Synthesis and biological evaluation of 2-heteroarylthioalkanoic acid analogues of clofibric acid as peroxisome proliferator-activated receptor α agonists

Article abstract of DOI:10.1021/jm900878u

Aseries of 2-heteroarylthioalkanoic acids were synthesized through systematic structural modifications of clofibric acid and evaluated for human peroxisome proliferator-activated receptor α (PPARα) transactivation activity, with the aim of obtaining new hypolipidemic compounds. Some thiophene and benzothiazole derivatives showing a good activation of the receptor α were screened for activity against the PPARγ isoform. The gene induction of selected compounds was also investigated in the human hepatoma cell line. 2009 American Chemical Society.

Full text of DOI:10.1021/jm900878u

6224 J. Med. Chem. 2009, 52, 6224–6232
DOI: 10.1021/jm900878u
Synthesis and Biological Evaluation of 2-Heteroarylthioalkanoic Acid Analogues of Clofibric Acid as
Peroxisome Proliferator-Activated Receptor r Agonists
Letizia Giampietro,† Alessandra Ammazzalorso,† Antonella Giancristofaro,† Fabio Lannutti,† Giancarlo Bettoni,†
Barbara De Filippis,† Marialuigia Fantacuzzi,† Cristina Maccallini,† Michele Petruzzelli,‡,§ Annalisa Morgano,
Antonio Moschetta,‡,§ and Rosa Amoroso*,†
†
‡
Dipartimento di Scienze del Farmaco, Universita degli Studi “G. d’Annunzio”, Chieti, Italy, Dipartimento di Farmacologia Traslazionale,
ꢀ
Consorzio Mario Negri Sud, Santa Maria Imbaro (CH), Italy, §Dipartimento di Medicina Interna e Medicina Pubblica,
ꢀ
Clinica Medica ‘‘A. Murri”, Universita di Bari, Bari, Italy, and Unita di Patologia Molecolare e Genomica,
Centro Scienze dell’Invecchiamento (CeSI), Fondazione Universita “G. d’Annunzio”, Chieti, Italy
ꢀ
ꢀ
Received May 30, 2009
A series of 2-heteroarylthioalkanoic acids were synthesized through systematic structural modifications
of clofibric acid and evaluated for human peroxisome proliferator-activated receptor R (PPARR)
transactivation activity, with the aim of obtaining new hypolipidemic compounds. Some thiophene and
benzothiazole derivatives showing a good activation of the receptor R were screened for activity against
the PPARγ isoform. The gene induction of selected compounds was also investigated in the human
hepatoma cell line.
Introduction
and necessitate use of high micromolar concentrations to
activate human PPARR (30-55 μM). Recent advances in
nuclear receptor ligand discovery have led to the identification
of a second generation PPARR agonists with affinities for
activation in the nanomolar range compared to the micro-
molar range for the fibrates. Examples are the ureido-based
fibric acid GW76478 (1), the phenylpropanoic acid derivative
KCL19980010799 (2), the fibrate LY51867410 (3), the 2,3-
dihydrobenzofuran-2-carboxylic acids11 4, which are con-
strained analogues of fibric acid, the indaneureidothioisobu-
The nuclear peroxisome proliferator-activated receptors
(PPARsa) are ligand-dependent transcription factors belong-
ing tothenuclear receptor superfamily.1 Upon ligand binding,
PPARs heterodimerize with the retinoid X receptor (RXR)
and regulate target gene transcription at specific consensus
DNA sequences, the peroxisome proliferator response ele-
ments (PPRE).2 Three subtypes of PPARs (PPARR, PPARγ,
and PPARδ) have been identified to date. Their endogenous
ligands include fatty acids and eicosanoids.3 PPARR is pre-
dominantly expressed in liver, where it plays a critical role in
lipidhomeostasis by regulating fatty acidbinding, uptake, and
oxidation.4 It is also expressed in a variety of cell types,
including smooth muscle cells, endothelial cells, and macro-
phages, playing a pivotal role in processes such as athero-
sclerosis and inflammation.5
Several studies have analyzed the overall contribution of
PPARR to cardiovascular disease, and a large number of
synthetic activators with atheroprotective properties in hu-
mans have been described.6 Fibrates are the only marketed
PPARR agonists that are effective in lowering elevated serum
triglyceride levels and moderately raising high-density lipo-
proteins (HDL). Their chemical structures are characterized
by the presence of the 2-phenoxy-2-methylpropanoic moiety.
Fibrates have weak affinities to both rodent and human
cloned receptors, with extremely poor subtype selectivity,7
tyric acids12 5, and the 1,3-dioxane-2-carboxylic acids13
6
(Figure 1).
In this study, we aimed to optimize the PPARR binding
profile and the in vitro efficacy of classical fibrates by synthe-
sizing a series of new compounds derived from chemical
modifications of clofibric acid (7), the active metabolite of
clofibrate (Figure 2). The clofibric acid moiety was changed
by substituting the oxygen with sulfur, thus leading to thioalk-
anoic acids. A previous example of this modification is the
potent and selective PPARR agonist 1.8 Moreover, the phenyl
ring was replaced with the heterocyclic scaffolds thiophene,
pyridine, and benzothiazole, with different substitution pat-
terns. In some compounds a chiral center was introduced in
R-position to the carboxylic group. For reference compounds
in the pharmacological evaluations, we selected compounds
7 and 1. On the basis of in vitro PPARR transactivation assay
results, some compounds were also tested on PPARγ and
wereselected for the in vitro analysis of target gene expression.
*To whom correspondence should be addressed. Phone: þ39 0871
3554686. Fax: þ39 0871 3554911. E-mail: ramoroso@unich.it.
a Abbreviations: PPARs, peroxisome proliferator-activated recep-
tors; RXR, retinoid X receptor; PPRE, peroxisome proliferator re-
sponse elements; HDL, high-density lipoproteins; CPT1A, carnitine
palmitoyl transferase 1A; HepG2, human hepatocellular liver carcino-
ma cell line; RTqPCR, real-time quantitative polymerase chain reaction;
HEK293, human embryonic kidney 293 cell line; FBS-GOLD, fetal
bovine serum “GOLD”.
Chemistry
Compounds 8, 9a,b, and 12a-u (Table 1) were easily
obtained in good yields by standard esterification procedures
followed by hydrolysis. We have previously described the
synthesis of 8, 9a,b, and 12a,b, which were found to have
interesting antiplatelet properties.14 Esters 11c-uwere obtained
r
pubs.acs.org/jmc
Published on Web 09/30/2009
2009 American Chemical Society

Article
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 20 6225
Figure 1. Selective PPARR agonists.
Figure 2. Structural modifications of clofibric acid.
by SN2 reaction of 2-mercaptoheterocycles (10c-u) with proper
2-bromoesters, in the presence of sodium in absolute ethanol at
reflux. The basic hydrolysis by 1 N NaOH of 11c-u gave the
acids 12c-u. When not commercially available, substituted
2-mercaptobenzothiazoles were synthesized according to well
established procedures.15 The rac-12l and rac-12o acids were
also synthesized in enantiomerically pure form. In this case, we
started from optically active (R)- and (S)-2-bromoacids, ester-
ified with ethanol, toluene, and concentrated sulfuric acid in a
Dean-Stark apparatus to obtain the corresponding bromo-
esters, which were used for SN2 reaction with 2-mercaptohe-
terocycles 10l and 10o to give (R)- and (S)-11l and (R)- and (S)-
11o. Finally, the optically pure (R)- and (S)-12l and (R)- and
(S)-12o acids were obtained by hydrolysis with 6 N HCl
(Scheme 1).
were selected for the determination of their EC50 values.
Results are shown in Table 1. Compounds 8, with pyridine,
and 9a, with thiophene, were found inactive on PPARR, while
the introduction of a chlorine atom on the 5-position of
thiophene (9b) resulted in a significant activation of the
receptor (EC50 = 1.8 μM). In the series of (2-benzothiazo-
lyl)thioisobutanoic acids 12a-k, structural modifications
focused on substitution of the benzothiazolic ring. While
unsubstituted derivative 12a proved inactive, the overall effect
of the introduction of substituents in the 5 and 6 positions
improved PPARR agonistic activity except for 12e and 12i,
which were inactive. Of note, among these compounds was
12c, the 5-bromine derivative, which is characterized by an
EC50 value of 2.5 μM and is thus 10-20 times more effective
than other compounds of the same series. As reported in
previous works, chiral aryloxyacid analogues of clofibric acid
were found to exhibit antilipidemic and antiplatelet activity.
It has been clearly demonstrated that pharmacological and
toxic effects are influenced by chirality.17 Recent screening
tests of other chiral analogues of clofibric acid have indicated
that some are potent PPARR/γ agonists.18 On the basis of
these findings, we focused on introducing a chiral center in the
R-position of some of the above-described heterocyclic analo-
gues of clofibric acid (rac-12l-u, R3 = H) and the new
compounds were preliminarily tested in racemic form. The
monomethylated derivatives rac-12l-q did not show signifi-
cant changes of PPARR activity in comparison with dimethyl
Results and Discussion
With the aim of identifying new compounds able to activate
the PPARR receptor, 8, 9a,b, and rac-12a-u were evaluated
for human PPARR functional activity by a cell-based trans-
activation assay in eukaryotic cells,16 a powerful and widely
used method whose good correlation with in vivo activity is
generally accepted. First, we evaluated the activity of new
compounds at a concentration of 150 μM, with 7 (150 μM)
and 1 (1 μM) as reference compounds; results are expressed as
fold activation. Then the compounds with the best activity

6226 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 20
Giampietro et al.
Scheme 1a
a Reagents and conditions: (a) Na, absolute EtOH, reflux, N2; (b) 1N NaOH, room temp; (c) 6 N HCl, 60 °C for enantiomeric compounds.
Table 1. In Vitro Human PPARR Transactivation of Test and Refer-
ence Compounds
Table 2. In Vitro Human PPARR Transactivation of Racemic and
Optically Active 12l and 12o
compd
R1
R2
R3
R4
FAa
EC50 (μM)b
compd
R1
R2
R3
R4
FAa
EC50 (μM)b
8
9a
nac
rac-12l
(R)-12l
(S)-12l
rac-12o
(R)-12o
(S)-12o
7
Cl
Cl
H
H
H
H
H
H
H
H
H
H
H
H
Me
Me
Me
Me
Me
Me
3.4 ( 0.2
4.5 ( 0.8
2.6 ( 1.6
2.9 ( 0.2
2.3 ( 0.3
2.9 ( 0.3
1.6 ( 0.2
2.8 ( 0.5
62.5 ( 5.9
73.5 ( 6.8
55.9 ( 5.2
33.3 ( 4.5
57.3 ( 4.7
1.9 ( 0.1
nac
9b
12a
2.8 ( 0.2
nac
1.8 ( 0.1
Cl
H
Cl
H
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
H
Me
OMe
OMe
OMe
12b
12c
H
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
n-Pro
n-Pro
n-Hex
Ph
1.6 ( 0.1
4.5 ( 1.0
1.9 ( 0.6
nac
35.9 ( 2.7
2.5 ( 0.1
46.3 ( 3.6
Br
CN
CF3
OMe
H
H
12d
12e
H
55.0 ( 3.9
0.2 ( 0.02
H
1
a FA: fold activation. Compounds were tested at least three separate
experiments at 150 μM. Only 1 was tested at 1 μM. The results are
expressed with (SEM. b Compounds were tested in at least three
separate experiments in at five concentrations ranging from 1 to 150
μM. The results are expressed with (SEM.
12f
12g
H
2.0 ( 0.2
1.7 ( 0.1
2.6 ( 0.4
nac
45.8 ( 3.9
38.9 ( 2.5
45.8 ( 4.0
Cl
Br
CN
CF3
OEt
H
12h
12i
H
H
12j
12k
H
1.7 ( 0.2
3.3 ( 0.8
3.4 ( 0.2
3.2 ( 0.6
nac
36.1 ( 2.9
69.3 ( 5.4
62.5 ( 5.9
9.3 ( 0.9
H
Cl
rac-12l
rac -12m
rac -12n
rac -12o
rac -12p
rac -12q
rac -12r
rac -12s
rac -12t
rac -12u
7
Br
CN
OMe
H
H
H
H
H
H
H
2.9 ( 0.2
1.9 ( 0.9
2.6 ( 0.2
2.7 ( 0.6
4.7 ( 0.1
nac
33.3 ( 4.5
84.3 ( 6.4
9.8 ( 1.3
9.3 ( 0.9
14.8 ( 1.2
Br
OEt
H
H
H
Cl
H
H
H
Cl
OEt
H
H
H
Cl
H
H
1.6 ( 0.1
1.6 ( 0.2
2.8 ( 0.5
14.3 ( 1.2
55.0 ( 3.9
0.2 ( 0.02
Figure 3. Selectivity PPAR R/γ.
1
a FA: fold activation. Compounds were tested at least three separate
experiments at 150 μM. Only 1 was tested at 1 μM. The results are
expressed with (SEM. b Compounds were tested in at least three
separate experiments in at five concentrations ranging from 1 to 150
μM. The results are expressed with (SEM. c Not active.
Enantiomerically pure (R)- and (S)-12l and (R)- and (S)-12o
acids were synthesized and tested. Data in Table 2 confirm
the greater activity of (S)-isomers, in agreement with previous
studies.19 In particular, a clear stereopreference was found
with (S)-12o, which exhibited more potent transactiva-
tion activity (EC50 = 1.9 μM) than the antipodal (R)-isomer
(EC50 = 57.3 μM).
The fibrate analogues described in this work have, like the
most selective PPARR activators, an aromatic system con-
nected to an acidic headgroup. Although they are less potent
thanthe compoundswitha longhydrophobictail linked tothe
aromatic scaffold, better values of EC50 than the classical
fibrates were observed.
All compounds showing good activation of PPARR recep-
tor (EC50 < 10 μM) were preliminarily tested on PPARγ in
order to explore a possible selective activation of these recep-
tors. We performed the transactivation assay on both PPARR
and PPARγ isoforms, testing each compound at a concentra-
tion of PPARR EC50. By comparing fold activation values, we
observed the preferential activation of R-isoform for com-
pounds 9b, 12c, and (S)-12o (Figure 3). This evaluation is only
a qualitative overview; however, is noteworthy that best
selectivity profiles PPARR/γ were obtained for compounds
more active on PPARR (EC50 values within 3 μM).
derivatives. Among them, only rac-12m (R1 =Br) andrac-12q
(R2 = OEt) exhibited good values of EC50 (9.3 and 9.8 μM,
respectively). Further structural modifications were carried
out in the R-position to the carboxylic function in order to
investigate the influence of more hydrophobic and sterically
hindered groups on PPARR agonistic activity. Compounds
with a n-propylic chain (rac-12r,s) or a phenyl group (rac-12u)
demonstrated an increase in agonistic activity over their
R4-methyl-substituted analogues (12k and 12l), while the
further elongation of the substituent (n-hexylic chain,
rac-12t) caused loss of activity. The transactivation studies
reported in Table 1 show that the position, the size, and the
electronic effect of R1 and R2 groups on benzothiazolic ring
did not seem to correlate with activity. Indeed, there were no
remarkable differences when varying the position and dimen-
sions of substituentsand whenchangingelectron-withdrawing
with electron-donor groups. Also, the introduction of a chiral
center in R-position to the carboxylic moiety did not improve
the transactivation activity except when using n-propyl and
phenyl groups as substituents.
The gene carnitine palmitoyl transferase 1A (CPT1A) has
been previously shown to be induced in human hepatocytes
and hepatoma cells in response to PPARR agonists; the
investigation of CPT1A expression is a well established in
Considering the high degree of stereoselectivity generally
displayed by PPAR ligands,19 we were also interested in the
biological evaluation of some optically active derivatives.

Article
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 20 6227
General Procedure for the Preparation of Esters 11c-k and
rac-11l-u. The heterocyclic thiol (3.0 mmol) and ethyl 2-bro-
moalkanoate (3.0 mmol), both dissolved in absolute EtOH
(10 mL), were added to a solution of sodium (69.0 mg, 3.0 mmol)
in absolute EtOH (10 mL) under nitrogen atmosphere. After the
mixture was stirred for 2-5 h at reflux, the solvent was removed
under reduced pressure. The residue was poured into water
(20 mL) and extracted with diethyl ether (3 ꢀ 20 mL). The
organic layer was dried over Na2SO4 and concentrated under
reduced pressure. The residue was purified by column chroma-
tography on silica gel (eluent cyclohexane/ethyl acetate, 95:5).
Ethyl 2-[(5-Bromo-1,3-benzothiazol-2-yl)thio]-2-methylpro-
panoate (11c). Orange-yellow oil, 47% yield. IR (KBr) 1728
cm-1; 1H NMR (CDCl3) δ 1.21 (t, 3H, J = 7.2 Hz, CH3CH2),
1.75 (s, 6H, C(CH3)2), 4.20 (q, 2H, J = 7.2 Hz, CH2CH3),
7.41-7.45 (dd, 1H, J = 8.7 Hz, J = 2.1 Hz, CH Ar), 7.62 (d, 1H,
J = 8.7 Hz, CH Ar), 8.04 (d, 1H, J = 2.1 Hz, CH Ar); 13C NMR
(CDCl3) δ 14.2 (CH3CH2), 26.6 (C(CH3)2), 54.5 (C(CH3)2), 62.1
(CH2CH3), 119.9 (C Ar), 122.2, 125.3, and 128.1 (CH Ar), 135.0
and 154.6 (C Ar), 164.9 (dC-S), 173.3 (CdO). Anal.
(C12H14BrNO2S2) C, H, N.
Ethyl 2-[(5-Cyano-1,3-benzothiazol-2-yl)thio]-2-methylpro-
panoate (11d). Yellowish oil, 72% yield. IR (KBr) 2229, 1733
cm-1; 1H NMR (CDCl3) δ 1.22 (t, 3H, J = 7.2 Hz, CH3CH2),
1.78 (s, 6H, C(CH3)2), 4.21 (q, 2H, J = 7.2 Hz, CH2CH3),
7.53-7.56 (dd, 1H, J = 8.1 Hz, J = 1.5 Hz, CH Ar), 7.86 (d, 1H,
J = 8.1 Hz, CH Ar), 8.13 (d, 1H, J = 1.5 Hz, CH Ar); 13C NMR
(CDCl3) δ 14.3 (CH3CH2), 26.6 (C(CH3)2), 54.9 (C(CH3)2), 62.2
(CH2CH3), 110.0 (C Ar), 118.93 (CN), 122.2, 126.0, and 127.3
(CH Ar), 140.9 and 153.0 (C Ar), 166.9 (dC-S), 173.1 (CdO).
Anal. (C14H14N2O2S2) C, H, N.
Figure 4. CPT1A expression in HepG2 following treatment. Cells
were treated with vehicle (DMSO), 1, 7, 9b, 12c, and (S)-12o at
150 μM for 48 h. RTqPCR was performed to measure CPT1A
mRNA levels. Values shown represent the mean ( SEM of four
independent determinations performed in duplicate. Cyclophilin
was used as reference gene, and values were normalized to data
obtained from vehicle treated cells.
vitro model to study PPARR activation.20 On the basis of the
transactivation assay results, we selected 9b, 12c, and (S)-12o
for the in vitro analysis of CPT1Α expression in human
hepatocellular liver carcinoma cell line (HepG2) by using
real-time
quantitative
polymerase
chain
reaction
(RTqPCR). As shown in Figure 4, a pronounced increase of
gene expression of about 8-fold was detected when cells were
treated for 48 h with reference compound 1, while CPT1A
mRNA levels were doubled with control 7, according to the
fibrate activity.20 Treatment with 9b increased the expression
of gene by 2-fold, while compounds 12c and (S)-12o displayed
mRNA levels similar to control 7.
Ethyl 2-[(5-Trifluoromethyl-1,3-benzothiazol-2-yl)thio]-2-methyl-
propanoate (11e). Yellowish oil, 62% yield. IR (KBr) 1735 cm-1
;
1HNMR(CDCl3) δ1.21 (t, 3H, J=7.2Hz, CH3CH2), 1.78(s, 6H,
C(CH3)2), 4.21 (q, 2H, J = 7.2 Hz, CH2CH3), 7.56 (dd, 1H, J =
8.4 Hz, J = 1.8 Hz, CH Ar), 7.87 (d, 1H, J = 8.4 Hz, CH Ar), 8.13
(d, 1H, J = 1.8 Hz, CH Ar); 13C NMR (CDCl3) δ 14.2 (CH3CH2),
26.6 (C(CH3)2), 54.7 (C(CH3)2), 62.2 (CH2CH3), 119.4, 121.3, and
121.7 (CH Ar), 128.8 (CF3), 129.2, 139.1, 153.1, and 165.8 (C Ar),
173.2 (CdO). Anal. (C14H14F3NO2S2) C, H, N.
Conclusions
A new series of clofibric acid analogues was synthesized and
in vitro evaluated for human PPARR activity by transactiva-
tion assay. Overall, the potencies of some newly designed
agonists were slightly higher than those of typical fibrates,
such as clofibrate. The best findings were obtained with
compounds 9b, 12c, and (S)-12o, showing EC50 values within
3 μM. Selectivity experiments on the PPARγ isoform also
demonstrated their preferential activation of R-isoform. Also,
the effects of gene induction were investigated by the analysis
of CPT1Αexpression in the HepG2 cell line: compound 9b was
remarkably twice as effective as control 7, making it a prime
candidate as a new lead compound for the design of more
potent and selective PPARR agonist analogues of fibrates.
Ethyl 2-[(5-Methoxy-1,3-benzothiazol-2-yl)thio]-2-methylpro-
panoate (11f). Yellowish oil, 42% yield. IR (KBr) 1729 cm-1; 1H
NMR (CDCl3) δ 1.20 (t, 3H, J = 7.2 Hz, CH3CH2), 1.74 (s, 6H,
C(CH3)2), 3.87 (s, 3H, OCH3), 4.19 (q, 2H, J = 7.2 Hz,
CH2CH3), 6.97-7.01 (dd, 1H, J = 8.7 Hz, J = 2.7 Hz, CH
Ar), 7.42 (d, 1H, J = 2.7 Hz, CH Ar), 7.62 (d, 1H, J = 8.7 Hz,
CH Ar); 13C NMR (CDCl3) δ 14.2 (CH3CH2), 26.6 (C(CH3)2),
54.1 (C(CH3)2), 55.8 (OCH3), 62.0 (CH2CH3), 105.2, 115.4, and
126.4 (CH Ar), 128.5, 154.8, and 159.1 (C Ar), 163.0 (dC-S),
173.5 (CdO). Anal. (C14H17NO3S2) C, H, N.
Ethyl 2-[(6-Chloro-1,3-benzothiazol-2-yl)thio]-2-methylpro-
panoate (11g). Yellowish oil, 46% yield. IR (KBr) 1729 cm-1
;
Experimental Section
1H NMR (CDCl3) δ 1.19 (t, 3H, J = 7.2 Hz, CH3CH2), 1.74 (s,
6H, C(CH3)2), 4.19 (q, 2H, J = 7.2 Hz, CH2CH3), 7.38 (dd, 1H,
J = 9.0 Hz, J = 1.8 Hz, CH Ar), 7.75 (d, 1H, J = 1.8 Hz, CH
Ar), 7.80 (d, 1H, J = 9.0 Hz, CH Ar); 13C NMR (CDCl3) δ 14.2
(CH3CH2), 26.6 (C(CH3)2), 54.4 (C(CH3)2), 62.1 (CH2CH3),
120.8, 123.2, and 127.1 (CH Ar), 131.1, 137.6, 152.0, and 163.2
(C Ar), 173.3 (CdO). Anal. (C13H14ClNO2S2) C, H, N.
Chemistry. General. Melting points were determined on a
Buchi B-540 apparatus and are uncorrected. Infrared spectra
(IR) were recorded on a FT-IR 1600 Perkin-Elmer spectro-
meter. NMR spectra were run at 300 MHz on a Varian instru-
ment; chemical shifts (δ) are reported in ppm. Microanalyses
were carried out with an Eurovector Euro EA 3000 model
analyzer, and the analytical results were within 0.4% of the
theoretical values. Commercial reagents were used as received
from Aldrich or Fluka. The optically active acids (R)- and (S)-
12l and 12o had enantiomeric excesses (ee) greater than 98%
determined by using an HPLC device (Waters Association,
Milford, MA) equipped with a Chiralpack AD or AI chiral
column (25 cm ꢀ 4.6 mm) (Daicel Chemical Industries Ltd.,
Japan) connected to an UV detector (254 nm): mobile phase,
n-Hex/EtOH = 95/5 þ 0.05% TFA; flow rate, 1.0 mL/min.
Compounds 8, 9a,b, 11a,b, and 12a,b have been previously
described.14,15
Ethyl 2-[(6-Bromo-1,3-benzothiazol-2-yl)thio]-2-methylpro-
panoate (11h). Yellowish oil, 63% yield. IR (KBr) 1741 cm-1
;
1H NMR (CDCl3) δ 1.19 (t, 3H, J = 7.2 Hz, CH3CH2), 1.74 (s,
6H, C(CH3)2), 4.19 (q, 2H, J = 7.2 Hz, CH2CH3), 7.52 (dd, 1H,
J = 8.7 Hz, J = 2.1 Hz, CH Ar), 7.74 (d, 1H, J = 8.7 Hz, CH
Ar), 7.90 (d, 1H, J = 2.1 Hz, CH Ar); 13C NMR (CDCl3) δ 14.2
(CH3CH2), 26.6 (C(CH3)2), 54.4 (C(CH3)2), 62.1 (CH2CH3),
118.7 (C Ar),123.6, 123.7, and 129.8 (CH Ar), 138.0, 152.3, and
163.4 (C Ar), 173.3 (CdO). Anal. (C13H14BrNO2S2) C, H, N.
Ethyl 2-[(6-Cyano-1,3-benzothiazol-2-yl)thio]-2-methylpropanoate
(11i). White solid, 47% yield. IR (KBr) 2225, 1720 cm-1; mp

6228 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 20
Giampietro et al.
88-89 °C; 1H NMR (CDCl3) δ 1.19 (t, 3H, J = 7.2 Hz,
CH3CH2), 1.79 (s, 6H, C(CH3)2), 4.20 (q, 2H, J = 7.2 Hz,
CH2CH3), 7.66 (dd, 1H, J = 8.4 Hz, J = 1.5 Hz, CH Ar), 7.90
(CDCl3) δ 1.25 (t, 3H, J = 7.2 Hz, CH3CH2), 1.70 (d, 3H,
CH3CH), 4.22 (q, 2H, J = 7.2 Hz, CH2CH3), 4.66 (q, 1H, J =
7.2 Hz, CHCH3), 7.51 (dd, 1H, J = 8.4 Hz, J = 1.8 Hz, CH Ar),
7.70 (d, 1H, J = 8.4 Hz, CH Ar), 7.88 (d, 1H, J = 1.8Hz, CH Ar);
13C NMR (CDCl3) δ 14.3 (CH3CH2), 18.1 (CH3CH), 45.4 (CH),
62.1 (CH2CH3), 118.1 (C Ar), 123.0, 123.8, and 129.7 (CH Ar),
137.3, 152.1, and 165.4 (C Ar), 171.6 (CdO). Anal. (C12H12-
BrNO2S2) C, H, N.
(d, 1H, J = 8.4 Hz, CH Ar), 8.08 (d, 1H, J = 1.5 Hz, CH Ar); 13
C
NMR (CDCl3)
δ 14.2 (CH3CH2), 26.6 (C(CH3)2), 54.9
(C(CH3)2), 62.2 (CH2CH3), 108.1 (C Ar), 118.9 (CN), 122.7,
125.7, and 129.6 (CH Ar), 136.3, 155.7, and 169.0 (C Ar), 173.1
(CdO). Anal. (C14H14N2O2S2) C, H, N.
Ethyl 2-[(6-Trifluoromethyl-1,3-benzothiazol-2-yl)thio]-2-methyl-
propanoate (11j). Yellowish oil, 71% yield. IR (KBr) 1734 cm-1;1H
NMR (CDCl3) δ 1.20 (t, 3H, J = 7.2 Hz, CH3CH2), 1.78 (s, 6H,
C(CH3)2), 4.20 (q, 2H, J = 7.2 Hz, CH2CH3), 7.65 (dd, 1H, J =
8.4 Hz, J = 1.8 Hz, CH Ar), 7.94 (d, 1H, J = 8.4 Hz, CH Ar), 8.06
(d, 1H, J = 1.8 Hz, CH Ar); 13C NMR (CDCl3) δ 14.2 (CH3CH2),
26.6 (C(CH3)2), 54.7 (C(CH3)2), 62.2 (CH2CH3), 118.8, 122.5, and
123.3 (CH Ar), 126.1 (CF3), 127.2, 136.1, 155.8, and 167.0 (C Ar),
173.2 (CdO). Anal. (C14H14F3NO2S2) C, H, N.
Ethyl 2-[(6-Ethoxy-1,3-benzothiazol-2-yl)thio]propanoate [(rac)-
1
11q]. Yellowish oil, 47% yield. IR (KBr) 1734 cm-1; H NMR
(CDCl3) δ 1.24 (t, 3H, J = 7.2 Hz, CH3CH2O), 1.43 (t, 3H, J =
7.2 Hz, CH3CH2OAr), 1.68 (d, 3H, CH3CH), 4.05 (q, 2H, J =
7.2 Hz, OCH2CH3), 4.19 (m, 2H, ArOCH2CH3), 4.56 (q, 2H, J =
7.2 Hz, CHCH3), 7.00 (dd, 1H, J = 8.7 Hz, J = 2.4 Hz, CH Ar),
7.21 (d, 1H, J = 2.4 Hz, CH Ar), 7.75 (d, 1H, J = 8.7 Hz, CH Ar);
13C NMR (CDCl3) δ 14.3 (CH3CH2O), 15.0 (CH3CH2OAr), 18.1
(CH3CH), 45.5(CHCH3), 62.0 (OCH2CH3), 64.3(ArOCH2CH3),
104.8, 115.7, and 122.6 (CH Ar), 137.3, 147.8, 156.8, and 160.7
(C Ar), 171.9 (CdO). Anal. (C14H17NO3S2) C, H, N.
Ethyl
panoate (11k). Yellowish solid, 48% yield. IR (KBr) 1727 cm-1
2-[(6-Ethoxy-1,3-benzothiazol-2-yl)thio]-2-methylpro-
;
1
mp 77-78 °C; H NMR (CDCl3) δ 1.20 (t, 3H, J = 7.2 Hz,
CH3CH2O), 1.43 (t, 3H, J = 7.2 Hz, CH3CH2OAr), 1.70 (s, 6H,
C(CH3)2), 4.06 (q, 2H, J = 7.2 Hz, OCH2CH3), 4.18 (q, 2H, J =
7.2 Hz, ArOCH2CH3), 7.03 (dd, 1H, J = 8.7 Hz, J = 2.4 Hz, CH
Ar), 7.22 (d, 1H, J = 2.4Hz, CH Ar), 7.83 (d, 1H, J = 8.7 Hz, CH
Ar); 13C NMR (CDCl3) δ 14.2 (CH3CH2O), 15.0 (CH3CH2OAr),
26.5 (C(CH3)2), 54.1 (C(CH3)2), 62.0 (OCH2CH3), 64.3 (ArO-
CH2CH3), 104.3, 116.2, and 123.6 (CH Ar), 138.6, 148.1, 157.3,
and 158.0 (C Ar), 173.5 (CdO). Anal. (C15H19NO3S2) C, H, N.
Ethyl 2-[(5-Chloro-1,3-benzothiazol-2-yl)thio]propanoate [(rac)-
Ethyl 2-[(5-Chloro-1,3-benzothiazol-2-yl)thio]pentanoate[(rac)-
1
11r]. Colorless oil, 63% yield. IR (KBr) 1731 cm-1; H NMR
(CDCl3) δ 0.97 (t, 3H, J = 7.2 Hz, CH3CH2), 1.26 (t, 3H, J =
6.9 Hz, CH3CH2O), 1.45-1.53 (m, 2H, CH2CH3), 1.88-2.10 (m,
2H, CH2CH), 4.23 (dq, 2H, J = 7.2 Hz, OCH2CH3), 4.62 (t, 1H,
J = 7.2 Hz, CHCH2), 7.27 (dd, 1H, J = 8.7 Hz, J = 2.1 Hz,
CH Ar), 7.65 (d, 1H, J = 8.7 Hz, CH Ar), 7.83 (d, 1H, J = 2.1 Hz,
CH Ar); 13C NMR (CDCl3) δ 13.8 (CH3CH2), 14.3 (CH3CH2O),
20.5 (CH2CH3), 34.2 (CH2CH), 50.3 (CH), 61.9 (OCH2), 121.8
and 125.0 (CH Ar), 132.3, 133.9, 154.0, and 167.2 (C Ar), 171.4
(CdO). Anal. (C14H16ClNO2S2) C, H, N.
1
11l]. Yellowish oil, 76% yield. IR (KBr) 1735 cm-1; H NMR
(CDCl3) δ 1.27 (t, 3H, J = 7.2 Hz, CH3CH2), 1.72 (d, 3H, J =
7.5 Hz, CH3CH), 4.20 (q, 2H, J = 7.2 Hz, CH2CH3), 4.69 (q, 1H,
J = 7.5 Hz, CH3CH), 7.27-7.30 (dd, 1H, J = 8.4 Hz, J = 1.8 Hz,
CH Ar), 7.67 (d, 1H, J = 8.4 Hz, CH Ar), 7.84 (d, 1H, J = 1.8 Hz,
CH Ar); 13C NMR (CDCl3) δ 14.3 (CH3CH2), 18.1 (CH3CH),
45.4 (CH3CH), 62.1 (CH2CH3), 121.8, 121.9, and 125.1 (CH Ar),
132.4 (CCl), 133.9 and 154.0 (C Ar), 166.9 (dC-S), 171.7 (CdO).
Anal. (C12H12ClNO2S2) C, H, N.
Ethyl 2-[(5-Bromo-1,3-benzothiazol-2-yl)thio]propanoate [(rac)-
11m]. Yellowish oil, 67% yield. IR (KBr) 1732 cm-1; 1H NMR
(CDCl3) δ 1.27 (t, 3H, J = 6.9 Hz, CH3CH2), 1.71 (d, 3H, J =
7.2 Hz, CH3CH), 4.22 (q, 2H, J = 6.9 Hz, CH2CH3), 4.68 (q, 1H,
J = 7.2 Hz, CH3CH), 7.39-7.44 (dd, 1H, J = 8.7 Hz, J = 1.8 Hz,
CH Ar), 7.60 (d, 1H, J = 8.7 Hz, CH Ar), 8.00 (d, 1H, J = 1.8 Hz,
CH Ar); 13C NMR (CDCl3) δ 14.3 (CH3CH2), 18.1 (CH3CH),
45.4 (CH3CH), 62.1 (CH2CH3), 119.9 (CBr), 122.2, 124.8, and
127.7 (CH Ar), 134.5 and 145.1 (C Ar), 154.3 (dC-S), 171.6
(CdO). Anal. (C12H12BrNO2S2) C, H, N.
Ethyl 2-[(6-Ethoxy-1,3-benzothiazol-2-yl)thio]pentanoate [(rac)-
1
11s]. Yellowish oil, 54% yield. IR (KBr) 1732 cm-1; H NMR
(CDCl3) δ 0.96 (t, 3H, J = 7.2Hz, CH3CH2CH2), 1.24 (t, 3H, J =
6.9 Hz, CH3CH2O), 1.43 (t, 3H, J = 6.9 Hz, CH3CH2OAr),
1.46-1.57 (m, 2H, CH3CH2CH2), 1.86-1.98 (m, 2H, CH3CH2-
CH2), 4.05 (q, 2H, J = 6.9 Hz, OCH2CH3), 4.20 (dq, 2H,
ArOCH2CH3), 4.49 (t, 1H, J = 7.2 Hz, CHCH2), 7.00 (dd, 1H,
J = 9.0 Hz, J = 2.4 Hz, CH Ar), 7.21 (d, 1H, J = 2.4 Hz, CH Ar),
7.74 (d, 1H, J = 9.0 Hz, CH Ar); 13C NMR (CDCl3) δ 13.8
(CH3CH2CH2), 14.3 (CH3CH2O), 15.0 (CH3CH2OAr), 20.6
(CH2CH2CH3), 34.3 (CH2CH2CH3), 50.5 (CHCH2), 61.8
(OCH2CH3), 64.3 (ArOCH2CH3), 104.8, 115.7, and 122.6
(CH Ar), 137.3, 147.7, 156.8, and 161.0 (C Ar), 171.7 (CdO).
Anal. (C16H21NO3S2) C, H, N.
Ethyl 2-[(5-Chloro-1,3-benzothiazol-2-yl)thio]octanoate [(rac)-
1
11t]. Yellowish oil, 55% yield. IR (KBr) 1732 cm-1; H NMR
(CDCl3) δ 0.87 (t, 3H, J = 7.2 Hz, CH3CH2), 1.26 (t, 3H, J =
7.2 Hz, CH3CH2O), 1.28-1.50 (m, 8H, CH2), 1.94-2.06 (m, 2H,
CH2), 4.22 and 4.23 (dq, 2H, J = 7.2 Hz, OCH2CH3), 4.60 (t, 1H,
J = 7.2 Hz, CHS), 7.27 (dd, 1H, J = 8.7 Hz, J = 2.1 Hz, CH Ar),
7.65(d, 1H, J = 8.7 Hz, CH Ar), 7.83 (d, 1H, J = 2.1 Hz, CH Ar);
13C NMR (CDCl3) δ 14.2 (CH3CH2), 14.4 (CH3CH2O), 22.7,
27.1, 28.9, 31.7, and 32.2 (CH2), 50.5 (CH), 62.0 (OCH2), 121.8,
121.9, and 125.0 (CH Ar), 132.3, 133.9, 154.0, and 167.2 (C Ar),
171.4 (CdO). Anal. (C17H22ClNO2S2) C, H, N.
Ethyl 2-[(5-Cyano-1,3-benzothiazol-2-yl)thio]propanoate [(rac)-
1
11n]. Yellowish oil, 78% yield. IR (KBr) 2234, 1732 cm-1; H
NMR (CDCl3) δ 1.28 (t, 3H, J = 6.9 Hz, CH3CH2), 1.72 (d, 3H,
J = 7.2 Hz, CH3CH), 4.25 (q, 2H, J = 6.9 Hz, CH2CH3), 4.73 (q,
1H, J = 7.2 Hz, CH3CH), 7.52-7.56 (dd, 1H, J = 8.4 Hz, J =
1.8 Hz, CH Ar), 7.85 (d, 1H, J = 8.4 Hz, CH Ar), 8,11(d, 1H, J =
1.8 Hz, CH Ar); 13C NMR (CDCl3) δ 14.3 (CH3CH2), 18.1
(CH3CH), 45.5 (CH3CH), 62.2 (CH2CH3), 110.0 (CCN), 118.9
(CN), 122.3, 125.6, and 127.1 (CH Ar), 140.7 and 152.8 (C Ar),
168.3 (dC-S), 171.4 (CdO). Anal. (C13H12N2O2S2) C, H, N.
Ethyl 2-[(5-Methoxy-1,3-benzothiazol-2-yl)thio]propanoate [(rac)-
11o]. White oil, 60% yield. IR (KBr) 1732 cm-1; 1H NMR (CDCl3)
δ 1.25 (t, 3H, J = 6.9 Hz, CH3CH2), 1.70 (d, 3H, J = 7.2 Hz,
CH3CH), 3.86 (s, 3H, OCH3), 4.21 (q, 2H, J = 6.9 Hz, CH2CH3),
4.64 (q, 1H, J = 7.2 Hz, CH3CH), 6.96-6.97 (dd, 1H, J = 8.7 Hz,
J = 2.4 Hz, CH Ar), 7.38 (d, 1H, J = 2.4 Hz, CH Ar), 7.60 (d, 1H,
J = 8.7 Hz, CH Ar); 13C NMR (CDCl3) δ 14.3 (CH3CH2), 18.2
(CH3CH), 45.4 (CH3CH), 55.8 (OCH3), 62.0 (CH2CH3), 104.9,
114.6, and 121.4 (CH Ar), 127.4, 154.4, and 159.1 (C Ar), 165.5
(dC-S), 171.9 (CdO). Anal. (C13H15NO3S2) C, H, N.
Ethyl [(5-Chloro-1,3-benzothiazol-2-yl)thio](phenyl)acetate [(rac)-
1
11u]. Colorless oil, 64% yield. IR (KBr) 1738 cm-1; H NMR
(CDCl3) δ1.26 (t, 3H, J=6.9Hz, CH3CH2), 4.19 and 4.28 (dq, 2H,
J = 6.9 Hz, OCH2CH3), 5.76 (s, 1H, CHS), 7.25-7.38 (m, 5H,
CH Ar), 7.52 (dd, 1H, J = 8.4 Hz, J = 1.8 Hz, CH Ar), 7.64 (d, 1H,
J = 8.4 Hz, CH Ar), 7.83 (d, 1H, J = 1.8 Hz, CH Ar); 13C NMR
(CDCl3) δ 14.3 (CH3CH2), 54.8 (CHS), 62.5 (OCH2), 121.7, 121.9,
125.0, 128.7, 129.1, and 129.2 (CH Ar), 132.3, 133.9, 153.9, and
167.0 (C Ar), 169.6 (CdO). Anal. (C17H14ClNO2S2) C, H, N.
General Procedure for the Preparation of Acids 12c-k and rac-
12l-u. NaOH (1 N, 3.9 mmol) was added to esters 11c-k and
rac-11l-u (3.0 mmol) in EtOH (20 mL), and the mixture was
stirred at room temperature for 10-15 h. The solvent was
removed under reduced pressure, and the residue was poured
into water (20 mL) and acidified with concentrated HCl at 0 °C.
Ethyl 2-[(6-Bromo-1,3-benzothiazol-2-yl)thio]propanoate [(rac)-
1
11p]. Yellowish oil, 52% yield. IR (KBr) 1741 cm-1; H NMR

Article
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 20 6229
The aqueous layer was extracted with dichloromethane (3 ꢀ
20 mL), and the organic layer was dried over Na2SO4 and
concentrated under reduced pressure. The residue was purified
by crystallization or by column chromatography on silica gel
(eluent cyclohexane/ethyl acetate, 1:1, or dichloromethane/
methanol, 9:1), affording desired acids with good yields.
2-[(5-Bromo-1,3-benzothiazol-2-yl)thio]-2-methylpropanoic Acid
2-[(6-Ethoxy-1,3-benzothiazol-2-yl)thio]-2-methylpropanoic Acid
(12k). Yellowish solid, 46% yield, mp 124-126 °C. IR (KBr)
1716 cm-1 1H NMR (CD3OD) δ 1.40 (t, 3H, J = 7.2 Hz,
;
CH3CH2OAr), 1.66 (s, 6H, C(CH3)2), 4.06 (q, 2H, J = 7.2 Hz,
ArOCH2CH3), 7.06 (dd, 1H, J = 9.3 Hz, J = 2.4 Hz, CH Ar), 7.39
C
(d, 1H, J = 2.4 Hz, CH Ar), 7.78 (d, 1H, J = 9.3 Hz, CH Ar); 13
NMR (CD3OD)
δ 13.9 (CH3CH2OAr), 25.8 (C(CH3)2),
(12c). White solid, 46% yield, mp 121-123 °C. IR (KBr) 1710 cm-1
;
54.5 (C(CH3)2), 64.0 (ArOCH2CH3), 104.1, 116.3, and 122.7
(CH Ar), 138.6, 147.5, 157.7, and 159.1 (C Ar), 175.9 (CdO).
Anal. (C13H15NO3S2) C, H, N.
1H NMR (DMSO) δ 1.71 (s, 6H, C(CH3)2), 7.48-7.51 (dd, 1H, J =
8.7 Hz, J = 2.7 Hz, CH Ar), 7.91 (d, 1H, J = 2.7 Hz, CH Ar), 8.04
(d, 1H, J = 8.7 Hz, CH Ar); 13C NMR (DMSO) δ 27.7 (C(CH3)2),
60.8 (C(CH3)2), 119.5 (CBr), 123.7, 124.3, and 127.7 (CH Ar), 134.8
and 155.0 (C Ar), 169.9 (dC-S), 176.1 (CdO). Anal. (C11H10-
BrNO2S2) C, H, N.
2-[(5-Chloro-1,3-benzothiazol-2-yl)thio]propanoic Acid [rac-(12l)].
White solid, 46% yield, mp 110-112 °C. IR (KBr) 1709 cm-1; 1H
NMR (CD3OD) δ 0.16 (d, 3H, J = 6.9 Hz, CH3CH), 3.02 (q, 1H,
J = 6.9 Hz, CH3CH), 5.73-5.76 (dd, 1H, J = 8.7 Hz, J = 1.8 CH
Ar), 6.22 (d, 1H, J = 1.8 Hz, CH Ar), 6.25 (d, 1H, J = 8.7 Hz, CH
Ar); 13C NMR (CD3OD) δ 20.8 (CH3CH), 51.1 (CH3CH), 121.0,
123.6, and 124.8 (CH Ar), 131.6 and 154.5 (C Ar), 133.9 (CCl),
171.4 (dC-S), 173.4 (CdO). Anal. (C10H8ClNO2S2) C, H, N.
2-[(5-Bromo-1,3-benzothiazol-2-yl)thio]propanoic Acid [rac-(12m)].
Yellow solid, 78% yield, mp 108-109 °C. IR (KBr) 1712 cm-1; 1H
NMR (DMSO) δ 1.62 (d, 3H, J = 6.6 Hz, CH3CH), 4.37 (q, 1H,
J = 6.6 Hz, CH3CH), 7.45-7.49 (dd, 1H, J = 8.4 Hz, J = 1.8 Hz,
CH Ar), 7.92 (d, 1H, J = 8.4 Hz, CH Ar), 7.99 (d, 1H, J = 1.8 Hz,
CH Ar); 13CNMR(DMSO) δ20.6 (CH3CH), 50.6 (CH3CH), 119.7
(CBr), 123.9, 124.0, and 127.5 (CH Ar), 134.4 and 154.8(CAr), 170.8
(dC-S), 173.5 (CdO). Anal. (C10H8BrNO2S2) C, H, N.
2-[(5-Cyano-1,3-benzothiazol-2-yl)thio]-2-methylpropanoic Acid
(12d). White solid, 61% yield, mp 265 °C (dec). IR (KBr) 2230,
1712 cm-1; 1H NMR (DMSO) δ1.74 (s, 6H, C(CH3)2), 7.72-7.76
(dd, 1H, J = 8.4 Hz, J = 1.8 Hz, CH Ar), 8.20 (d, 1H, J = 8.4 Hz,
CH Ar), 8.34 (d, 1H, J = 1.8 Hz, CH Ar); 13C NMR (DMSO) δ
27.6 (C(CH3)2), 60.1 (C(CH3)2), 109.5 (CCN), 123.8, 125.8, and
127.7 (CH Ar), 140.8 and 153.1 (C Ar), 170.6 (dC-S), 175.5
(CdO). Anal. (C12H10N2O2S2) C, H, N.
2-[(5-Trifluoromethyl-1,3-benzothiazol-2-yl)thio]-2-methylpro-
panoic Acid (12e). White needles, 48% yield, mp 147-149 °C. IR
(KBr) 1709 cm-1; 1H NMR (CD3OD) δ 1.78 (s, 6H, C(CH3)2),
7.61 (dd, 1H, J = 9.0 Hz, J = 1.8 Hz, CH Ar), 8.06 (d, 1H, J =
9.0 Hz, CH Ar), 8.14 (d, 1H, J = 1.8 Hz, CH Ar); 13C NMR
(CD3OD) δ 25.8 (C(CH3)2), 55.1 (C(CH3)2), 118.4, 120.9, and
122.2 (CH Ar), 128.4 (CF3), 139.7, 144.6, 152.9, and 167.2
(C Ar), 175.9 (CdO). Anal. (C12H10F3NO2S2) C, H, N.
2-[(5-Methoxy-1,3-benzothiazol-2-yl)thio]-2-methylpropanoic
Acid (12f). Yellowish solid (from cyclohexane), 58% yield, mp
131-133 °C. IR (KBr) 1710 cm-1; 1H NMR (CD3OD) δ 1.71 (s,
6H, C(CH3)2), 3.86 (s, 3H, OCH3), 7.01-7.05 (dd, 1H, J =
8.7 Hz, J = 2.7 Hz, CH Ar), 7.44 (d, 1H, J = 2.7 Hz, CH Ar),
7.73 (d, 1H, J = 8.7 Hz, CH Ar); 13C NMR (CD3OD) δ 25.6
(C(CH3)2), 54.1 (C(CH3)2), 54.8 (OCH3), 104.5, 115.3, and 121.4
(CH Ar), 128.3, 154.5, and 159.5 (C Ar), 163.6 (dC-S), 175.2
(CdO). Anal. (C12H13NO3S2) C, H, N.
2-[(5-Cyano-1,3-benzothiazol-2-yl)thio]propanoic Acid [rac-(12n)].
White solid, 66% yield, mp 124-125 °C. IR (KBr) 2233, 1721 cm-1
;
1HNMR(DMSO) δ1.63 (d, 3H, J=6.9Hz, CH3CH), 4.45(q,1H,
J = 6.9 Hz, CH3CH), 7.70-7.73 (dd, 1H, J = 8.1 Hz, J = 1.5 Hz,
CH Ar), 8.19 (d, 1H, J = 8.1 Hz, CH Ar), 8.29 (d, 1H, J = 1.5 Hz,
CH Ar); 13C NMR (DMSO) δ 20.1 (CH3CH), 49.6 (CH3CH),
109.5 (CCN), 120.7 (CN), 123.9, 125.3, and 127.5 (CH Ar), 140.6
and 153.1 (C Ar), 171.2 (dC-S), 173.3 (CdO). Anal. (C11H8-
N2O2S2) C, H, N.
2-[(5-Methoxy1,3-benzothiazol-2-yl)thio]propanoic
[rac-(12o)]. White solid, 90% yield, mp 131-133 °C. IR (KBr)
1710 cm-1 1H NMR (CD3OD) δ 1.70 (d, 3H, J = 7.5 Hz,
Acid
;
CH3CH), 3.84 (s, 3H, OCH3), 4.48 (q, 1H, J = 7.5 Hz, CH3CH),
6.93-6.97 (dd, 1H, J = 8.7 Hz, J = 2.4 Hz, CH Ar), 7.33 (d, 1H,
J = 2.4 Hz, CH Ar), 7.67 (d, 1H, J = 8.7 Hz, CH Ar); 13C NMR
(CD3OD) δ 18.9 (CH3CH), 49.3 (CH3CH), 54.8 (OCH3), 104.0,
113.8, and 121.2 (CH Ar), 126.6, 154.4, and 159.4 (C Ar), 155.8
(dC-S), 168.9 (CdO). Anal. (C11H11NO3S2) C, H, N.
2-[(6-Bromo-1,3-benzothiazol-2-yl)thio]propanoic Acid [rac-(12p)].
White solid, 63% yield, mp 112-114 °C. IR (KBr) 1718 cm-1; 1H
NMR (DMSO) δ 1.61 (d, 3H, J = 7.2 Hz, CH3CH), 4.45 (q, 1H,
J=7.2Hz,CHCH3), 7.55 (dd, 1H, J=8.4Hz,J=1.8Hz,CHAr),
7.72 (d, 1H, J = 8.4 Hz, CH Ar), 8.24 (d, 1H, J = 1.8 Hz, CH Ar);
13C NMR (DMSO) δ 20.0 (CH3CH), 49.1 (CH), 117.4 (C Ar),
123.1, 124.9, and 130.0 (CH Ar), 137.2, 152.5, and 168.6 (C Ar),
173.3 (CdO). Anal. (C10H8BrNO2S2) C, H, N.
2-[(6-Ethoxy-1,3-benzothiazol-2-yl)thio]propanoic Acid [rac-
(12q)]. White solid, 49% yield, mp 90-91 °C. IR (KBr) 1716
cm-1;1HNMR(CDCl3) δ1.45 (t, 3H, J=6.9Hz, CH3CH2OAr),
1.64 (d, 3H, CH3CH), 4.07 (q, 2H, J = 6.9 Hz, ArOCH2CH3),
4.32 (q, 2H, J = 6.9 Hz, CHCH3), 7.06 (dd, 1H, J = 9.0 Hz, J =
2.4 Hz, CH Ar), 7.23 (d, 1H, J = 2.4 Hz, CH Ar), 7.75 (d, 1H,
J=9.3 Hz, CH Ar); 13C NMR (CDCl3) δ 14.9 (CH3CH2OAr),
16.4 (CH3CH), 44.7 (CHCH3), 64.4 (ArOCH2CH3), 105.0, 116.5,
and 121.7 (CH Ar), 136.2, 145.3, 157.5, and 160.5 (C Ar), 171.9
(CdO). Anal. (C12H13NO3S2) C, H, N.
2-[(6-Chloro-1,3-benzothiazol-2-yl)thio]-2-methylpropanoic Acid
(12g). White solid, 45% yield, mp 140-141 °C. IR (KBr) 1714 cm-1
;
1H NMR (CDCl3) δ 1.75 (s, 6H, C(CH3)2), 7.42 (dd, 1H, J =
9.0 Hz, J = 1.8 Hz, CH Ar), 7.76 (d, 1H, J = 1.8 Hz, CH Ar), 7.81
(d, 1H, J = 9.0 Hz, CH Ar); 13C NMR (CDCl3) δ 26.0 (C(CH3)2),
54.6 (C(CH3)2), 121.1, 122.4, and 127.8 (CH Ar), 131.9, 136.2, 150.1,
and 166.4 (C Ar), 174.3 (CdO). Anal. (C11H10ClNO2S2) C, H, N.
2-[(6-Bromo-1,3-benzothiazol-2-yl)thio]-2-methylpropanoic Acid
(12h). White solid, 51% yield, mp 118-120 °C. IR (KBr) 1716 cm-1
;
1H NMR (CDCl3) δ 1.71 (s, 6H, C(CH3)2), 7.49 (dd, 1H, J =
8.7 Hz, J = 1.8 Hz, CH Ar), 7.71 (d, 1H, J = 8.7 Hz, CH Ar), 7.85
(d, 1H, J = 1.8 Hz, CH Ar); 13C NMR (CDCl3) δ 26.2 (C(CH3)2),
55.2 (C(CH3)2), 119.3 (C Ar),122.9, 123.8, and 130.3 (CH Ar),
136.9, 150.8, and 165.9 (C Ar), 174.5 (CdO). Anal. (C11H10-
BrNO2S2) C, H, N.
2-[(6-Cyano-1,3-benzothiazol-2-yl)thio]-2-methylpropanoic acid
(12i). White solid, 37% yield, mp 170-172 °C. IR (KBr) 2230,
1704 cm-1; 1H NMR (CD3OD) δ 1.79 (s, 6H, C(CH3)2), 7.73 (dd,
1H, J = 8.4 Hz, J = 1.5 Hz, CH Ar), 7.94 (d, 1H, J = 8.4 Hz,
CH Ar), 8.31 (d, 1H, J = 1.5 Hz, CH Ar); 13C NMR (CD3OD) δ
25.7 (C(CH3)2), 55.3 (C(CH3)2), 107.8 (C Ar), 118.4 (CN), 122.2,
126.1, and 129.5 (CH Ar), 136.3, 155.6, and 170.1 (C Ar), 175.5
(CdO). Anal. (C12H10N2O2S2) C, H, N.
2-[(6-Trifluoromethyl-1,3-benzothiazol-2-yl)thio]-2-methylpro-
panoic Acid (12j). White needles, 42% yield, mp 149-151 °C. IR
(KBr) 1709 cm-1; 1H NMR (CD3OD) δ 1.78 (s, 6H, C(CH3)2),
7.68 (dd, 1H, J = 9.0 Hz, J = 1.8 Hz, CH Ar), 7.96 (d, 1H, J =
9.0 Hz, CH Ar), 8.21 (d, 1H, J = 1.8 Hz, CH Ar); 13C NMR
(CD3OD) δ 26.2 (C(CH3)2), 57.1 (C(CH3)2), 118.8, 121.9, and
122.9 (CH Ar), 126.3 (CF3), 129.3, 136.1, 155.4, and 169.6
(C Ar), 177.9 (CdO). Anal. (C12H10F3NO2S2) C, H, N.
2-[(5-Chloro-1,3-benzothiazol-2-yl)thio]pentanoic Acid [rac-
(12r)]. White solid, 59% yield, mp 100-101 °C. IR (KBr) 1718
cm-1; 1H NMR (CDCl3) δ 0.97 (t, 3H, J = 7.2 Hz, CH3CH2),
1.51-1.61 (m, 2H, CH2CH3), 1.83-2.19 (m, 2H, CH2CH), 4.35
(t, 1H, J = 7.2 Hz, CH), 7.34 (dd, 1H, J = 8.7 Hz, J = 2.1 Hz,
CH Ar), 7.69 (d, 1H, J = 8.7 Hz, CH Ar), 7.87 (d, 1H, J =
2.1 Hz, CH Ar); 13C NMR (CDCl3) δ 13.8 (CH3CH2), 20.6
(CH2CH3), 34.6 (CH2CH), 49.8 (CH), 121.4, 122.1, and 125.9

6230 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 20
Giampietro et al.
(CH Ar), 133.1, 133.3, 152.3, and 169.2 (C Ar), 172.5 (CdO).
Anal. (C12H12ClNO2S2) C, H, N.
2-[(6-Ethoxy-1,3-benzothiazol-2-yl)thio]pentanoic Acid [rac-
(R)-Ethyl 2-[(5-methoxy-1,3-benzothiazol-2-yl)thio]propanoate
[(R)-(11o)]. White oil, 57% yield, [R]2D1 þ98.7° (c 1.68, CHCl3). IR
(KBr) 1732 cm-1; 1H NMR (CDCl3) δ 1.25 (t, 3H, J = 6.9 Hz,
CH3CH2), 1.70 (d, 3H, J = 7.2, CH3CH), 3.86 (s, 3H, OCH3),
4.21 (q, 2H, J = 6.9 Hz, CH2CH3), 4.64 (q, 1H, J = 7.2 Hz,
CH3CH), 6.96-6.97 (dd, 1H, J = 8.7 Hz, J = 2.4 Hz, CH Ar),
7.38(d, 1H, J = 8.7 Hz, CH Ar), 7.60 (d, 1H, J = 2.4 Hz, CH Ar);
13C NMR (CDCl3) δ 14.3 (CH3CH2), 18.2 (CH3CH), 45.4
(CH3CH), 55.8 (OCH3), 62.0 (CH2CH3), 104.9, 114.6, and
121.4 (CH Ar), 127.4, 154.4, and 159.1 (C Ar), 165.5 (dC-S),
171.9 (CdO). Anal. (C13H15NO3S2) C, H, N.
(12s)]. Yellowish oil, 51% yield. IR (KBr) 1718 cm-1 1H
;
NMR (CDCl3) δ 0.95 (t, 3H, J = 7.2 Hz, CH3CH2CH2), 1.44
(t, 3H, J = 6.9 Hz, CH3CH2OAr), 1.42-1.57 (m, 2H,
CH3CH2CH2), 1.78-2.20 (m, 2H, CH3CH2CH2), 4.06 (q, 2H,
J = 6.9 Hz, ArOCH2CH3), 4.17 (t, 1H, J = 7.2 Hz, CHCH2),
7.04 (dd, 1H, J = 9.0 Hz, J = 2.4 Hz, CH Ar), 7.21 (d, 1H, J =
2.4 Hz, CH Ar), 7.75 (d, 1H, J = 9.0 Hz, CH Ar); 13C NMR
(CDCl3) δ 13.8 (CH3CH2CH2), 14.9 (CH3CH2OAr), 20.6
(CH2CH2CH3), 32.4 (CH2CH2CH3), 50.1 (CHCH2), 64.4
(ArOCH2CH3), 105.0, 116.4, and 121.8 (CH Ar), 136.4, 145.6,
157.4, and 164.8 (C Ar), 172.2 (CdO). Anal. (C14H17NO3S2)
C, H, N.
(S)-Ethyl 2-[(5-Methoxy-1,3-benzothiazol-2-yl)thio]propanoate
[(S)-(11o)]. White oil, 60% yield, [R]2D1 -100.7° (c 1.68, CHCl3).
Spectroscopic data are the same as for the (R)-enantiomer.
General Procedure for the Preparation of Acids (R)- and (S)-12l
and (R)- and (S)-12o. HCl (6 N, 23 mmol) was added to chiral
esters (R)- and (S)-11l and (R)- and (S)-11o (1.22 mmol, 367.4 mg)
at room temperature. Then the mixture was heated at 60 °C for
24 h. Water (10 mL) was added to the reaction mixture and then
was extracted with diethyl ether (3 ꢀ 15 mL). The organic layer
was dried over Na2SO4 and concentrated under reduced pressure.
The residue was purified by column chromatography on silica gel
(eluent, 100%dichloromethane), affording acids withgoodyields.
(R)-2-[(5-Chloro-1,3-benzothiazol-2-yl)thio]propanoic Acid [(R)-
(12l)]. White solid, 87% yield, [R]1D9 þ28.7 (c 0.75, MeOH), mp
2-[(5-Chloro-1,3-benzothiazol-2-yl)thio]octanoic Acid [rac-
(12t)]. White solid, 53% yield, mp 91-93 °C. IR (KBr) 1716
cm-1; 1H NMR (CDCl3) δ 0.86 (t, 3H, J = 7.2 Hz, CH3CH2),
1.24-1.29 (m, 6H, CH2), 1.42-1.59 (m, 2H, CH2), 1.92-2.05 (m,
2H, CH2), 4.28 (t, 1H, J = 7.2 Hz, CHS), 7.36 (dd, 1H, J =
8.7 Hz, J =2.1 Hz, CH Ar), 7.70 (d, 1H, J = 8.7 Hz, CH Ar), 7.88
(d, 1H, J = 2.1 Hz, CH Ar); 13C NMR (CDCl3) δ 14.2
(CH3CH2), 22.7, 27.3, 29.0, 30.5, and 31.6 (CH2), 50.2 (CH),
121.3, 122.2, and 126.0 (CH Ar), 133.2, 133.3, 152.1, and 170.4
(C Ar), 171.7 (CdO). Anal. (C15H18ClNO2S2) C, H, N.
[(5-Chloro-1,3-benzothiazol-2-yl)thio](phenyl)acetic Acid [rac-
(12u)]. White needles (from cyclohexane), 56% yield, mp
1
108-110 °C. IR (KBr) 1709 cm-1; H NMR (CD3OD) δ 0.16
(d, 3H, J = 6.9 Hz, CH3CH), 3.02 (q, 1H, J = 6.9 Hz, CH3CH),
5.73-5.76 (dd, 1H, J = 8.7 Hz, J= 1.8 Hz, CH Ar), 6.22 (d, 1H,
J = 1.8 Hz, CH Ar), 6.25 (d, 1H, J = 8.7 Hz, CH Ar); 13C NMR
(CD3OD) δ 20.8 (CH3CH), 51.1 (CH3CH), 121.0, 123.6, and
124.8 (CH Ar), 131.6 and 154.5 (C Ar), 133.9 (CCl), 171.4
(dC-S), 173.4 (CdO). Anal. (C10H8ClNO2S2) C, H, N.
1
186-188 °C. IR (KBr) 1707 cm-1; H NMR (CD3OD) δ 5.79
(s, 1H, CHS), 7.31-7.41 (m, 5H, CH Ar), 7.54 (dd, 1H, J =
8.4 Hz, J = 1.8 Hz, CH Ar), 7.81 (d, 1H, J = 8.4 Hz, CH Ar),
7.84 (d, 1H, J = 1.8 Hz, CH Ar); 13C NMR (CD3OD) δ 55.0
(CHS), 120.9, 122.2, 124.8, 128.4, 128.7, and 128.9 (CH Ar),
132.2, 133.8, 135.0, 153.8, and 167.9 (C Ar), 171.2 (CdO). Anal.
(C15H10ClNO2S2) C, H, N.
(S)-2-[(5-Chloro-1,3-benzothiazol-2-yl)thio]propanoic Acid [(S)-
(12l)]. White solid, 48% yield, [R]3D1 -34.9° (c 0.75, MeOH).
Spectroscopic data are the same for the (R)-enantiomer.
General Procedure for the Preparation of (R)- and (S)-Ethyl
2-Bromopropanoate. Absolute EtOH (37.16 mmol), toluene
(31.63 mmol), and concentrated H2SO4 (0.265 mmol) were
added to (R)- or (S)-2-bromopropanoic acid (22.12 mmol,
3.39 g) using a Dean-Stark apparatus. After the mixture was
stirred for 5 h at reflux, absolute EtOH (6.64 mmol) was added
and the reaction mixture was stirred for another 30 min, then
poured into water (10 mL) and extracted with ethyl acetate (3 ꢀ
20 mL). The organic layer was washed with NaHCO3 (50 mL)
and H2O (50 mL), dried over Na2SO4, and concentrated under
reduced pressure. The crude products were used without puri-
fication.
General Procedure for the Preparation of Arylthioisobutanoic
Esters (R)- and (S)-11l and (R)- and (S)-11o. The heterocyclic
thiol 10l or 10o (2.21 mmol) and (R)- or (S)-ethyl 2-bromopro-
panoate (2.21 mmol) dissolved in absolute EtOH (10 mL) were
added to a solution of sodium (50.8 mg, 2.21 mmol) in absolute
EtOH (5 mL) under nitrogen atmosphere. After the mixture was
stirred for 2 h at reflux, the solvent was removed under reduced
pressure. The residue was poured into water (20 mL) and
extracted with diethyl ether (3 ꢀ 20 mL). The organic layer
was dried over Na2SO4 and concentrated under reduced pres-
sure. The crude products were used without purification.
(R)-Ethyl 2-[(5-Chloro-1,3-benzothiazol-2-yl)thio]propanoate
[(R)-(11l)]. Yellowish oil, 80% yield, [R]2D0 þ118.7° (c1.01, CHCl3).
IR (KBr) 1735 cm-1; 1H NMR (CDCl3) δ 1.27 (t, 3H, J = 7.2 Hz,
CH3CH2), 1.72 (d, 3H, J = 7.5 Hz, CH3CH), 4.20 (q, 2H, J =
7.2 Hz, CH2CH3), 4.69 (q, 1H, J = 7.5 Hz, CH3CH), 7.27-7.30
(dd, 1H, J = 8.4 Hz, J = 1.8 Hz, CH Ar), 7.67 (d, 1H, J = 8.4 Hz,
CHAr),7.84(d,1H,J=1.8Hz,CHAr); 13CNMR(CDCl3) δ14.3
(CH3CH2), 18.1 (CH3CH), 45.4 (CH3CH), 62.1 (CH2CH3), 121.8,
121.9, and 125.1 (CH Ar), 132.4 (CCl), 133.9 and 154.0 (C Ar),
166.9 (dC-S), 171.7 (CdO). Anal. (C12H12ClNO2S2) C, H, N.
(S)-Ethyl 2-[(5-Chloro-1,3-benzothiazol-2-yl)thio]propanoate
[(S)-(11l)]. Yellowish oil, 61% yield, [R]2D4 -107.6° (c1.05, CHCl3).
Spectroscopic data are the same as for the (R)-enantiomer.
(R)-2-[(5-Methoxy-1,3-benzothiazol-2-yl)thio]propanoic Acid
[(R)-(12o)]. White solid, 93% yield, [R]2D4 þ17.8° (c 1.05, MeOH),
1
mp 134-135 °C. IR (KBr) 1710 cm-1; H NMR (CD3OD) δ
1.70 (d, 3H, J = 7.5 Hz, CH3CH), 3.84 (s, 3H, OCH3), 4.48 (q,
1H, J = 7.5 Hz, CH3CH), 6.93-6.97 (dd, 1H, J = 8.7 Hz, J =
2.4 Hz, CH Ar), 7.33 (d, 1H, J = 2.4 Hz, CH Ar), 7.67 (d, 1H,
J = 8.7 Hz, CH Ar); 13C NMR (CD3OD) δ 18.9 (CH3CH), 49.3
(CH3CH), 54.8 (OCH3), 104.0, 113.8, and 121.2 (CH Ar), 126.6,
154.4, and 159.4 (C Ar), 155.8 (dC-S), 168.9 (CdO). Anal.
(C11H11NO3S2) C, H, N.
(S)-2-[(5-Methoxy-1,3-benzothiazol-2-yl)thio]propanoic Acid
[(S)-(12o)]. White solid, 85% yield, [R]2D4 -17.3° (c 0.79, MeOH),
1
mp 134-135 °C. IR (KBr) 1710 cm-1; H NMR (CD3OD) δ
1.70 (d, 3H, J = 7.5 Hz, CH3CH), 3.84 (s, 3H, OCH3), 4.48 (q,
1H, J = 7.5 Hz, CH3CH), 6.93-6.97 (dd, 1H, J = 8.7 Hz, J =
2.4 Hz, CH Ar), 7.33 (d, 1H, J = 2.4 Hz, CH Ar), 7.67 (d, 1H,
J = 8.7 Hz, CH Ar); 13C NMR (CD3OD) δ 18.9 (CH3CH), 49.3
(CH3CH), 54.8 (OCH3), 104.0, 113.8, and 121.2 (CH Ar), 126.6,
154.4, and 159.4 (C Ar), 155.8 (dC-S), 168.9 (CdO). Anal.
(C11H11NO3S2) C, H, N.
Biology. Cell-Based Transactivation Assay. Human embryo-
nic kidney 293 cell line (HEK293) was cultured in Dulbecco’s
modified Eagle’s minimal essential medium containing 10%
fetal calf serum and supplemented with penicillin/streptomycin,
sodium pyruvate, and nonessential amino acids at 37 °C in a
humidified atmosphere of 5% CO2 in air. Ligand agonist
activity for each PPAR subtype was determined by its transac-
tivation activity in a cell-based reporter-gene assay. Transfec-
tions of PPAR and reporter gene constructs were performed
by calcium phosphate coprecipitation. Before transfection, the
culture medium was replaced by fresh serum-free medium, and
6 h after transfection, the ligand, dissolved in DMSO, was added.
The final concentration of DMSO did not exceed 0.1% (v/v) in
any of the samples. Eighteen hours after treatment, luciferase and
renilla activities were measured by a dual luciferase assay kit

Article
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 20 6231
(Promega) using a luminometer (Labsystems Ascent Luminos-
kan reader). DNA cotransfection experiments included 50 ng of
reporter plasmid, 20 ng of renilla, 40 ng of pGEM, and 30 ng
of each receptor expression plasmid per well in a 96-well plate.
Luciferase data were normalized to the internal renilla control,
and reported values are the mean of triplicate assays. Luciferase
activity was determined as fold activation relative to untreated
cells.
RTqPCR. HepG2 was obtained from ATCC (ATCC-LGC
Promochem, London, U.K.). Cells were maintained in Dulbec-
co’s modified Eagle’s medium supplemented with 10% FBS-
GOLD and 1% penicillin/streptomycin at 37 °C in a humidified
incubator with 5% CO2 in air. For the treatment, 1 ꢀ 106 cells
were seeded into six-well culture dishes, grown for 24 h, and
finally treated with vehicle (DMSO) and ligand (150 μM). After
incubation for 48 h, mRNA was extracted.
Total RNA was isolated by TRIzol reagent (Invitrogen, Carls-
bad, CA) following the manufacture’s instruction. To avoid pos-
sible DNA contaminations, RNA was treated with DNAase-1
(Ambion, Foster City, CA). RNA purity was checked by spectro-
photometer and RNA integrity by examination on agarose gel
electrophoresis. cDNA was synthesized retrotranscribing 4 μg of
total RNA in a total volume of 100 μL using a high capacity DNA
archive kit (Applied Biosystem, Foster City, CA) and following the
manufacturer’s instruction.
RTqPCR primers were designed using Primer Express software.
RTqPCR assays were performed in 96-well optical reaction plates
using the ABI 7500HT machine (Applied Biosystem). PCR assays
were conducted in triplicate wells for each sample. Baseline values
of amplification plots were set automatically, and threshold values
were kept constant to obtain normalized cycle times and linear
regression data. The following reaction mixture per well was used:
10 μL Power Syber Green (Applied Biosystem), 2.4 μL of primers
at a final concentration of 150 nM, 4.6 μL of RNAase free water,
3 μL of cDNA (60 ng). For all experiments the following condi-
tions were used: denaturation at 95 °C for 10 min, followed by
40 cycles at 95 °C for 15 s, then at 60 °C for 60 s. Quantitative
normalization of cDNA in each sample was performed using
cyclophilin as internal control. Relative quantification was per-
formed using the ΔΔCT method.
regulators. Biochim. Biophys. Acta 2007, 1771, 915–925. (d) Vanden
Heuvel, J. P. The PPAR resource page. Biochim. Biophys. Acta 2007,
1771, 1108–1112.
(2) (a) Berger, J.; Moller, D. E. The mechanisms of action of PPARs.
Annu. Rev. Med. 2002, 53, 409–435. (b) Kota, B. P.; Huang, T. H-W.;
Roufogalis, B. D. An overview on biological mechanisms of PPARs.
Pharmacol. Res. 2005, 51, 85–94. (c) Feige, J. N.; Gelman, L.;
Michalik, L.; Desvergne, B.; Wahli, W. From molecular action to
physiological outputs: peroxisome proliferator-activated receptors are
nuclear receptors at the crossroads of key cellular functions. Prog. Lipid
Res. 2006, 45, 120–159.
(3) (a) Forman, B. M.; Chen, J.; Evans, R. M. Hypolipidemic drugs,
polyunsaturated fatty acids, and eicosanoids are ligands for per-
oxisome proliferator-activated receptors r and δ. Proc. Natl. Acad.
Sci. U.S.A. 1997, 94, 4312–4317. (b) Kliewer, S. A.; Sundseth, S. S.;
Jones, S. A.; Brown, P. J.; Bruce Wisely, G.; Koble, C. S.; Devchand, P.;
Wahli, W.; Willson, T. M.; Lenhard, J. M.; Lehmann, J. M. Fatty acids
and eicosanoids regulate gene expression through direct interactions
with peroxisome proliferator-activated receptors r and γ. Proc. Natl.
Acad. Sci. U.S.A. 1997, 94, 4318–4323. (c) Bishop-Bailey, D.; Wray,
J. Peroxisome proliferator-activated receptors: a critical review on
endogenous pathways for ligand generation. Prostaglandins Other
Lipid Mediators 2003, 71, 1–22. (d) Grimaldi, P. A. Peroxisome
proliferator-activated receptors as sensors of fatty acids and derivatives.
Cell. Mol. Life Sci. 2007, 64, 2459–2464.
(4) (a) van Raalte, D. H.; Li, M.; Pritchard, P. H.; Wasan, K. M.
Peroxisome proliferator-activated receptor (PPAR)-r: a pharma-
cological target with a promising future. Pharm. Res. 2004, 21,
1531. (b) Lefebvre, P.; Chinetti, G.; Fruchart, J. C.; Bart Staels, B.
Sorting out the roles of PPARr in energy metabolism and vascular
homeostasis. J. Clin. Invest. 2006, 116, 571–580.
(5) (a) Gouni-Berthold, I.; Krone, W. Peroxisome proliferator-acti-
vated receptor r (PPARr) and atherosclerosis. Curr. Drug Targets:
Cardiovasc. Haematol. Disord. 2005, 5, 513–525. (b) Israelian-
Konaraki, Z.; Reaven, P. D. Peroxisome proliferator-activated recep-
tor-alpha and atherosclerosis: from basic mechanisms to clinical im-
plications. Cardiol. Rev. 2005, 13, 240–246. (c) Duval, C.; Muller, M.;
Kersten, S. PPARr and dyslipidemia. Biochim. Biophys. Acta 2007,
1771, 961–971. (d) Zandbergen, F.; Plutzky, J. PPARr in atherosclero-
sis and inflammation. Biochim. Biophys. Acta, Mol. Cell Biol. Lipids
2007, 1771, 972–982. (e) Cheng, A. Y. Y.; Leiter, L. A. PPAR-r:
therapeutic role in diabetes-related cardiovascular disease. Diabetes,
Obes. Metab. 2008, 9, 691–698.
(6) (a) Miyachi, H. Synthetic ligands for peroxisome proliferator-
activated receptor-r, review of the patent literature 2000-2003.
Expert Opin. Ther. Pat. 2004, 14, 607–618. (b) Balakumar, P.; Rose,
M.; Singh, M. PPAR ligands: are they potential agents for cardiovas-
cular disorders? Pharmacology 2007, 80, 1–10. (c) Fruchart, J. C.
Novel peroxisome proliferator activated receptor-r agonists. Am.
J. Cardiol. 2007, 100, 41–46.
(7) (a) Schoonjans, K.; Staels, B. M; Auwerx, J. Role of the peroxisome
proliferator-activated receptor (PPAR) in mediating the effects of
fibrates and fatty acids on gene expression. J. Lipid Res. 1996, 37,
907–925. (b) Staels, B.; Auwerx, J. Role of PPAR in the pharmacolo-
gical regulation of lipoprotein metabolism by fibrates and thiazolidine-
diones. Curr. Pharm. Des. 1997, 3, 1–14. (c) Fruchart, J. C.; Duriez, P.;
Staels, B. Molecular mechanism of action of the fibrates. J. Soc. Biol.
1999, 193, 67–75. (d) Chapman, M. J. Fibrates in 2003: therapeutic
action in atherogenic dyslipidaemia and future perspectives. Athero-
sclerosis 2003, 171, 1–13. (e) Chinetti-Gbaguidi, G.; Fruchart, J. C.;
Staels, B. Pleiotropic effects of fibrates. Curr. Atheroscler. Rep. 2005,
7, 396–401. (f) Barter, P. J.; Rye, K.-A. Is there a role for fibrates in the
management of dyslipidemia in the metabolic syndrome? Arterioscler.,
Thromb., Vasc. Biol. 2008, 28, 39–46. (g) Staels, B.; Maes, M.;
Zambon, A. Fibrates and future PPARr agonists in the treatment of
cardiovascular disease. Nat. Clin. Pract. Cardiovasc. Med. 2008, 5,
542–553.
Validated primers for RTqPCR are listed below:
Human CPT1: FW-50TGCCATGGATCTGCTGTATATCC30,
RV-50GCGTTGCCGGCTCTTG30
Humancyclophilin: FW-50TTTCATCTGCACTGCCAAGA30,
RV-50TTGCAAAACACCACATGCT30
Acknowledgment. The authors gratefully acknowledge the
Italian MIUR for financial support and Dr. David J. Mangeldorf
(Dallas, TX) for the PPAR plasmids. They also thank Maria
Luisa Tricca for her precious technical help. Dr. Antonio
Moschetta is funded by Italian Association for Cancer Research
(AIRC, Milan, Italy), European Research Council Starting
Independent Grant IDEAS 2008, European Community’s
Seventh Framework Programme FP7/2007-2013 under Grant
Agreement No. 202272 (LipidomicNet), Italian Ministry of
Health and Education (Finanziamenti per la Ricerca di Base),
Cariplo Fundation Milan, Telethon Fundation (Grant
GGP08259). Dr. Michele Petruzzelli is supported by the Rosario-
Samanin Fund, and Dr. Annalisa Morgano is a fellow of the
G. d’Annunzio Oncology Program (Chieti, Italy).
(8) Brown, P. J.; Stuart, L. W.; Hurley, K. P.; Lewis, M. C.; Winegar,
D. A.; Wilson, J. G.; Wilkison, W. O.; Ittoop, O. R.; Willson, T. M.
Identification of a subtype selective human PPAR agonist through
parallel-array synthesis. Bioorg. Med. Chem. Lett. 2001, 11, 1225–
1227.
(9) (a) Nomura, M.; Tanase, T.; Ide, T.; Tsunoda, M.; Suzuki, M.;
Uchiki, H.; Murakami, K.; Miyachi, H. Design, synthesis and
evaluation of substituted phenylpropanoic acid derivatives as
human peroxisome proliferator activated receptor activators.
Discovery of potent and human peroxisome proliferator activated
receptor r subtype-selective activators. J. Med. Chem. 2003, 46,
3581–3599. (b) Miyachi, H.; Uchiki, H. Bioorg. Med. Chem. Lett.
2003, 13, 3145–3149.
References
(1) (a) Issemann, I.; Green, S. Activation of a member of the steroid
hormone receptor superfamily by peroxisome proliferators. Nature
1990, 347, 645–650. (b) Motojima, K. Peroxisome proliferator-acti-
vated receptor (PPAR): structure, mechanisms of activation and diverse
functions. Cell Struct. Funct. 1993, 18, 267–277. (c) Zoete, V.;
Grosdidier, A.; Michielin, O. Peroxisome proliferator-activated recep-
tor structures: ligand specificity, molecular switch and interactions with
(10) Xu, Y.; Mayhugh, D.; Saeed, A.; Wang, X.; Thompson, R. C.;
Dominianni, S. J.; Kauffman, R. F.; Singh, J.; Bean, J. S.; Bensch,

6232 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 20
Giampietro et al.
W. R.; Barr, R. W.; Osborne, J.; Montrose-Rafizadeh, C.; Zink,
R. W.; Yumibe, N. P.; Huang, N.; Luffer-Atlas, D.; Rungta, D.;
Maise, D. E.; Mantlo, N. B. Design and synthesis of a potent and
selective triazolone-based peroxisome proliferator-activated recep-
tor r agonist. J. Med. Chem. 2003, 46, 5121–5124.
Synthesis and antiplatelet activity of thioaryloxyacids analogues of
clofibric acid. Eur. J. Med. Chem. 2005, 40, 918–921.
(15) Zhu, L.; Zhang, M.; Dai, M. A convenient synthesis of 2-mercapto
and 2-chlorobenzothiazoles. J. Heterocycl. Chem. 2005, 42, 727–730.
(16) Schulman, I. G.; Heyman, R. A. The flip side: identifying small
molecule regulators of nuclear receptors. Chem. Biol. 2004,11, 639–646.
(17) Rangwala, S. M.; O’Brien, M. L.; Tortorella, V.; Longo, A.;
Loiodice, F.; Noonan, D. J.; Feller, D. R. Stereoselective effects
of chiral clofibric acid analogs on rat peroxisome proliferator-
activated receptor (rPPAR) activation and peroxisomal fatty acid-
oxidation. Chirality 1997, 9, 37–47.
(18) Fracchiolla, G; Laghezza, A.; Piemontese, L.; Carbonara, G.;
Lavecchia, A.; Tortorella, P.; Crestani, M.; Novellino, E.; Loiodice,
F. Synthesis, biological evaluation, and molecular modeling inves-
tigation of chiral phenoxyacetic acid analogues with PPARr and
PPARγ agonist activity. ChemMedChem 2007, 14, 641–654.
(19) Miyachi, H.; Nomura, M.; Tanase, T.; Suzuki, M.; Murakami, K.;
Awano, K. Enantio-dependent binding and transactivation of
optically active phenylpropanoic acid derivatives at human peroxi-
some proliferator-activated receptor alpha. Bioorg. Med. Chem.
Lett. 2002, 12, 333–335.
(11) Shi, G. Q.; Dropinski, J. F.; Zhang, Y.; Santini, C.; Sahoo, S. P.;
Berger, J. P.; MacNaul, K. L.; Zhou, G.; Agrawal, A.; Alvaro, R.;
Cai, T-q.; Hernandez, M.; Wright, S. D.; Moller, D. E.; Heck, J. V.;
Meinke, P. T. Novel 2,3-dihydrobenzofuran-2-carboxylic acids:
highly potent and subtype-selective PPARr agonists with potent
hypolipidemic activity. J. Med. Chem. 2005, 48, 5589–5599.
(12) Matthews, J. M.; Chen, X.; Cryan, E.; Hlasta, D. J.; Rybczynski,
P. J.; Strauss, K.; Tang, Y.; Xu, June, Z.; Yang, M.; Zhou, L.;
Demarest, K. T. Design and synthesis of indane-ureido-thioisobu-
tyric acids: a novel class of PPARr agonists. Bioorg. Med. Chem.
Lett. 2007, 17, 6773–6778.
(13) (a) Asaki, T.; Aoki, T.; Hamamoto, T.; Sugiyama, Y.; Ohmachi, S.;
Kuwabara, K.; Murakami, K; Todo, M. Structure-activity studies
on 1,3-dioxane-2-carboxylic acid derivatives, a novel class of
subtype-selective peroxisome proliferator-activated receptor
r (PPARr) agonists. Bioorg. Med. Chem. 2008, 16, 981–994.
(b) Aoki, T.; Asaki, T.; Hamamoto, T.; Sugiyama, Y.; Ohmachi, S.;
Kuwabara, K.; Murakami, K; Todo, M. Discovery of a novel class of
1,3-dioxane-2-carboxylic acid derivatives as subtype-selective peroxi-
some proliferator-activated receptor r (PPARr) agonists. Bioorg.
Med. Chem. Lett. 2008, 18, 2128–2132.
(20) Lawrence, J. W.; Li, Y.; Chen, S.; De Luca, J. G.; Berger, J. P.;
Umbenhauer, D. R.; Moller, D. E.; Zhou, G. Differential gene
regulation in human versus rodent hepatocytes by peroxisome
proliferator-activated receptor (PPAR) alpha. PPAR alpha fails
to induce peroxisome proliferation-associated genes in human cells
independently of the level of receptor expression. J. Biol. Chem.
2001, 276, 31521–31527.
(14) Ammazzalorso,A.;Amoroso, R.;Baraldi, M.;Bettoni,G.;Braghiroli,
D.; De Filippis, B.; Giampietro, L.; Tricca, M. L.; Vezzalini, F.