Interaction of aflatoxin B1 with cytochrome P450 2A5 and its mutants: correlation with metabolic activation and toxicity.

Article abstract of DOI:10.1021/tx960078m

Among members of the mouse cytochrome P450 2A family, P450 2A5 is the best catalyst of aflatoxin B1 (AFB1) oxidation to its 8,9-epoxide (Pelkonen, P., Lang, M., Wild, C. P., Negishi, M., and Juvonen, R. O. (1994) Eur. J. Pharmacol., Environ. Toxicol. Pharmacol. Sect. 292, 67-73). Here we studied the role of amino acid residues 209 and 365 of the P450 2A5 in the metabolism and toxicity of AFB1 using recombinant yeasts. The two sites have previously been shown to be essential in the interaction of coumarin and steroids with the P450 2A5. Reducing the size of the amino acid at position 209 or introducing a negatively charged residue at this site increased the 8,9-epoxidation of AFB1 compared to the wild type. In addition, replacing the hydrophobic amino acid at the 365 position with a positively charged lysine residue strongly decreased the metabolism of AFB1. These mutations changed the KM values generally less than the Vmax values. The changes in AFB1 metabolism contrast with the changes in coumarin 7-hydroxylation caused by these amino acid substitutions, since reducing the size of the 209 residue strongly reduced coumarin metabolism and increased the K(M) values. On the other hand, the results with AFB1 are similar to those obtained with steroid hydroxylation. This suggests that the size of the substrate is important when interacting with the residue 209 of the protein. The catalytic parameters of AFB1 correlated generally with its toxicity to the recombinant yeasts expressing the activating enzyme and with the binding of AFB1 to yeast DNA. Furthermore high affinity substrates and inhibitors (e.g., methoxsalen, metyrapone, coumarin 311, 7-methylcoumarin, coumarin, and pilocarpine) of P450 2A5 could efficiently block the toxicity of AFB1. It is suggested that the recombinant yeasts expressing engineered P450 enzymes are a useful model to understand the substrate protein interactions, to study the relationship of metabolic parameters to toxicity, and to test potential inhibitors of metabolism based toxicity.

Full text of DOI:10.1021/tx960078m

Chem. Res. Toxicol. 1997, 10, 85-90
85
In ter a ction of Afla toxin B1 w ith Cytoch r om e P 450 2A5
a n d Its Mu ta n ts: Cor r ela tion w ith Meta bolic Activa tion
a n d Toxicity
Pa¨ivi Pelkonen,†,‡ Matti A. Lang,‡ Masahiko Negishi,§ Christopher P. Wild,| and
Risto O. J uvonen*,†
Department of Pharmacology and Toxicology, University of Kuopio, POB 1627, 70211 Kuopio,
Finland, International Agency for Research on Cancer, 150 Cours Albert-Thomas, 69372 Lyon
Cedex 08, France, Laboratory of Reproductive and Developmental Toxicology, National Institutes of
Environmental Health Sciences, POB 12233, Research Triangle Park, North Carolina 27709, and
Molecular Epidemiology Unit, Research School of Medicine, 24 Hyde Terrace, University of Leeds,
Leeds LS16 6BG, U.K.
Received May 6, 1996X
Among members of the mouse cytochrome P450 2A family, P450 2A5 is the best catalyst of
aflatoxin B1 (AFB1) oxidation to its 8,9-epoxide (Pelkonen, P., Lang, M., Wild, C. P., Negishi,
M., and J uvonen, R. O. (1994) Eur. J . Pharmacol., Environ. Toxicol. Pharmacol. Sect. 292,
67-73). Here we studied the role of amino acid residues 209 and 365 of the P450 2A5 in the
metabolism and toxicity of AFB1 using recombinant yeasts. The two sites have previously
been shown to be essential in the interaction of coumarin and steroids with the P450 2A5.
Reducing the size of the amino acid at position 209 or introducing a negatively charged residue
at this site increased the 8,9-epoxidation of AFB1 compared to the wild type. In addition,
replacing the hydrophobic amino acid at the 365 position with a positively charged lysine residue
strongly decreased the metabolism of AFB1. These mutations changed the KM values generally
less than the Vmax values. The changes in AFB1 metabolism contrast with the changes in
coumarin 7-hydroxylation caused by these amino acid substitutions, since reducing the size of
the 209 residue strongly reduced coumarin metabolism and increased the KM values. On the
other hand, the results with AFB1 are similar to those obtained with steroid hydroxylation.
This suggests that the size of the substrate is important when interacting with the residue
209 of the protein. The catalytic parameters of AFB1 correlated generally with its toxicity to
the recombinant yeasts expressing the activating enzyme and with the binding of AFB1 to
yeast DNA. Furthermore high affinity substrates and inhibitors (e.g., methoxsalen, metyrapone,
coumarin 311, 7-methylcoumarin, coumarin, and pilocarpine) of P450 2A5 could efficiently
block the toxicity of AFB1. It is suggested that the recombinant yeasts expressing engineered
P450 enzymes are a useful model to understand the substrate protein interactions, to study
the relationship of metabolic parameters to toxicity, and to test potential inhibitors of
metabolism based toxicity.
In mouse liver, three highly homologous P450 2A
enzymes are expressed (namely, P450 2A4, P450 2A5,
and P450 7R) having high specific activities for testoster-
one 15R-hydroxylation, coumarin 7-hydroxylation, and
testosterone 7R-hydroxylation, respectively (12-15). Re-
cently we showed that AFB1 8,9-epoxide is formed by
P450 2A4 and P450 2A5 but practically not at all by P450
7R (11). In spite of their extremely high sequence
identity (only 11 amino acid residues out of a total 494
are different) the KM value of P450 2A5 for AFB1 is about
50 times lower than the value of P450 2A4. This could
indicate that P450 2A5 is more important in vivo in the
bioactivation of AFB1 than P450 2A4 and that only minor
changes in the protein conformation may dramatically
affect the interaction with the substrates.
In tr od u ction
To exert its toxic effects, aflatoxin B1 (AFB1)1 needs to
be metabolized to 8,9-epoxide (1-3) by several P450
enzymes including 1A2, 2A, and 3A (4-10). P450 2A
enzymes contribute to metabolic activation of AFB1 in
several species including human (4-7). Antibodies against
rat P450 2A inhibited the formation of AFB1 8,9-epoxide
by 13-47% in various human liver microsomes (5), and
antibody against mouse P450 2A5 inhibits aflatoxin B1
epoxidation by up to 50% in hamster liver microsomes
(7). Furthermore, human P450 2A6 expressed in trans-
formed cells activates AFB1 to a mutagen in the Salmo-
nella typhimurium test system as do mouse P450 2A4
and 2A5 in transformed yeast cells (6, 11).
For the activities of steroid 15R-hydroxylase and cou-
marin 7-hydroxylase of P450 2A4 and P450 2A5, respec-
tively, amino acid residues 117, 209, and 365 are essen-
tial (16). For example, mutating Phe209 of P450 2A5 to
Leu confers steroid 15R-hydroxylase to coumarin 7-hy-
droxylase activity. In addition, the affinity of the en-
zymes for coumarin is dependent on the size of residue
209, and the nature of this residue determines the rate
of coumarin 7-hydroxylation (17). Since the interaction
* Correspondence to Risto O. J uvonen, Department of Pharmacology
and Toxicology, University of Kuopio, POB 1627, 70211 Kuopio,
Finland, tel. +358-17-162010, fax +358-17-162424, mail
rjuvonen@falli.uku.fi.
† University of Kuopio.
‡ International Agency for Research on Cancer.
§ National Institutes of Environmental Health Sciences.
| University of Leeds.
X Abstract published in Advance ACS Abstracts, December 15, 1996.
1
Abbreviations: AFB1, aflatoxin B1; AFM1, aflatoxin M1; AFP1,
aflatoxin P1; AFQ1, aflatoxin Q1; P450(s), cytochrome P450; ELISA,
enzyme-linked immunosorbent assay.
S0893-228x(96)00078-1 CCC: $14.00 © 1997 American Chemical Society

86 Chem. Res. Toxicol., Vol. 10, No. 1, 1997
Pelkonen et al.
of AFB1 with P450 2A4 and P450 2A5 seems to be
different with testosterone and coumarin, we tested
whether amino acid changes at these critical sites also
affect the 8,9-epoxidation of AFB1. The substrate protein
interactions and the toxic effects of the metabolic activa-
tion were studied in yeast cells transformed by the
enzymes and their mutants. Further, several known
substrates or inhibitors of P450 2A5 were tested for their
ability to inhibit bioactivation of AFB1.
Exp er im en ta l P r oced u r es
Ca u tion : Aflatoxin B1 is carcinogenic, and pilocarpine and
bispilocarpine are potent cholinomimetic drugs; they all should
be handled with care. Ch em ica ls. Coumarin, coumarin 311,
7-methylcoumarin, dilauroylphosphatidylcholine, sorbitol, tes-
tosterone, metyrapone, and aflatoxin B1 were obtained from
Sigma Chemical Co. (St. Louis, MO); NADP, NADPH, glucose
6-phosphate, and glucose 6-phosphate dehydrogenase were from
Boehringer Mannheim (Germany); Zymolyase 20-T from ICN
Biomedicals (Costa Mesa, CA); yeast nitrogen base without
amino acid and bacto-agarose were from Difco (Detroit, MI);
glucose was from BDH Laboratory Supplies (Poole, England);
pilocarpine was from Leiras (Turku, Finland); bispilocarpine
was kindly provided by Dr. Tomi J a¨rvinen, University of Kuopio,
Finland, and methoxsalen by Dr. J ukka Ma¨enpa¨a¨, University
of Oulu, Finland.
F igu r e 1. HPLC chromatogram of the analysis of AFB1
metabolism. 50 µM AFB1 was incubated in the reconstituted
system with mutant Phe209Asp, and the reaction was stopped
by addition of ice cold ethanol after 10 min. Formation of AFB1
8,9-epoxide, as measured by determination of the AFB1-tris-diol
complex , and AFM1 was as described in detail in the Experi-
mental Procedures. In the chromatogram the tris-diol is repre-
sented by peaks at 14.3 and 15.09 min as demonstrated by the
absence of these peaks in reactions in which the tris was
omitted. Other peaks are as follows: 18.69, AFM1; 24.15,
unmetabolized AFB1; 26.77, aflatoxicol internal standard. Both
fluoresence (400 nm) and UV (365 nm) were monitored to allow
optimum quantification of tris-diol and the other metabolites,
respectively. In this example, the y axis is fluoresence.
Biologica l Ma ter ia l. The construction of pAAH5 expression
vector system in Saccharomyces cerevisiae AH22 cells for mouse
liver P450 2A5 and its mutants of residue 209 is described in
earlier publications (17-19). Residues of amino acid 365 were
mutated using pSELECTtm-1 vector (Promega, Madison, WI)
and primers 5′-AGATTTGCAGACAAGATCCCCATGGGC, 5′-
AGATTTGCAGACATTATCCCCATGGGC, and 5′-AGATTTG-
CAGACTTCATCCCCATGGGC for Met365Lys, Met365Ile, and
Met365Phe. The mutated cDNAs were ligated to pAAH5 vector
and transfected to S. cerevisiae AH22. The expression level was
the same for all enzymes. Purification of the enzymes is
described in earlier papers (17, 19).
Meta bolism of AF B1. The conditions for epoxidation in the
reconstituted system were described previously (11) and com-
prised reaction mixtures containing 2-15 pmol of P450, 4-30
pmol of NADPH-cytochrome P450 reductase, 0.8-6 nmol of
dilauroylphosphatidylcholine, 77 mM Tris-HCl buffer (pH 7.4),
5 mM MgCl2, 0.4 mM NADP, 5.75 mM glucose 6-phosphate,
0.075 U of glucose 6-phosphate dehydrogenase, and 0.5-100 µM
AFB1. AFB1 8,9-epoxide measured indirectly as a tris-diol
adduct, aflatoxin M1, aflatoxin Q1, and aflatoxin P1 were
analyzed by high performance liquid chromatography, as previ-
ously described by Kirby and co-workers (20). It should be noted
that mouse liver microsomes have been shown to produce almost
exclusively the exo-8,9-epoxide,2 and therefore it is most likely
that the epoxide formed in these studies is of this form.
Resu lts
Role of Resid u es 209 a n d 365 of P 450 2A5 in th e
Ep oxid a tion of AF B1. These amino acid residues are
critical for the binding and metabolism of coumarin, a
specific substrate of P450 2A5 (16, 17). We therefore
wanted to know if they also affect AFB1 epoxidation. Two
peaks for AFB1-tris-diol were observed (Figure 1). These
peaks were always in the same ratio for all mutants and
at all AFB1 concentrations; although their identities were
not further characterized, both peaks were eliminated by
omitting tris from the reaction mixture (data not shown).
Mouse liver microsomes were only previously found to
produce exo-8,9-epoxide,2 and this observation would not
be consistent with these two peaks representing the exo-
and endo-epoxides of AFB1. Replacing the Phe209 resi-
due of the wild type with six different amino acids
increased the epoxidation rate (Table 1 and Figure 2.).
The highest rate was reached with Phe209Gly, Phe209Val,
and Phe209Asn with a 5-fold higher Vmax value than
obtained for the wild type, followed by Phe209Asp,
Phe209Leu, and Phe209Ala. The KM value of AFB1 to
the enzyme was also dependent to some extent on the
residue at position 209 (Table 1). In Phe209Asn it was
decreased to half of the value of wild type, and in
Phe209Val and Phe209Leu it increased 1.8- and 3.5-fold.
These data demonstrate that residue 209 influences
reaction kinetic parameters of AFB1 epoxidation by P450
2A5. It is noteworthy that an engineered protein such
Toxicity of AF B1 for th e Recom bin a n t Yea sts. Details
of the test have been described by Pelkonen and co-workers (11).
Briefly, recombinant yeast cells were incubated in growth
medium in the presence of AFB1 for 4 h at 30 °C and then
transferred onto the Petri dish, and after 3 days’ incubation,
the number of colonies was calculated. In the rescue tests, the
inhibitors of P450 2A5 were added together with the AFB1. The
pH of the yeast medium was 5.5, and in the experiments
indicated phosphate buffer was used to increase it to 7.0.
Mea su r em en t of AF B1-DNA Ad d u cts. DNA was prepared
from about 1 × 109 yeast cells in culture by the method described
by Ausubel and co-workers (11, 21). AFB1-DNA adducts were
measured by ELISA as described (22) in duplicate cultures.
The statistical analysis of kinetics of epoxidation of AFB1 was
made by GraphPad PRISM version 2.0.
2
D. L. Eaton, Personal communication.

Interaction of Aflatoxin B1 with P450 2A5
Ta ble 1. Effect of Resid u e 209 in P 450 2A5 on 8,9-Ep oxid e F or m a tion a n d Toxicity of AF B1a
Part A Part B
AFB1-DNA adduct
Chem. Res. Toxicol., Vol. 10, No. 1, 1997 87
8,9-epoxide formation
Vmax [nmol/
LC50 of yeast
type of P4502A5
with 50 µM AFB1
KM (AFB1) (µM)
(nmol of P450‚min)]
cells (µM)
(pmol/mg of DNA)
Phe209 (wild)
Phe209Leu
Phe209Val
Phe209Ala
Phe209Gly
Phe209Asn
Phe209Asp
yeast without
recombinant p450
15 ( 3 (15)
30 ( 4 (4)
63 ( 6 (5)
22 ( 8 (6)
82 ( 9 (3)
91 ( 11 (7)
47 ( 18 (4)
ND
11 (4-18)
39 (12-64)
18 (11-25)
-
16 (13-20)
56 (35-77)
84 (70-99)
-
0.4 ( 0.2 (3)
0.8 ( 0.3 (3)
77 ( 14 (5)
18 ( 5 (5)
0.29 ( 0.05 (3)
0.04 ( 0.01 (3)
0.04 ( 0.01 (3)
0.04 ( 0.02 (3)
0.07 ( 0.01 (3)
not sensitive
50 ( 14 (4)
1100 ( 400 (6)
2400 ( 1400 (6)
1600 ( 300 (6)
1100 ( 100
<1
11 (5-16)
6 (3-9)
-
77 (63-90)
81 (69-93)
-
ND
ND
a
In panel A metabolic parameters of AFB1 with purified P450 2A5 mutant enzymes used in reconstituted system are shown. For
further details, see Experimental Procedures. In part B, AH22 yeast cells were transformed with mutant P450 2A5 cDNA, and then
exposed to various AFB1 concentrations, and LC50 values were calculated . The adduct formation in yeast cells was measured at 0.2 µM
AFB1 concentration. The values in parentheses show the number of experiments repeated or the 95% confidence intervals. (-) not measured.
ND ) not detectable.
Ta ble 2. Hyd r oxyla tion of AF B1 to AF M1 by P 450 2A5 a n d
Its Mu ta n tsa
formation of AFM1
[pmol/(nmol of
type of P450 2A5
P450‚min)]
wild type
41
23
25
41
Phe209Val
Phe209Ala
Phe209Asn
a
The same conditions as in Table 1 were used. P450 enzymes
were incubated with 50 µM AFB1 and the products separated with
high performance liquid chromatography and quantitated by
fluorescence (Ex 360 nm, Em 400 nm) and UV 365 nm absorbance.
F igu r e 2. Dependency of 8,9-epoxidation of AFB1 by P450 2A5
and its mutants on the concentration of AFB1. The reaction rate
was measured by purified P450 2A5 mutant enzymes in
reconstituted system as descraibed in detail in the Experimental
Procedures. Each point represents the average of 2-4 measure-
ments. Each curve was analyzed by nonlinear regression
analysis of Prizm version 2.0, giving R2 values of 0.913 for
209Phe wild (0), 0.958 for Phe209Leu (2), 0.966 for Phe209Val
(×), 0.924 for Phe209Gly (*), and 0.922 for Phe209Asn (b) and
the KM and Vmax values obtained are represented in Table 1.
In summary, it appears that the two amino acid residues
at positions 209 and 365 which are critical for the
metabolism of coumarin also play a role in AFB1 me-
tabolism.
Role of Resid u es 209 a n d 365 in th e Toxicity of
AF B1 to th e Recom bin a n t Yea sts. The engineered
P450s are constitutively expressed at the same level in
the AH22 S. cerevisiae. We tested whether the toxicity
of AFB1 reflects its metabolism to 8,9-epoxide in these
cells. In preliminary experiments, we found that the
viability of recombinant yeasts is decreased in the
presence of increasing concentrations of AFB1 and that
the viability was less for those cells expressing an enzyme
with a high AFB1 8,9-epoxide formation compared to
those with low activity. After the preliminary experi-
ments, we determined the LC50 values for the yeasts:
LC50 being defined as the concentration of AFB1 where
the number of colonies is 50% from that without AFB1
in the incubation mixture.
Table 1 shows the relationship between the biochemi-
cal parameters and the LC50. As could be expected, the
yeasts expressing an enzyme with a high Vmax and a low
KM toward AFB1 like Phe209Asn and Phe209Gly were
the most sensitive to the toxic effects. Their LC50 had
decreased 10 times. On the other hand, the survival of
yeasts harboring an enzyme with increased Vmax and KM
for AFB1, such as Phe209Leu or Phe209Val, did not differ
much from the survival of the wild type. LC50 of
Phe209Val was 72% and Phe209Leu 2-fold compared to
the value of wild type. These results show that for the
metabolism dependent toxicity of AFB1 both the KM and
the Vmax of the metabolizing enzyme are important.
as the Phe209Asn is much more efficient than the wild
type in the metabolism of AFB1.
As epoxidation is only one metabolic pathway of AFB1,
its oxidation to other known metabolites by wild type
P450 2A5 and some of its mutants was determined. No
AFQ1 was formed by any of the enzymes. Neither could
we detect AFP1 formation reliably. Some samples seem
to give trace amounts, but quantitation was not possible
due to cochromatography with degradation products of
AFB1. AFM1 was formed by all the enzymes but only
about 1/1000 the amount of the 8,9-epoxide. Interest-
ingly, the replacement of Phe209 residue with Asn, Val,
or Ala did not increase the formation of AFM1 as in case
of 8,9-epoxide (Table 2.). These results demonstrated
that 8,9-epoxide is the main oxidation product of AFB1
formed by P450 2A5 and its 209 mutants.
Earlier studies with coumarin have shown that amino
acid residue 365 is also critical for substrate specificity
of P450 2A5 (16, 23). We therefore studied the role of
this residue in the AFB1 epoxidation by mutating me-
thionine 365 to phenylalanine, isoleucine, and lysine
(Table 3). The mutations Met365Phe and Met365Ile
increased the epoxidation rate of AFB1 slightly at the 50
µM substrate concentration (Table 3) whereas Met365Lys
decreased the activity to 5% from the wild type level. We
therefore conclude that the epoxidation of AFB1 by P450
2A5 may also be dependent on amino acid residue 365.
The level of binding of AFB1 to the yeast DNA seems
to correlate well with toxicity, because the most sensitive
cells have clearly the highest levels of AFB1 DNA adducts

88 Chem. Res. Toxicol., Vol. 10, No. 1, 1997
Ta ble 3. Effect of Resid u e 365 of P 450 2A5 on Ep oxid a tion a n d Toxicity of AF B1
Pelkonen et al.
a
Part A
Part B
8,9-epoxide formation with 50 µM
AFB1 [nmol/(nmol of P450‚min)]
LC50 of yeast
cells (µM)
AFB1-DNA adduct
(pmol/mg of DNA)
type of P450 2A5
Met365 (wild)
Met365Ile
Met365Lys
Met365Phe
15 ( 3 (15)
21 ( 10 (4)
0.8 ( 0.4 (4)
19 ( 8 (4)
0.4 ( 0.2 (3)
0.24 ( 0.05 (3)
38 ( 11 (3)
77 ( 14 (5)
320 ( 100 (4)
3 ( 1 (4)
0.8 ( 0.2 (3)
39 ( 18 (4)
a
In Part A, epoxidation at 50 µM concentration was measured with purified mutants of P450 2A5 in the same reconstituted conditions
as in Table 1. In Part B, AH22 yeast cells were transformed with mutant P450 2A5 cDNAs, and then exposed to various AFB1 concentrations,
and LC50 values were calculated. DNA adduct formation was measured at 0.2 µM AFB1 concentration. Values in parentheses show the
number of experiments.
F igu r e 3. Inhibition of AFB1 toxicity on P450 2A5 expressing
F igu r e 4. Effect of pH of incubation medium on rescue
yeast cells. P450 2A5 expressing cells were incubated in yeast
concentration of amino group containing compounds. P450 2A5
culture medium containing 3.2 µM AFB1 with increasing meth-
expressing yeast cells were incubated in nonbuffered (pH 5.5,
open symbols) or phosphate buffered (pH 7.0, closed symbols)
yeast culture medium containing 3.2 µM aflatoxin B1 concentra-
tion with increasing pilocarpine (O, b), bispilocarpine (4 ,2),
oxsalen (O), metyrapone (*), 7-methylcoumarin (1), coumarin
(9), AFB2 (+), and testosterone (×) concentrations, and their
viability was compared with the samples containing AFB1 or
without inhibitor.
coumarin (0, 9), and coumarin 311 (3, 1) concentrations, and
their viability was compared to the samples having aflatoxin
B1 or the compound in the indicated medium.
(Table 1) at low (0.2 µM) AFB1 concentration. It is
interesting to note that the mutant Phe209Val, with one
50%. In addition, AFB2, which lacks the double bond at
the 8,9-position and cannot therefore be directly con-
verted to the epoxide, does not inhibit the toxicity of
AFB1.
The increase in viablity of the yeast cells by pilo-
carpine, bispilocarpine, and coumarin 311 was dependent
on pH of the culture medium (Figure 2). They result in
only a weak increase in viability at pH 5.5 but at pH 7.0
were markedly more effective. However, with coumarin
the viability was increased similarly at both pHs.
of the highest Vmax values but increased KM value for
AFB1, has almost the same DNA adduct levels as the wild
type at low AFB1 concentration, and further DNA adduct
levels of Phe209Leu with 3.5-fold increased KM value are
only 23%. These results suggest that the KM of the
metabolizing enzyme is essential in determining the
genotoxicity of AFB1 at varying concentrations.
The relationship of metabolism, toxicity, and DNA
binding was further demonstrated by mutations at site
365: a loss of metabolism by Met365Lys mutation
paralleled with a dramatic increase in the LC50 and loss
of DNA binding (Table 3).
Discu ssion
In h ibition of AFB1 Toxicity in Recom bin an t Yeast
Cells b y Su b st r a t es a n d In h ib it or s of P 450 2A5.
Several compounds have been found to inhibit coumarin
7-hydroxylation in vivo and in vitro. This reaction is
catalyzed by P450 2A5, and therefore we tested whether
or not the inhibitors affect AFB1 metabolism in the same
way as coumarin 7-hydroxylation. To achieve this, the
viability of yeast expressing wild type P450 2A5 was
followed in the presence of AFB1 with increasing concen-
tration of inhibitors of P450 2A5 (24-26). The most
potent inhibitor of toxicity was methoxsalen which
increased the viability by 50% at a concentration of 0.4
µM (Figure 1). This was followed by metyrapone at 1.5
µM, by 7-methylcoumarin at 3 µM, by pilocarpine at 6
µM, by coumarin 311 at 7.5 µM, and by coumarin and
bispilocarpine at 15 µM concentration (Figures 3 and 4).
With testosterone, a poor substrate of P450 2A5, even a
concentration of 250 µM did not increase the viability by
In this paper we show that amino acid residues 209
and 365 play an important role in the interaction of AFB1
with P450 2A5. We also show that changing amino acids
at these sites may change the KM and Vmax of AFB1
metabolism to the 8,9-epoxide and that these changes
affect on the toxicity of AFB1 to the recombinant yeasts
expressing the enzymes as well as with the binding of
AFB1 to the yeast DNA. This suggests that minimal
changes in primary structure of P450 enzymes metabo-
lizing AFB1 may have dramatic effects on the metabolism
and toxicity of AFB1
Cytochromes P450 can metabolize AFB1 to both the
AFB1 exo- and endo-8,9-epoxides (27, 28). Although
mouse liver microsomes have been reported to only yield
the exo-epoxide,2 we cannot rule out the possibility that
part of the epoxidation measured in some of the mutants
is in the endo form. Nevertheless, it seems unlikely, even

Interaction of Aflatoxin B1 with P450 2A5
Chem. Res. Toxicol., Vol. 10, No. 1, 1997 89
if the latter form is produced by P450 2A5, that there
are differences in the relative production of the two forms
by the different mutant enzymes. This is because only
the exo-epoxide binds efficiently to DNA (27), and we
observed a good correlation between measured epoxide
formation and both toxicity and DNA adduct levels in
the different recombinant yeasts.
another critical residue for coumarin and testosterone
specificity in the P450 2A4 and 2A5 model (16). Mutation
of methionine 365 to a positively charged lysine residue
strongly decreased AFB1 epoxidation, toxicity, and DNA
binding, while mutations to isoleucine or phenylalanine
did not have much effect on the epoxidation or toxicity.
The increase in DNA binding with the Met365Ile mutant
despite a lack of increase in epoxidation or toxicity is
difficult to explain. One possibility is that the DNA
adduct experiments were performed at low substrate
concentrations (0.2 µM) compared to the metabolism
studies (50 µM), and this mutation may yield a high
affinity enzyme at low substrate concentrations. This is
consistent with the 2-fold decrease in LC50 compared to
wild type. As isoleucine, phenylalanine, and methionine
are all hydrophobic and therefore chemically similar, it
was expected that these mutants would not have much
difference in the reaction. However, lysine is basic, thus
differing greatly from methionine, and as predicted this
changes AFB1 epoxidation to a greater extent, as this
residue is in a critical position for the reaction. Spectral
properties of 365 mutants of P450 2A5 indicate that this
residue resides close to the 6th axial position of heme
(23). In the crystallized P450 101 model, this residue
exists at the other end of the substrate binding pocket.
Although it is known that mutations in amino acid
residues of this region in P450 2D1, P450 17, and P450
2C are critical for catalysis of bufuralol, steroids, and
warfarin oxidations, respectively (32-34), more research
is needed to determine how residue 365 is involved in
the reaction.
At present, the substrate specificity of mammalian
P450 enzymes is difficult to predict as only bacterial P450
enzymes have been crystallized and models based on
systematic testing of structure activity relationships are
few. Pelkonen’s group has tested about 90 compounds
for their interaction with P450 2A5 (25). Based on the
results, we choose nine compounds having various af-
finities for P450 2A5 to see how they affect the toxicity
of AFB1 for the recombinant yeasts. It appeared that
compounds with the highest affinities for P450 2A5
inhibit AFB1 toxicity most efficiently although there were
exceptions to the correlation. The discrepancy may due
to the fact that diffusion of inhibitors through the yeast
membrane is variable and independent of their affinity
for P450 2A5. The significance of diffusion is clearly
illustrated by basic compounds pilocarpine, bispilo-
carpine, and coumarin 311, which are more charged in
lower pH: they all had weaker effects on AFB1 toxicity
at pH 5.5 than at pH 7.0. It is likely that at higher pH
the compounds penetrate the cell easier and high con-
centrations are reached inside the cells leading to ef-
ficient inhibition. This hypothesis was supported by the
results with coumarin, the charge of which is unaffected
by pH, which caused a similar increase in viability at
both pHs.
Residues 209 and 365 have previously been shown to
be important for the metabolism of coumarin, by P450
2A5 (16, 17). We therefore tested whether manipulation
of these two sites would have similar effects on the
metabolic parameters of coumarin and AFB1. It appears
that AFB1 8,9-epoxide formation is strongly dependent
on the amino acid residue at position 209, as demon-
strated by the fact that the reaction rate was increased
when the size of this residue was decreased and when
wild type Phe209 was changed to negatively charged
aspartic acid. Interestingly, these results contrast with
the results obtained with coumarin as its 7-hydroxylation
is decreased both with smaller and with charged residues
in position 209 (17). However, the results are similar to
those obtained with steroids as steroid hydroxylation is
also increased when Phe209 is replaced with smaller
amino acids like leucine, valine, or asparagine (16, 19).
In terms of enzyme kinetics, KM of coumarin is inversely
correlated with the size of residue 209 (17) while that of
AFB1 seems to be less dependent on this parameter. A
possible explanation for the differential effects of various
amino acid residues at position 209 on coumarin, afla-
toxin B1, and steroid oxidation could be that the size of
the substrate binding pocket of P450 2A5 limits the
binding of larger substrates like steroids and AFB1 while
the steric restrictions could strengthen the binding of the
smaller coumarin molecule.
When Lindberg and Negishi (1989; 16) initially pre-
sented evidence that residue 209 of P450 2A4 and 2A5
influences substrate specificity, the mechanism was
unclear because mutation of phenylalanine 209 to leucine
in P450 2A5 conferred a high testosterone 15R-hydroxyl-
ase activity and because this residue was localized, by
alignment studies, to a helix on the surface part of the
enzyme, not a site directly interacting with either the
heme or the substrate (29, 30). Later additional evidence
showed that residue 209 exists near the putative sixth
ligand of P450 heme and it is in fact involved with the
substrate binding (17, 19). In 1992 Gotoh (31) presented
a new and improved alignment study taking into account
not only primary structures but also a secondary struc-
ture prediction and hydropathy indices and doing the
alignment only with the P450 2 family. He identified
six substrate recognition sites for P450 2 enzymes based
on residues of crystallized bacterial P450 101 (P450cam)
interacting with the substrate. Residue 209 was localized
to substrate recognition site 2 existing in interhelical
region of helixes F and G, which exists in the middle of
the active center in the crystallized P450 101 model. This
region is important for entering and binding of substrate
in P450 101. In P450 2A4, the 11â-hydroxy position of
corticosterone is oriented toward phenylalanine 209 (15),
and the 11 position is in the middle part of the molecule.
Therefore, the importance of residue 209 is due to its
localization in the middle of the substrate binding pocket
a site for which there are several examples of a strong
effect on the interaction between the substrate and the
enzyme.
The recombinant yeasts described in this paper give
an opportunity to compare the role of individual P450
enzymes in AFB1 metabolism and relate the metabolic
parameters to toxicity. Several other P450 enzymes in
addition to the P450 2A5 have been shown to metabolize
AFB1. These include human P450 1A2, 2A6, 2B7, 3A3,
and 3A4 (6, 10, 28).
The recombinant yeast system is valuable in trying to
evaluate the contribution of the different P450 enzymes
in AFB1 related carcinogenesis. In addition, the recom-
binant yeasts allow testing of inhibitors of AFB1 metabo-
Amino acid residue 365 of P450 2A5 belongs to
substrate recognition site 5 in Gotoh’s model and is

90 Chem. Res. Toxicol., Vol. 10, No. 1, 1997
Pelkonen et al.
(16) Lindberg, R. L. P. and Negishi, M. (1989) Alteration of mouse
cytochrome P450coh substrate specificity by mutation of a single
amino-acid residue. Nature 339, 632-634.
lism for their potential usefulness in the prevention of
AFB1 toxicity.
(17) J uvonen, R. O., Iwasaki, M. and Negishi, M. (1991) Structural
function of residue-209 in coumarin 7-hydroxylase (P450coh):
enzyme kinetic studies and site-directed mutagenesis. J . Biol.
Chem. 266, 16431-16435.
(18) Oeda, K., Sakaki, T. and Ohkawa, H. (1985) Expression of rat
liver cytochrome P-450MC cDNA in Saccharomyces cerevisiae.
DNA 4, 203-210.
(19) Iwasaki, M., J uvonen, R., Lindberg, R. and Negishi, M. (1991)
Alteration of high and low spin equilibrium by a single mutation
of amino acid 209 in mouse cytohrome P450. J . Biol. Chem. 266,
3380-3382.
Ack n ow led gm en t. P.P. was financially supported by
the Foundations of Helena Vuorenmies, Saastamoinen,
and Finnish Drug Research. The authors thank B.
Chapot, I. Chemin, and J .-C. Be´re´ziat for excellent
technical assistance. C.P.W. gratefully acknowledges the
support of NIEHS Grant 01ES06052.
Refer en ces
(20) Kirby, G. M., Wolf, C. R., Neal, G. E., J udah, D. J ., Henderson,
C. J ., Chutimataewin, S. and Wild, C. P. (1993) In vitro metabo-
lism of aflatoxin B1 by normal and tumorous liver tissue from
Thailand. Carcinogenesis 12, 2613-2620.
(21) Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman,
J . G., Smith, J . A. and Struhl, K. (1990) Saccharomyces Cerevi-
siae. In Current Protocols in Molecular Biology 2 Suppl. 12, Vol
2, pp 13.03-13.13.7, J ohn Wiley & Sons, New York.
(22) Hollstein, M., Wild, C. P., Bleicher, F., Chutinata-Ewin, S., Harris,
C. C., Srivatanakul, P. and Montesano, R. (1993) p53 Mutations
and aflatoxin B1 exposure in hepatocellular carcinoma patients
from Thailand. Int. J . Cancer 53, 51-55.
(23) J uvonen, R. O., Iwasaki, M. and Negishi, M. (1994) Function of
residue-365 in mouse P4502A5 (P450coh): site directed mutagen-
esis, spectral and enzymatic properties. Cytochrome P450. 8th
International Conference (Lechner, M. C., Ed.) pp 801-803, J ohn
Libbey Eurotext, Paris.
(24) Kimonen, T., J uvonen, R. O., Alhava, E. and Pasanen, M. (1995)
The inhibition of P450 enzymes in mouse and human liver by
pilocarpine. Br. J . Pharmcol. 114, 832-836.
(25) Ma¨enpa¨a¨, J ., Sigusch, H., Raunio, H., Syngelma¨, T., Vuorela, P.,
Vuorela, H. and Pelkonen, O. (1993) Differential inhibition of
coumarin 7-hydroxylase activity in mouse and human liver
microsomes. Biochem. Pharmacol. 45, 1035-1042.
(26) J uvonen, R. O. and Niemitz, M. (1993) Hydroxylation of 7-me-
thylcoumarin in vitro in the liver microsomes of DBA/2N mouse.
Pharmacol. Toxixol. 73, Suppl. II, 66.
(27) Iyer, R., Coles, B., Raney, K. D., Thier, R., Guengerich, F. P. and
Harris, T. M. (1994) DNA adduction by the potent carcinogen
aflatoxin B1: mechanistic studies. J . Am. Chem. Soc. 116, 1603-
1609.
(28) Ueng, Y.-F., Shimada, T., Yamazaki, H. and Guengerich, F. P.
(1995) Oxidation of aflatoxin B1 by bacterial recombinant human
cytochrome P450 enzymes. Chem. Res. Toxicol. 8, 218-225.
(29) Nelson, D. R. and Strobel, H. W. (1989) Secondary structure
prediction of 52 membrane-bound cytochromes P450 shows a
strong structural similarity to P450cam. Biochemistry 28, 656-
660.
(1) Garner, R. C. (1973) Chemical evidence for the formation of a
reactive aflatoxin B1 metabolite, by hamster liver microsomes.
FEBS Lett. 32, 261-264.
(2) Campbell, T. C., and Hayes, J . R. (1976) The role of aflatoxin
metabolism in its toxic lesion. Toxicol. Appl. Pharmacol. 35, 199-
222.
(3) Swenson, D. H., Lin, J .-K., Miller, E. C. and Miller, J . A. (1977)
Aflatoxin B1-2,3-oxide as a probable intermediate in the covalent
binding of aflatoxins B1 and B2 to rat liver DNA and ribosomal
RNA in vivo. Cancer Res. 37, 172-181.
(4) Shimada, T. and Guengerich, F. P. (1989) Evidence for cytochrome
P-450NF, the nifedipine oxidase, being the principal enzyme
involved in the bioactivation of aflatoxins in human liver. Proc.
Natl. Acad. Sci. U.S.A. 86, 462-465.
(5) Forrester, L. M., Neal, G. E., J udah, D. J ., Glancey, M. J . and
Wolf, C. R. (1990) Evidence for involvement of multiple forms of
cytochrome P-450 in aflatoxin B1 metabolism in human liver.
Proc. Natl. Acad. Sci. U.S.A. 87, 8306-8310.
(6) Aoyama, T., Yamano, S., Guzelian, P. S., Gelboin, H. V. and
Gonzalez, F. J . (1990) Five of 12 forms of vaccinia virus-expressed
human hepatic cytochrome P450 metabolically activate afaltoxin
B1. Proc. Natl. Acad. Sci. U.S.A. 87, 4790-4793.
(7) Pelkonen, P., Kirby, G. M., Wild, C. P., Bartsch, H. and Lang, M.
A. (1994) Metabolism of nitrosamines and aflatoxin B1 by hamster
liver P4502A enzymes. Chem.-Biol. Interact. 93, 41-50.
(8) Pelkonen, P., Lang, M. A., Wild, C. P., Negishi, M. and J uvonen,
R. O. (1994) Activation of aflatoxin B1 by mouse P4502A enzymes
and cytotoxicity in recombinant yeast cells. Eur. J . Pharmacol.,
Environ. Toxicol. Pharmacol. Sect. 292, 67-73.
(9) Doehmer, J ., Dogra, S., Firedber, T., Monier, S., Adesnik, M.,
Glatt, H. and Oesch, F. (1988) Stable expression of rat cytochrome
P-450IIB1 cDNA inchinese hamster cells (V79) land metabolic
activation of aflatoxin B1. Proc. Natl. Acad. Sci. U.S.A. 85, 5769-
5773.
(10) Crespi, C., Penman, B. W., Steimel, D. T., Gelboin, H. V. and
Gonzalez, F. J . (1990) The development of a human cell line stably
expressing human CYP3A4: role in the metabollic activation of
aflatoxin B1 and comparison to CYP1A2 and CYP2A3. Carcino-
genesis 12, 335-359.
(11) Yanagimoto, T., Itoh, S., Sawada, M., Hashimoto, H. and Ka-
mataki, T. (1994) Molecular cloning and functional expression of
a mouse cytochrome P-450 (P4503a-13): examination of P4503a-
13 enzyme to activate aflatoxin B1 (AFB1). Biochim. Biophys. Acta
1201, 405-410.
(12) Burkhart, B. A., Harada, N. and Negishi, M. (1985) Sexual
dimorphism of testosterone 15a-hydroxylase mRNA levels in
mouse liver: cDNA cloning and regulation. J . Biol. Chem. 260,
15357-15361.
(30) Poulos, T. L. (1989) Reversing enzyme specificity. Nature 339,
580-581.
(31) Gotoh, O. (1992) Substrate recognition sites in cytochrome P450
family 2 (P4502) proteins inferred from comparative analyses of
amino acid and coding nucleotide sequences. J . Biol. Chem. 267,
83-90.
(32) Kitamura, M., Buczko, E. and Dufau, M. L. (1991) Dissociation
of hydroxylase and lyase activities by site directed mutagenesis
of the rat P45017a. Mol. Endocrinol. 5, 1373-1380.
(13) Lindberg, R., Burkhart, B., Ichikawa, T. and Negishi, M. (1989)
The structure and characterization of type I P-45015a gene as a
major steroid 15a-hydroxylase and its comparison with type II
P-45015a gene. J . Biol. Chem. 264, 6465-6471.
(14) Negishi, M., Lindberg, R., Burkhart, B., Ichikawa, T., Honkakoski,
P. and Lang, M. A. (1989) Mouse steroid 15a-hydroxylase gene
family: identification of Type II P45015a as a coumarin 7-hydroxyl-
ase. Biochemistry 28, 4169-4172.
(15) Iwasaki, M., Lindberg, R. L. P., J uvonen, R. O. and Negishi, M.
(1993) Site-directed mutagenesis of mouse steroid 7a-hydroxylase
(cytochrome P-4507a): role of residue-209 in determining steroid-
cytochrome P-450 interaction. Biochem. J . 291, 569-573.
(33) Matsunaga, E., Zeugin, T., Zanger, U. M., Aoyama, T., Meyer, U.
A. and Gonzalez, F. J . (1990) Sequenze requirements for cyto-
chrome P-450IID1 catalytic activity: a single amino acid change
(Ile380Phe) specifically decreases Vmax of the enzyme for bufuralol
but not debrisoquine hydroxylation. J . Biol. Chem. 265, 17197-
17201.
(34) Kaminsky, L. S., de Morais, S. M. F., Faletto, M. B., Dunbar, D.
A. and Goldstein, J . A. (1993) Correlation of human cytochrome
P4502C substrate specificities with primary structure: warfarin
as a probe. Mol. Pharmacol. 43, 234-239.
TX960078M