Effects of cultured Cordyceps mycelia polysaccharide A on tumor neurosis factor-α induced hepatocyte injury with mitochondrial abnormality

Article abstract of DOI:10.1016/j.carbpol.2017.01.019

Cordyceps sinensis mycelia polysaccharide A (CPS-A), was isolated from cultured Cordyceps mycelia by 65% alcohol extraction and ion-exchange column chromatography. The molecular weight of CPS-A was 1.2?×?10⁴?Da and the backbone was mainly composed of (1?→?2)-linked β-D-mannopyranose, (1?→?2,4)-linked β-D-mannopyranose and (1?→?4)-linked α-D-glucopyranose with terminal β-D-mannopyranose and α-D-glucopyranose residues. CPS-A played a protective role against TNF-α induced mitochondria injury in L02 cells via up-regulation of mitofusin 2, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), and membrane potential. CPS-A also played a protective role against TNF-α induced L02 cells apoptosis via up-regulation of Bcl-2 and down-regulation of Bid, Bax, cleaved caspase-3, cleaved caspase-9 and ROS production. Moreover, CPS-A attenuated both the normal expression and overexpression of TNF-α receptor 1 (TNFR1) induced by TNF-α administration. In conclusion, CPS-A was involved in TNF-α induced mitochondria abnormality via TNFR1/ROS/Mfn2 pathway.

Full text of DOI:10.1016/j.carbpol.2017.01.019

Accepted Manuscript
Title: Effects of cultured Cordyceps mycelia polysaccharide A
on tumor neurosis factor-␣ induced hepatocyte injury with
mitochondrial abnormality
Author: <ce:author id="aut0005"
author-id="S0144861717300206-
eeb39cb1f4cd3d09702b829db6803fff"> Huiling
Tang<ce:author id="aut0010"
author-id="S0144861717300206-
9
8ad71373043388404c3e4b2fee2e3a1"> Weikun
Wei<ce:author id="aut0015"
author-id="S0144861717300206-
2
75e81903cdef7d0c5f052c118a35854"> Wang
Wang<ce:author id="aut0020"
author-id="S0144861717300206-
1
6202160cfc5db66b0926ee7fabde3b8"> Zhengqi
Zha<ce:author id="aut0025"
author-id="S0144861717300206-
8
d1bc6b9a466b3bc360e3c2b61d98a5a"> Ting Li<ce:author
id="aut0030" author-id="S0144861717300206-
ee95b825e61eb3f56052a3b80c77e18"> Zhijie
3
Zhang<ce:author id="aut0035"
author-id="S0144861717300206-
1
fb67eb8c86d448cb2d0669f8bea80ab"> Chen Luo<ce:author
id="aut0040" author-id="S0144861717300206-
d8dd16710e218f5657bf50d2706a3347"> Hongping
Yin<ce:author id="aut0045"
author-id="S0144861717300206-
0
7b54cde2e0050ac67d7e1f880fcf2e3"> Fengjie
Huang<ce:author id="aut0050"
author-id="S0144861717300206-
b440db44b623e039eef05f316b82156d"> Ying
Wang
PII:
S0144-8617(17)30020-6
DOI:
Reference:
http://dx.doi.org/doi:10.1016/j.carbpol.2017.01.019
CARP 11897
To appear in:
Received date:
21-7-2016

Revised date:
Accepted date:
4-1-2017
4-1-2017
Please cite this article as: Tang, Huiling., Wei, Weikun., Wang, Wang., Zha, Zhengqi., Li,
Ting., Zhang, Zhijie., Luo, Chen., Yin, Hongping., Huang, Fengjie., & Wang, Ying.,
Effects of cultured Cordyceps mycelia polysaccharide A on tumor neurosis factor-
␣
induced hepatocyte injury with mitochondrial abnormality.Carbohydrate Polymers
http://dx.doi.org/10.1016/j.carbpol.2017.01.019
This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.

Effects of cultured Cordyceps mycelia polysaccharide A on tumor neurosis
factor-α induced hepatocyte injury with mitochondrial abnormality
Huiling Tang1,2,#, Weikun Wei , Wang Wang , Zhengqi Zha , Ting Li , Zhijie
1,#
3
1
4
1
1
1
1,*
1,*
Zhang , Chen Luo , Hongping Yin , Fengjie Huang , Ying Wang
1
School of Life Science and Technology, State Key Laboratory of Natural Medicines,
China Pharmaceutical University, Nanjing 210009, People’s Republic of China
2
Department of Pharmacy, Jiangsu Food & Pharmaceutical Science College, Huaian
2
23003, People's Republic of China
3
Basic Medical College, Nanjing University of Chinese Medicine, Nanjing 210046,
People’s Republic of China
4
School of Pharmaceutical Sciences, Shandong University, Jinan 250012, People’s
Republic of China.
#Both the authors worked equally to this work.
*Corresponding authors: hfj@cpu.edu.cn (FJ Huang); ywang@cpu.edu.cn (Y Wang)
Postal address: No. 24 Tongjiaxiang Road, Nanjing 210009, Jiangsu, People’s
Republic of China
Tel: +86 025 83271108;
Fax: +86 025 83271249.
1

Highlights


CPS-A was isolated by 65% alcohol extraction and ion-exchange chromatography.
CPS-A was composed of →2)-β-D-manp-(1→, →2, 4)-β-D-manp-(1→, and
(
1→4)-linked α-D-Glcp.
CPS-A protected TNF-α induced mitochondria abnormality via TNFR1/ROS/Mfn2
pathway.



CPS-A could up-regulate Mfn2, PGC-1α, and membrane potential.
CPS-A released TNF-α induced apoptosis and ROS production in L02 cells.
Abstract
Cordyceps sinensis mycelia polysaccharide A (CPS-A), was isolated from
cultured Cordyceps mycelia by 65% alcohol extraction and ion-exchange column
4
chromatography. The molecular weight of CPS-A was 1.2×10 Da and the backbone
was mainly composed of (1→2)-linked β-D-mannopyranose, (1→2,4)-linked
β-D-mannopyranose and (1→4)-linked α-D-glucopyranose with terminal
β-D-mannopyranose and α-D-glucopyranose residues. CPS-A played a protective role
against TNF-α induced mitochondria injury in L02 cells via up-regulation of
mitofusin 2, peroxisome proliferator-activated receptor gamma coactivator 1-alpha
(PGC-1α), and membrane potential. CPS-A also played a protective role against
TNF-α induced L02 cells apoptosis via up-regulation of Bcl-2 and down-regulation of
Bid, Bax, cleaved caspase-3, cleaved caspase-9 and ROS production. Moreover,
2

CPS-A attenuated both the normal expression and overexpression of TNF-α receptor 1
TNFR1) induced by TNF-α administration. In conclusion, CPS-A was involved in
(
TNF-α induced mitochondria abnormality via TNFR1/ROS/Mfn2 pathway.
Key words: Cordyceps sinensis mycelia polysaccharide A; Mitochondria abnormality;
TNF-α receptor 1; Mitofusin 2; Apoptosis
1
. Introduction
Mitochondrial abnormality is associated with the development of nonalcoholic
fatty liver, which causes life-threatening liver damage (Hikita et al., 2015; Kathirvel,
Morgan, French, & Morgan, 2013). Mitochondria play an important role in free
radical production, energy metabolism, aging and cell apoptosis. Mitofusin-2 (Mfn2)
is a mitochondrial membrane protein that participates in mitochondrial fusion and
contributes to the maintenance and operation of the mitochondrial network (Bach et
al., 2003). Mitochondria fusion could preserve cells from death while apoptosis
restrains mitochondria fusion. Therefore, inhibition of hepatocyte apoptosis and
amelioration of liver damage might be regulated by Mfn2 (De Brito & Scorrano,
2
008). Peroxisome proliferator–activated receptor gamma co-activator (PGC)-1α is a
thermogenic transcriptional co-activator, which is involved in energy metabolism
through regulation of mitochondrial biogenesis and respiration (Wu et al., 1999). Li et
al. (2004) found that the overexpression of Mfn2 decreased hepatic injury in livers
and L02 cells treated with TNF-α, however, without up-regulating PGC-1α.
3

TNF-α is a cell signaling protein involved in systemic inflammation, which is
ascribed to induce ROS production in mitochondria, as well as to alter mitochondrial
function by impairing membrane permeability (Busquets et al., 2003). TNF-α
interacts with two cognate receptors: TNF receptor type 1 (TNFR1) and TNF receptor
type 2 (TNFR2). TNFR1 is ubiquitously expressed in most tissues, and it can be fully
activated by both the membrane-bound and soluble trimeric forms of TNF; in addition,
TNFR2 is found only in cells of the immune system, responding to the
membrane-bound form of the TNF homotrimer (Desmouliere & Guyot, 2004).
Cordyceps sinensis, a traditional Chinese medicine, has been used for thousands
of years to maintain health and treat a wide range of disorders (Yan, Wang, & Wu,
2
014). Polysaccharides extracted from C. sinensis had significant activities in the
treatment of tumor, oxidative effects, renal dysfunction, and liver disease (Shashidhar,
Giridhar, Sankar, & Manohar, 2013). Peng et al. (2013) found that a polysaccharide
extracted from C. sinensis had a potent effect on anti-liver fibrosis associated with the
inhibition of HSC activation and TGF-β1/Smads signaling pathway. Our group
reported that C. sinensis polysaccharide CPS-2 and its active fragment CPS-F showed
protective effects against renal injury and kidney inflammation. Since the underlying
molecular mechanism of hepatocyte injury caused by mitochondria-associated
apoptosis remains unclear in our previous studies (Wang et al., 2014b; Wang et al.,
2
015), an active polysaccharide CPS-A was extracted by 65% ethanol at pH 2.0 in the
present study, and the mechanism of its remarkable protective effects were also
studied.
4

Mitochondrial impairment is hypothesized to contribute to the pathogenesis of
chronic liver diseases. Li et al. (2014) reported that TNF-α induced down-regulation
of Mfn2 and PGC-1α in a rat liver IRI model, which was associated with hepatic
mitochondrial swelling, increased levels of ROS and alanine aminotransferase (ALT)
activity, as well as L02 cell apoptosis. Wang et al. (2012) reported that the protective
effect of water extracts of Cordyceps sinensis against t-BHP-induced HepG2 cells
might be a result of the reduction of ROS, the modulation of Bcl-2 and Bax,
mitochondrial membrane potential and SOD activity in hepatocytes. Additionally, the
overexpression of Mfn2 effectively attenuated mitochondrial fragmentation and
reversed the mitochondrial damage observed in glycochenodeoxycholic acid treated
L02 cells (Chen et al., 2013). Taken together, these findings indicate that the
pathogenesis of the liver damage is highly associated with mitochondrial abnormality,
the loss of Mfn2, and ROS accumulation. In order to clarify the mechanism of the
action of CPS-A in suppressing liver damage, we hypothesized that CPS-A relieved
TNF-α-induced hepatocyte apoptosis through the TNFR1/ROS/Mfn2 signaling
pathway in the present study. We have investigated the effects of CPS-A against
TNF-α-induced mitochondrial abnormality on L02 cells and explored its effects of
CPS-A on mitochondria-associated targets, apoptosis-related proteins, and the TNF-α
receptors.
2
. Materials and methods
2
.1. Materials
Cultured Cordyceps sinensis mycelia were obtained from Changxing
5

Pharmaceutical Co. Ltd., Zhejiang, China. The material was identified as
Cephalosporium sinense Chen, one kind of C. sinensis, by the Institute of
Microbiology, Chinese Academy of Sciences (Microbiological Detection Report
no.169, 2004). Mannose, rhamnose, glucose, galactose, arabinose, xylose, glucuronic
acid, galacturonic acid, ribose, fucose and 1-phenyl-3-methyl-5-pyrazolone (PMP)
were purchased from Sigma-Aldrich (St. Louis, USA). Dextran standards (Mw
8
05,000, 393,000, 210,000, 48,800, 21,700, 10,000, 6,000, and 180) were purchased
from Shodex Co. Ltd (Shodex, china). All other reagents were of analytical grade.
Cell culture materials were obtained from Gibco-BRL (Rockville, MD, USA). Human
recombination TNF-α was purchased from PeproTech (Rocky Hill, NJ, USA).
Reagents used for reverse transcription PCR were purchased from Bio-Rad
Corporation (Hercules, California, USA). TRNzol Plus was from Biouniquer
Corporation (Jiangsu, China). Rhodamine-123 was purchased from Beyotime
(Nanjing, China).
2
.2. Isolation and purification of CPS-A
C. sinensis was refluxed for 2 h in eight-fold 95% ethanol (m/v) to remove fats.
The residue was refluxed again for 3 h in ten-fold 65% ethanol (m/v) at pH 2.0. Then
the supernatant was adjusted to pH 7.0 and precipitated with 95% ethanol until the
final concentration of ethanol was up to 75%. Crude polysaccharide was
deproteinized with Sevag reagent (Savag, Lackman, & Smolens, 1938). After dialysis
and lyophilization, the crude polysaccharide was dissolved and loaded onto a
DEAE-cellulose 52 column (4.5×30 cm). One main fraction eluted by distilled water
6

was collected and further purified on a Sephadex G-50 column (1.0×80 cm) eluted
with distilled water to get one polysaccharide fraction, which was designated as
CPS-A.
2
.3. Purity and molecular weight of CPS-A
Purity and molecular weight were estimated by high performance gel permeation
chromatography (HPGPC) in 0.1 M NaNO
SB-805, SB-802) were used and the flow rate was 0.35 mL/min. CPS-A was dissolved
in 0.1 M NaNO , and the solution (2 mg/mL, 80 μl) was injected. Dextran standards
were used to establish a standard curve with GPC software.
3
at 30°C. Shodex columns (OHpak
3
2
.4. Monosaccharide constituents of CPS-A
High performance liquid chromatography (HPLC) was conducted to identify the
monosaccharides by the PMP-labeling procedure as described previously (Dai et al.,
010). Briefly, 5 mg CPS-A was hydrolyzed by 2 M TFA for 2 h at 100°C. After
removing TFA, the hydrolysate was derivatized through the addition of 0.6 M NaOH
25 μl) and 0.4 M PMP (50 μl). Afterward, the solution was neutralized with 50 μl of
.3 M HCl and extracted with chloroform three times. The aqueous phase was loaded
2
(
0
into a ZORBAX Eclipse XDB-C18 (250 mm×4.6 mm) column with an acetonitrile to
phosphate buffer (pH 6.7) ratio of 17:83 (v/v). Flow rate was 1 mL/min. The ten
standard monosaccharides were labeled by the same procedure.
2
.5. FT-IR analysis
The mixture of 2 mg CPS-A and 200 mg KBr powder was ground slightly under
infrared lamp, and then was flaked to be scanned by Nicolet Impact 410 FT-IR from
7

−
1
−1
4
000 cm to 400 cm .
2
.6. Methylation and GC-MS analysis
The CPS-A was methylated according to the Ciucanu method (Ciucanu & Kerek,
984). The methylated residues were hydrolyzed with 2 M TFA. The hydrolysates
1
were reduced with NaBH . The partially methylated alditol acetates were analyzed by
4
GC–MS (HP 6890Ⅱ, Agilent USA). The acetylated derivatives were loaded into a
DB-225MS capillary column. The temperature of Ramp 1 was elevated from 160°C to
2
10°C at a rate of 2°C/min, then remained unchanged for 8 min, and the temperature
of Ramp 2 was ramped from 210°C to 240°C at a rate of 5°C/min, then kept at 240°C
for 6 min.
2
.7. NMR spectroscopy
1
13
CPS-A (40 mg) was dissolved in 99.99% D O. 1D ( H and C) NMR and 2D
2
1
1
1
1
NMR, including H- H Correlated Spectroscopy ( H- H COSY), Heteronuclear
Singular Quantum Correlation (HSQC), and Heteronuclear Multiple Bond Correlation
(HMBC) spectra were measured at 25°C with JEOL JNM-ECP 600 NMR
spectrometer (JEOL, Tokyo, Japan). All chemical shifts were in reference to
acetone-d6.
2
2
.8. Biological activity
.8.1. Cell culture
Human hepatocyte HL-7702 (L02) was purchased from cell resource center of
Institutes of Biomedical Sciences of Fudan University. L02 cells were cultured in
Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine
8

serum and 1% penicillin/streptomycin at 37°C in an incubator filled with 5% CO .
2
L02 cells were pre-incubated with 10 mM glutathione (GSH, positive control) or
CPS-A for 12 h, and then induced with 100 ng/mL TNF-α for additional 24 h.
2
.8.2. Cell Viability Assay
MTT assay was carried out to determine the proliferation and growth viability of
L02 cells (Hansen, Nielsen, & Berg, 1989). L02 cells were added in the 96-well plate
5
at 5×10 cells/mL overnight. Different concentrations of TNF-α (0, 0.01, 0.1, 1, 10, 30,
and 100 ng/mL), glutathione (GSH) (0, 0.1, 1, 5, 10, and 25 mM), or CPS-A (0, 12.5,
2
5, 50, 100, and 200 μg/mL) were incubated for 24 h or 48 h at 37°C in the
atmosphere with 5% CO . Each concentration was repeated in three wells. 20μl of 5
2
mg/mL MTT was added into each well and incubated for 4 h. Subsequently, 150 μl of
dimethyl sulfoxide was added into each well and the optical density (OD) was read at
5
70 nm by Microplate Reader (BioTek, USA).
2
.8.3. Apoptosis measurement using DAPI staining
The cells in logarithmic growth phase were seeded in the 6-well plate, and
treated with 100 ng/mL TNF-α for 24 h after pretreatment with 10 mM of GSH, 25,
0, and 100 μg/mL of CPS-A for 12 h. 4% paraformaldehyde was added into each
5
well, and fixed at room temperature. Finally, the cells were stained by DAPI under
dark condition for 15 min after rinsing with PBS three times, and then were observed
under an IX51 inverted fluorescence microscope (Olympus, Japan).
2
.8.4. ROS expression level using DCFH-DA fluorescence probe
L02 cells were added to the 6-well plate, and incubated with 10 mM of GSH, 25,
9

5
0, or 100 μg/mL of CPS-A for 12 h, then were treated with 100 ng/mL TNF-α for 24
h. DCFH-DA (2', 7'-dichlorofluorescin-diacetate) was added into each well, and
reacted at 37°C for 20 min. Then L02 cells were shed using pancreatin without EDTA,
rinsed with PBS three times and resuspended. Subsequently, flow cytometry was
performed to detect ROS generation at an excitation wavelength of 488 nm and an
emission wavelength of 525 nm.
2
.8.5. Mitochondrial membrane potential assay
Mitochondrial membrane potential was measured by Rhodamine-123, an
indicator of mitochondrial membrane potential (Lemasters & Nieminen, 1997).
Briefly, L02 cells in the logarithmic growth phase were added in the 6-well plate at
5
1
×10 cells/mL and stimulated by 100 ng/mL TNF-α for 24 h after pretreatment with
0 mM of GSH, 25, 50, or 100 μg/mL of CPS-A for 12 h. Rhodamine-123 was added
1
to the cells until the concentration reached 10 μg/mL to cultivate at 37°C in the
atmosphere of 5% CO for 20 min. The cells were resuspended in the medium or PBS
2
several times and the fluorescence intensity was assessed by an Accuri C6 cell flow
cytometry (BD Biosciences, Franklin Lakes, NJ, USA).
2
.8.6. Real-Time PCR
Total RNA was detached from L02 cells and RNA concentration was quantified
by Microplate Reader at 260 nm after being dissolved in DEPC water. cDNA was
acquired through the transcription of mRNA using olig(dT) 18 primer via
BU-SuperScript RT KIT (Biouniquer) according to the manufacturer’s instructions.
Real-Time PCR was operated using an ABI 7700 Prism Sequence Detection System
10

and TaqMan primer probes (Applied Biosystems, Foster City, CA, USA). GAPDH
was used as the loading control. Sequences of the primers were as follows: Mfn2
forward primer, 5’-GACCCCGTTACCACAGAAGA-3’ and reverse primer,
5
’-GCAGAACTTTGTCCCAGAGC-3’;
PGC-1α
reverse
TNFR1
forward
primer,
forward
primer,
primer,
primer,
5’-
5’-
CCTGCATGAGTGTGTGCTCT-3’
GCAAAGAGGCTGGTCTTCAC-3’;
TGCCAGGAGAAACAGAACA-3’
AACCAATGAAGAGGAGGGAT-3’;
CTCACTTGCCTGCCGATAA-3’
and
primer,
5’-
and
reverse
5’-
TNFR2
and
and
forward
reverse
forward
reverse
5’-
primer,
primer,
primer,
5
5
5
2
’-CCCTTCTGTCCAACGCACT3’;
’-ATGGTGGTGAAGACGCCAGT-3’
’-GCACCGTCAAGGCTGAGAAC-3’.
.8.7. Western blot
GAPDH
and
L02 cells were harvested and lysed in RIPA buffer. Ninety micrograms of
proteins were loaded into each lane of a 10% sodium dodecyl sulfate
SDS)-polyacrylamide gel and transferred onto polyvinylidene fluoride (PVDF)
(
membranes (Bio-Rad, Hercules, CA, USA). The following antibodies were used:
β-actin (Epitomics, USA); TNFR I, Mfn2, and Bid (Abcam, UK); cleaved caspase-3,
cleaved caspase-9, Bax, and Bcl-2 (Cell Signaling, USA). Protein expression levels
were detected using an enhanced chemiluminescence (ECL) system (BeyoECL Plus,
Beyotime). Immunoblotted bands were quantified using Gel-Pro Analyzer 4.0
software (Media Cybernetics, Rockville, MD, USA) and the protein of interest was
11

normalized to β-actin.
2
.8.8. pGL3-TNFR1 promoter construction
On the basis of the GenBank sequence of Homo sapiens TNFR1 NC_000012.12,
the TNFR1 promoter was amplified by PCR using the specific forward primer
(TCTCTCGAGAGAGTGAGGCAGTGTTGCA)
and
reverse
primer
(TCTACGCGTCTTTGTGATGGTGGTGAGC). Both purified PCR products and
pGL3-Basic vector were conducted to react with XhoI and MluI at 37°C for 3 h and
connected with T4 Ligase at a ratio of 1:3 at 16°C overnight. The pGL3-TNFR1
promoter was transformed into E.coli DH5α competent cells and then cultivated with
5
0 μg/mL Amp at 37°C for 12~48 h. The pGL3-TNFR1 promoter vectors were
transfected with LipofectamineTM 2000 to L02 cells in 24-well plates with DMEM
free antibiotics for 10 h. Meanwhile, pGL3-Basic was transfected as a negative
control and pGL3-SV40 as a positive control. The L02 cells were pre-treated with
various concentrations of CPS-A (25, 50, 100 μg/mL) for 12 h prior to 100 ng/mL
TNF-α stimulation for an additional 24 h. Fluorescence intensity of luciferase reporter
vectors were determined by Microplate Reader (BioTek Instruments, USA).
2
.9. Statistical analysis
Data were expressed as mean ± standard error of the mean (SEM). Differences
were analyzed using one-way analysis of variance (ANOVA), followed by
Student–Newman–Keuls post hoc multiple comparison tests. A p value less than 0.05
was considered statistically.
3
. Results
12

3
.1. Isolation, purification, and monosaccharide composition of CPS-A
CPS-A was obtained by 65% ethanol solution extraction at pH 2.0. Showed as
light yellow powder, CPS-A’s yield was 11.0%. HPGPC was used to determine the
homogeneity and molecular weight of the polysaccharide. A single symmetrical peak
was shown (Fig. 1A), suggesting that CPS-A was a homogeneous polysaccharide. It
had no absorption peaks appeared at 280 or 260 nm, indicating that the absence of
4
protein or nucleic acid. The molecular weight of CPS-A was 1.2×10 Da, as
determined by the correlation with a dextran standard curve (Fig. 1B and 1C). A
monosaccharide analysis conducted by the PMP precolumn derivation method
showed that CPS-A was composed of mannose and glucose with the ratio of 11:2.
(Supplementary data 1).
3
.2. FT-IR spectroscopy analysis of CPS-A
The FT-IR spectrum of CPS-A was examined. The broad and intense bands at
−
1
3
600-3200 cm were attributed to the symmetrical stretching vibration of O-H,
identified as inter-molecular hydrogen bond due to the absence of the bands of
-1
intra-molecular hydrogen bond near 3560 cm but the presence of the bands of
-1
-1
inter-molecular below 3400 cm (Hu, Liang, & Wu, 2015). The band at 1122 cm
-1
was attributed to vibrations of C-O-C linkages. The band at 1055 cm was the result
of vibrations of C-O-H. The bands at 1638 cm-1 was attributed to the characteristic
-1
-1
peak of bound water (Liu et al., 2016). The bands at 844±8 cm and 891±7 cm
indicated the presence of α and β epimerides, respectively (Cai, Xie, Chen, & Zhang,
013).
2
13

3
.3. Methylation and GC-MS analyses of CPS-A
CPS-A was methylated and converted into five main types of alditol acetates at a
relative ratio of 4.4:17.1:43.7:27.5:7.4 (Table 1). GC-MS chromatograms of
methylated sugars of CPS-A were shown in Supplementary data 2.
2
4
1
1
,4,5-tetra-O-acetyl-3,6-di-O-methyl-mannitol
was
originated
from
→2,
)-Manp-(1→, indicating that CPS-A contains
,5-di-O-acetyl-2,3,4,6-tetra-O-methyl-Manp
a
branched structure.
and
,5-di-O-acetyl-2,3,4,6-tetra-O-methyl-Glcp were originated from Manp-(1→ and
Glcp-(1→, respectively. Terminal Manp and terminal Glcp existed in the end of main
chain or branched chain. Combining weight-average molecular weight and molar
proportion, it can be speculated that the main chain of CPS-A was comprised of
→
2)-Manp-(1→, →2, 4)-Manp-(1→, and →4)-Glcp-(1→ residues.
3
.4. NMR spectroscopy analysis of CPS-A
1H NMR spectrum was used to preliminarily identify the categories of glycosidic
bonds of polysaccharides (Makarova et al., 2013). There existed both α-configuration
and β-configuration in CPS-A (Fig. 2A). The anomeric proton signals at δ 5.15 and
5
4
.10 were attributed to α-configuration units in pyran ring, while the signals at δ 4.99,
.85, and 4.90 were attributed to β-configuration (Dang et al., 2013). Other proton
signals were situated in the range of δ 3.09-4.01, which were assigned to H2–H6 of
the sugar residues.
According to different chemical shifts of carbon, we can determine not only the
location of the various chemical environment of carbon, but also the molecular
14

configuration and conformation (Ruthes et al., 2013). The 13C NMR spectrum of
CPS-A (Fig. 2B) can be divided into three regions: δ 90~95 for the anomeric carbon
C-1; δ 70~75 for C-2, C-3, C-4, and C-5; and δ 60~70 for C-6. The anomeric carbon
signals appeared at δ 102.54, 102.20, 102.12, and 100.49, suggesting O-linking with
C-1 (Li et al., 2013). The signal at δ 100.49 was attributed to →4)-α-D-Glcp-(1→; the
signal at δ 102.12 was assigned to →2)-β-D-Manp-(1→; and the signal at δ 100.54
was attributed to α-D-Glcp-(1→. Signals at δ 78.83, 78.77, 78.74, and 78.62 indicated
O-linking with C-2, C-3, C-4, and C-5 substituted to varying degrees. The chemical
shifts were shown in Table 2.
HSQC spectrum provides the connectivity information between carbons and its
attached protons (Nie et al., 2011). Taken HSQC spectrum (Fig. 2D) together with
1
1
H- H COSY spectrum (Fig.2C), signals of H-1/C-1 at δ 5.10/100.49, 4.85/102.12,
.90/102.20, 5.15/100.54, and 4.99/102.20 were assigned to five main glycosyl types
4
including →4)-α-D-Glcp-(1→, →2)-β-D-Manp-(1→, →2,4)-β-D-Manp-(1→,
α-D-Glcp-(1→ and β-D-Manp-(1→, respectively. Signals of H-6/C-6 at δ 3.61/60.99,
3
.80/64.74, and 3.61/60.99 were assigned to →2)-β-D-Manp-(1→, α-D-Glcp-(1→,
and →2,4)-β-D-Manp-(1→, respectively. Signals of H-5/C-5 at δ 3.80/69.92 and
.90/78.74 were assigned to →4)-α-D-Glcp-(1→ and β-D-Manp-(1→, respectively.
3
Signals of H-3/C-3 at δ 3.69/73.15 and 3.66/78.43 were assigned to β-D-Manp-(1→
and →2,4)-β-D-Manp-(1→, respectively.
HMBC spectrum gives correlations between carbons and protons that are
separated by two or three bonds (Shang et al., 2012). Signals at δ 5.15/73.15 were
15

assigned to H-1 of β-D-Glcp-(1→ and C-2 of →2, 4)-β-D-Manp-(1→. Signals at δ
5
4
.03/73.15 were assigned to H-2 of →2)-β-D-Manp-(1→ and C-2 of →2,
)-β-D-Manp-(1→. Signals at δ 4.99/78.43 were assigned to H-1 of β-D-Manp-(1→
and C-3 of →2, 4)-β-D-Manp-(1→. Signals at δ 5.03/102.20 were assigned to H-2 of
2)-β-D-Manp-(1→ and C-1 of →2, 4)-β-D-Manp-(1→. Signals at δ 4.85/78.76
→
were assigned to H-1 of →2)-β-D-Manp-(1→ and C-4 of →4)-α-D-Glcp-(1→.
Signals at δ 4.85/71.02 were assigned to H-1 of →2)-β-D-Manp-(1→ and C-2 of
→
4)-α-D-Glcp-(1→ (Fig. 2E).
In summary, the molecular structure of CPS-A was predicted as follows: the
main chain was composed of →2)-β-D-Manp-(1→, →2, 4)-β-D-Manp-(1→, and
4)-α-D-Glcp-(1→ residues with β-D-Manp-(1→ and α-D-Glcp-(1→ as terminal
→
residues. The entire molecule was a kind of repetitive structure composed of
segments.
3
.5. Effects of CPS-A on TNF-α-induced L02 cell viability
TNF-α, involved in the systemic inflammatory response, is an important cytokine
in the induction of apoptosis (Santos et al., 2016). The results of the present study
indicated that TNF-α played an effectively suppressive role on L02 cells when the
concentration was 30 ng/mL. TNF-α significantly reduced the proliferation of L02
cells at 100 ng/mL, which was chosen as the stimulation concentration (Fig. 3A).
Similarly, 10 mM of GSH was chosen as the positive group (Fig. 3B). CPS-A at less
than 100 μg/mL had no inhibitory impact on the growth of L02 cells after treatment
for 48 h (Fig. 3C). As shown in Fig. 3D, L02 cells were pre-incubated with CPS-A (25,
16

5
0, and 100 μg/mL) for 12 h prior to TNF-α treatment. Therefore, CPS-A could
significantly relieve TNF-α-induced L02 injury in a dose-dependent manner.
3
.6. Effect of CPS- A on the TNF-α-induced apoptosis
DAPI assay was employed to monitor cell apoptosis, in which a strong
fluorescence signal was emitted when DAPI combined with DNA in the nucleus
Sourav, Soumya, & Samiran, 2014). As shown in (Fig. 4G), normal nuclei of cells
(
had an intact round morphology and a clear outline. Cell shrinkage, membrane
blebbing, chromatin condensation, and apoptotic bodies (arrows) appeared in TNF-α
group. Pretreatment with GSH or CPS-A caused a statistically significant reduction in
apoptosis compared with the control group. With the concentrations of CPS-A
increasing, the number of normal cells raised and apoptotic bodies decreased.
3
.7. CPS-A inhibited abnormal expression of apoptosis-related protein
To investigate whether CPS-A exerted protective effects on the expression of
apoptosis-related protein, L02 cells were pre-treated with CPS-A (25, 50, and 100
μg/mL) for 12 h, respectively, then incubated with 100 ng/mL of TNF-α. Compared
with the model group, the protein expression of Bid and Bax were decreased in all
treatment groups (Fig. 4A, 4B, and 4C), whereas Bcl-2 expression was reversed to
normal levels by CPS-A pre-treatment (Fig. 4A and 4D).
To further elucidate the mechanism responsible for the anti-apoptosis effect of
CPS-A, the expression levels of caspases were detected by Western blot (Fig. 4C and
D). The results illustrated that the protein levels of cleaved caspase-3 and cleaved
17

caspase-9 were significantly increased, compared with the control group after
stimulation of TNF-α (100 ng/mL). Moreover, CPS-A (50 and 100 μg/mL)
pre-treatment could significantly decrease the mRNA expression of cleaved caspase-3
and cleaved caspase-9 in a dose-dependent manner (Fig. 4E and 4F). `
3
.8. Effects of CPS-A on intracellular ROS production
Since many DNA damage-causing agents turns on the apoptosis pathway through
ROS generation (Chen et al., 2013), the possibility that ROS increasing might be a
key step in the TNF-α-induced apoptosis was evaluated in the present study. The
down-regulated ROS production was determined by flow cytometric analysis using
DCFH-DA as a fluorescence probe. Compared with TNF-α treated group, L02 cells
exposed to CPS-A (25, 50, and 100 μg/mL) showed significant decreases in the
intracellular ROS in a dose-dependent manner (Fig. 5A and 5B).
3
.9. CPS-A raised expression levels of Mfn2 and PGC-1α in TNF-α-induced L02 cells
Mfn2, a sort of highly conserved transmembrane protein, mediates the fusion of
mitochondria, and participates in various cell biological processes such as cell energy
metabolism, cell apoptosis, and cell proliferation (Antonio, Isabel, David, & Pablo,
2
015). In comparison with the model group, a significant rebound of mRNA
expression occurred at 25 μg/mL of CPS-A group. In addition, 50 and 100 μg/mL of
CPS-A exerted an influence on extremely rising expression level of Mfn2 by
TNF-α-induced mitochondrion damage in L02 cells (Fig. 5E). Pre-treatment with
CPS-A dramatically elevated Mfn2 expression in a dose-independent manner (Fig. 5C
18

and 5D), which was consistent with the results of Real-Time PCR experiment.
We further explored the influence of PGC-1α on TNF-α-treated L02 cells. After
TNF-α decreased the mRNA expression of PGC-1α, CPS-A up-regulated the
expression of PGC-1α in a dose-dependent manner (Fig. 5F). In conclusion, CPS-A
could significantly reverse the inhibited expression of Mfn2 and PGC-1α caused by
TNF-α.
3
.10. Analysis of mitochondrial membrane potential in TNF-α-treated L02 cells
The mitochondrial membrane potential of the cells was measured by
rhodamine-123 (Fig. 5G and 5H). A decrease in the mean fluorescence intensity was
observed after treating with TNF-α, which was abolished by CPS-A pre-treatment.
The data indicated that CPS-A relieved TNF-α-induced L02 cells apoptosis, which
was accompanied by the changes in mitochondrial membrane potential.
3
.11. CPS-A regulated the expression of TNF-α receptors
The biological activities of TNF-α, mainly mediated by TNFR1, plays a crucial
role in a range of biological processes such as cell injury, antagonism of viral activity
and fibroblast proliferation (Peltzer, Darding, & Walczak, 2016). TNFR2 mainly
transmits the proliferation signals of thymus cells and NK lymphocytes (Chen et al.,
2
013). Compared with the control group, the gene expression of TNFR1 in the model
group was significantly elevated. CPS-A (100 μg/mL) led to a significant decrease in
TNF-α-induced L02 injury in mRNA expression (Fig. 6A). Meanwhile, the evident
19

change of TNFR2 hardly emerged in mRNA expression. Furthermore, TNFR1
expression was significantly raised after stimulation with TNF-α, compared with the
control group. After treatment with 10 mM of GSH, TNFR1 expression was
significantly lower than that of the model group. Moreover, CPS-A pre-treatment
decreased the expression of TNFR1 in a dose-dependent manner. Lastly, there was no
significant change in TNFR2 expression (Fig. 6B and 6C).
3
.12. CPS-A inhibited TNFR1 promoter activity
In this study, the fluorescence intensity of luciferase reporter genes reflected the
activity of promoter by inserting DNA sequence of gene promoter of TNFR1 into
pGL3 luciferase reporter vector. The pGL3-TNFR1 promoter vectors were
constructed by inserting the promoter regions ~1.8 kb upstream of transcription start
site in TNFR1 genes into pGL3-Basic vector between MluI and XhoI sites, and then
were transferred into L02 cells (Fig. 6D). Meanwhile, pGL3-Basic and pGL3-SV40
were transferred into L02 cells as the negative and positive controls. Fig. 6E indicated
that the transfection was successful because the luciferase intensity in the positive
control group was 15.8 times higher than that of the negative control group. The
promoter activity was increased by one-fold by the treatment of TNF-α, compared
with the control group. In addition, compared with the model group, CPS-A (25, 50,
and 100 μg/mL) significantly lowered the activities of TNFR1 promoter with the
inhibition rates of 15.8%, 24.8%, and 44.9%, respectively.
4
. Discussion
A purified polysaccharide (CPS-A) was obtained from cultured C. sinensis mycelia in
the current study. Fractions with large molecular weight were precipitated by 65% ethanol
20

and then removed. Fractions with relatively low molecular weight were used in the study to
avoid strong immunity reaction in vivo during the further study. Finally, CPS-A was obtained,
and the measurements indicated that CPS-A was composed of →2)-β-D-Manp-(1→,
→
4)-α-D-Glcp-(1→ residues in the straight chain, and →2,4)-β-D-Manp-(1→ residues in the
side chain with the ratio of 9:2. Different from CPS-1, a glucomannogalactan with the
monosaccharide composition of glucose: mannose: galactose=2.8:2.9:1 (Wang et al., 2009),
the monosaccharide composition of CPS-A included only glucose and mannose. The
fundamental findings in the present study could promote further research on structure-activity
relationships of CPS-A, as well as other similar polysaccharides.
TNF-α induces mitochondrial abnormality and excessive ROS production that leads to
hepatocyte injury and apoptosis by sequentially activating the TNFR1/ROS/Mfn2 pathway
(
Li et al., 2014). It has been reported that oxidative stress is an important factor inducing
mitochondrial dysfunction, which results in excessive production of ROS and the imbalance
of oxidation system and antioxidation system (Simon, Haj-Yehia, & Levi-Schaffer, 2000) The
mitochondrial pores oxidized by excessive ROS disrupt the mitochondrial membrane
potential, leading to cytochrome c release (Wang et al., 2015; Park et al., 2014). The present
study revealed that pre-treatment with CPS-A was able to reverse altered mitochondrial
membrane potential to normal levels in a dose-dependent manner. Moreover, we also found
that CPS-A reduced TNF-α-induced ROS production. Taken together, this study suggests that
CPS-A is able to regulate mitochondrial membrane potential and ROS production to relieve
oxidative stress.
Bcl-2 family play a central role in apoptosis, and are apoptotic regulatory proteins that
control the mitochondrial cell death pathway (Wang et al., 2014a). Bcl-2 family members
locate on the mitochondrial membrane, which could alter the permeability of the
mitochondrial membrane. Among Bcl-2 family members, Bcl-2 is an anti-apoptotic protein,
21

while Bax and Bid are pro-apoptotic proteins. The balance between Bcl-2 and Bax is critical
for the induction of apoptosis to determine whether to undergo apoptosis (Wang & Xia, 2016;
Quast, Berger, & Eberle, 2013). Apoptosis is dependent on the expression of Bax, and
abrogated by the overexpression of Bcl-2. In particular, Bax/Bcl-2 regulates the release of
cytochrome c that activates caspase-9 and the downstream effector caspase-3, eventually
inducing apoptosis (Song et al., 2015; Nicholson & Thornberry, 2003). In the present study,
we demonstrated that pre-treatment with CPS-A significantly attenuated TNF-α-induced Bax
and Bid expression, and increased Bcl-2 expression; additionally, CPS-A had a synergistic
effect with the reduction of caspase-3 and caspase-9. These findings suggest that CPS-A is
most likely to suppress TNF-α-induced apoptosis through the activation of Bcl-2 and the
inhibition of Bax generation.
Mitochondrial permeability transition is a vital step in the induction of cellular apoptosis
(Upur et al., 2011). Mfn2 encodes an integral outer mitochondrial network that regulates
mitochondrial metabolism, oxidative stress, and cell death etc (De Brito & Scorrano, 2008).
Loss or down-regulation of Mfn2 has been found in energy dysmetabolism-related diseases.
In this study, CPS-A showed reversing effects against TNF-α-induced decreases in both
mRNA and protein expression of Mfn2, which indicated that CPS-A might release energy
dysmetabolism-related mitochondrial damage. PGC-1α has been well-documented to regulate
Mfn2 activation in hepatocytes, which is based on the observation that TNF-α inhibited both
expression of Mfn2 and PGC-1α (Li et al., 2014).
TNF-α regulates cell survival and apoptosis, depending on the cell type and biological
context (Hehlgans & Pfeffer, 2005). TNF-α production has been shown to be increased in
TNF-α-induced hepatocyte injury and apoptosis both in vitro and in vivo during ischemia
reperfusion, which suggests that TNF-α promotes hepatocyte apoptosis under ischemia
reperfusion conditions (Li et al., 2014). TNF-α activity is mediated by two distinct cell
22

surface receptors: TNFR1 and TNFR2. TNFR1 presents in normal hepatocytes, and is
up-regulated upon apoptosis in response to liver injury, while TNFR2 is rarely expressed in
normal liver cells (Desmouliere & Guyot, 2004). We demonstrated that CPS-A treatment
reduced the overexpression of TNF-α receptor induced by TNF-α via the type-1 receptor, but
not the type-2 receptor. Therefore, these findings suggest that CPS-A has protective effects on
liver parenchyma cells against liver damage to maintain the normal function in liver.
In summary, our study demonstrates that CPS-A exhibits protective effects against
TNF-α-induced mitochondria abnormality via TNFR1/ROS/Mfn2 pathway; CPS-A is able to
efficiently mediate the expression of key factors, such as Mfn2, PGC-1α, and TNFR1, to
attenuate the generation of ROS and mitochondria-related apoptosis cytokines. The present
study provides new insight into the mechanisms underlying the function of CPS-A against
TNF-α induced mitochondria abnormality and L02 cells apoptosis. Combined with our earlier
study (Wang et al., 2014b; Wang et al., 2015), Cordyceps sinensis mycelia polysaccharide is
approved for Phase II clinical trials now. The dosage is 0.25 g×5 pills, three times a day, oral
drug administration. We believed that in addition to reducing renal injury, CPS-A may have
additional therapeutic benefits against liver diseases that are associated with mitochondria
abnormality, oxidation, and apoptosis.
Conflict of Interest
The authors confirm that there are no conflicts of interest.
Acknowledgments
This work was supported by the 2011 National Natural Science Foundation (No.
8
1173527), and 2012 Youth Fund of National Natural Science Foundation (No. 81202900).
This work was also supported by the Industry-University-Institute Cooperation Project of
Science & Technology Department of Jiangsu provincial government (No.BY2015072-01)
and the Fundamental Research Funds for the Central Universities (No.2016ZPY002). A
23

project funded by the Priority Academic Program Development of Jiangsu Higher Education
Institutions (PAPD).
References
Antonio, Z., Isabel, H. M., David, S., & Pablo, M. J. (2015). Mitofusin 2 as a driver that
controls energy metabolism and insulin signaling. Antioxidants & Redox Signaling, 22(12),
1
020-1031.
Bach, D., Pich, S., Soriano, F. X., Vega, N., Baumgartner, B., Oriola, J., et al. (2003).
Mitofusin-2 determines mitochondrial network architecture and mitochondrial metabolism.
Journal of Biological Chemistry, 278, 17190-17197.
Busquets, S., Aranda, X., Ribas-Carbo, M., Azcon-Bieto, J., Lopez-Soriano, F. J., & Argiles, J.
M. (2003). Tumor necrosis factor-alpha uncouples respiration in isolated rat mitochondria.
Cytokine, 22, 1–4.
Cai, W., Xie, L., Chen, Y., & Zhang, H. (2013). Purification, characterization and
anticoagulant activity of the polysaccharides from green tea. Carbohydrate Polymers,
9
2(2), 1086–1090.
Chen, J., Yao, D., Yuan, H., Zhang, S., Tian, J., Guo, W., et al. (2013). Dipsacus asperoides
polysaccharide induces apoptosis in osteosarcoma cells by modulating the PI3K/Akt
pathway. Carbohydrate Polymers, 95, 780-784.
Chen, X., Wu, X., Zhou, Q., Howard, O. M. Z., Netea, M. J., & Oppenheim, J. J. (2013).
TNFR2 is critical for the stabilization of the CD4(+)Foxp3(+) regulatory T cell phenotype
in the inflammatory environment. Journal of Immunology, 190(3), 1076-1084.
Chen, Y. B., Lv, L., Jiang, Z., Yang, H., Li, S., & Jiang, Y. (2013). Mitofusin 2 Protects
Hepatocyte Mitochondrial Function from Damage Induced by GCDCA. PloS one, 8(2),
1
08-115.
Ciucanu, I., & Kerek, F., (1984). A simple and rapid method for the permethylation of
24

carbohydrates. Carbohydrate research, 131(2), 209-217.
Dang, Z., Feng, D., Liu, X., Yang, T., Guo, L., Liang, J., et al. (2013). Structure and
antioxidant activity study of sulfated acetamido-polysaccharide from Radix hedysari.
Fitoterapia, 89, 20–32
Dai, J., Wu, Y., Chen, S. W., Zhu, S., Yin, H. P., Wang, M., et al. (2010). Sugar compositional
determination of polysaccharides from Dunaliella salina by modified RP-HPLC method of
precolumn derivatization with 1-phenyl-3-methyl-5-pyrazolone. Carbohydrate Polymers,
8
2, 629–35.
De Brito, O. M., & Scorrano, L. (2008). Mitofusin 2 tethers endoplasmic reticulum to
mitochondria. Nature, 456(7222), 605-610.
Desmouliere, A., & Guyot, C. C. (2004). The stroma reaction myofibroblast: a key player in
the control of tumor cell behavior. International Journal of Developmental Biology,
4
8(5-6), 509-517.
Hansen, M. B., Nielsen, S. E., & Berg, K. (1989). Re-examination and further development
of a precise and rapid dye method for measuring cell growth/cell kill. Journal of
Immunological Methods, 119, 203–210.
Hehlgans, T., & Pfeffer, K. (2005). The intriguing biology of the tumor necrosis factor/tumor
necrosis factor receptor superfamily: players, rules and the games. Immunology, 115, 1–20.
Hikita, H., Kodama, T., Tanaka, S., Saito, Y., Nozaki, Y., Nakabori, T., et al. (2015).
Activation of the mitochondrial apoptotic pathway produces reactive oxygen species and
oxidative damage in hepatocytes that contribute to liver tumorigenesis. Cancer Prevention
Research, 8(8), 693-701.
Hu, H., Liang, H., & Wu, Y. (2015). Isolation: purification and structural characterization of
polysaccharide from Acanthopanax brachypus. Carbohydrate Polymers, 127, 94–100.
Kathirvel, E., Morgan, K., French, S. W., & Morgan, T. R. (2013). Acetyl-L-carnitine and
25

lipoic acid improve mitochondrial abnormalities and serum levels of liver enzymes in a
mouse model of nonalcoholic fatty liver disease. Nutrition Research, 33(11), 932-941.
Lemasters, J. J., & Nieminen, A. L. (1997). Mitochondrial oxygen radical formation during
reductive and oxidative stress to intact hepatocytes. Bioscience Reports, 17, 281-291.
Li, B., Dobruchowska, J. M., Gerwig, G. J., Dijkhuizen, L., & Kamerling, J. P. (2013).
Structural investigation of water-soluble polysaccharides extracted from the fruit bodies of
Coprinus comatus. Carbohydrate Polymers, 91(1), 314–321.
Li, J., Ke, W., Zhou, Q. Wu, Y. Z., Luo, H., Zhou, H., et al. (2014). Tumor necrosis factor-α
promotes liver ischemia-reperfusion injury through the PGC-1α/Mfn2 pathway. Journal of
Cellular and Molecular Medicine, 18(9), 1863-1873.
Liu, W., Liu, Y. M., Zhu, R., Yu, J. P., Lu, W. S., Pan, C., et al. (2016). Structure
characterization, chemical and enzymatic degradation, and chain conformation of an acidic
polysaccharide from Lycium barbarum L. Carbohydrate Polymers, 147, 114–124.
Makarova, E. N., Patova, O. A., Shakhmatov, E. G., Kuznetsov, S. P., & Ovodov, Y. S. (2013).
Structural studies of the pectic polysaccharide from Siberian fir (Abies sibirica Ledeb.).
Carbohydrate Polymers, 92, 1817–1826.
Nicholson, D. W., & Thornberry, N. A. (2003). Life and death decisions. Science, 299,
2
14–15.
Nie, S., Cui, S., Phillips, A., Xie, M., Phillips, G., Al-Assaf, S., et al. (2011). Elucidation of
the structure of a bioactive hydrophilic polysaccharide from Cordyceps sinensis by
methylation analysis and NMR spectroscopy. Carbohydrate Polymers, 84(3), 894–899.
Park, J., Ko, Y. S., Yoon, J., Kim, M. A., Park, J. W., Kim, W. H., et al. (2014). The forkhead
transcription factor FOXO1 mediates cisplatin resistance in gastric cancer cells by
activating phosphoinositide 3-kinase/Akt pathway. Gastric Cancer, 17, 423–30.
Peltzer, N., Darding, M., & Walczak, H. (2016). Holding RIPK1 on the ubiquitin leash in
26

TNFR1 signaling. Trends in Cell Biology, 26(6), 445-461.
Peng, J. H., Li, X. M., Feng, Q., Chen, L., Xu, L. L., & Hu, Y. Y. (2013). Anti-fibrotic effect
of Cordyceps sinensis polysaccharide: Inhibiting HSC activation, TGF-β1/Smad signaling,
MMPs and TIMPs. Experimental Biology and Medicine, 238(6), 668-677.
Quast, S. A., Berger, A., & Eberle, J. (2013). ROS-dependent phosphorylation of Bax by
wortmannin sensitizes melanoma cells for TRAIL-induced apoptosis. Cell Death and
Disease, 4, 839.
Ruthes, A. C., Carbonero, E. R., Córdovac, M. M., Baggio, C. H., Santos, A. R. S., Sassaki, G.
L., et al. (2013). Lactarius rufus (1 → 3), (1 → 6)-β-d-glucans: Structure, antinociceptive
and anti-inflammatory effects. Carbohydrate Polymers, 94, 129–136.
Santos, M. H. H., Higuchi M, d. L., Tucci P, J. F., Garavelo, S. M., Reis, M. M., Antonio, E.
L., et al. (2016). Previous exercise training increases levels of PPAR-alpha in long-term
post-myocardial infarction in rats, which is correlated with better inflammatory response.
Clinics, 71(3), 163-168.
Savag, M. G., Lackman, D. B., & Smolens, J. (1938). The isolation of the components of
streptococcal nucleoproteins in serologically active form. Journal of Biological Chemistry,
1
24, 425－436
Shang, M., Zhang, X., Dong, Q., Yao, J., Liu, Q., & Ding, K. (2012). Isolation and structural
characterization of the water-extractable polysaccharides from Cassia obtusifoliaseeds.
Carbohydrate Polymers, 90(2), 827–832.
Shashidhar, M. G., Giridhar, P., Sankar, K. U., & Manohar, B. (2013). Bioactive principles
from Cordyceps sinensis: A potent food supplement - A review. Journal of Functional
Foods, 5(3), 1013-1030.
Simon, H. U., Haj-Yehia, A., & Levi-Schaffer, F. (2000). Role of reactive oxygen species
(ROS) in apoptosis induction. Apoptosis, 5, 415–418.
27

Song, G. H., Huang, F. B., Gao, J. P., Liu, M. L., Pang, W. B., Li, W. B., et al. (2015). Effects
of fluoride on DNA damage and caspase-mediated apoptosis in the liver of rats. Biological
Trace Element Research, 166(2), 173-182.
Sourav, K. M., Soumya, C., & Samiran, S. G. (2014). Isolation and characterization of
extracellular polysaccharide Thelebolan produced by a newly isolated psychrophilic
antarctic fungus Thelebolus. Carbohydrate Polymers, 104, 204-212.
Upur, H., Yusup, A., Baudrimont, I., Umar, A., Berke, B., Yimit, D., et al. (2011). Inhibition
of cell growth and cellular protein, DNA, and RNA synthesis in human hepatoma (HepG2)
cells by ethanol extract of abnormal Savda Munziq of traditional Uighur medicine.
Evidence-Bases Complementary and Alternative medicine, 25, 14-24.
Wang, B. S., Lee, C. P., Chen, Z. T., Yu, H.M., & Duh, P. D. ( 2012). Comparison of the
hepatoprotective activity between cultured Cordyceps militaris, and natural Cordyceps
sinensis. Functional Foods, 4(2):489-495.
Wang, T. E., Wang, Y. K., Jin, J., Xu, B. L., & Chen, X. G. (2014a). A novel derivative of
quinazoline, WYK431 induces G2/M phase arrest and apoptosis in human gastric cancer
BGC823 cells through the PI3K/Akt pathway. International Journal of Oncology,
4
5,771–781.
Wang, X., & Xia, M. (2016). 5-Hydroxy-3, 6, 7, 8, 3', 4'-hexamethoxyflavone, a
polymethoxyflavone, exerts antitumor effect on PI3K/Akt signaling pathway in human
gastric cancer cell BGC-7901. Journal of Receptors and Signal Transduction, 36(5),
4
71-477.
Wang, Y., Liu, D., Zhao, H., Jiang, H. X., Luo, C., Wang, M., et al. (2014b). Cordyceps
sinensis polysaccharide CPS-2 protects human mesangial cells from PDGF-BB-induced
proliferation through the PDGF/ERK and TGF-beta1/Smad pathways. Molecular and
Celluar Endocrinology, 382(2), 979-988.
28