D. Aerts et al. / Carbohydrate Research 346 (2011) 1860–1867
dihydrate and 2% acetic acid in milliQ water is added, and the mix-
ture is incubated for 15 min at room temperature before the absor-
bance is read at 655 nm.
repetitions. The activity in the absence of acceptor (vWater) was
used as reference and was measured by either phosphate determi-
nation or the BCA assay depending on the donor substrate.
4.2.2. Determination of reducing sugars
Acknowledgments
The release of the reducing sugar fructose from sucrose as glyco-
syl donor was measured with the bicinchoninic acid (BCA) as-
say.48,49 The color reagent is prepared by adding 23 parts of a
solution containing 130.43 mg/100 mL 4,40-dicarboxy-2,20-biquin-
oline and 6.23% (w/v) anhydrous Na2CO3 in milliQ water and 1 part
of a solution composed of 2.33% (w/v) aspartic acid, 3.33% (w/v)
anhydrous Na2CO3 and 0.73% (w/v) CuSO4 in milliQ water and 6
The authors wish to thank the Institute for the Promotion of
Innovation through Science and Technology in Flanders (IWT-
Vlaanderen) for financial support through a Ph.D.-Grant (81323)
and an SBO-Project (50191).
References
parts ethanol. From the color reagent, 150 lL is added to 50 lL sam-
ˇ
1. Kren, V. Glycoside vs. Aglycon: The Role of Glycosidic Residue in Biological
ple or standard, covered by a plastic foil and incubated for 30 min at
70 °C. After cooling to room temperature, the absorbance is mea-
sured at 540 nm.
Activity. In Glycoscience; Fraser-Reid, B. O., Tatsuta, K., Thiem, J., Eds., 2nd ed.;
Springer: Berlin, Heidelberg, New York, 2008; pp 2589–2644.
2. Desmet, T.; Soetaert, W. Biocatal. Biotransform. 2011, 29, 1–18.
3. Henrissat, B. Biochem. J. 1991, 280, 309–316.
4. Henrissat, B.; Bairoch, A. Biochem. J. 1996, 316, 695–696.
5. Kagan, B. O.; Latker, S. n.; Zfasman, E. M. Biokhimiya 1942, 7, 93–108.
6. Stam, M. R.; Danchin, E. G. J.; Rancurel, C.; Coutinho, P. M.; Henrissat, B. Protein
Eng., Des. Sel. 2006, 19, 555–562.
7. Mieyal, J. J.; Abeles, R. H. Disaccharide Phosphorylases. In The Enzymes; Boyer, P.
D., Ed., 3rd ed.; Academic Press: New York, 1972; pp 515–532.
8. Mieyal, J. J.; Abeles, R. H.; Simon, M. J. Biol. Chem. 1972, 247, 532–542.
9. Voet, J. G.; Abeles, R. H. J. Biol. Chem. 1970, 245, 1020–1031.
10. Silverstein, R.; Voet, J.; Reed, D.; Abeles, R. H. J. Biol. Chem. 1967, 242, 1338–
1346.
4.2.3. Determination of glucose
To determine the contribution of glucose to the amount of reduc-
ing sugars, its concentration (and resulting vGlc) was determined
with a discontinuous coupled assay using glucose oxidase and per-
oxidase.50 The coloring reagent was composed of 453 mg/L glucose
oxidase (Sigma), 69.2 mg/L peroxidase (Sigma), and 500 mg/L 2,20-
azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (Sigma) in
100 mM Tris–HCl, 5 mM NaH2PO4, pH 7.0, and 0.1% (v/v) Triton
11. Mirza, O.; Skov, L. K.; Sprogoe, D.; van den Broek, L. A. M.; Beldman, G.; Kastrup,
J. S.; Gajhede, M. J. Biol. Chem. 2006, 281, 35576–35584.
X100 (Sigma). To 50
lL of an inactivated sample or standard
12. Sprogoe, D.; van den Broek, L. A. M.; Mirza, O.; Kastrup, J. S.; Voragen, A. G. J.;
Gajhede, M.; Skov, L. K. Biochemistry 2004, 43, 1156–1162.
13. Goedl, C.; Schwarz, A.; Mueller, M.; Brecker, L.; Nidetzky, B. Carbohydr. Res.
2008, 343, 2032–2040.
(5 min at 95 °C), 200
the reaction was incubated at 30 °C for 30 min, after which the
absorbance was read at 405 nm.
lL of the coloring solution was added and
14. Mueller, M.; Nidetzky, B. FEBS Lett. 2007, 581, 1403–1408.
15. Mueller, M.; Nidetzky, B. FEBS Lett. 2007, 581, 3814–3818.
16. Schwarz, A.; Brecker, L.; Nidetzky, B. Biochem. J. 2007, 403, 441–449.
17. Schwarz, A.; Nidetzky, B. FEBS Lett. 2006, 580, 3905–3910.
18. Doudoroff, M.; Hassid, W. Z.; Barker, H. A. Science 1944, 100, 315–316.
19. Kitao, S.; Sekine, H. Biosci. Biotechnol. Biochem. 1992, 56, 2011–2014.
20. Lee, J. H.; Yoon, S. H.; Nam, S. H.; Moon, Y. H.; Moon, Y. Y.; Kim, D. Enzyme
Microb. Technol. 2006, 39, 612–620.
21. Kitao, S.; Matsudo, T.; Sasaki, T.; Koga, T.; Kawamura, M. Biosci. Biotechnol.
Biochem. 2000, 64, 134–141.
22. Kitao, S.; Sekine, H. Biosci. Biotechnol. Biochem. 1994, 58, 38–42.
23. Vandamme, E. J.; Vanloo, J.; Machtelinckx, L.; Delaporte, A. Adv. Appl. Microbiol.
1987, 32, 163–201.
4.3. Kinetic parameters
The apparent kinetic parameters for sucrose as donor and for
fructose as acceptor were determined in 50 mM MOPS buffer at
pH 7 and 37 °C, using 75 mM phosphate and 50 mM
respectively, as co-substrate. The parameters were calculated by
non-linear regression of the Michaelis-Menten equation using
Sigma Plot 10.0.
a-Glc-1-P,
24. Gold, A. M.; Osber, M. P. Biochem. Biophys. Res. Commun. 1971, 42, 469.
25. Goedl, C.; Sawangwan, T.; Wildberger, P.; Nidetzky, B. Biocatal. Biotransform.
2010, 28, 10–21.
26. Cantarel, B. L.; Coutinho, P. M.; Rancurel, C.; Bernard, T.; Lombard, V.;
Henrissat, B. Nucleic Acids Res. 2009, 37, D233–D238.
27. Lee, J. H.; Moon, Y. H.; Kim, N.; Kim, Y. M.; Kang, H. K.; Jung, J. Y.; Abada, E.;
Kang, S. S.; Kim, D. Biotechnol. Lett. 2008, 30, 749–754.
28. Bertrand, A.; Morel, S.; Lefoulon, F.; Rolland, Y.; Monsan, P.; Remaud-Simeon,
M. Carbohydr. Res. 2006, 341, 855–863.
29. Cerdobbel, A.; De Winter, K.; Desmet, T.; Soetaert, W. Biotechnol. J. 2010, 5,
1192–1197.
30. Fujii, K.; Iiboshi, M.; Yanase, M.; Takaha, T.; Kuriki, T. J. Appl. Glycosc. 2006, 53,
91–97.
31. Cerdobbel, A.; Desmet, T.; De Winter, K.; Maertens, J.; Soetaert, W. J. Biotechnol.
2010, 150, 125–130.
4.4. Stability in co-solvent
The solvent stability was determined by measuring the SP
activity in the presence of 0–40% (v/v) organic co-solvent, that is,
ethanol (Merck), acetonitrile (Fisher), dimethylsulfoxide (DMSO)
(Sigma), dimethylformamide (DMF) (Sigma) and iso-propanol
(Acros). Enzyme reactions were performed in quadruple in 96-well
microtiter plates using 50 mM sucrose in 50 mM sodium phos-
phate buffer at pH 7 and 37 °C as substrate. At regular intervals,
samples were taken with a liquid-handling robot (Freedom EVO
Tecan) and analyzed with the BCA assay.
32. Goedl, C.; Sawangwan, T.; Brecker, L.; Wildberger, P.; Nidetzky, B. Carbohydr.
Res. 2010, 345, 1736–1740.
4.5. Acceptor screening
33. Sawangwan, T.; Goedl, C.; Nidetzky, B. Org. Biomol. Chem. 2009, 7, 4267–4270.
34. Goedl, C.; Sawangwan, T.; Mueller, M.; Schwarz, A.; Nidetzky, B. Angew. Chem.,
Int. Ed. 2008, 47, 10086–10089.
35. Goedl, C.; Schwarz, A.; Minani, A.; Nidetzky, B. J. Biotechnol. 2007, 129, 77–86.
36. Nomura, K.; Sugimoto, K.; Nishiura, H.; Ohdan, K.; Nishimura, T.; Hayashi, H.;
Kuriki, T. Biosci. Biotechnol. Biochem. 2008, 72, 82–87.
Acceptors of reducing and non-reducing nature were screened
with the phosphate and BCA assay, respectively (Table 3). Enzyme
reactions were performed in 96-low-well microtiter plates with
65 mM acceptor and either 30 mM
a-glucose-1-phosphate or
37. Sugimoto, K.; Nomura, K.; Nishiura, H.; Ohdan, K.; Nishimura, T.; Hayashi, H.;
Kuriki, T. J. Biosci. Bioeng. 2007, 104, 22–29.
50 mM sucrose in 50 mM MOPS buffer at pH 7 and 37 °C. For the
hydrophobic acceptors, 25% (v/v) DMSO was added to the reaction
mixture. The purified enzymes were diluted to a level that allowed
the accurate determination of their hydrolytic activity. Initial reac-
tion rates were determined with a pipetting robot (Freedom EVO,
38. van den Broek, L. A. M.; van Boxtel, E. L.; Kievit, R. P.; Verhoef, R.; Beldman, G.;
Voragen, A. G. J. Appl. Microbiol. Biotechnol. 2004, 65, 219–227.
39. Witczak, Z. J. Monosaccharides: Occurrence, Significance, and Properties. In
Glycoscience; Fraser-Reid, B. O., Tatsuta, K., Thiem, J., Eds.; Springer: Berlin,
Heidelberg, New York, 2008; pp 815–840.
40. Goedl, C.; Nidetzky, B. Carbohydr. Res. 2010, 345, 1492–1496.
41. Saito, K.; Tomita, F. Biosci. Biotechnol. Biochem. 2000, 64, 1321–1327.
42. Gursoy, R. N.; Benita, S. Biomed. Pharmacother. 2004, 58, 173–182.
43. Sawangwan, T.; Goedl, C.; Nidetzky, B. Biotechnol. J. 2010, 5, 187–191.
44. Kwon, T.; Kim, C. T.; Lee, J. H. Biotechnol. Lett. 2007, 29, 611–615.
Tecan), taking samples of 50
ll every 30 min for 2 h when
a-Glc-1-P was used as donor and every 5 minutes for 20 minutes
when sucrose was the donor. The transglucosylation activity and
standard deviation for every compound were calculated from four

D. Aerts et al. / Carbohydrate Research 346 (2011) 1860–1867
1867
45. Aerts, D.; Verhaeghe, T.; De Mey, M.; Desmet, T.; Soetaert, W. Eng. Life Sci. 2011,
11, 10–19.
46. Lowry, O. H.; Rosebrough, N. J.; Farr, A. L.; Randall, R. J. J. Biol. Chem. 1951, 193,
265–275.
47. Gawronski, J. D.; Benson, D. R. Anal. Biochem. 2004, 327, 114–118.
48. Garcia, E.; Johnston, D.; Whitaker, J. R.; Shoemaker, S. P. J. Food Biochem. 1993,
17, 135–145.
50. Blecher, M.; Glassman, A. B. Anal. Biochem. 1962, 3, 343–352.
51. Barrangou, R.; Altermann, E.; Hutkins, R.; Cano, R.; Klaenhammer, T. R. Proc.
Natl. Acad. Sci. U.S.A. 2003, 100, 8957–8962.
52. Russell, R. R. B.; Mukasa, H.; Shimamura, A.; Ferretti, J. J. Infect. Immun. 1988,
56, 2763–2765.
53. Koga, T.; Nakamura, K.; Shirokane, Y.; Mizusawa, K.; Kitao, S.; Kikuchi, M. Agric.
Biol. Chem. 1991, 55, 1805–1810.
49. Waffenschmidt, S.; Jaenicke, L. Anal. Biochem. 1987, 165, 337–340.