α-L-fucosidase from paenibacillus thiaminolyticus: Its hydrolytic and transglycosylation abilities

Article abstract of DOI:10.1093/glycob/cwt041

In this work, focused on possible application of α-L-fucosidases from bacterial sources in the synthesis of α-L-fucosylated glycoconjugates, several nonpathogenic aerobic bacterial strains were screened for α-L-fucosidase activity. Among them Paenibacillus thiaminolyticus was confirmed as a potent producer of enzyme with the ability to cleave the chromogenic substrate p-nitrophenyl α-L-fucopyranoside. The gene encoding α-L-fucosidase was found using the genomic library of P. thiaminolyticus constructed in the cells of Escherichia coli DH5α and sequenced (EMBL database: FN869117, carbohydrate-active enzymes database: Glycosidase family 29). The enzyme was expressed in the form of polyhistidine-tagged protein (51.2 kDa) in Escherichia coli BL21 (DE3) cells, purified using nickel- nitrilotriacetic acid agarose affinity chromatography and characterized using the chromogenic substrate p-nitrophenyl α-L-fucopyranoside (K_m = (0.44 ± 0.02) mmol/L, K_S = (83 ± 8) mmol/L (substrate inhibition), pH_optimum = 8.2, t_optimum = 48°C). By testing the ability of the enzyme to catalyze the transfer of α-L-fucosyl moiety to different types of acceptor molecules, it was confirmed that the enzyme is able to catalyze the formation of α-L-fucosylated p-nitrophenyl glycopyranosides containing α-D-galactopyranosidic, α-D- glucopyranosidic, α-D-mannopyranosidic or α-L-fucopyranosidic moiety. This enzyme is also able to catalyze α-L-fucosylation of aliphatic alcohols of different lenghs of alkyl chain and hydroxyl group positions (methanol, ethanol, 1-propanol, 2-propanol and 1-octanol) and hydroxyl group-containing amino acid derivatives (N-(tert-butoxycarbonyl)-L-serine methyl ester and N-(tert-butoxycarbonyl)-L-threonine methyl ester). These results indicate the possibility of exploiting this enzyme in the synthesis of different types of α-L-fucosylated molecules representing compounds with potential application in biotechnology and the pharmaceutical industry. The Author 2013. Published by Oxford University Press.

Full text of DOI:10.1093/glycob/cwt041

Glycobiology Advance Access published May 30, 2013
1
-L-Fucosidase from Paenibacillus thiaminolyticus: its hydrolytic and transglycosylation
abilities
Eva Benešová
Department of Biochemistry and Microbiology, ICT Prague, Prague,
166 28, Czech Republic, Fax: +420 220 445 167, Tel: +420 220 443 028, e-mail:
Eva.Benesova@vscht.cz
- corresponding author (proofs etc.)
Petra Lipovová
Department of Biochemistry and Microbiology, ICT Prague, Prague,
166 28, Czech Republic
Hana Dvořáková
Republic
Laboratory of NMR spectroscopy, ICT Prague, Prague, 166 28, Czech
Blanka Králová
Department of Biochemistry and Microbiology, ICT Prague, Prague,
166 28, Czech Republic
Key words: -L-fucosidase/ L-fucose/ Paenibacillus thiaminolyticus/ transglycosylation/
© The Author 2013. Published by Oxford University Press. All rights reserved.
For Permissions, please e-mail: journals.permissions@oup.com

2
Abstract
In this work, focused on possible application of -L-fucosidases from bacterial sources
in synthesis of -L-fucosylated glycoconjugates, several nonpatogennic aerobic bacterial
strains were screened for -L-fucosidase activity. Among them Paenibacillus thiaminolyticus
was confirmed as a potent producer of enzyme with the ability to cleave the chromogenic
substrate p-nitrophenyl -L-fucopyranoside. The gene encoding -L-fucosidase was found
using genomic library of Paenibacillus thiaminolyticus constructed in the cells of Escherichia
coli DH5 and sequenced (EMBL database: FN869117, CAZy database: glycosidase family
29). The enzyme was expressed in form of polyhistidine tagged protein (51,2 kDa) in
Escherichia coli BL21 (DE3) cells, purified using Ni-NTA agarose affinity chromatography
and characterized using the chromogenic substrate p-nitrophenyl -L-fucopyranoside (Km =
(0.44 ± 0.02) mmol/L, KS = (83 ± 8) mmol/L (substrate inhibition), pHoptimum = 8.2, toptimum
48 °C).
=
By testing the ability of the enzyme to catalyze the transfer of -L-fucosyl moiety to
different types of acceptor molecules it was confirmed that the enzyme is able to catalyze the
formation of -L-fucosylated p-nitrophenyl glycopyranosides containing α-D-
galactopyranosidic, α-D-glucopyranosidic, α-D-mannopyranosidic or α-L-fucopyranosidic
moiety. This enzyme is also able to catalyze -L-fucosylation of aliphatic alcohols of different
lenght of alkyl chain and hydroxyl group position (methanol, ethanol, 1-propanol, 2-propanol
and 1-octanol) and hydroxyl group containing amino acid derivatives (N-(tert-
butoxycarbonyl)-L-serine methyl ester and N-(tert-butoxycarbonyl)-L-threonine methyl ester).
Obtained results indicate the possibility to exploit studied enzyme in synthesis of
different types of -L-fucosylated molecules representing compounds with potential
application in biotechnology and pharmaceutical industry.

3
Introduction
L-Fucose (6-deoxy-L-galactose) is a monosaccharide that is a constituent of
oligosaccharidic chains of many glycoconjugates (glycoproteins, glycolipids) involved in
many life important biochemical events. This saccharide moiety is usually situated on the
nonreducing end of saccharidic chains, connected by α(1→2) glycosidic linkage to D-
galactosyl residue or by α(1→3), α(1→4) or α(1→6) glycosidic bond to N-acetyl-D-
glucosamine. Unlike most other common monosaccharides, which occur as D-isomers, fucose
is in nature usually present in form of L-isomer (Ajisaka et al 1998; Becker and Lowe 2003;
Flowers 1981; Moriwaki and Miyoshi 2010; Nelson and Cox 2005; Tarling et al 2003;
Vanhooren and Vandamme 1999). The presence of D-fucose was confirmed e.g. in some
compounds with interesting biological effects, as antibiotics (chartreusin, curamycin,
labilomycin, avilamycin A), cardiac glycosides (e.g. ledienoside, cheirotoxin), spider venoms
(Tegenaria agrestis, Hololena curta) or asterosaponins (D´Auria et al 1993; Cesar et al 2005;
Flowers 1981; Kon et al 1990; Taggi et al 2004; Zayni et al 2007).
L-Fucose containing compounds were confirmed to participate in processes as growth
regulation, ontogenesis, fertilization, apoptosis, inflammation etc. L-Fucosyl residues form
also a part of erythrocyte surface antigens, which are responsible for determining of ABO
blood groups, and are also present in oligosaccharides of human milk, which represent a
natural protection of infants against some pathogens as e.g. Campylobacter jejuni. Changes in
L-fucosylation patterns were observed also during pregnancy or in some pathological
processes (Becker and Lowe 2003; Flowers 1981; Ma et al 2006; Osanjo et al 2007; Ruiz-
Palacios et al 2003; Staudacher et al 1999; Vanhooren and Vandamme 1999; Wada et al
2008; Zeng et al 2003).
Two pathological events, probably most frequently mentioned in context of L-fucose,
are fucosidosis and cancer diseases. Fucosidosis, caused by deficiency of α-L-fucosidase,

4
belongs to lysosomal storage diseases and is characterized by accumulation of α-L-fucose
containing glycolipids, glycoproteins and oligosaccharides in lysosomes of different tissues.
Consequences of this incorrect metabolism of α-L-fucose containing molecules are serious
mental and neurological retardation and motoric degeneration of patients (Michalski and
Klein 1999; Önenli-Mungan et al 2004; Osanjo et al 2007; Provenzale et al 1995;
Sulzenbacher et al 2004; Tarling et al 2003). Changes in L-fucosylation of different
glycoproteins and glycolipids were confirmed during some types of cancer diseases (e.g. lung
carcinoma, colon cancer, hepatocarcinoma, ovarian and breast cancer) and are caused by an
altered activity of fucosyltransferases. In some cases also changes in activity of α-L-
fucosidase were observed in tumor tissues. It is supposed that α-L-fucosyl residues containing
oligosaccharides on the malignant tumor cells are involved in process of metastasis
propagation (Becker and Lowe 2003; Cordero et al 2001; Flowers 1981; Ma et al 2006;
Miyoshi et al 2008; Moriwaki and Miyoshi 2010; Staudacher et al 1999; Vanhooren and
Vandamme 1999).
α-L-Fucose containing glycans may also serve as ligands for some pathogens, e.g.
Campylobacter jejuni, Helicobacter pylori, Pseudomonas aeruginosa or Ehrlichia
phagocytophila (Becker and Lowe 2003; Ma et al 2006; Moriwaki and Miyoshi 2010; Osanjo
et al 2007; Ruiz-Palacios et al 2003; Wada et al 2008). As other pathological events
connected directly or indirectly with α-L-fucose residues it is possible to name leukocyte
adhesion deficiency type II, cystic fibrosis, rheumatoid arthritis or diabetes mellitus type 1
(Becker and Lowe 2003, Cordero et al 2001; Eneyskaya et al 2001; Ma et al 2006; Staudacher
et al 1999; Vanhooren and Vandamme 1999).
The ability to specifically synthetize α-L-fucose containing compounds may enable
further investigation and deeper understanding of all named biologically important events and
thus also effective designing of treatment of some severe diseases. As example the treatment

5
of cancer diseases (anti-cancer vaccines, targeting of cytotoxic agents to the carcinoma cells),
enhancement of fruitfullness of transplantations or utilization of antiadhezive therapy can
serve (Becker and Lowe 2003; Ma et al 2006; Osanjo et al 2007; Ruiz-Palacios et al 2003;
Staudacher et al 1999; Vanhooren and Vandamme 1999; Wada et al 2008).
There are several different approaches enabling the synthesis of oligosaccharides or
glycoconjugates: chemical synthesis, enzymatic synthesis or combination of these two
technics. The advantage of enzymatic synthesis lies in the simplicity of the process,
stereospecificity and sometimes also regiospecificity of the enzymatic reactions, in mild
reaction conditions and in avoidance of toxic compounds sometimes necessary in chemical
synthesis (Bojarová and Křen 2009; Crout and Vic 1998; Křen and Thiem 1997; Mackenzie et
al 1998; Perugino et al 2004; Seeberger and Haase 2000; Watt et al 1997).
Two groups of enzymes may be used for the catalysis of glycosidic bond formation -
glycosyltransferases and glycosidases, both of them having their advantages and limitations.
Glycosyltransferases are enzymes responsible for the synthesis of oligosaccharidic structures
in living organisms. They are strictly stereo- and regiospecific, but their limitations consist
primarily in high costs of suitable substrates and in specificity to the acceptor molecule.
Glycosidases belong to the class of hydrolases and under normal conditions they cleave
glycosidic bonds in oligosaccharides and glycoconjugates. After suitable change of reaction
conditions these enzymes are also able to catalyze the transfer of monosacharidic (or
oligosaccharidic) residue to the acceptor molecule. The usage of glycosidases enables
glycosylation of wide variety of acceptor molecules with utilization of relatively cheap donor
molecules. The application of glycosidases is restricted by low regiospecificity of some of
these enzymes and by the ability to cleave glycosylation product and thus decrease the final
reaction yields. The solution for overcoming of all previously named complications that
accompany glycosidases application consists among other in isolation and characterization of

6
new enzymes, in gene manipulation producing enzymes with more suitable features and in
new technics as e.g. enzymatic solid fase synthesis or utilization of whole cells synthetic
apparatus (Bojarová and Křen 2009; Crout and Vic 1998; Koeller and Wong 2000; Křen and
Thiem 1997; Mackenzie et al 1998; Osanjo et al 2007; Perugino et al 2004; Trincone and
Giordano 2006; Watt et al 1997; Wymer and Toone 2000).
-L-Fucosidases (EC 3.2.1.51) are widespread hydrolytic enzymes, which catalyze the
cleavage of -L-fucosyl residue from nonreducing ends of oligosaccharidic chains. The ability
of some of them to catalyze synthesis of glycosidic bonds via transfucosylation reaction using
different types of acceptor molecules was described in different publications. -L-Fucosidases
from Aspergillus niger, Corynebacterium sp., ampullaria, Penicillium multicolor, Pecten
maximus, Alcaligenes sp., Thermus sp. Y5 or canine -L-fucosidase can be mentioned as
examples. In some cases interesting results were obtained as e.g. production of higher
oligosaccharides or even of branched structures (Ajisaka and Shirakabe 1992; Ajisaka et al
1998; Berteau et al 2004; Eneyskaya et al 2001; Osanjo et al 2007; Vetere et al 1997; Zeng et
al 2003). However, strictly regioselective and high yielded synthesis of α-L-fucosylated
molecules is still a challenging task and searching for new enzymes with transfucosylation
abilities applicable to biosynthesis of particular products is of highest interest.
Preparation of recombinant α-L-fucosidase from Paenibacillus thiaminolyticus,
characterization of its hydrolytic activity and testing the possibility to utilize this enzyme in
synthesis of -L-fucosyl containing molecules are the main topics of this paper.

7
Results
Determination of the -L-fucosidase producing bacterium
Twenty-four aerobic and nonpathogenic bacterial strains (for concrete information see
Methods) were screened for -L-fucosidase activity using the chromogenic substrate p-
nitrophenyl -L-fucopyranoside (pNP-L-Fuc). Different mesophilic, psychrotrophic and
psychrophilic bacterial strains were chosen for the screening. -L-Fucosidase activity was
measured in cell extracts obtained after disintegration. Paenibacillus thiaminolyticus (P.
thiaminolyticus) was confirmed as only one producer of an enzyme with desired activity.
Determination of the nucleotide sequence of the gene encoding -L-fucosidase from P.
thiaminolyticus and construction of expression plasmid pET16b-αLF1
The gene encoding the enzyme with -L-fucosidase activity was searched using the
genomic library of P. thiaminolyticus constructed in cells Escherichia coli (E. coli) DH5.
Because of absence of enzymes with -L-fucosidase activity in cells of E. coli DH5, positive
colonies, producing enzyme with the ability to cleave chromogenic substrate 5-bromo-4-
chloro-3-indolyl -L-fucopyranoside (X-Fuc), were detected directly on ampicillin containing
Luria-Bertani medium (LBA) plates with aforesaid substrate. The process of preparation of
genomic library of P. thiaminolyticus and following detection of colonies producing an
enzyme with desired activity is illustrated in Figure 1.
One positive colony was found and its plasmid DNA was isolated by Gen EluteTM HP
Plasmid Midiprep kit. The size of isolated plasmid was estimated to be approximately 6 500
bp. This plasmid DNA was further used as a template for sequencing by the method of
primer walking (Geneart company, Germany). Determined sequence was compared with
known sequences included in the NCBI database using program WU-BLAST2. Based on
sequence similarities (an open reading frame with a 67% identity with a gene of -L-

8
fucosidase from Paenibacillus sp. JDR-2 (ACT04757) was found) the gene of -L-fucosidase
from P. thiaminolyticus (1278 bp) was identified. Determination of presumable Shine-
Dalgarno sequence 5´-AAGGAGAGAA-3´ enabled the identification of the start of the gene.
Complete nucleotide sequence of this gene is available in EMBL Nucleotide Sequence
Database with Accession No FN869117.
With consideration of advantages coming from production of enzymes in form of
fusion proteins with histidine-tag, plasmid pET16b was chosen as a vector for the gene of -
L-fucosidase from P. thiaminolyticus. Prepared expression plasmid (for more details see the
Methods) was named pET16b-αLF1 and its correctness was confirmed by sequencing.
Expression and purification of the recombinant -L-fucosidase
Recombinant -L-fucosidase was produced in competent cells E. coli BL21 (DE3)
using prepared expression plasmid pET16b-αLF1. After cultivation the cells were
disintegrated and cell extract containing produced recombinant enzyme was applied at the Ni-
NTA agarose column, which is able to specifically bind histidine-tagged proteins. After the
washing out of nonspecifically bind proteins -L-fucosidase in form of fusion protein was
eluted and samples of the purified enzyme were immediately transferred to the 25 mM EPPS
buffer (pH 8) by gel filtration using PD10 desalting column. Processes of cultivation,
disintegration and purification were followed by sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) under denaturing conditions and are summarized in the Figure
2.
It is possible to see that after induction of expression a protein of anticipated molecular
weight (51.2 kDa) started to be produced. The weight of fusion protein was calculated from
the amino acid sequence using program ProtParam tool on ExPASy Proteomics server. Also
the method of affinity chromatography was confirmed to be very successful, because only one

9
single band is present after the elution of specifically bind proteins and their analysis by SDS-
PAGE. Contaminants visible in the line 9 were either not eluted from the column or their
concentration in the final solution was too low to be detected by Coomassie Brilliant Blue
used for visualization.
Purified enzyme was further used for the characterization of hydrolytic and
transglycosylation activities. In enzyme preparations after the purification process, which
were used for the characterization, concentration of the proteins was on the average 0.1
mg/mL and the specific activity reached 80 µmol/min/mg.
Characterization of the hydrolytic activity of the recombinant -L-fucosidase
Characterization of hydrolytic activity of recombinant -L-fucosidase was carried out
with the substrate pNP-L-Fuc. Simultaneously it was determined that this enzyme is not able
to cleave chromogenic substrates as p-nitrophenyl -D-galactopyranoside (pNP-D-Gal), p-
nitrophenyl -D-glucopyranoside (pNP-D-Glc) and p-nitrophenyl -D-mannopyranoside
(pNP-D-Man), which were later tested to be possible acceptor molecules for
transglycosylation reactions.
Effects of pH and temperature on the a-L-fucosidase activity: The influence of reaction
temperature and pH on the activity of the enzyme was measured. Also the stability of the
enzyme at different temperatures was determined (for more details see the Methods).
By measuring the temperature profile it was found that the highest activity was
exhibited (under chosen conditions and reaction time of 10 min) at 48 °C. The optimal pH for
the enzyme, determined using a set of Britton-Robinson buffers of different pH, was 8.2 and
the zone of maximal activity was very narrow. Buffers suitable for the work with the enzyme

10
were 25 mM EPPS (pH 8) or 100 mM phosphate buffer (pH 8), but 50 mM Tris buffer
inhibited notably the activity of the enzyme.
During the storage of the enzyme at - 20 °C its activity was continuously
controlled for a period of 15 weeks. It was determined that the consequence of the freezing
was a lost of 30% of original activity of the enzyme, which was measured immediately after
the purification and desalting process. The time of storage did not exhibit further influence on
the enzyme activity.
Apparent kinetic parameters for the recombinant a-L-fucosidase: The dependence of initial
velocity of the reaction catalyzed by -L-fucosidase on the concentration of pNP-L-Fuc in
the reaction mixture was measured in concentration range from 0 to 19 mmol/L. During the
experiment it was discovered that the measured dependence corresponds to the behavior of
substrate inhibition caused probably by contemporary binding of several substrate molecules
into the active site of the enzyme. The Km value was measured to be (0.44  0.02) mmol/L
and Ks as (83 ± 8) mmol/L.
Transfucosylation activity of the recombinant -L-fucosidase
Three different types of acceptor molecules were used for transfucosylation reactions
catalyzed by purified preparations of recombinant -L-fucosidase. p-Nitrophenyl
glycopyranosides (pNP-D-Gal, pNP-D-Glc, pNP-D-Man and pNP-L-Fuc) constituted
acceptors with saccharidic part. Aliphatic alcohols (methanol, ethanol, 1-propanol, 2-
propanol, 1-octanol and 2-octanol) and hydroxyl group containing amino acid derivatives (N-
(tert-butoxycarbonyl)-L-serine methyl ester (Boc-L-Ser-OMe) and N-(tert-butoxycarbonyl)-L-
threonine methyl ester (Boc-L-Thr-OMe)) were tested as possible acceptors of nonsaccharidic
character.

11
During designing of suitable reaction conditions for tranglycosylations it was
necessary to consider relatively low solubility of p-nitrophenyl glycopyranosidic substrates
serving as donor or acceptor molecules in buffer systems at 45 °C. This temperature was
chosen as a suitable compromise among high enzyme activity, good stability and sufficient
substrate solubility. The possibility to use dimethylformamide (DMF) for increase of p-
nitrophenyl glycopyranosides solubility was also tested and -L-fucosidase activity of the
recombinant enzyme was measured in set of reaction mixtures containing 5%, 10%, 25% and
50% DMF. It was determined that in the presence of 10% of this organic solvent in reaction
mixture the activity of -L-fucosidase did not decrease under 90%. Stability of the enzyme at
45 °C in 10% DMF and 25 mM EPPS buffer (pH 8) for 6 hours was tested, too. More than
85% of original activity was preserved. Based on this results 10% DMF was used for the
increase of the solubility of p-nitrophenyl glycopyranosidic donor and acceptor molecules in
transglycosylation reactions utilizing pNP-D-Gal, pNP-D-Glc, pNP-D-Man, pNP-L-Fuc,
Boc-L-Ser-OMe and Boc-L-Thr-OMe as acceptors. In case of alcohol acceptors the solubility
of the donor molecule was ensured by presence of acceptor molecules.
During experiments with p-nitrophenyl glycopyranosidic acceptors it was confirmed
that the enzyme is able to catalyze the transfer of -L-fucosyl moiety to pNP-D-Gal, pNP-
D-Glc, pNP-D-Man and pNP-L-Fuc. Results of analysis by thin layer chromatography
(TLC) and visualization by 2-methylresorcinol (saccharidic parts of molecules) are
demonstrated in the Figure 3. Visualisation by ultraviolet (UV) light (aromatic parts of
molecules) is presented in supplementary data. Spots corresponding not only to donor and
acceptor molecules or to products of hydrolysis, but also to transglycosylation products are
visible. Formation of all transglycosylation products, predicted according to TLC analysis,
was confirmed by mass spectrometry and NMR analysis as described in following
paragraphs.

12
The determination of regiospecificity of the enzyme was a next task of this work.
Samples of main transglycosylation products for the analysis by mass spectrometry and
nuclear magnetic resonance (NMR) were prepared.
In case of pNP-D-Man the amount of transglycosylation products was too low for
an extraction and NMR analysis, but the presence of a compound of anticipated molecular
weight was confirmed in the whole reaction mixture (after removing the enzyme by filtration
- Cellulose Triacetate filters Vecta Spin Micro(12kDa)) by mass spectrometry.
Transglycosylation products of reactions with pNP-D-Glc and pNPα-L-Fuc as
acceptors were isolated by extraction from TLC plates to methanol and following
evaporation, the main products of transfucosylation of pNP-D-Gal had to be isolated by
extraction to deionized water and by lyophilization because of presence of unidentified
compounds soluble in methanol and insoluble in water. The presence of all products of
molecular weights corresponding to used acceptor molecules with bind α-L-fucosyl moiety
was confirmed by mass spectrometry. During the NMR analysis (using standard experiments
as 1H, 13C, COSY, HMQC, HMBC, NOE and TOCSY) the formation of 2 different
regioisomers was determined for pNP-D-Glc and pNPα-L-Fuc serving as acceptors and even
5 regioisomers in case of pNP-D-Gal. Based on results of 1H-13C HMBC experiments the
types of formed glycosidic linkages of transfucosylation products of pNP-D-Glc and pNPα-
L-Fuc were determined. In both cases the cross peaks between H-1’ – C-2 and H-2 – C-1’
confirmed the presence of (1’ 2) glycosidic bond. The second position of pNPα-L-Fuc used
for the transfer of α-L-fucosyl moiety was the hydroxyl group at the carbon C4, in case of
pNP-D-Glc the utilized hydroxyl group was positioned at the carbon C6. Source materials
for this results constitute again cross peaks between H-1’ – C-4 and H-4 – C-1’ or H-1’ – C-6
and H-6 – C-1’, respectively. In both cases the amounts of formed regioisomers were
approximately 1:1.

13
In transfucosylation reactions utilizing pNP-D-Gal as acceptor three of five formed
regioisomers were produced in major amount in ratio 1:2.5:4. Particular types of glycosidic
bonds were not possible to determine as the full NMR characterization could not be
performed due to heavy overlaps of 1H and 13C resonances of different saccharide moieties.
Formation of five regioisomers suggests the impossibility of the use of pNPα-D-Gal as an
acceptor for application in biotechnological practice and thus further experiments were not
carried out.
The results of NMR analysis and yields of reactions are summarized in Table I,
assignments of detected NMR signals are mentioned in Methods. Final reaction yields were
calculated according to the amount of acceptor added to reaction mixture and amount of
transglycosylation product isolated by the extraction process. Yield presented for pNPα-L-Fuc
serving as acceptor is not easily comparable with other yields because of the fact, that the
acceptor molecule is also a donor of the α-L-fucosyl residue.
For transglycosylation reactions testing the ability of recombinant α-L-fucosidase to
catalyze the transfer of α-L-fucosyl moiety to aliphatic alcohols methanol, ethanol, 1-
propanol, 2-propanol, 1-octanol and 2-octanol were chosen as suitable acceptor molecules.
Methanol and ethanol represent simplest alcohol structures, 1-propanol and 2-propanol are the
shortest alcohols differing in position of hydroxyl group and 1-octanol and 2-octanol serve for
monitoring of influence of the length of aliphatic chain on transglycosylation activity.
Suitable amount of acceptor molecules was determined according to results of a set of
experiments differing only in quantity of acceptor molecules in reaction mixtures.
Results of analysis of reaction mixtures by TLC and both visualization methods are
demonstrated in the Figure 4 and in supplementary data. Products of transglycosylation of
methanol, ethanol, 1-propanol and 2-propanol are of good visibility. All reaction mixtures
were after filtration again analyzed by mass spectrometry and this method confirmed also the

14
presence of 1-octanol transglycosylation product. Further structural analysis of
transglycosylation products by NMR was not necessary, for only one hydroxyl group is
possessed by donor molecules.
For the determination of concrete reaction yields programs Total Lab and Image J
were used in this case. TLC spot densities of remaining substrate and of hydrolysis and
transglycosylation products, obtained as outputs of used analyzing programs, were used for
the final yield calculation. It was not possible to use this method for the determination of
reaction yields of α-L-fucosylation of p-nitrophenyl glycopyranosidic acceptors because of the
presence of different types and combinations of saccharidic residues that influence the
staining by 2-methylresorcinol (Brückner 1955). Transglycosylation products of alcohol α-L-
fucosylation contain only one type of monosaccharidic moiety (α-L-fucosyl residue) and thus
the results of Total Lab and Image J analysis are not affected. All results are summarized in
Table II, this time the yields are calculated according to the amount of the donor molecule in
the reaction mixture (the sum of spot densities of all molecules containing α-L-fucosyl residue
after the end of reaction is calculated to be 100%).
Last acceptor molecules tested in transfucosylation reactions were amino acid
derivatives Boc-L-Ser-OMe and Boc-L-Thr-OMe. Simultaneously with the monitoring of the
ability of the enzyme to catalyze the transfer of the α-L-fucosyl moiety to hydroxyl group in
side chains of amino acids the influence of the position of this hydroxyl group was tested
again. Plates illustrating the results of TLC analysis after visualization are present in the
Figure 5 and in supplementary data. The advantage of contemporary visualization by 2-
methylresorcinol and UV light is well demonstrated here, for the same mobility of pNPα-L-
Fuc and transglycosylation products. Spots indicated in Figure 5 by arrows are visible only
after 2-methylresorcinol visualization and it is therefore possible to conclude that these spots
have to belong to molecules with saccharidic part but without an aromatic ring. As only one

15
hydroxyl group was present in acceptor molecules only mass spectrometry was used for the
analysis of whole reaction mixtures after removing enzyme by filtration. Compounds of
anticipated molecular weights were confirmed in both cases.
Final reaction yields were calculated using programs Total Lab and Image J as
described previously for alcohol acceptors. Results (calculated again according to the amount
of donor molecule added to the reaction mixture) are presented in Table II.

16
Discussion
This paper represents our effort to find new enzymes for fucosylated molecules
production. In our previous publication we demonstrated the possibility to use recombinant β-
D-galactosidase from P. thiaminolyticus for β-D-fucosylation of different types of acceptor
molecules (Benešová et al 2010). In this phase of our research we have successfully
confirmed the possibility to use recombinant α-L-fucosidase originating from the same
bacterial strain as used in our first work for the synthesis of α-L-fucosylated molecules.
The gene encoding the enzyme with α-L-fucosidase activity was found and sequenced.
According to glycosidase classification introduced by Henrissat this enzyme belongs to
glycoside hydrolase family 29 (Henrissat 1991) together with more than 600 other α-L-
fucosidases (EC 3.2.1.51 and EC 3.2.1.111) from different origines (Archaea, Bacteria and
Eukaryota). All these enzymes share among others the same reaction mechanism, it means the
double-displacement mechanism with retaining of configuration at the anomeric carbon of
arising product. This finding was important for following research due to the fact that α-L-
fucosidases are at present members of only two glycoside hydrolase families, i.e. the families
29 and 95. Enzymes from glycoside hydrolase family 95 (EC 3.2.1.51 and 3.2.1.63) act by a
mechanism resulting in an inversion of anomeric configuration and they are generally not able
to catalyze transglycosylation reactions (Cantarel et al 2009; Trincone and Giordano 2006).
Expression plasmid pET16b-αLF1 containing the found nucleotide sequence was
prepared for its ability to produce recombinant α-L-fucosidase in form of histidine-tagged
enzyme. Fusion tag attached to the N-terminus of protein of interest didn´t mean any
restriction for the testing of the enzyme ability to catalyze transglycosylation reactions and for
the appraisal of possible application in α-L-fucosylated molecules biosynthesis. It simplified

17
the purification process and enabled the work with highly purified enzyme preparations
without any significant influence of contaminating proteins.
Characterization of hydrolytic activity of purified recombinant enzyme (pH and
temperature profil, temperature stability, the dependance of initial velocity on pNPα-L-Fuc
concentration) was carried out in order to find the best conditions for transglycosylation
reactions.
According to known stereospecificity of glycosidases it was possible to assume that α-
L-fucosidase would not be able to cleave molecules containing D-isomer of particular sugar
moiety bound by α-glycosidic linkage, as e.g. pNP-D-Gal, pNP-D-Glc and pNP-D-Man,
which were chosen as possible acceptors for testing of transglycosylation abilities of studied
enzyme. The ability of the enzyme to catalyze the transfer of α-L-fucosyl moiety to pNPα-L-
Fuc (donor molecule in all transglycosylation reactions) was tested, too. Two next groups of
tested acceptor molecules were aliphatic alcohols of different length of alkyl chain and
position of hydroxyl group and amino acids containing hydroxyl group in side chain, which
serves in glycoproteins for attachment of oligosaccharides to a protein by O-glycosidic
linkage.
All above mentioned acceptor molecules were chosen according to their importance
for further possible applications. Enzymatic synthesis of α-L-fucosyl moiety containing
oligosaccharidic chains of defined structure enables a detailed basic research of impact of
particular motives in natural biological processes. Results of this research can consequently
help in designing of new treatment of several serious diseases. For the same reason also
synthesis of different compounds of new structure, not usually occuring in the nature, is of
high importance (Ajisaka et al 1998; Berteau et al 2004; Wada et al 2008; Zeng et al 2003).
Different alkyl glycosides represent as easily biodegradable surfactants an important improve
for pharmaceutical, food, chemical and cosmetic industry (Das-Bradoo et al 2004; Hu et al

18
2008; Sarney and Vulfson 1995). Fucosylated amino acids with hydroxyl group in their side
chain can be used as building blocks in synthesis of glycopeptides of defined structure and
thus enable the deepening of findings in basic research and their application in pharmaceutical
practice (Liu et al 2006; Pratt and Bertozzi 2005).
Our research confirmed recombinant α-L-fucosidase from P. thiaminolyticus as an
enzyme with the ability to catalyze a transfer of L-fucosyl moiety to all tested saccharidic
acceptors. However, this transfer is not regioselective, as in all samples analyzed by NMR a
mixture of transfucosylation products with different glycosidic bonds was detected. Although
not regioselective transfer was determined, the fact, that α(1→2) and α(1→6) linkages were
formed when pNPα-D-Glc was used as acceptor molecule, should be stressed as important,
because in many papers of other authors formation of α(1→3) glycosidic bond was reported.
Exactly this property makes this enzyme interesting for subsequent research. Nevertheless,
the relatively low yields represent in this moment the most significant complication for the
practical application of studied enzyme and should be solved in the first place. Genetic
manipulations, for example, can offer solution for some shortcomings, which we recognized
during the work with "wild-type" recombinant α-L-fucosidase from P. thiaminolyticus.
As it is known that during transglycosylation reactions catalyzed by glycosidases two
processes are competing i.e. synthesis of the product (glycosylation) and hydrolysis of the
formed product (caused by natural activity of glycosidases), it is obvious that suppression of
hydrolytic activity could strongly influence final reaction yields. Therefore, genetic
manipulations producing so called glycosynthases, i.e. mutants of glycosidases with preserved
transglycosylation abilities (when suitable substrate molecules are used) and suppressed
hydrolytic activity, represent an interesting tool for final transglycosylation yields increasing
(Cobucci-Ponzano et al 2009; Mackenzie et al 1998; Perugino et al 2004; Wada et al 2008;
Wang 2009).

19
In 2009 results of Cobucci-Ponzano and co-workers were published reporting a
successfull preparation of two α-L-fucosynthases. These enzymes, originating from Sulfolobus
solfataricus and Thermotoga maritima, were able to use β-L-fucopyranosyl azide as donor
molecule for transglycosylation reactions using several different acceptor molecules. In some
cases interestingly high final yields reaching e.g. 91% (fucosynthase from Thermotoga
maritima, p-nitrophenyl β-D-xylopyranoside used as acceptor) or 86% (fucosynthase from
Sulfolobus solfataricus, p-nitrophenyl β-N-acetyl-D-glucosamine used as acceptor) were
found (Cobucci-Ponzano et al 2009; Wang 2009). The increase of transfucosylation activity
of α-L-fucosidase from Thermotoga maritima was also the goal of the work of Osanjo and co-
workers. In this case the method of directed evolution was used and a significant
improvement of tranglycosylation yield (from original 7% to more than 60%) was achieved
(Osanjo et al 2007).
According to above-mentioned results of authors interested in altering of enzyme
abilities by genetic manipulations, it is obvious that methods of molecular biology can offer a
new direction for the work with studied recombinant α-L-fucosidase originating from P.
thiaminolyticus. However, it is also necessary to emphasise that genetic manipulations and
glycosynthase preparation is not in any way a routine task. Nevertheless, obtained results can
contribute to better understanding of this process and its mechanism.
Also other aspects of presented work should be taken into account. The main goal of
this work was to characterize molecules arising during transglycosylation reactions and thus
verify the ability of the enzyme to catalyze synthetic reactions. Therefore, attention was not
paid to the optimization of isolation and purification process of formed compounds. These
steps should be solved during following experiments. Substantial increase of achieved yields
can by very likely assumed as a result of extraction optimization. Also the fact that suitable
conditions for individual reactions were designed according to results obtained from

20
experiments with small reaction mixtures (ten to thirty-five times smaller than mixtures used
for samples isolation for NMR analysis) could influenced the time course of the reaction and
thus also final yields and should be considered in future tests.
As mentioned earlier, primary and secondary aliphatic alcohols of a different alkyl
chain length (methanol, ethanol, 1- and 2-propanol and 1- and 2-octanol) represent the second
group of molecules tested to be able to serve as acceptors in transfucosylation reactions
catalyzed by α-L-fucosidase from P. thiaminolyticus. The enzyme was able to catalyze the
transfer of L-fucosyl moiety to short alcohols with relatively high yields (nearly 70% in
experiments with methanol as acceptor), which decreased with the length of the alkyl chain.
Also an influence of position of hydroxyl group was observed and it was evident that primary
alcohols were preferred as acceptor molecules to secondary alcohols with the same length of
alkyl chain. Because of combination of these two facts transfucosylation products of 2-
octanol - if arising - were under the limit of used detection methods (TLC and mass
spectrometry).
Many papers interested in chemical or enzymatic synthesis of alkylglycosides with
different types of saccharidic moieties (glucose, galactose, mannose) and in their properties
and possible applications were published (e.g. Das-Bradoo et al 2004; Kouptsova et al 2001;
Lirdprapamongkol and Svasti 2000; Matsumura et al 1990; Okahata and Mori 1998; von
Rybinski and Hill 1998).
In comprehensive work Vermeer and co-workers tested the possibility to fucosylate
ethanol, 1-propanol, allyl alcohol, 1-butanol, 3-bromopropanol, 3-azidopropanol, 5-
azidopentanol and 1-decanol by different chemical methods. Although in some cases
interestingly high yields overcoming 90% were achieved, a mixture of α and β anomers in
different molar ratios was obtained in all cases (Vermeer et al 2001). Strictly stereospecific

21
glycosidases could thus represent an advantageous tool for synthesis of products with
particular anomeric configuration.
From results obtained by us in experiments with alcohols as acceptor molecules it is
evident that a lot of research remains to be done before the studied α-L-fucosidase from P.
thiaminolyticus can be declared as suitable for practical application or definitely rejected.
Besides the above-mentioned possibility to prepare genetically modified enzyme also other
possibilities will be tested. One of them would be the test of suitability of enzyme protection
by encapsulation, as in some experiments negative influence of high concentration of acceptor
molecules on enzyme activity was observed. Also further molecules of different structure will
be tested as possible acceptors.
Last group of tested acceptor molecules was presented by amino acid derivatives Boc-
L-Ser-OMe and Boc-L-Thr-OMe, where both (α-carboxy and α-amino) functional groups are
protected, as recommended in literature (Nilsson and Sciegelova 1994; Cantacuzene and Attal
1991).
According to achieved yields (3.5% for Boc-L-Ser-OMe α-L-fucosylation and 3.2% for
α-L-fucosylated Boc-L-Thr-OMe synthesis) it is obvious that α-L-fucosidase from P.
thiaminolyticus is not suitable for application in biotechnological practice under tested
conditions, as our results cannot compete e.g. with yields of chemical synthesis published by
Mereyala and co-workers. They employed iodomethane activation with achieved final yields
of 79% of N-Boc-3-O-(2,3,4-tri-O-benzyl-α-L-fucopyranosyl)-L-serine methyl ester and 73%
of N-Boc-3-O-(2,3,4-tri-O-benzyl-α-L-fucopyranosyl)-L-threonine methyl ester (Mereyala et
al 1997). However, many advantages of enzymatic synthesis were mentioned above and for
that reason it would be interesting to determine possible effect of different reaction conditions
changes on final results. The fact, that the enzyme studied in our research is able to use both
tested molecules as suitable acceptors is crucial. Interestingly, in this case (it means in

22
transglycosylation reactions using amino acid derivatives as acceptor molecules) the enzyme
doesn´t exhibit any significant preference for acceptor containing primary hydroxyl group
over a molecule with secondary hydroxyl group. In the future, the influence of amino acid
derivatives protecting group will be tested, as their character could cause substantial
differences in final yields of transglycosylation reactions (Cantacuzene and Attal 1991;
Leparoux et al 1994). Naturally, also here the final yields result from two parallel phenomena,
namely hydrolytic and transglycosylation reactions and thus can be influenced by application
of genetically modified enzyme.
In conclusion, in this part of our research work we found that the bacterial strain P.
thiaminolyticus produces the enzyme, which is able to catalyze transfucosylation reactions.
Recombinant form of this α-L-fucosidase expressed with histidine tag in E. coli BL21(DE3)
was able to catalyze the transfer of α-L-fucosyl moiety to structurally different acceptor
molecules including p-nitrophenyl glycopyranosides, aliphatic alcohols and amino acid
derivatives. This fact is the most important finding of this research. Although the results
achieved during the work are not directly applicable in the biotechnological practice, they are
opening the ways for further research.

23
Materials and methods
Microorganisms and their cultivation
Used bacterial strains originated from Czech Collection of Microorganisms in Brno
(an acronym CCM), from the Collection of Microorganisms at the Institute of Chemical
Technology in Prague, Department of Biochemistry and Microbiology (an acronym DBM),
from National Collection of Industrial and Marine bacteria (an acronym NCIMB) or were
kindly provided by Professor N. J. Russell, MA, PhD (Camb) (Imperial College London).
All bacterial strains were cultivated in platform shaker under following conditions:
a) Agrobacterium rhizogenes A4 (DBM 3131), Arthrobacter nicotianae (CCM 1648),
Arthrobacter ureafaciens (CCM 1644), Bacillus sp. (DBM 3069), Bacillus amyloliquefaciens
(DBM 3129), Bacillus megaterium (CCM 2007), Bacillus pumilus (DBM 3128),
Brevibacterium ammoniagenes (DBM 1075), Brevibacterium linens (DBM 3111),
Brevibacterium stationis (CCM 317), Micrococcus luteus (CCM 169), Micrococcus roseus
(CCM 679) and P. thiaminolyticus (CCM 3599): liquid Luria-Bertani (LB) medium, 16
hours, 30 °C, 250 RPM. Bacterial strain P. thiaminolyticus was also cultivated on LB plates
under same temperature conditions.
b) Bacillus licheniformis (DBM 3100) and Enterococcus faecalis (DBM 3075): liquid
LB medium, 16 hours, 37 °C, 250 RPM
c) Arthrobacter sp. C1-1 (Prof. Russell), Arthrobacter sp. C1-2a (Prof. Russell),
Arthrobacter sp. C2-2 (Prof. Russell), Arthrobacter sp. CH07 (Prof. Russell), Arthrobacter
globiformis (NCIMB 8907), CO85 (Prof. Russell) and GY26 (Prof. Russell): liquid Brain
Heart Infusion medium, 40 hours, 15 °C, 150 RPM
d) Leuconostoc mesenteroides subsp. dextranicum (CCM 2086) and Leuconostoc
mesenteroides subsp. mesenteroides (CCM 1807): liquid Man-Rogosa-Sharpe medium, 16
hours, 30 °C, 250 RPM

24
All bacterial cultures were after cultivation harvested by centrifugation (4 000 g, 20
min, 4 °C) and stored at -20 °C.
Bacterial strains E. coli DH5α (GibcoBRL, USA) used for genomic library contruction
and E. coli BL21 (DE3) (Novagen, USA) exploited for protein expression process were
cultivated on liquid LBA medium (final concentration of ampicillin was 0.1 mg/mL
(AppliChem GmbH, Germany)) for 16 hours at 37 °C and 250 RPM or LBA plates under
same temperature conditions.
Disintegration of bacterial cells
Harvested bacterial cells were resuspended in 25 mM EPPS buffer (pH 8) (Sigma-
Aldrich, USA) and disintegrated using lysozyme (final concentration of 5 mg/mL, 30 min
incubation at laboratory temperature) (Fluka, USA) and natrium deoxycholate (final
concetration 0.1%, 30 min incubation at 4 °C) (Sigma-Aldrich, USA). Described steps were
followed by DNase addition (20 U to 1mL, 15 min incubation at laboratory temperature)
(Sigma-Aldrich, USA) and sonication (20 W, 6 x 30 s) at Sonicator® 3000 ultrasonic liquid
processor (Misonix Inc., USA). Cell debris was discarded by centrifugation (20 000 g, 20
min, 4 °C) and cell lyzates were stored at -20 °C.
Genomic library construction and sequence analysis
Commercial plasmid pUC19 (GibcoBRL, USA) was used for the construction of
genomic library of P. thiaminolyticus in cells E. coli DH5. This vector was cleaved by
restriction enzyme BamHI and subsequently dephosphorylated by CIAP. Wizard® DNA
Clean-Up System (Promega Corporation, USA) was used for the purification of prepared
plasmid DNA.

25
Chromosomal DNA of P. thiaminolyticus was isolated from cells after cultivation
process by Genomic tip 500/G (Qiagen, Germany) and partially digested by restriction
endonuclease Sau3AI. Arised fragments were ligated into prepared vector pUC19 using T4
DNA ligase.
CIAP was purchased from Invitrogen (USA), all other enzymes were purchased from
New England Biolabs (USA). Reaction conditions stated by the producer were followed.
Competent cells of E. coli DH5 were transformed (Sambrook and Russel 2001) with
prepared ligation mixture and spread on LBA plates with X-Fuc (40 g/mL) (Biosynth AG®,
Switzerland) and isopropyl -D-thiogalactopyranoside (IPTG, 40 g/mL) (Duchefa
biochemie, Netherlands). Positive colony producing enzyme with α-L-fucosidase activity was
identified according to its blue color caused by the ability to cleave chromogenic substrate X-
Fuc. Plasmid DNA of this colony was isolated by alkaline lysis (Sambrook and Russel 2001)
and by GenEluteTM HP Plasmid Midiprep Kit (Sigma-Aldrich, USA) and used as a template
for sequencing analysis (Geneart, Germany) by "primer walking" method. Commercial
primers „M13-21 (forward)“ and „M13-R“ were used for the first sequencing analysis. An
open reading frame of α-L-fucosidase encoding gene was determined using program WU-
BLAST2.
Construction of an expression plasmid
Plasmid pET16b (Novagen, USA) was chosen as a suitable vector for expression
plasmid containing a gene of α-L-fucosidase construction. Chosen plasmid was cleaved by
restriction endonucleases NdeI and BamHI, whose restriction sites are situated in pET16b
cloning region, dephosphorylated by CIAP and purified by Wizard® DNA Clean-Up System.
Primers GGCAAAGGAGAGAACACATATGACGTTAACCGC containing a restriction
site for NdeI (emphasized by underlining) and

26
CAGAAAATACAGAAAACAGGATCCCAAGTAG with a restriction site for BamHI
were used for production of DNA fragment (1382 bp) containing desired gene sequence in the
PCR reaction catalyzed by Kod Hot Start DNA polymerase (Novagen, USA). Chromosomal
DNA of P. thiaminolyticus served as template in this reaction. After specific cleavage by NdeI
and BamHI and purification by commercial kit Wizard® SV Gel and PCR Clean-Up System
(Promega Corporation, USA) the PCR product was ligated into the prepared plasmid pET16b.
Molar concentration ratio of plasmid DNA and PCR product was 1:3. Ligation catalyzed by
T4 DNA ligase (3 h at 16 °C and 10 min at 22 °C) was followed by transformation of
competent cells E. coli BL21 (DE3) (Novagen, USA) by obtained ligation mixture and by
their cultivation on LBA plates with X-Fuc and IPTG, as described previously. The plasmid
DNA of positive colony was isolated by alkaline lysis and GenEluteTM HP Plasmid Midiprep
Kit and the accuracy of the prepared expression vector was confirmed by sequencing. The
name pET16b-αLF1 will be used for this expression plasmid in the text.
Expression and purification of recombinant histidine-tagged α-L-fucosidase
Prepared expression plasmid pET16b-αLF1 was used for transformation of the
competent cells of E. coli BL21 (DE3) and the cells were cultivated on LBA plates for 16 h at
37 °C. One colony was used for inoculation of 10 mL of LBA, which was subsequently
cultivated overnight at 37 °C and 250 RPM and afterwards used for 1% inoculation of 100
mL of LBA. Optical density at 600 nm (OD600) of the growing culture (37 °C, 250 RPM) was
followed and at the value OD600 of 0.5 expression of the recombinant protein was induced by
addition of IPTG to the final concentration of 0.3 mmol/L. The cultivation was finished four
hours after induction of recombinant protein expression and the cells were harvested by
centrifugation (4 000 g, 20 min, 4 °C).

27
Harvested cells were resuspended in 25 mM EPPS buffer (pH 8) and disintegrated by
the same protocol as described for P. thiaminolyticus cells disruption.
Ni-NTA agarose column (Qiagen GmbH, Germany) for affinity chromatography was
equilibrated with 50 mM phosphate buffer (pH 7.5) with 150 mM KCl (Lach-Ner, s.r.o, CZ)
and 10 mM imidazole (Sigma-Aldrich, USA). The sample after E. coli BL21 (DE3) cells
disintegration, containing recombinant histidine-tagged α-L-fucosidase, was applied on the
Ni-NTA agarose column. The contaminants were washed out of the column by 50 mM
phosphate buffer (pH 7.5) with 150 mM KCl with 40 mM imidazole. For the elution of the
recombinant α-L-fucosidase 50 mM phosphate buffer (pH 7.5) with 150 mM KCl and 250
mM imidazole was used. All fractions were assayed for α-L-fucosidase activity. Samples
displaying this activity were put together and desalted by gel chromatography (column PD10
(GE Healthcare, UK)). This chromatographic step served also for the transfer of the protein of
interest into 25 mM EPPS buffer (pH 8).
Electrophoretic analysis
Different samples of chromosomal or plasmid DNA were analysed by agarose
electrophoresis in 1% gel. Lambda DNA/Hind III Marker (Invitrogen, USA) or 100 bp DNA
Ladder (Invitrogen, USA) were used as molecular weight standards. Ethidium bromide
(Amresco, USA) was used for the visualization.
Expression and purification of recombinant α-L-fucosidase were followed by SDS-
PAGE in 5% stacking gel and 10% running gel (Laemmli 1970). Reduction conditions in the
presence of dithiotreitol (Amresco, USA) were used. SDS-PAGE Molecular Weight
Standards, Broad Range (Bio-Rad Laboratories, USA) served as molecular weight standard.
Coomassie Brilliant Blue R-250 (Amresco, USA) was used for proteins visualization.

28
Protein concentration assay
Protein concentration was in analyzed samples determined by Bradford protein
method (Bradford 1976). Bradford reagent was purchased from Amresco, USA. Bovine
serum albumin (SERVA Electrophoresis GmbH, Germany) was used as standard protein in
the concentration range 0-0.1 mg/mL.
α-L-Fucosidase assay
Enzymatic activity of α-L-fucosidase was measured in 25 mM EPPS buffer (pH 8) at
37 °C for 10 min using pNPα-L-Fuc (Biosynth AG®, Switzerland) as a substrate (7 mM in the
reaction mixture). An equal volume of 10% Na2CO3 was used for reaction termination and the
absorbance of reaction mixture was measured at 405 nm. Calibration curve, constructed for p-
nitrophenol in the concentration range 0-100 µmol/L, was constructed under same reaction
conditions and served for the calculation of realeased amount of p-nitrophenol. Enzyme
amount, which was able to release 1 mol of p-nitrophenol per minute at 37 °C, was defined
as one unit.
α-L-Fucosidase characterization
Samples of recombinant α-L-fucosidase after purification process were used for
enzyme characterization. Temperature profil (i.e. the dependence of α-L-fucosidase activity
on reaction temperature) was measured for different temperatures ranging from 20 °C to 70
°C. Stability of the enzyme was tested by incubation of enzyme sample at different
temperatures (37 °C, 45 °C, 50 °C and 55 °C) for defined time intervals and subsequent
standard activity assay. Stability of the enzyme at -20 °C (storage conditions) was controled
weekly during 15 weeks by standard activity assay. For the determination of the influence of
reaction mixture pH on the enzyme activity a set of Britton-Robinson buffers was used. Final

29
reaction mixture pH covered the range from 2 to 12. Kinetic parameters were determined by
measuring the dependance of initial velocity on the concentration of pNPα-L-Fuc in reaction
mixtures and subsequent calculation by the nonlinear regression method. According to
obtained data it was necessary to use an equation (1) taking into account inhibition caused by
high substrate concentrations.
Vlim


S


v0 


S



KM  1

S
 

KS


(1),
v0 represents initial velocity, [S] represents substrate concentration, KM is used for Michaelis
constant, Vlim for maximum velocity and KS for inhibition constant (Copeland, 2000).
Confidence intervals are expressed in standard deviations.
Transglycosylation reactions
The ability of recombinant α-L-fucosidase to catalyze transfer of α-L-fucosyl moiety to
different types of acceptor molecules (p-nitrophenyl glycopyranosides, alcohols and amino
acid derivatives) was tested. All transglycosylation reactions were carried out in 25 mM EPPS
buffer (pH 8) at 45 °C. In all cases pNPα-L-Fuc served as a donor molecule. Due to low
solubility of p-nitrophenyl glycopyranosides (especially pNPα-L-Fuc) in 25 mM EPPS buffer
(pH 8) the possibility to use 5%, 10%, 25% and 50% DMF in reaction mixtures containing p-
nitrophenyl glycopyranosidic and amino acid acceptors was tested. Stability of the
recombinant enzyme at 45 °C in the presence of 10% DMF was measured for 6 hours.
Preserved activity was determined using standard activity assay. According to obtained results
final reaction mixtures contained 10% DMF. In all cases the composition of reaction mixtures
and reaction time were designed to achieve maximal transglycosylation product yields. The
volumes of reaction mixtures depended on the method used for product analysis and on the
expected amount of arising product.

30
a) p-nitrophenyl glycopyranosides as acceptors
Chromogenic substrates pNP-D-Gal, pNP-D-Glc, pNP-D-Man (purchased from
Sigma-Aldrich (USA)) and also the compound serving as donor molecule (pNPα-L-Fuc) were
tested to be suitable acceptor molecules for transglycosylation reactions. Reaction mixtures
composition is summarized in Table III. Composition of final reaction mixtures after
transglycosylation reaction was analyzed by TLC. Main transglycosylation products were
isolated from TLC plates by extraction into methanol (pNP-D-Glc and pNPα-L-Fuc used as
acceptors) or into deionized water (pNP-D-Gal used as acceptor). Different isolation
procedures were caused by the presence of methanol soluble contaminants in the sample with
pNP-D-Gal as acceptor. After decreasing of sample volume by methanol evaporation (rotary
evaporator Büchi, Rotavapor R114 with water bath B480 (Büchi Labortechnik AG,
Switzerland)) or water lyophilisation (FreeZone 1 Liter Benchtop Freeze Dry System
(Labconco, USA)) samples were filtered using Puradisc 4 Syringe Filter (0.45 m)
(Whatmann, UK). Remaining methanol/deionized water was evaporated/lyophilised, the
samples were dissolved in D2O, and analyzed by mass spectrometry and NMR spectroscopy.
Final yields were calculated according to isolated molar amounts of transglycosylation
product and added acceptor molecule. Due to low transglycosylation yield in case of pNP-D-
Man the presence of anticipated reaction product was confirmed only by mass spectrometry in
the whole reaction mixture after filtration on VectaSpin Centrifuge Tube Filter (Whatmann,
UK) with cut-off of 12 kDa.
b) aliphatic alcohols as acceptors
Aliphatic alcohols with the primary or secondary hydroxyl group (methanol, ethanol
and 1-propanol (Penta, CZ), 2-propanol (Lach-Ner, s.r.o, CZ), 1-octanol (Fluka, USA) and 2-