Flavokawain a induces apoptosis in MCF-7 and MDA-MB231 and inhibits the metastatic process in vitro

Article abstract of DOI:10.1371/journal.pone.0105244

Introduction: The kava-kava plant (Piper methsyticum) is traditionally known as the pacific elixir by the pacific islanders for its role in a wide range of biological activities. The extract of the roots of this plant contains a variety of interesting mol

Full text of DOI:10.1371/journal.pone.0105244

Flavokawain A Induces Apoptosis in MCF-7 and MDA-
MB231 and Inhibits the Metastatic Process In Vitro
Nadiah Abu1,2, M. Nadeem Akhtar3, Swee Keong Yeap4, Kian Lam Lim5, Wan Yong Ho6,
Aimi Jamil Zulfadli2, Abdul Rahman Omar4, Mohd Roslan Sulaiman7, Mohd Puad Abdullah2,
Noorjahan Banu Alitheen2*
1 Bright Sparks Unit, Universiti Malaya, Kuala Lumpur, Malaysia, 2 Faculty of Biotechnology and Bimolecular Sciences, Universiti Putra Malaysia, Serdang, Selangor Darul
Ehsan, Malaysia, 3 Faculty of Industrial Sciences & Technology, Universiti Malaysia Pahang, Kuantan, Pahang, Malaysia, 4 Institute of Bioscience, Universiti Putra Malaysia,
Serdang, Selangor Darul Ehsan, Malaysia, 5 Faculty of Medicine and Health Sciences, Universiti Tunku Abdul Rahman, Cheras, Selangor, Malaysia, 6 School of Biomedical
Sciences, University of Nottingham Malaysia Campus, Semenyih, Selangor, Malaysia, 7 Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Serdang,
Selangor Darul Ehsan, Malaysia
Abstract
Introduction: The kava-kava plant (Piper methsyticum) is traditionally known as the pacific elixir by the pacific islanders for
its role in a wide range of biological activities. The extract of the roots of this plant contains a variety of interesting
molecules including Flavokawain A and this molecule is known to have anti-cancer properties. Breast cancer is still one of
the leading diagnosed cancers in women today. The metastatic process is also very pertinent in the progression of
tumorigenesis.
Methods: MCF-7 and MDA-MB231 cells were treated with several concentrations of FKA. The apoptotic analysis was done
through the MTT assay, BrdU assay, Annexin V analysis, cell cycle analysis, JC-1 mitochondrial dye, AO/PI dual staining,
caspase 8/9 fluorometric assay, quantitative real time PCR and western blot. For the metastatic assays, the in vitro scratch
assay, trans-well migration/invasion assay, HUVEC tube formation assay, ex vivo rat aortic ring assay, quantitative real time
PCR and western blot were employed.
Results: We have investigated the effects of FKA on the apoptotic and metastatic process in two breast cancer cell lines. FKA
induces apoptosis in both MCF-7 and MDA-MB231 in a dose dependent manner through the intrinsic mitochondrial
pathway. Additionally, FKA selectively induces a G2/M arrest in the cell cycle machinery of MDA-MB231 and G1 arrest in
MCF-7. This suggests that FKA’s anti-cancer activity is dependent on the p53 status. Moreover, FKA also halted the migration
and invasion process in MDA-MB231. The similar effects can be seen in the inhibition of the angiogenesis process as well.
Conclusions: FKA managed to induce apoptosis and inhibit the metastatic process in two breast cancer cell lines, in vitro.
Overall, FKA may serve as a promising candidate in the search of a new anti-cancer drug especially in halting the metastatic
process but further in vivo evidence is needed.
Citation: Abu N, Akhtar MN, Yeap SK, Lim KL, Ho WY, et al. (2014) Flavokawain A Induces Apoptosis in MCF-7 and MDA-MB231 and Inhibits the Metastatic Process
In Vitro. PLoS ONE 9(10): e105244. doi:10.1371/journal.pone.0105244
Editor: Rajeev Samant, University of Alabama at Birmingham, United States of America
Received March 11, 2014; Accepted July 21, 2014; Published October 6, 2014
Copyright: ß 2014 Abu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its
Supporting Information files.
Funding: This study was supported by Fundamental Research Grant Scheme (FRGS/1/2012/SG05/UPM/02/5) from the Ministry of Education, Government of
Malaysia. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* Email: noorjahan@upm.edu.my
it inhibits the metastatic process as well. [4]. Natural products have
played an important part in search for new drugs, even some of the
most famous widely used drugs are derived from natural sources
Introduction
Breast cancer is among the leading cause of cancer-related
deaths among women today [1]. It is estimated that in 1 out of 16
[5,6].
women will be diagnosed with breast cancer at some point in their
Kava-kava plant is an evergreen shrub that is widely consumed
lives [1]. Conventional treatments include chemotherapy and
in the pacific region [7,8]. This plant is largely known to be
surgery, nevertheless, these methods have several drawbacks
involved in a wide spectrum of biological activities including, anti-
including physical pain, increased relapse and lower survival rate
inflammation, anti-bacterial and most importantly, anti-cancer
[2,3]. One of the main reasons administering anti-cancer agents in
[9,10]. Intriguingly, there has been a correlation between the
cancer patients is to eliminate cancer cells; it is also favorable that
consumption of kava-kava and the incidence of cancer [11]. There
PLOS ONE | www.plosone.org
1
October 2014 | Volume 9 | Issue 10 | e105244

Flavokawain A Induces Apoptosis and Inhibits the Metastatic Process
are several interesting components that can be found in the kava
root extracts, including chalcones [7,10]. Chalcones are open ring
flavonoids that are widely synthesized in the plant kingdom [12].
Flavokawain A is a chalcone and has been reported to possess
promising anti-cancer and anti-inflammatory activities [10].
Additionally, flavokawain A was found to inhibit the growth of
bladder cancer cell lines in vitro [10].Nevertheless, the effects of
flavokawain A in breast cancer cells in vitro, as well as the anti-
metastatic activity have not been studied yet. Based on the
preliminary study, flavokawain A was found to have similar
potential cytotoxic activities in breast cancer as to bladder cancer
cells. Since breast cancer has become the most diagnosed type of
cancer in women, especially in Malaysia and generally, worldwide,
we aim to investigate the in vitro cytotoxic and anti-metastatic
effects of flavokawain A on two types of breast cancer cell lines,
MCF-7 and MDA-MB231.Both MCF-7 and MDA-MB231 are
well-established breast cancer cell lines but they differ in several
aspects including, the p53 status, estrogen receptor status and
invasiveness [13]. Therefore we could assess the effectiveness of
flavokawain A in a more wholly approach.
Percentage of Cell Viability~
½OD Sample at 570 nm=OD control at 570 nmꢀ x 100%
Cell Treatment
Based on the results of the MTT assay, three doses of
flavokawain A were used in the remaining assays. The doses are
the IC25, IC50 and IC75 values of flavokawain
A when
administered to MCF-7 and MDA-MB231. The values are
according to Table 1.Since flavokawain A is not soluble in water,
this compound was dissolved in DMSO and the volume of DMSO
administered to cells was below 0.1%.
BrdU Proliferation Assay
The BrdU cell proliferation assay was conducted according to
the manufacturers protocol. The cells were cultured in 96-well
plates at a density of 0.8x104 cells/well overnight. The following
day the cells were treated with three different concentrations of
flavokawain A. After the designated hours of treatment, 24 hours
prior, the cells were labeled with BrdU and tagged with the anti-
BrdU antibody. Afterwards the substrate was added and the
colored product was measured using the mquant ELISA plate
reader (Bio-tek Instruments, USA) at 450 nm.
Materials and Methods
Synthesis of flavokawain A
Flavokawain A was synthesized by Claisen-Schmidt condensa-
tion reaction of the corresponding acetophenone (1.5 mmole) and
4-methoxybenzaldehyde (1.25 mmole). Both acetophenone and
aldehyde were mixed together in the presence of 40% solution
KOH.The reaction mixtured was stirred for 18 hrs at room
temeprature. The product was finally purified by using flash
column chromatography using ethylacetate:hexane of 1:1 as
eluent. Flavokawain A was then recrystallized from MeOH to
yield yellow crystalline flat compound. Finally the FKA was
characterized by spectroscopic techniques such as IR, UV, EI-MS
and NMR data analyses.
AO/PI Double Staining
AO/PI double staining was assayed to determine the morpho-
logical changes of MCF-7 and MDA-MB231 upon treatment with
flavokawain A. The cells were seeded in 6 well plates at a
concentration of 2.4x105 cells/well and were incubated overnight.
The next day, the cells were treated with three different
concentrations of FKA, IC25, IC50 and IC75 for 48 h and
72 hours. Afterwards, the cells were trypsinized and washed with
PBS twice. The harvested cells were resuspended in 100 ml PBS
and stained with 10 mg/ml of each dye. Acridine Orange is a stain
that is permeable to viable cells and can stain the cell’s DNA
directly [15]. This dye emits a green fluorescence once it is excited
[15]. Propidium Iodide on the other hand, is a dye that is
impermeable to viable cells [15]. It can bind to DNA only when
the cells are dead; it emits a red-orange fluorescence instead [15].
The mixture was viewed under a fluorescent microscope (Nikon,
Japan).
Cell Culture
The cell lines MCF-7, MDA-MB231 and MCF-10A were
obtained from the ATCC collection (ATCC, USA). MCF-7 cells
were maintained in RPMI, while MDA-MB231 cells were
maintained in DMEM. Both media were supplemented with
10% fetal bovine serum and 1% penicillin-streptomycin. MCF-
10A cells on the other hand, was maintained in DMEM-F12
media supplemented with hydrocortisone (0.5 mg/ml), insulin
(10 mg/ml), hEGF (20 ng/ml) and 10% (v/v) FBS. All the cells
were kept in a 37uC incubator equipped with 5% CO2.
Cell Cycle Analysis
The cells were seeded in 6 well plates at a density of 2.4x105
cells/well. The following day, the cells were treated with three
different concentrations of flavokawain A. After 12 hours and
24 hours, the cells were trypsinized, washed with PBS and
collected. The resulting pellet was fixed in 70% ethanol and
stored at -20uC. After a week, the fixed cells were washed with
PBS and treated with Rnase and Triton-x, and were then stained
with PI (Sigma, USA). Afterwards, the cells were subjected to flow
cytometric analysis using the FACS Calibur flow cytometer
(Becton Dickinson, USA).
MTT Assay
The MTT assay was conducted in accordance to Mosmann
(1983) with slight modifications [14]. The cells were seeded in 96-
well plates at a concentration of 0.8x105 cells/well. The cells were
then incubated in a 37uC CO2 incubator overnight. The following
day, flavokawain A was added to the wells with seven different
concentrations. The cell viability was measured at 72 hours post-
treatment. MTT solution (5 mg/ml) was added at a volume of
20 ml in each well and was incubated for three hours. Afterwards,
the solution was discarded, and 100 ml of DMSO was added to
each well to solubilize the crystals. The plates were then read using
an ELISA plate reader at the wavelength of 570 nm (Bio-tek
instruments, USA). Triplicates were carried out for each cell line.
The following formula was used to determine the percentage of
viable cells.
Annexin V/FITC Assay
The Annexin V assay was carried out using the Annexin V Kit
(BD Pharmingen, USA). The cells were seeded in 6 well plates at a
concentration of 2.4x105 cells/well overnight. The seeded cells
were treated with the desired concentrations of flavokawain A for
PLOS ONE | www.plosone.org
2
October 2014 | Volume 9 | Issue 10 | e105244

Flavokawain A Induces Apoptosis and Inhibits the Metastatic Process
24, 48 and 72 hours. After the designated incubation time, the
treated cells were collected and harvested according to the desired
time points. The resulting pellets were immediately resuspended in
the provided binding buffer and subsequently stained with 5 ml of
FITC Annexin V and 5 ml of PI. The mixture was left to incubate
at room temperature for 15 minutes. Afterwards, the cells were
analyzed using the FACS system (Becton Dickinson, USA).
cells/ml on top of the solidified matrigel. In the lower compart-
ment of the chamber, 2 ml of media supplemented with 10% FBS,
1 ml of conditioned 3T3 media and the desired concentrations of
flavokawain A were added. The inserts were incubated in a 37uC
CO2 incubator for 24 hours. Afterwards, the non-migrated/
invaded cells were removed from the upper chamber of the
transwell using a cotton swab. Migrated/invaded cells from the
lower part of the membrane were fixed in methanol for
30 minutes before being stained with 0.3% of crystal violet. The
membranes were later photographed using an inverted microscope
and analyzed (Nikon, Japan).
JC-1 (MitoScreen) Assay
The BD MitoScreen Kit was used (Becton Dickinson, Franklin
Lakes, NJ, USA) to measure the depolarization of the mitochon-
drial membrane potential. The cells were seeded in 6 well plates at
a density of 2.4x105 cells/ml. The following day, the cells were
treated with three different concentrations of flavokawain A and
incubated in a humidified CO2 incubator. After 48 hours, the cells
were collected by trypsinization and centrifuged at 2000 rpm for
5 minutes. Around 1x106 cells were incubated with 500 ml of JC-1
working solution. The JC-1 working solution contains the JC-1
stock solution and assay buffer at a 1:100 ratio. This mixture was
incubated at 37uC for 15 minutes. Afterwards, the cells were
washed with the assay buffer twice, before proceeding to the FACS
analysis (Becton Dickinson, USA).
In vitro HUVEC Tube Formation Assay
The HUVEC tube formation assay was performed as summa-
rized by Ponce, 2009 [18]. Firstly, 50 ml of undiluted matrigel was
layered in a 96 well plate for 2 hours. The HUVEC cells were
trypsinized and washed with PBS three times before being added
to the precoated 96 well plates at a density of 1x105 cells/ml
together with the flavokawain A treatment. The plate was then
incubated in a 37uC humidified CO2 incubator for 18 hours. After
the desired time incubation, the tubes were photographed under
an inverted light microscope (Nikon, Japan).
Caspase 8/9 FluorometricDetection Assay
Ex vivo Rat Aortic Ring Assay
To determine the activation of Caspase 8/9 we used the
CaspGLOW Red Active Caspase-8/9 Staining Kit (BioVision Inc,
USA). The cells were seeded in 6 well plates at a density of 2.4x105
cells/ml. The following day, the cells were treated with three
different concentrations of flavokawain A for 48 hours. Next, the
cells were harvested by trypsinization and centrifuged at 2000 rpm
for 5 minutes. 1 ml of Red-IETD-FMK (Caspase-8)/Red-LEHD-
FMK (Caspase-9) were added to 1x106 cells and incubated at
37uC for 30 minutes. Subsequently, the cells were washed twice
before being subjected to FACS analysis (Becton Dickinson, USA).
The dorsal aorta was isolated from 5–7 weeks of male Sprague-
Drawley rats. The aorta was rinsed under sterile conditions with
ice cold PBS three times before being cut into ,1–1.5 mm pieces.
The sections of the aorta were placed in a matrigel-precoated 96
well plate. Afterwards, another layer of matrigel (50 ml) was placed
on top of the aorta sections to sandwich it in between. Once the
top layer of matrigel has solidified, fresh EGM media with the
addition of flavokawain A were added to the wells. The aorta was
left in a 37uC-humidified incubator for 7 days before being
photographed and analyzed.
Wound Healing Assay
Quantitative Real Time PCR Assay
This assay was done using the protocol outlined by Liang et al
[16]. MDA-MB231 cells were seeded to full confluency in 6 well
plates over night. The following day, a scratch was introduced in
the middle of the well using a sterile yellow tip. The media was
discarded and replaced with fresh media containing different
concentrations of flavokawain A. The rate of migration towards
the center of the wound was captured every three hours up until
24 hours (Nikon, Japan). The following formula was used to
calculate the rate of migration:
Total RNA was isolated by using the QIAGEN RNaeasy Kit
according to the manufacturer’s protocol (Qiagen, Germany). The
purity and concentration of the isolated RNA were measured
using a spectrophotometer (Beckman Coulter) and the integrity of
the RNA was determined by running a standard agarose gel.
Then, 1 mg of the RNA was converted to cDNA using the
QuantiTect Reverse Trasncription Kit according to the manu-
facturer’s protocol (Qiagen, Germany). Afterwards, real-time PCR
was carried out using the Power SYBR Green PCR Master Mix
(Invitrogen, Carlsbad, CA, USA) on the iCycler IQ5 (Bio-Rad,
USA). The accession number and sequence of the selected genes is
illustrated in table 2.
Percentage of wound closure~
ðArea of wound at 0h ꢁ area wound at ðnÞhÞ=area of wound at 0h x 100
Western Blot
Total protein lysates were obtained by lysing the cells with
RIPA buffer supplemented with phosphatase inhibitor cocktail
(Roche, Canada). The protein content was then measured by
using the Bradford assay (Sigma, USA). Then, 100 mg of each
sample were subjected to a 10% SDS-Page. The proteins were
then transferred to a PVDF membrane (Roche, Laval, Canada)
using the Pierce Fast Semi-Dry Blotter (Pierce, USA). Afterwards,
the membrane was blocked with 0.5% skimmed milk overnight.
The following day, the membranes were washed in TBST for 3
times and incubated with the designated antibodies, anti-BCL2
(ab18210, Abcam, USA), anti-cytochrome c (ab13575, Abcam,
USA), anti-p27 kip1 (ab32034, Abcam, USA), Afterwards, the
membranes were incubated in the appropriate secondary
In vitro Transwell Migration/Invasion Assay
The transwell migration/invasion assay was attempted based on
the predicament that MDA-MB231 cells are able to migrate/
invade with the presence of stimulants. This assay was conducted
based on the protocol by Chen (2005) [17]. In the invasion assay, a
layer of matrigel was applied to the upper chamber, whereas for
the migration assay, the chamber was not coated with any
basement membrane. This extracellular basement membrane was
prepared by diluting to a ratio of 1:3 with serum-free media and
was left to solidify for 2 hours in a 37uC incubator. Prior to the
experiment, MDA-MB231 cells were serum starved for 24 hours
before being seeded in transwell chambers at a density of 2x105
PLOS ONE | www.plosone.org
3
October 2014 | Volume 9 | Issue 10 | e105244

Flavokawain A Induces Apoptosis and Inhibits the Metastatic Process
Table 1. The values of IC25, IC50 and IC75of FKA in MCF-7 and MDA-MB231 to be used in other assays.
FKA Concentrations
IC25 (mM)
IC50(mM)
IC75(mM)
MCF-7
9
25
70
65
MDA-MB231
6.5
17.5
doi:10.1371/journal.pone.0105244.t001
antibodies conjugated with HRP. The western blots were then
developed under chemiluminescence condition (SuperSignal West
Pico, Pierce, USA) using the ChemiDoc XRS machine (Bio-rad,
USA). The bands were then analyzed using the Quantity One 1D
Analysis software (Bio-rad, USA).
(17.49 mM) than MCF-7 (25.13 mM) according to Table 3. The
selectivity index was calculated based on the ratio of the IC50
obtained. In Table 3, it can be seen that the selectivity index of
flavokawain A is substantially higher than tamoxifen in both
MCF-7 and MDA-MB231. The BrdU incorporation assay was
also done to confirm the anti-proliferative effects of flavokawain A
(FKA). As seen in Figure 1B, the percentage of BrdU incorpora-
tion decreases as the dose of FKA elevates. Nonetheless, it is
evident that FKA is more potent in inhibiting the proliferation of
MDA-MB231 than MCF-7.
Statistical Analysis
The data are presented as statistical means 6 S.E (Standard
Errors). The cut-off p value for significance was set at p, 0.05.
The statistical comparison analysis was done using the one-way
ANOVA. Graphpad Prism version 4 was used to perform all
statistical analysis.
Cell cycle accumulation at the G2/M phase in MDA-
MB231
Results
To further examine the effects of FKA on the induction of
apoptosis, the effects on the cell cycle machinery was investigated.
Comparing to the control group, there was a substantial increase
in the percentage of cells at the G2/M phase as the dose of FKA
increased from IC25 to IC50 to IC75in MDA-MB231 cells. As in
Figure 1C and Figure S1, the percentage of cells in the G2/M
phase escalated from 24.8960.25% in the control group to
54.9660.57% in the IC75 treatment group. After 24 hours of
treatment, in the MDA-MB231 cells, the percentage of SubG0/
G1 cells increased slowly as the concentration of FKA increases.
The percentage of cells in the G2/M phase also increased
marginally from 16.8661.07% to 25.6360.41% in the IC25
group, 26.8360.40% in the IC50 group and 23.9360.46% in the
IC75 treatment group. Interestingly, there were no significant
arrests at any phase after 12 hours of treatment in MCF-7.
Nevertheless, after 24 hours of treatment in MCF-7, there was a
slight arrest at the G1 phase in the IC25 treatment group from
55.4460.54% to 66.8360.72%. The percentage of Sub G0/G1
cells in MCF-7 also increased as the concentration of FKA
escalates.
Synthesis of FlavokawainA (E)-1-(2’-Hydroxy-4’,6’-
dimethoxyphenyl)-3-(4-methoxyphenylprop-2-en-1-one
Yellow flat crystals: Yield 72.6%, mp 112-115 uC. (Molecular
formula C18H18O5).1HNMR (CDCl3, 500 MHz). d 12.2 (s, 1H,
OH), 8.10(d, 1H, J = 15.5 Hz, Hb), 7.79 (d, 1H, J = 15.5 Hz,
Ha), 7.70 (brd, 2H, H-2, 6), 7.48 (m, 2H, H-3, 5), 6.00 (br,s, 1H,
H-3’), 6.79 (br, s, 1H, H-5’), 3.89 (s, 3H, OMe, C-6’), 3.86 (s, 3H,
OMe, C-4’), 3.80 (s, 3H, OMe, C-4). EI-MS m/z 298.0.
Flavokawain A inhibits the proliferation of MCF-7 and
MDA-MB231
To assess the anti-proliferative effect of flavokawain A on both
MCF-7 and MDA-MB231, as well as on the non-transformed
mammary epithelial cell line, MCF-10A, the MTT assay was
conducted. The cells were treated with 2-fold serial dilutions of
Flavokawain A for 72 hours. Tamoxifen served as a positive
control in this assay. Based on Figure 1A, the effects of
flavokawain A is dose-dependent with 50% of the cell viability is
suppressed below 50 mM. The IC50, (half-maximal inhibitory
concentration) of flavokawain A is lower in MDA-MB231
Table 2. The accession number and sequence of the primers used in the quantitative real-time PCR assay.
Accession Number
Gene
Sequence
NM_001101.3
NM_002046.4
HQ387008.1
ACTB
F: 59-AGAGCTACGAGCTGCCTGAC-39R: 59-AGCACTGTGTTGGCGTACAG-39
F: 5- GGATTTGGTCGTATTGGGC-3R: 5- TGGAAGATGGTGATGGGATT-3
F: 5- GTAACCCGTTGAACCCCATT-3R: 5- CCATCCAATCGGTAGTAGCG -3
F: 5- TGTCCGTCAGAACCCATGC-3R: 5- AAAGTCGAAGTTCCATCGCTC-3
F: 5-CCTGCACCGAAACCGAGTTAT-3R: 5- CCGTCATATTCGACTTTGGTTGC-3
F: 5-TCCGGCTAACTCTGAGGACA-3R: 5-AAGAATCGTCGGTTGCAGGT-3
F: 5-ATACGTGGATTGAGGACCACT-3R: 5-TCCAATGTCAAGTAGCGGTTG -3
F: 5-ACAACACTGGAGTCATCAATGC-3R: 5-CCACAGAGAAGGAGCCAATCA-3
F: 5-GACCCCAACCCTTGATGATA-3R: 5-GTGCTTTTGTGCCGATAGAA-3
F: 5-GCTGTGGACTTGAGTTGGG-3R: 5-GCTGGGTTTGTCGGTGTT-3
GAPDH
18S rRNA
p21
NM_001220778.1
NM_005030.3
NM_004064.3
NM_001243089.1
NM_006516.2
NM_000201.2
NM_001287044.1
PLK1
p27
FOXM1
GLUT1
ICAM
VEGF
doi:10.1371/journal.pone.0105244.t002
PLOS ONE | www.plosone.org
4
October 2014 | Volume 9 | Issue 10 | e105244

Flavokawain A Induces Apoptosis and Inhibits the Metastatic Process
Figure 1. Flavokawain A inhibits the proliferation and induces apoptosis in both MCF-7 and MDA-MB231.A) The percentage of cell
viability of MDA-MB231, MCF-7 and MCF-10A when treated with Flavokawain A for 72 hours.B) The percentage of BrdU incorporation in MCF-7 and
MDA-MB231 after being treated with three different concentrations of flavokawain A for 48 hours.C) Histogram analysis of the cell cycle machinery in
MCF-7 and MDA-MB231 after being treated with three different doses of flavokawain A for 12 and 24 hours.D) Histogram analysis of Annexin V/FITC
in MDA-MB231 and MCF-7 after being treated with three different concentrations of flavokawain A after 48 hours. Data are expressed as mean 6
S.E.M with p value, 0.05.
doi:10.1371/journal.pone.0105244.g001
PLOS ONE | www.plosone.org
5
October 2014 | Volume 9 | Issue 10 | e105244

Flavokawain A Induces Apoptosis and Inhibits the Metastatic Process
Table 3. The average values of IC50 in MCF-7, MDA-MB231 and MCF-10A after being treated with FKA and tamoxifen, as well as
the selectivity index.
Flavokawain A
Tamoxifen
Cell Lines
IC50 (mM)
MDA-MB231
MCF7
17.49 6 1.50
25.13 6 3.00
.100
25.84 6 1.60
24.76 6 0.80
26.24 6 1.21
MCF-10A
Selectivity Index
MCF-10A/MDA-MB231
MCF-10A/MCF-7
5.42
3.78
1.01
1.06
doi:10.1371/journal.pone.0105244.t003
Similarly, the same pattern can be seen in MDA-MB231 treated
cells, the level of activation of caspase 8 and 9 is depending on the
dose given. Nevertheless, unlike MCF-7 treated cells, there is a
much more significant increase in the activation of caspase 9 than
caspase 8 in MDA-MB231 cells.
Flavokawain A induces apoptosis in MCF-7 and MDA-
MB231
It is imperative to assess the mode of cell death that FKA
induces. The morphological changes of both MCF-7 and MDA-
MB231 upon treatment with flavokawain A were also observed via
AO/PI double staining (Figure S2). The detection of the
externalization of phosphatidylserine was performed. Based on
Figure 1D, there is a pattern of cell population shifting from viable
to early apoptosis to late apoptosis/necrosis in both MCF-7 and
MDA-MB231. The percentage of early apoptotic cells in MDA-
MB231 increased gradually from 4% in the control group up until
32% in IC75 of the treatment group. A similar pattern can be seen
in the late apoptotic/necrotic cells as well, according to Figure 1D
and figure S3. There is a direct proportional relationship between
the percentage of apoptotic cells and the dose of FKA. In MCF-7
treated cells, the percentage of late apoptotic/necrotic cells also
gradually increased from 1% (control) to 43% (IC75) as the dose
escalates. This suggests that FKA is cytotoxic and induces
apoptosis towards both cell lines in a dose-dependent manner,
similar to the MTT results.
FKA inhibits the motility and invasiveness of MDA-MB231
cells in vitro
To further understand the anti-cancer activity of FKA, the
wound-healing assay was conducted in accordance to Liang et al
[16]. This assay was attempted in MDA-MB231 only since it is
highly invasive than MCF-7. The rate of migration of MDA-
MB231 cells is dose-dependent; the higher the dose of FKA given,
the lower the percentage of migrated cells towards the center of
the wound. In Figure 3A, it can be seen that in the IC12.5
treatment group, the percentage of wound closure decreased to
68.4865.12% from 100% in the control group. There is an
additional decrement in the IC25 and IC50 group with the
percentage of wound closure, 52.2963.85% and 40.6161.85%
respectively.
To further confirm the anti-migration effects of FKA, the
transwell in vitro migration assay was performed. Based on
Figure 3B, the rate of migration through the transwell membrane
decreased as the dose is increased. The IC12.5 treatment group had
a 77.6463.5%; this percentage was reduced in the IC25 treatment
group to 71.2867.3%. Expectantly, the percentage of migrated
cells in the IC50 group also declined. The percentage went down to
48.1164.7%.
The invasiveness of MDA-MB231 through a layer of matrigel
when treated with FKA was also measured. Similar to the in vitro
migration assay, the in vitro invasion assay was also dose-
dependent. In the lowest treatment group, IC12.5, the percentage
of invaded cells was 69.5561.16%. The percentage decreased to
61.4863.0% in the IC25 group. As depicted in Figure 3C, the
percentage of the IC50 group was 52.9866.9%.
Flavokawain Ainduces changes in the Mitochondrial
Membrane Potential (DYm)
To measure the changes in the mitochondrial membrane
potential in MCF-7 and MDA-MB231 cells when treated with
FKA, the JC-1 dye; that emits green fluorescence when it is in
monomers and red when it aggregates, was used. The ratio of
green fluorescence to red fluorescence is proportional to the
strength of the mitochondrial membrane potential (DYm)
[19,20]. Control, healthy cells usually have a polarized (DYm)
and can be detected as aggregates (red fluorescence) (Figure 2A).
In FKA-treated cells, there is a shift in between the percentage of
monomers and aggregates as the dose is increased in both cell
lines, MCF-7 and MDA-MB231. The higher the dose of the FKA
treatment, the lower the ratio of monomers to aggregates as
depicted in Figure 2A.
FKA possesses anti-angiogenic potential
In part of the metastatic cascading steps, angiogenesis also plays
a major role in the formation of secondary tumors. To further
investigate the anti-metastatic potential of FKA, two angiogenic
assays were performed. The HUVEC tube formation assay was
conducted on a layer of matrigel. The number of tubes formed
were scored and analyzed based on the dose of FKA given. As
depicted in Figure 3D, there is a decline in the number of tubes
formed as the dose of FKA is increased. This indicates that FKA
inhibits the formation of new blood vessels in vitro.
FKA mediates apoptosis through caspase 8 and 9
To determine the mode of apoptosis FKA was inducing, the
activation of caspases 8 and 9 in both MCF-7 and MDA-MB231
was determined. After 48 hours of treatment with three different
concentrations of FKA, there is a staggered increase in the
activation of both caspase 8 and 9 in MCF-7 depending on the
dose given. A seen in Figure 2B, it can be implied that the effects
of FKA on MCF-7 is dose-dependent. Interestingly, there is a
much more significant increase in caspase 8 than caspase 9.
PLOS ONE | www.plosone.org
6
October 2014 | Volume 9 | Issue 10 | e105244

Flavokawain A Induces Apoptosis and Inhibits the Metastatic Process
Figure 2. Flavokawain A induces changes in the mitochondrial membrane potential and activates caspase 8 and 9 in MCF-7 and
MDA-MB231. A) Bar chart and histogram analysis of the depolarization of mitochondrial membrane potential of MCF-7 and MDA-MB231 after
treatment with three doses of flavokawain A for 48 hours.B) Detection of the activation of caspase 8 and 9 in both MCF-7 and MDA-MB231 after
48 hours of treatment with three concentrations of flavokawain A. Data are expressed as mean 6 S.E.M..(p,0.05)
doi:10.1371/journal.pone.0105244.g002
To further confirm the anti-angiogenic potential of FKA, the ex
vivo rat aortic ring assay was conducted. Similar to the HUVEC
tube formation assay, in Figure 3E, the outgrowth of vessels from
the fragmented aorta is impeded as the dose of FKA escalates.
This implies that the anti-angiogenic potential of FKA is dose-
dependent.
treatment groups. As in Figure 4, in MDA-MB231 however, the
level of p21, PLK1 and FOXM1 decreased, as the level p27
increased. The protein level of BAX and cytochrome c increased
in both cell lines as shown in Figure 5. Nevertheless, the protein
level of p27 declined in MCF-7 but was shown otherwise in MDA-
MB231. For the metastatic genes, the expressions were only tested
in MDA-MB231 treated cells only, the mRNA level of GLUT1,
ICAM and VEGF decreased significantly as shown in Figure 6.
FKA regulates several apoptosis and metastatic-related
genes and proteins
Discussion
The effects of apoptotic related genes and proteins in MCF-7
and MDA-MB231 when treated with FKA were measured by
qPCR and western blot. In MCF-7, the level of p27, PLK1 and
FOXM1 decreased whereas the level of p21 increased in the
Fighting cancer has been an ongoing battle for decades, and
even now, there is no exact way to treat this disease. One of the
PLOS ONE | www.plosone.org
7
October 2014 | Volume 9 | Issue 10 | e105244

Flavokawain A Induces Apoptosis and Inhibits the Metastatic Process
Figure 3. Flavokawain A inhibits the migration and invasion of cancer cells and possess anti-angiogenic properties. A) Percentage of
wound closure in MDA-MB231 cells when a wound is introduced. Images represent the wound healing of MDA-MB231 when treated with three
different doses of flavokawain A. Magnification: 10x. B) Images ofthein vitrotranswell migration analysis of MDA-MB231 when treated with three
different doses of flavokawain A. for 24 hours. The cells were allowed to migrate through an 8 mM pore membrane. C)Images of the in vitro invasion
analysis of MDA-MB231 when treated with three different doses of flavokawain A. The cells were allowed to invade through a layer of Matrigel for
24 hours. D) In vitro HUVEC tube formation analysis when treated with three different doses of flavokawain A for 18 hours. Magnification: 10X.E) Ex
vivo rat aortic ring analysis when treated with three different doses of flavokawain A. The protrusions of vessels from the aorta were counted
individually. The experiment was done in triplicates and the data are expressed as mean 6 S.E.M. Magnification: 10X.
doi:10.1371/journal.pone.0105244.g003
PLOS ONE | www.plosone.org
8
October 2014 | Volume 9 | Issue 10 | e105244

Flavokawain A Induces Apoptosis and Inhibits the Metastatic Process
most recent approaches to treat breast cancer is by targeting the
human endogenous retrovirus-k antigens using antibodies[21,22].
Although this method is still preliminary it still holds promising
development [21,22]. Nevertheless, though drug therapy has been
revolutionizing rapidly in the past decade, the options of selecting
a viable drug is still limited.FKA has been reported to be cytotoxic
towards bladder cancer [10]. Nevertheless, to the best of our
knowledge, the effect of FKA on breast cancer in vitro has not
been reported yet. The operating mechanism of FKA is not fully
understood yet and therefore, this study attempts to elucidate the
mechanism of cytotoxic and anti-metastasis effects.
was further confirmed based on the changes in the cell
morphological features as seen in the double staining AO/PI.
Furthermore, as demonstrated by the JC-1 assay, FKA triggered
the depolarization in the mitochondrial membrane potential in
both MCF-7 and MDA-MB231. To use JC-1 as a main indicator
regarding the changes of the mitochondrial membrane potential is
bias. Therefore, the mechanistic activity of FKA was further
analyzed by the expression of apoptotic related proteins and genes.
FKA increased the expression of BAX as well as cytochrome c in
both MCF-7 and MDA-MB231. Bax is traditionally known as a
member of the BCL family and is widely known as its role as a pro-
apoptotic protein [23]. Bax is one of the proteins that induces
changes in the mitochondrial potential upon apoptotic stimuli, this
ultimately leads to the secretion of cytochrome c, another pro-
apoptotic protein [23,24]. Cytochrome c, in turns, stimulates the
caspase cascade activation and subsequently, cell death [24]. The
activation of caspase 9 is directly related to the level of cytochrome
c. Caspase 9 is known to be involved in the activation of the
intrinsic apoptosis pathway [25]. The activation of caspase 9 is
essential to induce the changes in the mitochondrial morphological
features as well as ROS production [25]. Caspase 8 on the other
hand, is more likely to be involved in the execution of apoptosis
through the extrinsic pathway [26]. This protein is usually
activated by receptors such as Fas ligand or TNF receptors [27].
Downstream of caspase 8 is usually other effector caspases that
induces apoptosis [27]. As depicted in Figure 3B, there is a
substantial increase in the activation of caspase 8 and 9 in both
MCF-7 and MDA-MB231. Interestingly, in MCF-7, the activation
of caspase 8 is more significant than caspase 9, unlike MDA-
MB231 where the reverse effect is seen. The level of cytochrome c
is much more higher in MDA-MB231 than MCF-7 and this could
explain the higher level of activation of caspase 9. This implies that
FKA may act differently in different types of cancer cells.
As evidenced by the preliminary MTT assay, FKA inhibited the
proliferation of both MCF-7 and MDA-MB231 in a dose
dependent manner. Based on the IC50 value, FKA inhibited the
proliferation in MDA-MB231 better than in MCF-7. In terms of
selectivity, FKA is more selective than tamoxifen, a commonly
used drug to treat breast cancer. The selectivity index of FKA in
MDA-MB231 is much higher than in MCF-7. The results
obtained from our study suggest that FKA was cytotoxic toward
both MCF-7 and MDA-MB231. The IC50 values of FKA on two
types of bladder cancer with different status of p53 were reported
to be around 17 mM [9].As shown in our Annexin V FACS
analysis, in FKA-treated cells, there is a shift in the pattern of the
externalization of phosphatidylserine. This indicates that FKA
induced apoptosis in both cell lines. Additionally, this perception
To further understand the action of FKA, the effects of FKA on
the cell cycle progression was analyzed. Intriguingly, there were
some differential effects of FKA in both MCF-7 and MDA-
MB231. It can be seen in the cell cycle analysis, that FKA induced
a significant G2/M arrest in MDA-MB231 after 12 and 24 hours
of treatment, but not in MCF-7. In MCF-7 there was a minor
arrest at the G1 phase after 24 hours of treatment, but this phase is
shifted towards the sub G0/G1 phase consequently. It has been
reported, that FKA induces different effects depending on the
status of the p53, in p53-mutant cells it is more likely to induce a
G2/M arrest instead of G1 arrest in p53-wild type cells [10]. This
could explain the different effects of FKA on MCF-7 and MDA-
MB231, as MCF-7 possesses wild-type p53 whereas MDA-MB231
has a mutant type p53 [28]. Based on the qPCR and western blot
analysis, the level of p27 is increased in MDA-MB231 while the
mRNA expression of p21, decreased significantly in MDA-
MB231. The pattern of expression of both of these cell cycle
regulatory proteins could explain the resulting effects of the G2/M
phase arrest seen in MDA-MB231 cells. Nevertheless, for the
MCF-7 treated cells, there is an increase in the p27 expression
only in the IC25 treatment group, doses higher than that led to a
decrement of the protein. Inversely, there was an increase in the
p21 mRNA expression in MCF-7 cells. Both these proteins are
major players in the G1 phase and as such, could explain the G1
arrest in MCF-7. The mRNA expression of G2/M related cell
cycle regulatory proteins such as PLK1 and Forkhead Box M1
were also measured. PLK1 is a mitotic polo like kinase that
controls multiple stages of cell cycle entries [29–31]. PLK1 is often
overexpressed in several tumors including breast cancer [31]. The
depletion of PLK1 is associated with the arrest at the G2/M phase
and consequently, apoptosis [30]. FOXM1 on the other hand, is a
Figure 4. qPCR analysis of apoptosis and cell cycle related
genes; p27, p21, PLK1 and WEE1 in MCF-7 and MDA-MB231
after treatment with three doses of flavokawain A for 18 hours.
The experiment was done in triplicates and the data are expressed as
mean 6 S.E.M.
doi:10.1371/journal.pone.0105244.g004
PLOS ONE | www.plosone.org
9
October 2014 | Volume 9 | Issue 10 | e105244

Flavokawain A Induces Apoptosis and Inhibits the Metastatic Process
Figure 5: Western Blot analysis of apoptotic-related proteins; BAX, Cytochrome C, and p27 in both MCF-7 and MDA-MB231 after
24 hours of treatment with three concentrations of flavokawain A.
doi:10.1371/journal.pone.0105244.g005
substrate for PLK1 in regulating the cell cycle machinery [29]. As
depicted in Figure 4, FKA managed to inhibit the mRNA
expression of both PLK1 and FOXM1 significantly in MCF-7
and MDA-MB231. Nevertheless, the inhibition was much more
significant in MDA-MB231 as there was a substantial G2/M
arrest in the treated group.
assay, the rate of migration of the cells towards the center of the
wound is dependent on the dose of FKA given. This indicates that
FKA is more effective in inhibiting the migration of cells at a
higher concentration. Additionally, this pattern can also be seen in
the in vitro transwell migration and invasion assay. The potential
use of FKA as anti-cancer agent is further strengthened by the
anti-angiogenic assays. Angiogenesis is a process whereby cancer
cells form new blood vessels to supply for nutrients [32]. This step
is vital in order for cancer cells to become malignant. As
The anti-cancer activity of FKA was further evaluated for its
anti-metastatic potential. There are several steps in metastasis; and
migration is one of the crucial stages [4]. In the wound-healing
PLOS ONE | www.plosone.org
10
October 2014 | Volume 9 | Issue 10 | e105244

Flavokawain A Induces Apoptosis and Inhibits the Metastatic Process
demonstrated in the in vitro tube formation assay, and the ex vivo
rat aortic ring assay, FKA managed to inhibit the formation of
new vessels significantly. From the qPCR and western blot results,
FKA inhibited the expression of VEGF in MDA-MB231. VEGF is
a common associate to metastasis, especially in breast cancer. The
level of VEGF is highly correlated with the initiation of
angiogenesis. On a related note, cancer cells have an unusual
high demand of energy in order to sustain. The Warburg effect is a
popular theory in the participation of aerobic glycolysis in tumor
[33]. GLUT1 is a glucose transporter that plays a major role in the
glycolytic pathway and is often related to the malignant type of
cancer [34,35]. FKA treatment decreased the mRNA expression
of GLUT1 in MDA-MB231. Additionally, ICAM-1 is a glyco-
protein that is regularly involved in the immune response and
tumorigenesis [36]. This protein is highly expressed in most
malignant tumors [36]. Based on the qPCR reactions, FKA was
found to reduce the mRNA expression of ICAM1 significantly.
Figure 6. qPCR analysis of metastasis-related genes; GLUT1,
VEGF and ICAM in Flavokawain A-treated MDA-MB231 after
18 hours of treatment. The experiment was done in triplicates and
the data are expressed as mean 6 S.E.M.
Conclusions
This study suggests that FKA has a promising anti-cancer
potential especially in treating breast cancer. Figure 7 illustrates
the possible pathway of FKA depending on the p53 status of the
cancer cells. FKA induces apoptosis in both MCF-7 and MDA-
MB231 dose-dependently. FKA induces G2/M arrest in MDA-
MB231 only and thus implying that there is a selective anti-cancer
doi:10.1371/journal.pone.0105244.g006
Figure 7. Probable operative mechanisms of Flavokawain A in cancer cells with different status of p53.
doi:10.1371/journal.pone.0105244.g007
PLOS ONE | www.plosone.org
11
October 2014 | Volume 9 | Issue 10 | e105244

Flavokawain A Induces Apoptosis and Inhibits the Metastatic Process
activity of FKA depending on the p53 status. Thus, FKA is
promising to treat more aggressive triple negative breast cancer
with mutant p53.In terms of metastasis, FKA inhibited the
migration and invasion of MDA-MB231 significantly. Addition-
ally, FKA also holds promising anti-angiogenic potential as it
impeded the growth of vessels in in vitro and ex vivoexperimental
models. Overall, FKA can be seen as a breakthrough candidate in
battling cancer as well as become an anti-metastatic agent.
Nevertheless, further in depth analysis including in vivo trial is
needed to better understand the functional machinery of FKA.
Figure S2 AO/PI double staining of MCF-7 and MDA-
MB231 after being treated with three different doses of
FKA for 48 and 72 hours.
(TIFF)
Figure S3 Bar chart analysis of the annexin v assay in
MCF-7 and MDA-MB231 after 24 h, 48 h and 72 h of
treatment with three doses of flavokawain A. The
experiment was done in triplicates and the data are expressed as
mean 6 S.E.M. (p,0.05)
(TIFF)
Supporting Information
Author Contributions
Figure S1 Bar chart analysis of the cell cycle analysis in
MCF-7 and MDA-MB231 after 12 and 24 hours of
treatment with flavokawain A. The experiment was done
in triplicates and the data are expressed as mean 6 S.E.M.
(p,0.05)
Conceived and designed the experiment: NA SKY NBA. Performed the
experiments: NA MNA SKY AJZ. Analyzed the data: SKY NA KLL
WYH NBA. Contributed reagents/materials/analysis tools: SKY MNA
ARO MPA MRS NBA. Contributed to the writing of the manuscript: NA
SKY NBA.
(TIFF)
References
20. Cossarizza A, Baccaranicontri M, Kalashnikova G, Franceschi C (1993) A New
Method for the Cytofluorometric Analysis of Mitochondrial Membrane
Potential Using the J-Aggregate Forming Lipophilic Cation 5,59,6,69-Tetra-
chloro-1,19,3,39 tetraethylbenzimidazolcarbocyanine Iodide (JC-1). Biochemical
and Biophysical Research Communications 197: 5.
21. Cegolon L, Salata C, Weiderpass E, Vineis P, Palu` G, et al. (2013) Human
endogenous retroviruses and cancer prevention: evidence and prospects. BMC
Cancer 13: 10.
1. Siegel R, Naishadham D, Jemal A (2013) Cancer Statistics, 2013. CA: A cancer
Journal for Clinicians 63: 19.
2. Bauma M, Demichelib R, Hrusheskyc W, Retskyd M (2005) Does surgery
unfavourably perturb the ‘‘natural history’’ of early breast cancer by accelerating
the appearance of distant metastases? European Journal of Cancer 41: 7.
3. Ganz PA, Kwan L, Stanton AL, Bower JE, Belin TR (2011) Physical and
Psychosocial Recovery in the Year After Primary Treatment of Breast Cancer.
Journal of Clinical Oncology 29: 8.
22. Wang-Johanning F, Rycaj K, Plummer JB, Li M, Yin B, et al. (2012)
Immunotherapeutic Potential of Anti-Human Endogenous Retrovirus-K
Envelope Protein Antibodies in Targeting Breast Tumors. Journal of the
National Cancer Institute 104: 21.
23. Eskes R, Antonsson B, Osen-Sand A, Montessuit S, Richter C, et al. (1998) Bax-
induced Cytochrome C Release from Mitochondria Is Independent of the
Permeability Transition Pore but Highly Dependent on Mg2+ Ions. J Cell Biol
143: 7.
24. Jiang X, Wang X (2004) Cytochrome C-Mediated Apoptosis. Annual Review of
Biochemistry 73: 19.
25. Brentnall M, Rodriguez-Menocal L, Guevara RLD, Cepero E, Boise LH (2013)
Caspase-9, caspase-3 and caspase-7 have distinct roles during intrinsic apoptosis.
BMC Cell Biology 14: 9.
26. Parrish AB, Freel CD, Kornbluth S (2013) Cellular Mechanisms Controlling
Caspase Activation and Function. Cold Spring Harbor Perspectives in Biology 5.
27. Kruidering M, Evan GI (2000) Caspase-8 in Apoptosis: The Beginning of ‘‘The
End’’? Life 50: 5.
28. Gartel A, Feliciano C, Tyner A (2003) A new method for determining the status
of p53 in tumor cell lines of different origin. Oncol Res 13: 3.
29. Fu Z, Malureanu L, Huang J, Wang W, Li H, et al. (2008) Plk1-dependent
phosphorylation of FoxM1 regulates a transcriptional programme required for
mitotic progression. Nature Cell Biology 10: 6.
30. Liu X, Erikson RL (2003) Polo-like kinase (Plk)1 depletion induces apoptosis in
cancer cells. PNAS 100: 5.
31. Takai N, Hamanaka R, Yoshimatsu J, Miyakawa I (2005) Polo-like kinases (Plks)
and cancer. Oncogene 24: 4.
4. Zijl Fv, Krupitza G, Mikulits W (2011) Initial steps of metastasis: Cell invasion
and endothelial transmigration. Mutation Research/Reviews in Mutation
Research 728: 11.
5. Newman DJ, Cragg GM (2012) Natural Products as Sources of New Drugs over
the 30 Years from 1981 to 2010{. J Nat Prod 75: 24.
6. Rocha AB, Lopes RM, Schwartsmann G (2001) Natural products in anticancer
therapy. Current Opinion in Pharmacology 1: 5.
7. Dharmaratne HRW, Nanayakkara NPD, Khan IA (2002) Kavalactones from
Piper methysticum, and their 13 C NMR spectroscopic analyses. Phytochemistry
59: 429.
8. Lebot V, Merlin M, Lindstrom L (1997) Kava: The Pacific Elixir: The Definitive
Guide to Its Ethnobotany, History, and Chemistry; Bear&Co, editor: Yale
University Press.
9. Abu N, Ho WY, Yeap SK, Akhtar MN, Abdullah MP, et al. (2013) The
flavokawains: uprising medicinal chalcones. Cancer Cell International 12: 7.
10. Tang Y, Simoneau AR, Xie J (2008) Effects of the Kava Chalcone Flavokawain
A Differ in Bladder Cancer Cells with Wild-type versus Mutant p53. Cancer
Prevention Research 1.
11. Steiner G (2000) The correlation between cancer incidence and kava
consumption. Hawaii Med J 59: 2.
12. Batovska DI, Todorova IT (2010) Trends in Utilization of the Pharmacological
Potential of Chalcones. Current Clinical Pharmacology 5: 29.
¨
13. Janicke RU (2009) MCF-7 breast carcinoma cells do not express caspase-3.
Breast Cancer Research and Treatment 117: 3.
14. Mosmann T (1983) Rapid colorimetric assay for cellular growth and survival:
Application to proliferation and cytotoxicity assays. Journal of Immunological
Methods 65: 8.
32. Fidler I (2000) Angiogenesis and cancer metastasis. Cancer J 6: 7.
33. Robey I, Stephen R, Brown K, Baggett B, Gatenb R, et al. (2008) Regulation of
the Warburg effect in early-passage breast cancer cells. Neoplasia 10: 11.
34. Airley R, Loncaster J, Davidson S, Bromley M, Roberts S, et al. (2001) Glucose
Transporter Glut-1 Expression Correlates with Tumor Hypoxia and Predicts
Metastasis-free Survival in Advanced Carcinoma of the Cervix. Clinical Cancer
Research 7: 6.
35. Krzeslak A, Wojcik-Krowiranda K, Forma E, Jozwiak P, Romanowicz H, et al.
(2012) Expression of GLUT1 and GLUT3 Glucose Transporters in Endometrial
and Breast Cancers. Pathology Oncology Research 18: 7.
15. Haughland R (2002) Handbook of fluorescent probes and research products
Molecular Probes 9.
16. Liang C, Park A, Guan J (2007) In vitro scratch assay: a convenient and
inexpensive method for analysis of cell migration in vitro. Nature Protocols 2: 4.
17. Chen H (2005) Boyden chamber assay. Methods in Molecular Biology 294: 7.
18. Ponce ML (2009) Tube Formation: an In Vitro Matrigel Angiogenesis Assay.
Methods in Molecular Biology 467: 5.
19. Smiley ST, Reers M, Mottola-Hartshorn C, Lin M, Chen A, et al. (1990)
Intracellular heterogeneity in mitochondrial membrane potentials revealed by a
J-aggregate-forming lipophilic cation JC-1. PNAS 88: 4.
36. Rosette C, Roth RB, Oeth P, Braun A, Kammerer S, et al. (2005) Role of
ICAM1 in invasion of human breast cancer cells. Carcinogenesis 26: 7.
PLOS ONE | www.plosone.org
12
October 2014 | Volume 9 | Issue 10 | e105244