Enzymatic synthesis and RNA interference of nucleosides incorporating stable isotopes into a base moiety

Article abstract of DOI:10.1016/j.bmc.2015.09.011

Thymidine phosphorylase was used to catalyze the conversion of thymidine (or methyluridine) and uracil incorporating stable isotopes to deoxyuridine (or uridine) with the uracil base incorporating the stable isotope. These base-exchange reactions proceede

Full text of DOI:10.1016/j.bmc.2015.09.011

Bioorganic & Medicinal Chemistry 23 (2015) 6683–6688
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Enzymatic synthesis and RNA interference of nucleosides
incorporating stable isotopes into a base moiety
b
a
a
c
Akihiko Hatano a, , Mitsuya Shiraishi , Nanae Terado , Atsuhiro Tanabe , Kenji Fukuda
⇑
a Department of Chemistry, Shibaura Institute of Technology, 307 Fukasaku, Minuma-ku, Saitama 337-8570, Japan
b Joint Faculty of Veterinary Medicine, Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan
c Taiyo Nippon Sanso Corp., 10 Okubo, Tsukuba-shi, Ibaragi 300-2611, Japan
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 30 July 2015
Revised 3 September 2015
Accepted 4 September 2015
Available online 7 September 2015
Thymidine phosphorylase was used to catalyze the conversion of thymidine (or methyluridine) and uracil
incorporating stable isotopes to deoxyuridine (or uridine) with the uracil base incorporating the stable
isotope. These base-exchange reactions proceeded with high conversion rates (75–96%), and the isolated
yields were also good (64–87%). The masses of all synthetic compounds incorporating stable isotopes
were identical to the theoretical molecular weights via EIMS. 13C NMR spectra showed spin–spin coupling
between 13C and 15N in the synthetic compounds, and the signals were split, further proving incorpora-
tion of the isotopes into the compounds. The RNA interference effects of this siRNA with uridine incorpo-
rating stable isotopes were also investigated. A 25mer siRNA had a strong knockdown effect on the
MARCKS protein. The insertion position and number of uridine moieties incorporating stable isotopes
introduced into the siRNA had no influence on the silencing of the target protein. This incorporation of
stable isotopes into RNA and DNA has the potential to function as a chemically benign tracer in cells.
Ó 2015 Elsevier Ltd. All rights reserved.
Keywords:
Thymidine phosphorylase
Nucleoside synthesis
Nucleosides incorporating stable isotopes
13C NMR
RNA interference
1. Introduction
introduced into the termini of an RNA sequence at the 50-32P by
T4 polynucleotide kinase. Radioisotope labeling does not change
Recently, the behavior of intracellular RNA molecules has been
the subject of a great deal of research.1 mRNA plays a role in trans-
lating DNA information for the sequence of amino acids. The abun-
dance and location of RNA in cells differs with the type of cell.
Previous reports have shown that 20–25mer (short) sequences of
double stranded RNA can inhibit the expression of a target pro-
tein,2 and thus, the observation of RNA behavior is increasing in
importance. Various highly sensitive fluorescent probe mole-
cules/methods for tracing mRNA in cells have been developed,
including: hybridization-sensitive molecules,3 the molecular bea-
con method,4 the probe molecule conjugated RNA binding pro-
tein,5 the green fluorescent protein (GFP),6 and the dye-binding
light-up aptamer.7 All are sensitive enough to allow detection of
a single molecule, but are limited by their large size.
The intracellular environment is crowded-cells contain large
numbers of big molecules, especially proteins, nucleic acids, and
sugars.8 The probes above (probes possessing a large labeled
molecule) lack mobility and therefore cannot provide information
concerning molecular mobility due to molecular crowding, and
thus, cannot reflect the behavior of RNA in a cell accurately.
Radioisotope labeling also has high sensitivity and is easily
the size of the probe, however, a disadvantage is the risk associated
with increased radiation exposure and the short half-life of
some radioactive isotopes. A labeling method which does not
change molecular size and does not cause damage is the stable
isotope labeling method. Observation of molecules incorporating
stable isotopes can be performed simply via mass spectrometry,9
and imaging of biomaterial can be accomplished with isotope
microscopy.10
In this research, stable isotopes were easily and rapidly intro-
duced into the nucleoside chemical structure using a nucleic meta-
bolic enzyme. Thymidine phosphorylase (TP) is a unique metabolic
control enzyme that catalyzes the conversion of thymidine to
deoxyribose-1a-phosphate and a free thymine base in a phosphate
buffer.11 Raap et al. tried to incorporate a stable isotope into the
ribosyl position of a nucleoside with this enzyme, but the reaction
yields were not high.12 We previously developed a synthetic
method involving TP to change the nucleobase moieties thymidine
and various uracil derivatives substituted at the C5 position.13
Herein is reported the enzymatic production of (deoxy)uridine,
which facilitates the incorporation of stable isotopes including
13C, 15N, 18O into a base moiety. Also reported is the use of labeled
50-dimethoxytrithilated and 30-phosphoramidated uridine in an
automatic RNA synthesizer to introduce these tagged/labeled uri-
dine moieties into an RNA sequence, and a comparison of the
⇑
Corresponding author. Tel.: +81 48 687 5035; fax: +81 48 687 5013.
E-mail address: a-hatano@sic.shibaura-it.ac.jp (A. Hatano).
http://dx.doi.org/10.1016/j.bmc.2015.09.011
0968-0896/Ó 2015 Elsevier Ltd. All rights reserved.

6684
A. Hatano et al. / Bioorg. Med. Chem. 23 (2015) 6683–6688
Table 1
RNA interference effects of stable isotope-labeled and unlabeled
siRNAs (Fig. 1).
Conversion and isolated yield of base exchange reactions using thymidine phospho-
rylase to convert thymidine to deoxyuridine possessing stable isotopes
2. Results and discussion
2.1. Base-exchange reaction with thymidine phosphorylase
Initially, a base-exchange reaction was examined, using thymi-
dine phosphorylase to synthesize deoxyuridine and uridine nucle-
osides incorporating stable isotopes. Starting substrates were
either a ribosyl donor (such as thymidine or 5-methyluridine)
or a uracil incorporating a 13C, 15N, or 18O isotope. Reaction mix-
tures were composed of 40 mM thymidine (or 5-methyluridine),
5 mM of the labeled uracil compound, and 1 unit/mL of TP (from
Escherichia coli; EC 2.4.2.4) in 1 mM phosphate buffer (pH 6.8),
and were incubated at 40 °C. Product formation was monitored
via UV absorption at 254 nm using HPLC with a C18 column
(4.6 mm diameter, 5% MeCN in 1 mM phosphate buffer; pH 6.8).
After removal of H2O in vacuo, the residue was purified via
preparative HPLC (reversed phase C18 column; 20 mm diameter,
5% MeCN in H2O). Uridine possessing a uracil base with a stable
isotope incorporated was eluted from the column. A combination
of 1H, 13C, and 15N NMR and mass spectrometric analysis was
used to verify the structures of the various products as well as
the incorporation of stable isotopes into the respective base
moiety.
Substrate
R = –H
R = –OH
Conv. (%)
Conv. (%)
91.3
Yield (%)
63.5
Yield (%)
74.8
78.9
74.8
96.4
87.4
64.2
86.9
84.9
77.8
69.8
82.6
77.9
65.4
75.6
C: 13C, N: 15N, O: 18O.
TP effectively converted (74.8–96.4%) the uracils incorporating
various stable isotopes into the nucleoside (Table 1). The nucle-
oside isolated yields were slightly lower than the conversion ratios
(63.5–87.4%), because purification was performed via repeated
preparative HPLC operations. Neither the position of stable isotope
incorporation, the identity of the converted stable isotope, or the
number of stable isotopes incorporated had any relationship to
TP reactivity. This result demonstrates the lack of steric hindrance
on the uracil structure as a base. Of course, the atomic diameters of
stable isotopes such as 12C and 13C, or 14N and 15N are effectively
identical to the more common isotopes, and therefore, the chemi-
cal structure of a uracil moiety incorporating stable isotopes is the
same as ‘natural’ uracil. In this study, the substrate specificity of TP
did not change upon incorporation of stable isotope(s) into uracil.
The rate of base-exchange reaction for deoxyribose was faster
than the reaction for the ribo form of uridine under the same con-
ditions. In a previous report,14 we noted that the absence of a 20OH
interfered with the enzymatic base-exchange reaction, and that the
reaction time was extended. To reach equilibrium took about five
times as long for the ribosyl form (20 to 24 h) as its deoxyribosyl
form (4 h).
2.2. Proof of existence of stable isotopes in synthetic
compounds by mass spectrometry
Mass spectrometry is highly sensitive and capable of distin-
guishing between compounds incorporating only a few isotopes.
The electron impact mass spectrometry (EI-MS) data presented
in Table 2 makes it clear that stable isotopes have been introduced
into the chemical structure of a deoxyuridine or ribo form of uri-
dine. Increased molecular mass was observed in the synthetic
nucleosides which resulted from the enzymatic base-exchange
reaction. For instance, the molecular weight of ‘normal’ uridine is
244 by EI-MS, and the uridine incorporating one 13C and two 15N
is 247 (+3, as predicted).
2.3. Proof of existence of stable isotopes in synthetic
compounds by NMR
The 1H NMR spectra of the natural compounds are identical to
those of the synthetic deoxy-form and ribo-form compounds
O
O
O
N
NH
NH
C
NH
C
HO
HO
DMTrO
O
N
O
N
O
O
O
O
O
OH
R
OH
R
O
OTBDMS
NC
P
N
R = -H or -OH
O
18
O
O
O
H
O
H
15
15
N
N
C
NH
C
NH
13
13
15
15
N
N
O
N
O
18
N
H
O
H
H
H
Transfection
RNAi
dsRNA
Cell
Knockdown
Figure 1. RNA interference by dsRNA containing the nucleosides incorporating stable isotopes and its production with thymidine phosphorylase.

A. Hatano et al. / Bioorg. Med. Chem. 23 (2015) 6683–6688
6685
Table 2
atoms with atomic weight 15 at the 1 and 3 positions of the deox-
yuridine base, in addition to the 13C substitution. There are two
strong signals in the 15N NMR (see Supplementary data), indicating
successful incorporation of stable nitrogen isotopes into the deox-
yuridine through the TP base-exchange reaction. In addition, the
deoxyuridine 2-13C is split into an overlapping doublet of doublets
by the effectively magnetically non-equivalent neighboring 15N
(Fig. 2b). The signals for the carbons at the 4 and 6 positions are
also split into doublets (Fig. 2b and c) by coupling with one 15N
neighbor each. Because of this, all signals were checked in detail,
and the signals for C10 and C5 in deoxyuridine incorporating 15N
were also split into doublets (long-range coupling; see Supplemen-
tary data). The signals derived from deoxyuridine introducing 18O
at the 2 and 4 positions (Fig. 2d) were nearly identical to those
from ‘normal’ deoxyuridine. 13C data from ribo-form uridine was
fundamentally the same as for deoxyuridine (spectra available in
Supplementary data).
Comparison of predicted molecular masses of nucleosides incorporating stable
isotopes with EI-MS data
C = 13
C
N
Structure
C = 13
C
N = 15
N
O = 18
O
N = 15
Molecular
weight
EI-MS
228.2
228
229.2
229
230.2
230
231.2
231
232.2
232
C = 13
C
N
C = 13
C
N = 15
N
O = 18
O
N = 15
Molecular
weight
EI-MS
224.2
244
245.2
245
246.2
246
247.2
247
248.2
248
2.4. RNA sequences and MALDI–TOF MS
RNA oligomers were synthesized using a commercially avail-
able synthesizer with phosphoramidite chemistry. Table 3 shows
the synthetic ssRNA sequences used for RNAi experiments and
the results of MALDI–TOF (matrix-assisted laser desorption/
ionization time of flight) mass spectrometry analysis of the sam-
ples. We used the previously reported method to prepare the
stable isotope-labeled phosphoramidite building blocks.15 The
20-tert-buthyldimethylsilyl, 30-(2-cyanoethyl diisopropylphospho-
ramidite), and 50-DMTr groups were introduced into 2-13C,
1,3-15N2-uridine for automatic RNA syntheses (see Supplementary
data). The ssRNAa and ssRNAc samples here utilize the same
sequence; however, the uridines with stable isotopes occupy dif-
ferent positions in the sequence. The ssRNAa sequence has two
uridines possessing stable isotopes near the middle (bold U⁄ in
Table 3), and sequence ssRNAc has one uridine incorporating stable
isotopes at the center position. The ‘a’ and ‘c’ sequences have the
containing uridine(s) incorporating stable isotopes. On the other
hand, 13C NMR proved to be a very important tool for structural
determination of compounds incorporating stable isotopes, as
spectra drastically change depending on the isotope inserted. The
results are shown in Figure 2. For example, 2-13C deoxyuridine
exchanges 12C for 13C at the 2 position of the base, resulting in
the sharp singlet at 152 ppm (Fig. 2a). Because the natural isotopic
abundance of 13C is low (1.1%), a uracil with 99% 13C substitution at
the 2 position gives a remarkably large signal. (Natural abundance
13C gives small signals for the 4 and 6 positions at 167 and 141,
respectively.) Similarly, synthetic deoxyuridine introducing uracil
possessing two different stable isotopes (2-13C and 1,3-15N2) also
shows a strong signal at 151 ppm. This compound has two nitrogen
Figure 2. Comparison of 13C NMR spectra for deoxyuridine incorporating stable isotopes. (a) 2-13C-deoxyuridine, (b): 2-13C, 1,3-15N2-deoxyuridine, (c): 1,3-15N2-
deoxyuridine, (d): 2,4-18O2-deoxyuridine. The scale of the y-axis is different in each spectrum for clarity.

6686
A. Hatano et al. / Bioorg. Med. Chem. 23 (2015) 6683–6688
Table 3
Sequences and MS analysis of ssRNAs synthesized
Duplex RNA name
Single stranded RNA name
Sequence
Molecular weight (m/z)
Calculated
Observed
siRNA (SI1)
siRNA (SI2)
siRNA (SI0)
ssRNAa
ssRNAb
50-UUCGCUGCGGU⁄CU⁄UGGAGAACUGGG
8069
7939
8068
7939
30-AAGCGACGCCAGAACCUCUUGACCC
ssRNAc
ssRNAd
50-UUCGCUGCGGUCU⁄UGGAGAACUGGG
30-AAGCGACGCCAGAACCU⁄CUUGACCC
8058
7950
8060
7951
ssRNAe
ssRNAb
50-UUCGCUGCGGUCUUGGAGAACUGGG
30-AAGCGACGCCAGAACCUCUUGACCC
—
—
—
—
U⁄: 2-13C, 1,3-15N2 uridine.
same base order and as do ssRNAb and ssRNAd, which are com-
posed of ribonucleosides having 0 or 1 labeled uridine in the
sequences, respectively. The predicted molecular mass of each sin-
gle-stranded 25 mer RNA matched well with that observed via
MALDI–TOF MS (Table 3).
inhibiting its translation (Fig. 3). b-Actin was used to revise errors
between the columns in the western blot. The control experiment
did not add the siRNA to the cells, and this did not suppress the
knockdown of expression of the MARCKS protein (100%). When a
transfection reagent such as RNAiMAX (Lipofectamine) was added
without the siRNA, the silencing effect was moderate (28%, expres-
sion: 72%, see Supplementary data). On the other hand, a negative
control siRNA proved to be less effective at interfering with expres-
sion of MARCKS (90%, Fig. 3, No. 2) due to a lack of interaction
between the mRNA and dsRNA. Knockdowns were observed in
RNA interference experiments using three 25mer, double-stranded
siRNAs composed of the ssRNAs differing in the position of the
labeled uridine discussed above (Table 3). Single-stranded
sequences a and b (Table 3) were combined to form a double-
stranded RNA (siRNA (SI1)), as were sequences c and d to form a
complementary ds sequence with the labeled uracil in different
positions (siRNA (SI2)). MARCKS siRNA (SI0), composed of one
strand with the same sequence as ssRNAa (or c) and one strand
with the same sequence as ssRNAb (or d), both having natural-
abundance uracil, served as a positive control. SI0 had a strong
silencing effect on the MARCKS protein (83%, expression: 27%,
Fig. 3, No. 3). MARCKS siRNA (SI1), composed of ssRNAa and
ssRNAb (incorporating two and zero labeled uridines, respectively,
into the same sequences as for siRNA (SI0)), suppressed expression
of the target protein even more (19%, Fig. 3, No. 4). MARCKS siRNA
(SI2), composed of ssRNAc and ssRNAd (one labeled uridine in each
ssRNA sequence), also showed the same effect (18%, Fig. 3, No. 5).
Thus, the position and number of labeled uridine moieties does not
appear to have an effect on the knockdown capability of the
sequence.
2.5. RNA interference
Next, the biological activity of labeled and unlabeled siRNAs
was compared. To do so, the silencing effect of siRNAs targeting
the myristoylated alanine-rich C-kinase substrate (MARCKS)16
gene in the human neuroblastoma cell line SH-SY5Y was analyzed
by western blotting. MARCKS plays an essential role in neuronal
cell differentiation and central nervous system development.17 It
was found that 25mer, double-stranded RNAs suppress the expres-
sion of the target genes by causing cleavage of the mRNA, or
3. Conclusion
Thymidine phosphorylase catalyzes the reaction of thymidine
(or methyluridine) and uracil incorporating stable isotopes to form
deoxyuridine (or uridine) with the uracil base incorporating the
stable isotope. These base-exchange reactions occur with high con-
version (75–96%), and the isolated yields are good (64–87%). EI-MS
data for the synthetic compounds matched the theoretical molec-
ular weights. While the 1H NMR spectra of the synthetic com-
pounds were identical to the natural-abundance compounds, the
13C NMR spectra were different for each of the four compounds
incorporating 13C, 15N and 18O studied. Coupling between 13C and
15N in deoxyuridine or uridine was observed. 25mer siRNA
sequences containing uridine incorporating stable isotopes showed
as good or better knockdown effects on the MARCKS protein from
SH-SY5Y cells as common siRNA for the MARCKS gene. The inser-
tion position into and number of uridine incorporating stable iso-
topes in the siRNA had no influence on the silencing of the target
protein. The insertion of stable isotopes into RNA and DNA has
the potential to assist in examining the existence, mechanism of
action, and location of signal expression in a cell.
Figure 3. MARCKS knockdown effect of dsRNA with uridine incorporating stable
isotopes (RNA interference). SH-SY5Y cells were treated with distilled water
(control, No. 1), and non-targeting dsRNA (negative control siRNA, No. 2), normal
dsRNA (MARCKS siRNA (SI0), 50-UUCGCUGCGGUCUUGGAGAACUGGG: 30-AAGC-
GACGCCAGAACCUCUUGACCC, No. 3), duplex RNA composed of ssRNAa and
b
inserting the labeled uridine into one chain of the dsRNA only (SI1,
50-UUCGCUGCGGU⁄CU⁄UGGAGAACUGGG: 30-AAGCGACGCCAGAACCUCUUGACCC,
No. 4), and duplex RNA composed of ssRNAc and d inserting a labeled uridine
into each chain of the ⁄dsRNA (SI2, 50-UUCGCUGCGGUCU⁄UGGAGAACUGGG:
30-AAGCGACGCCAGAACCU CUUGACCC, No. 5). Experiments performed
4 times
(see Supplementary data). Data show the expression of the MARCKS protein and
concentration of standard b-actin of equal loading by western blotting. Data
expressed as a percentage of total cells. Results shown as mean SEM (n = 3).
*P <0.01 (Tukey’s test).

A. Hatano et al. / Bioorg. Med. Chem. 23 (2015) 6683–6688
6687
4.2.5. 2-13C-deoxyuridine
H NMR (CD3OD) d 7.94 (1H, J = 3.2, 3.2, 8.0 Hz, ddd), 6.24 (1H,
J = 6.2 Hz, t), 5.67 (1H, J = 3.4, 8.0 Hz, dd), 4.35 (1H, m), 3.89 (1H,
m), 3.72 (2H, J = 3.5, 12, 25, 25 Hz, dddd), 2.21 (2H, m). 13C NMR
4. Experimental section
4.1. General
(CD3OD)
d 165.0 (J = 9.5 Hz, d), 151.0 (J = 7.3 Hz, t), 141.1
All solvents and reagents were of reagent-grade quality, and
used without further purification. Stable isotope reagents were of
high purity (>95% isotope) and were supplied by Taiyo Nippon
Sanso Corp. TLC analysis was carried out on silica gel 60 F254
1.05554 (Merck). The 1H, 13C and COSY NMR spectra were recorded
on a JEOL ECS 400 spectrometer (400.0 MHz for 1H; 100.4 MHz for
13C; 40.5 MHz for 15N). Spectra were referenced to TMS in
CD3OD-d4. Chemical shifts (d) are reported in ppm. EI-MS was
recorded on a GCMS-QP2010 Plus (Shimadzu). MALDI–TOF MS
was recorded on a Voyager DE-STR (Applied Biosystems).
(J = 12.4 Hz, d), 101.3 (J = 5.7 Hz, d), 87.6, 85.2 (J = 12.4 Hz, d),
70.9, 61.5, 40.0. 15N NMR (CD3OD) d 148.6 (J = 16.8, 339 Hz, dd).
EIMS m/e 229 [M]+.
4.2.6. 1,3-15N2-deoxyuridine
1H NMR (CD3OD) d 7.98 (1H, J = 1.6, 8.4 Hz, dd), 6.27 (1H, J = 6.6,
6.6 Hz, dd), 5.69 (1H, m), 4.30 (1H, m), 4.38 (1H, J = 3.2, 3.2, 3.2,
3.2 Hz, dddd), 3.69 (2H, m), 3.92 (1H, J = 3.2, 6.8 Hz, dd), 3.74 (3H,
J = 3.4, 12, 29 Hz, ddd), 2.24 (2H, m). 13C NMR (CD3OD) d 165.3,
151.1, 141.1, 101.3, 87.6, 85.3, 70.9, 61.5, 40.0. EIMS m/e 305 [M]+.
4.2. Enzymatic reactions
4.2.7. 1,3-15N2, 2-13C-deoxyuridine
H NMR (CD3OD) d 7.95 (1H, J = 1.9, 1.9, 8.0 Hz, ddd), 6.24 (1H,
J = 6.8, 6.8 Hz, dd), 5.67 (1H, J = 2.8, 4.8, 7.6 Hz, ddd), 4.35 (1H,
J = 3.2, 3.2, 3.4, 3.4 Hz, dddd), 3.89 (1H, J = 3.2, 6.8 Hz, dd), 3.72
(2H, J = 3.2, 12, 25 Hz, ddd), 2.21 (2H, m). 13C NMR (CD3OD) d
165.0 (J = 9.5 Hz, d), 151.0 (J = 7.3, 7.3 Hz, dd), 141.1 (J = 12.4 Hz,
d), 101.3 (J = 5.7 Hz, d), 87.6, 85.2 (J = 12.4 Hz, d), 70.9, 61.5, 40.0.
15N NMR (CD3OD) d 148.6 (J = 16.8, 339 Hz, dd), 140.2 (J = 18.6,
Hz, d). m/e 231 [M]+.
Thymidine phosphorylase (from Escherichia coli, EC 2.4.2.4) was
purchased from Sigma–Aldrich Chemical Co. The units of enzy-
matic activity indicate the transition of native substrates as
1.0 lmol each of thymidine and phosphate to thymine and
2-deoxyribose-1-phophate per 1 min. In this research, a ‘unit’
refers to the amount of enzyme activity, even though both syn-
thetic and natural substrates were in use.
Incubations generally contained 40 mM thymidine (0.4 mmol,
0.097 g), 5 mM various uracil derivatives (incorporated stable iso-
topes, 0.05 mmol) and 1 unit/mL of thymidine phosphorylase in
10 mL of 1 mM phosphate buffer (pH 6.8). Mixtures were stirred
at 40 °C until the reactions reached equilibrium. Product formation
was monitored via UV absorption at 254 nm using HPLC with a C18
column (4.6 mm diameter, 5% MeCN in 1 mM phosphate buffer; pH
6.8). After removal of H2O in vacuo, the residue was purified using
preparative HPLC (C-18 reverse phase column, 4.6 mm diameter,
Unison UK-C18, Imtakt Co., Kyoto) by eluting with an H2O-MeCN
system (as above) to afford a pure nucleoside incorporating stable
isotopes.
4.2.8. 2,4-18O2-deoxyuridine
1H NMR (CD3OD) d 7.98 (1H, J = 8.0 Hz, d), 6.30 (1H, J = 6.8 Hz,
t), 5.72 (1H, J = 8.4 Hz, d), 4.40 (1H, m), 3.95 (1H, m), 3.79 (2H,
m), 3.37 (1H, s), 2.29 (2H, m). 13C NMR (CD3OD) d 166.2, 151.8,
141.0, 101.4, 87.6, 85.3, 70.9, 61.5, 40.0. EIMS m/e 232 [M]+.
4.3. RNA interference
Commercially synthesized siRNA for human MARCKS and non-
targeting siRNA were purchased from the Invitrogen and Bex cor-
porations. Transfection of siRNA (10 nM) was performed using
lipofectamine RNAiMAX (Invitrogen) according to the manufac-
turer’s instructions. After 72 h of transfection, western blotting
was carried out.
SH-SY5Y cells, a human neuroblastoma cell line, were grown in
DMEM containing 10% fetal bovine serum (Sigma) at 37 °C in a
humidified 5% CO2 atmosphere. One day before the experiments,
the cells were seeded at a density of 7 ꢀ 104 cells/cm2 for western
blotting.
4.2.1. 2-13C-uridine
1H NMR (CD3OD) d 8.00 (1H, J = 8.0 Hz, d), 5.90 (1H, m), 5.69
(1H, J = 8.4 Hz, d), 4.18 (1H, m), 3.92 (1H, m), 3.73 (2H, m), 2.23
(1H, m). 13C NMR (CD3OD) d 166.2, 152.1, 142.7, 102.6, 90.7,
86.3, 75.7, 71.3, 62.3. EIMS m/e 305 [M]+.
4.2.2. 1,3-15N2-uridine
1H NMR (CD3OD) d 7.97 (1H, J = 8.4 Hz, d), 6.26 (1H, J = 6.6 Hz,
t), 5.69 (1H, m), 4.38 (1H, m), 3.92 (1H, m), 3.73 (2H, m), 2.23
(1H, m). 13C NMR (CD3OD) d 166.3 (J = 9.5 Hz, d), 152.5 (J = 18,
18 Hz, dd), 142.7 (J = 12 Hz, d), 102.6 (J = 6.7 Hz, d), 90.6
(J = 11 Hz, d), 86.3, 82.5, 75.7, 71.2, 62.2. EIMS m/e 247 [M]+.
4.4. Western blotting17,18
Western blotting was performed according to established pro-
cedures. After blocking with 0.5% skim milk in TBS-T (0.14 M NaCl,
0.01 M Tris pH 7.4, 0.1% Tween 20), the PVDF membranes were
incubated with primary antibody solution containing anti-MARCKS
antibody (1:3000 in TBS-T) for 60 min at room temperature. HRP-
conjugated anti-goat IgG antibody (1:5000) was used as a sec-
ondary antibody. Cell homogenates were subjected to western blot
analysis for MARCKS expression using Image J software. b-Actin
was detected to monitor equal loading.
4.2.3. 1,3-15N2-2-13C-uridine
1H NMR (CD3OD) d 7.97 (1H, m), 6.27 (1H, m), 5.71 (1H, m), 4.39
(1H, m), 3.94 (1H, m), 3.75 (2H, m), 2.25 (1H, m). 13C NMR (CD3OD)
d 166.3 (J = 11 Hz, d), 152.3 (J = 18, 18 Hz, dd), 142.5 (J = 12 Hz, d),
102.6 (J = 5.8 Hz, d), 88.9, 86.6 (J = 12 Hz, d), 72.2, 62.8, 41.3.
15N NMR (CD3OD) d 152.2 (J = 18 Hz, d), 143.8 (J = 19 Hz, d).
EIMS m/e 246 [M]+.
4.5. Statistical analysis17
4.2.4. 2,4-18O2-uridine
1H NMR (CD3OD) d 8.00 (1H, J = 8.0 Hz, d), 5.90 (1H, J = 4.4 Hz,
d), 5.71 (1H, m), 4.16 (1H, m), 4.01 (1H, m), 3.79 (2H, J = 2.8, 12,
46 Hz, ddd). 13C NMR (CD3OD) d 166.2, 152.4, 142.7, 102.7, 90.6,
86.3, 75.7, 71.3, 62.2. EIMS m/e 248 [M]+.
Results are expressed as the mean SEM (standard error of the
mean). Statistical differences between means were evaluated by
Student’s t-test or one-way ANOVA followed by Tukey’s test and
considered significant at P <0.05.

6688
A. Hatano et al. / Bioorg. Med. Chem. 23 (2015) 6683–6688
6. (a) Bertrand, E.; Chartrand, P.; Schaefer, M.; Shenoy, S. M.; Singer, R. H.; Long, R.
Acknowledgments
M. Mol. Cell 1998, 2, 437; (b) Fusco, D.; Accornero, N.; Lavoie, B.; Shenoy, S. M.;
Blanchard, J. M.; Singer, R. H. Curr. Biol. 2003, 13, 161.
We acknowledge the financial support and fellowships from
Adaptable and Seamless Technology transfer Program through tar-
get driven R & D of JST (A step). This work was supported in part by
JSPS KAKENHI Grant Number 12874792, grants of the JGCS schol-
arship foundation and Amano Institute of Technology. We thank
Prof. Akiko Hori, Shibaura Institute of Technology, for the measure-
ments of EI-MS.
7. Sando, S.; Narita, A.; Hayami, M.; Aoyama, Y. Chem. Commun. 2008, 3858.
8. (a) Ellis, R. J.; Minton, A. P. Nature 2003, 425, 27; (b) Muhuri, S.; Mimura, K.;
Miyoshi, D.; Sugimoto, N. J. Am. Chem. Soc. 2009, 131, 9268.
9. (a) Berhane, B. T.; Limbach, P. A. J. Mass Spectrom. 2003, 38, 872; (b) Meng, Z.;
Limbach, P. A. Anal. Chem. 2005, 77, 1891; (c) Dai, Q.; Frederiksen, J. K.;
Anderson, V. E.; Harris, M. E.; Piccirilli, J. A. J. Org. Chem. 2008, 73, 309.
10. (a) Hamasaki, T.; Matsumoto, T.; Sakamoto, N.; Shimahara, A.; Kato, S.;
Yoshitake, A.; Utsunomiya, A.; Yurimoto, H.; Gabazza, E. C.; Ohgi, T. Nucleic
Acids Res. 2013, 41, e126; (b) Suda, K. H.; Kajiwara, M.; Sakamoto, N.;
Kobayashi, S.; Ijiro, K.; Yurimoto, H.; Yamato, H. J. Oral Biosci. 2013, 55, 61.
11. (a) Schwartz, M. Methods Enzymol. 1978, 51, 442; (b) Utagawa, T. J. Mol. Catal. B
Enzym. 1999, 6, 215.
Supplementary data
12. (a) Ouwerkerk, N.; Steenweg, M.; Ruijter, M. D.; Boom, J. H. V.; Lugtenburg, J.;
Raap, J. J. Org. Chem. 2002, 67, 1480; (b) Ouwerkerk, N.; Jacques, H.; Boom, V. J.
H.; Lugtenburg, J.; Raap, J. Eur. J. Org. Chem. 2000, 861; (c) Schultheisz, H. L.;
Szymczyna, B. R.; Scott, L. G.; Williamson, J. R. J. Am. Chem. Soc. 2011, 133, 297.
13. (a) Hatano, A.; Harano, A.; Kirihara, M. Chem. Lett. 2006, 35, 232; (b) Hatano, A.;
Kurosu, M.; Yonaha, S.; Okada, M.; Uehara, S. Org. Biomol. Chem. 2013, 11, 6900.
14. Hatano, A.; Harano, A.; Takigawa, Y.; Naramoto, Y.; Toda, K.; Nakagomi, Y.;
Yamada, H. Bioorg. Med. Chem. 2008, 16, 3866.
15. (a) Serebryany, V.; Beigelman, L. Tetrahedron Lett. 2002, 43, 1983; (b) Blaisdell,
T. P.; Lee, S.; Kasaplar, P.; Sun, X.; Tan, K. L. Org. Lett. 2013, 15, 4710.
16. (a) Aderem, A. Cell 1992, 71, 713; (b) Albert, K. A.; Walaas, S. I.; Wang, J. K.;
Greengard, P. Proc. Natl. Acad. Sci. U.S.A. 1986, 8, 2822; (c) Stumpo, D. J.; Graff, J.
M.; Albert, K. A.; Greengard, P.; Blackshear, P. J. Proc. Natl. Acad. Sci. U.S.A. 1989,
86, 4012; (d) Stumpo, D. J.; Bock, C. B.; Tuttle, J. S.; Blackshear, P. J. Proc. Natl.
Acad. Sci. U.S.A. 1995, 92, 944; (e) Shiraishi, M.; Tanabe, A.; Saito, N.; Sasaki, Y. J.
Cell. Physiol. 2006, 209, 1029.
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.bmc.2015.09.011.
References and notes
1. (a) Cech, T. R.; Zaug, A. J.; Grabowski, P. J. Cell 1981, 27, 487; (b) Nahvi, A.;
Sudarsan, N.; Ebert, M. S.; Zou, X.; Brown, K. L.; Breaker, R. R. Chem. Biol. 2002, 9,
1043; (c) Winkler, W.; Nahvi, A.; Breaker, R. R. Nature 2002, 419, 952.
2. Fire, A.; Xu, S.; Montogomery, M. K.; Kostas, S. A.; Deriver, S. E.; Mello, C. C.
Nature 1998, 391, 806.
3. Ikeda, S.; Kubota, T.; Yuki, M.; Okamoto, A. Angew. Chem., Int. Ed. 2009, 48, 6480.
4. (a) Tyagi, S.; Bratu, D. P.; Kramer, F. R. Nat. Biotechnol. 1998, 16, 49; (b) Wang,
W.; Cui, Z. Q.; Han, H.; Zhang, Z. P.; Wei, H. P.; Zhou, Y. F.; Chen, Z.; Zhang, X. E.
Nucleic Acids Res. 2008, 36, 4913; (c) Sando, S.; Kool, E. T. J. Am. Chem. Soc. 2002,
124, 9686; (d) Sando, S.; Abe, H.; Kool, E. T. J. Am. Chem. Soc. 2004, 126, 1081.
5. (a) Valegard, K.; Murray, J. B.; Stonehousem, N. J.; Worm, V. D.; Stockley, P. G.;
Lijas, L. J. Mol. Biol. 1997, 270, 724; (b) Yoshimura, H.; Inaguma, A.; Yamada, T.;
Ozawa, T. ACS Chem. Biol. 2012, 5, 999; (c) Ozawa, T.; Natori, Y.; Sato, M.;
Umezawa, Y. Nat. Methods 2007, 4, 413.
17. Yamaguti, H.; Shiraishi, M.; Fukami, K.; Tanabe, A.; Matsuo, K. Y.; Naito, Y.;
Sasaki, Y. J. Cell. Physiol. 2009, 220, 748.
18. Nagumo, H.; Ikenoya, M.; Sakurada, K.; Furuya, K.; Ikuhara, T.; Hiraoka, H.;
Sasaki, Y. Biochem. Biophys. Res. Commun. 2001, 280, 605.