Development of an anti-hepatitis B virus (HBV) agent through the structure-activity relationship of the interferon-like small compound CDM-3008

Article abstract of DOI:10.1016/j.bmc.2018.11.039

Hepatitis B, a viral infectious disease caused by hepatitis B virus (HBV), is a life-threatening disease that leads liver cirrhosis and liver cancer. Because the current treatments for HBV, such as an interferon (IFN) formulation or nucleoside/nucleotide

Full text of DOI:10.1016/j.bmc.2018.11.039

Bioorganic&MedicinalChemistryxxx(xxxx)xxx–xxx
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Development of an anti-hepatitis B virus (HBV) agent through the structure-
activity relationship of the interferon-like small compound CDM-3008
Nobuaki Takahashia, Kyohei Hayashia, Yusuke Nakagawaa, Yutaka Furutanib, Mariko Toguchib,
⁎
Yumi Shiozaki-Satob, Masayuki Sudohb, Soichi Kojimab, Hideaki Kakeyaa,
a Department of System Chemotherapy and Molecular Sciences, Division of Bioinformatics and Chemical Genomics, Graduate School of Pharmaceutical Sciences, Kyoto
University, Sakyo-ku, Kyoto 606-8501, Japan
b Liver Cancer Prevention Research Unit, RIKEN Center for Integrative Medical Sciences, 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan
A R T I C L E I N F O
A B S T R A C T
Keywords:
Hepatitis B, a viral infectious disease caused by hepatitis B virus (HBV), is a life-threatening disease that leads
liver cirrhosis and liver cancer. Because the current treatments for HBV, such as an interferon (IFN) formulation
or nucleoside/nucleotide analogues, are not sufficient, the development of a more effective agent for HBV is
urgent required.
Hepatitis B virus
Anti-HBV agent
Interferon
Structure-activity relationship
CDM-3008 (1, 2-(2,4-bis(trifluoromethyl)imidazo[1,2-a][1,8]naphthyridin-8-yl)-1,3,4-oxadiazole) (RO8191)) is a
small molecule with an imidazo[1,2-a][1,8]naphthyridine scaffold that shows anti-HCV activity with an IFN-like
effect. Here, we report that 1 was also effective for HBV, although the solubility and metabolic stability were in-
sufficient for clinical use. Through the structure-activity relationship (SAR), we discovered that CDM-3032 (11, N-
(piperidine-4-yl)-2,4-bis(trifluoromethyl)imidazo[1,2-a][1,8]naphthyridine-8-carboxamide hydrochloride) was more
soluble than 1 (> 30 mg/mL for 11 versus 0.92 mg/mL for 1). In addition, the half-life period of 11 was dramatically
improved in both mouse and human hepatic microsomes (T1/2, > 120 min versus 58.2 min in mouse, and > 120
min versus 34.1 min in human, for 11 and 1, respectively).
1. Introduction
administration because the discontinuation of these drugs may cause
the reactivation of HBV.4 Therefore, nucleoside/nucleotide analogues
Hepatitis B is a viral infectious disease caused by hepatitis B virus
(HBV). In some cases of chronic infection, hepatitis B progresses to
more serious diseases such as liver cirrhosis and liver cancer. HBV be-
longs to the hepadnaviridae family, which have partially single stranded
DNA. The replication process of HBV involves attachment, inter-
nalization into a host cell, uncoating, intranuclear transport, formation
of covalently closed circular DNA (cccDNA), transcription from cccDNA
to pregenome RNA, and reverse transcription for DNA synthesis.1
Currently, the standard therapies for chronic HBV patients include
interferon (IFN) treatment or nucleoside/nucleotide analogues.2 IFN
formulations suppress viral growth and have an immunostimulating
effect. However, IFN formulations are only effective in approximately
30% of patients and they can induce serious side effects.3 Nucleoside/
nucleotide analogues (Entecavir, Lamivudine, and Adefovir) exhibit
anti-HBV effects by inhibiting reverse transcription. Despite their strong
antiviral effect, nucleoside/nucleotide analogues require long-term
are not effective at removing remaining cccDNA from cell nuclei, and
the replication process can start again by utilizing cccDNA as the
template DNA. Thus, the discovery of a new compound that inhibits
viral cccDNA will lead to the development of a more effective agent for
the treatment of hepatitis B.
In 2012, RO8191 (1) was reported as an orally available IFN-like
compound with an imidazo[1,2-a][1,8]naphthyridine scaffold that
displayed remarkable anti-hepatitis C virus (HCV) activity (Fig. 1).5
Interestingly, RO8191 (1) exerted its antiviral activity by directly in-
teracting with IFN alfa and beta receptor subunit 2 (IFNAR2) to drive
IFN-stimulated gene (ISG) expression, which then induced an antiviral
immune response. Therefore, RO8191 (1) is a potentially beneficial
compound that might be a new agent for the treatment of HCV. Other
groups have reported structure–activity relationship (SAR) studies of
RO8191 (1).6 Among them, Tan’s group discovered that compounds
containing amide moieties showed remarkable anti-HCV activity
Abbreviations: HBV, Hepatitis B virus; HCV, Hepatitis C virus; Interferon, IFN; cccDNA, covalently closed circular DNA; ISG, Interferon-stimulated gene; SAR,
Structure-activity relationship
⁎ Corresponding author.
E-mail address: scseigyo-hisyo@pharm.kyoto-u.ac.jp (H. Kakeya).
https://doi.org/10.1016/j.bmc.2018.11.039
Received 4 September 2018; Received in revised form 27 November 2018; Accepted 28 November 2018
0968-0896/©2018ElsevierLtd.Allrightsreserved.
Pleasecitethisarticleas:Takahashi,N.,Bioorganic&MedicinalChemistry,https://doi.org/10.1016/j.bmc.2018.11.039

N. Takahashi et al.
Bioorganic&MedicinalChemistryxxx(xxxx)xxx–xxx
Compound 3 was reacted with hydrazine hydrate to obtain hydrazide 4
that was then treated with various acyl chlorides to provide the cor-
responding hydrazides 6a–6d. Then, the oxadiazole ring was con-
structed by reaction with phosphorous trichloride to give CDM-3050
(7a), CDM-3049 (7b), CDM-3052 (7c), and compound 7d. The benzyl
group of 7d was removed by hydrogenation to obtain CDM-3056 (8d).
Next, derivatives that possessed an amide moiety were synthesized
(Scheme 2). The ester group of 3 was hydrolyzed with aqueous NaOH to
generate carboxylic acid 9. This carboxylic acid was condensed with
tert-butyl 4-aminopiperidine-1-carboxylate to obtain amide 10, fol-
lowed by the deprotection of the Boc group to obtain CDM-3032 (11).
Carboxylic acid 9 was converted to CDM-3075 (12a), CDM-3074 (12b),
and CDM-3020 (12c) by condensation with respective aminopyridines.
Derivatives possessing an amino ethyl group at the 2-position were
synthesized as follows (Scheme 3). After the preparation of ethyl 2-
hydroxy-4-(trifluoromethyl)imidazo[1,2-a][1,8]naphthyridine-8-car-
boxylate (13) from 2,6-diaminopyridine (2),6a an N-Boc amino ethyl
group was introduced by Mitsunobu reaction. The ester group was
hydrolyzed and the resulting carboxylic acid was converted to an ox-
adiazole ring7 to afford 16, followed by the deprotection of the Boc
group to obtain CDM-3030 (17). CDM-3026 (19) was synthesized using
4-aminopyridine in a similar fashion.
Fig. 1. Chemical structures of CDM-3008 (1, RO8191) and the compound 5i.
2.2. Biological activities
Because CDM-3008 (1) has an antiviral effect via IFN-like actions,
we expected that derivatives might function in the same manner. As an
artificial evaluation of IFN-like activity, we measured the anti-HCV
activity of derivatives by using a luciferase reporter assay with HCV
replicon cells.8 Thereafter, the anti-HBV activity of compounds selected
by the anti-HCV assay was examined. We used primary human hepa-
tocytes PXB cells9,10 to measure the anti-HBV activity of the synthesized
analogues.
Fig. 2. Anti-HBV activity of CDM-3008 (1) in primary human hepatocytes PXB
cells. Primary cultured human hepatocytes, PXB cells, were infected with HBV
genotype C for 1 day and cultured for 28 days, and then the cells were treated
with indicated concentration of CDM-3008 (1) or IFNα2a for 7 days. Then,
cellular HBV DNA copies were measured as described in Experimental section.
Data represent the mean
standard error (n = 3).
2.2.1. Anti-HCV activity
Table 1 shows the effect of substation at position 11. CDM-3056
(8d), containing a hydroxyl group as a polar group, did not show the
desired activity (12.0% inhibition at 30 μM). CDM-3050 (7a)6c con-
taining a methyl group, showed activity similar to CDM-3008 (1)
(89.8% inhibition at 30 μM). However, the introduction of a methoxy
methyl group and n-propyl group reduced its anti-HCV activity (4.8%
and 15.3% inhibition, respectively). These data revealed that there was
a low acceptability for a substitution at position 11.
(EC50 = 0.017–0.159 μM; i.e. 0.046 μM for compound 5i).6c Interest-
ingly, their antiviral effects depended on inhibiting viral entry, unlike
RO8191 (1).
Recently, we discovered that RO8191 (1) was effective for HCV as
well as HBV as IFN was (Fig. 2), indicating this compound might be
potentially useful as an anti-HBV agent. As we found that RO8191 (1)
exhibited anti-HBV activity and modulated covalently closed circular
DNA (cccDNA) levels (data not shown), we named this compound as
cccDNA modulator (CDM) and numbered as 3008. Nevertheless, it is
difficult to use CDM-3008 (1) for clinical applications because it has
poor metabolic stability and solubility. Here we report the structure-
activity relationship of CDM-3008 (1) using synthesized analogs and
the development of a compound with improved half-life and solubility.
We next examined the replacement of the oxadiazole ring by amide
moieties (Table 2). As mentioned above, we expected that this con-
version would improve solubility by destructing the rigid planar
structure. We synthesized CDM-3075 (12a) whose amide bond was
constructed with 2-aminopyridine. This compound possessed an oxygen
atom and two nitrogen atoms at the near position relative to these
atoms in the oxadiazole ring. In addition, we prepared other isomers
connected with 3-aminopyridine (CDM-3074, 12b) and 4-aminopyr-
idine (CDM-3020, 12c) through an amide bond. Although CDM-3075
(12a) did not show anti-HCV activity, CDM-3074 (12b) and CDM-3020
(12c) exhibited the expected effect (63.6%, 40.1%, respectively).
However, the solubility of these active compounds was lower than that
of CDM-3008 (1). Next, we substituted the pyridine ring by piperidine
hydrochloride salt (CDM-3032, 11). Although CDM-3032 (11) had
weak cytotoxicity, this compound exhibited anti-HCV activity (90.7%)
with a similar potency to CDM-3008 (1). In addition, its solubility was
remarkably improved in comparison with CDM-3008 (1).
2. Results and discussion
2.1. Design and synthesis of derivatives
We synthesized analogs of CDM-3008 (1) to improve its solubility.
First, the introduction of a polar group at position 11 was examined.
Next, the oxadiazole ring was substituted by an amide moiety. We ex-
pected that this conversion would make the molecules more soluble in
aqueous solutions by breaking the planarity of the molecule. Finally,
substitution of the trifluoromethyl group at position 2 was also in-
vestigated.
Finally, we investigated the substitution of the trifluoromethyl
group at position 2. As described above (Table 2), CDM-3008 (1) and
CDM-3020 (12c) exhibited IFN-like activity, but these compounds had
low solubility. To improve solubility, we synthesized derivatives with
an ethyl amine group at position 2. Although the anti-HCV activity of
these derivatives was weaker than that of CDM-3008 (1) (28.1% vs
The synthetic method used for 11-alkylated derivatives is shown in
Scheme 1. We started the synthesis with ethyl 2,4-bis(trifluoromethyl)
imidazo[1,2-a][1,8]naphthyridine-8-carboxylate (3), which was syn-
thesized from commercially available 2,6-diaminopyridine (2).6a
2

N. Takahashi et al.
Bioorganic&MedicinalChemistryxxx(xxxx)xxx–xxx
Scheme 1. Synthesis of 11-alkylated derivatives. a) H2N-NH2 H2O, EtOH, 65 °C, 4 h, 91%; b) pyridine, CH2Cl2, rt, 12 h, 6a; 47%, 6b; 66%, 6c; 91%, 6d; 71%; c)
POCl3, CH3CN, reflux, 6 h, CDM-3050 (7a); 41% (2 steps), CDM-3049 (7b); 39% (2 steps), CDM-3052 (7c); 19% (2 steps), 7d; 7% (2 steps); d) H2, Pd/C, MeOH, THF,
45 °C, 20 h, 15%.
Scheme 2. Synthesis of amide derivatives. e) 1 N
NaOH aq., THF, 50 °C, 18 h; f) tert-butyl 4-amino-
piperidine-1-carboxylate, HATU, HOAt, DIEA, DMF,
rt, 14 h, 51% (2 steps); g) 4 N HCI, 1.4-dioxane, rt,
20 min, 25%; h) aminopyridines, HATU, HOAt,
DIEA, DMF, rt, 14 h, CDM-3075 (12a); 8% (2 steps),
CDM-3074 (12b); 83% (2 steps), CDM-3020 (12c);
45% (2 steps).
78.2%, respectively), their solubilities were remarkably improved
(Table 3).
PXB cells. As a result, the compound 5i showed weak anti-HBV activity,
comparing with CDM-3032 (11) (See supplementary data). In the lit-
erature, they measured the anti-HBV activity of their selected com-
pounds using HepAD38 cells derived from HepG2 cell lines and they
mentioned that their compound did not have anti-HBV effect
(EC50 = > 20 µM). However, HepAD38 cells are not appropriate to be
Primary cultured human hepatocytes, PXB cells, were infected with
HBV genotype C for 1 day and cultured for 28 days, and then the cells
were treated with indicated concentration of CDM-3008 (1), CDM-3026
(19), CDM-3030 (17), or CDM-3032 (11) for 14 days. Then, cell via-
bility and cellular HBV DNA copies were measured as described in
used for measuring of anti-HBV effect via ISGs.11
.
Experimental section. Data represent the mean
(n = 3).
standard error
Human hepatocellular carcinoma JHH-7 cells were treated with 3
and 30 μM of CDM-3008 (1), CDM-3026 (19), CDM-3030 (17), or CDM-
3032 (11) for 3 days. Then, OAS-1 mRNA expression levels were
measured as described in Experimental section. Data represent the
2.2.2. Anti-HBV activity
mean
standard error (n = 3).
We selected CDM-3026 (19), CDM-3030 (17) and CDM-3032 (11)
for the evaluation of anti-HBV activity based on the SAR study results,
because these compounds showed sufficient solubility and maintained
anti-HCV-activity. The anti-HBV activities of the selected compounds
were measured in PXB cells (Fig. 3). Although CDM-3026 (19) did not
have anti-HBV activity, the other derivatives, CDM-3030 (17) and
2.2.3. Expression of OAS-1 mRNA
To analyze the mechanism of anti-HBV activity, we measured the
mRNA levels of OAS-1, an ISG. Similar to CDM-3008 (1), OAS-1 mRNA
expression was increased compared with the control DMSO and CDM-
3030 (17) treatment groups, respectively. CDM-3032 (11) tended to
increase OAS-1 expression levels, but not to a significant level, sug-
gesting that an oxadiazole ring is necessary for the IFN-like effect
(Fig. 4).
CDM-3032 (11), exhibited the expected activity (IC50
10.0 μM and
=
8.4 μM, respectively) without cytotoxicity.
Because of the structural similarity with CDM-3032 (11), we syn-
thesized the compound 5i6c and measured its anti-HBV activity using
3

N. Takahashi et al.
Bioorganic&MedicinalChemistryxxx(xxxx)xxx–xxx
Scheme 3. Synthesis of derivatives possessing amino
ethyl group; i) tert-butyl (2-hydroxyethyl)-carba-
mate, PPh3, DEAD, DMF, 0 °C to rt, 7 h, 29%; j) 1 N
NaOH aq., THF, 50 °C, 18 h; k) (isocyanoamino)-tri-
phenylphosphorane, CH2Cl2, rt, 12 h, 34% (2 steps);
l) 4 N HCl/1.4-dioxane, rt, 5 min, 10%. m) 4-amino-
pyridine, HATU, HOAt, DIEA, DMF, rt, 16 h 33% (2
steps); n) 4 N HCl/1.4-dioxane, rt, 20 min, 39.
Table 1
Table 2
Effect of the substitutions of diazaoxazole ring (R2).
Effect of the substitutions of the diazaoxazole ring (R1).
Compound
R2
Anti-HCV
activitya
(%)
Cytotoxicitya,b (%) Solubility
(mg/mL)c
Compound
R1
Anti-HCV activitya (%)
Cytotoxicitya,b (%)
CDM-3008 (1)
CDM-3056 (8d)
CDM-3050 (7a)
CDM-3049 (7b)
CDM-3052 (7c)
H
92.1
12.0
89.8
15.3
4.8
3.1
CDM-3008
92.1
3.1
1.6
6.9
0.92
CH2OH
Me
−7.4
4.3
(1)
n-Pr
8.5
CDM-3075
2.6
< 0.1
< 0.1
CH2OMe
−2.5
(12a)
a
Mean data (n = 2) at 30 μM relative to DMSO control (n = 2).
Evaluated by using XTT.
CDM-3074
63.6
b
(12b)
CDM-3032 (11) has a similar structure with the compounds re-
CDM-3020
40.1
90.7
4.2
< 0.1
> 30
ported by Tang, which had an amide bond and amino moiety. Of note,
both compounds did not have IFN-like activity. However, CDM-3032
(11) showed an anti-HBV effect in contrast to the compounds reported
by Tang. Therefore, the mechanism of anti-HBV activity induced by
CDM-3032 should be further studied.
(12c)
CDM-3032
58.6
(11)
a
b
c
Mean data at 30 μM relative to DMSO control (n = 2).
Evaluated by using XTT.
2.2.4. Metabolic stability
Finally, the metabolic stability of CDM-3032 (11) was evaluated
using mouse and human liver microsomes in vitro. In comparison with
CDM-3008 (1), the half-life period of CDM-3032 (11) dramatically
improved in both mouse and human hepatic microsomes (T1/
2, > 120 min versus 58.2 min in mouse, and > 120 min versus 34.1 min
in human, for 11 and 1, respectively) (Table 4). Therefore, CDM-3032
(11) might have the advantage of a sustained anti-HBV effect.
Solubility was calculated using the peak area of HPLC.
of CDM-3008 (1) in aqueous solutions is low, we focused on improving
its solubility and that of its synthesized derivatives. After the con-
firmation of anti-HCV activity by luciferase assay with HCV replicon
cells, we measured anti-HBV activity using PXB cells and demonstrated
CDM-3032 (11) had anti-HBV activity. The solubility of CDM-3032 (11)
was markedly increased compared with CDM-3008 (1). In addition, the
half-life period of CDM-3032 (11) was longer than that of CDM-3008
(1) in both mouse and human liver microsomes.
3. Conclusion
This study performed a SAR analysis of the IFN-like compound
The evaluation of OAS-1 mRNA expression to determine the anti-
HBV activity of CDM-3032 (11) indicates it might function independent
CDM-3008 (1) to develop a new anti-HBV agent. Because the solubility
4

N. Takahashi et al.
Bioorganic&MedicinalChemistryxxx(xxxx)xxx–xxx
Table 3
Effect of the substitutions of diazaoxazole ring (R3) and trifluoromethyl group (R4).
Compound
R3
R4
Anti-HCV activitya (%)
90.1
Cytotoxicitya,b (%)
3.1
Solubilityc (mg/mL)
0.92
CDM-3008 (1)
CF3
CDM-3030 (17)
CDM-3026 (19)
OCH2CH2NH2∙HCI
OCH2CH2NH2∙HCI
28.1
78.2
5.7
19.8
51.8
> 30
a
b
c
Mean data at 30 μM relative to DMSO control (n = 2).
Evaluated by using XTT.
Solubility was calculated using the peak area of HPLC.
of IFN-like actions. In addition, the strength of anti-HBV effect was not
sufficient for clinical applications. To discover more effective com-
pounds for anti-HBV treatment, our future studies include SAR analysis
and the identification of the mechanisms of anti-HBV activity.
twice with AcOEt. The combined organic layers were washed with
brine, dried over Na2SO4, and evaporated. The residue was purified by
silica gel flash column chromatography (AcOEt/CHCl3 = 40:60) to
afford 2.2 mg (47%) of 6a as a white solid.
6a: 1H NMR (500 MHz, CD3OD) δ ppm: 9.11 (1H, s), 8.34 (1H, s),
8.02 (1H, d, J = 15.2), 7.93 (1H, d, J = 9.6), 2.08 (3H, s); 13C NMR
(125 MHz, DMSO‑d6) δ ppm: 168.8, 160.7, 145.22 (q, J = 35.7), 144.3,
143.7, 138.9, 137.0 (q, J = 32.5), 123.9, 123.6, 122.2, 121.6, 120.1,
4. Experimental section
4.1. Chemistry
118.1, 115.8, 115.4, 21.1; HR-ESI-MS calcd for C15H8F6N5O [M + H]+
388.0633, found: 388.0634, calcd for C15H7F6N5NaO [M + Na]+
410.0452, found: 410.0443.
:
:
1H and 13CNMR spectra were recorded on JEOL NMR spectrometers
at 500 MHz (1H NMR) and at 125 MHz (13C NMR) or Bruker Avance I at
150 MHz (13C NMR). J values are given in Hz. Multiplicities are given
as s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet, and
br = broad. High-resolution mass spectra were recorded on LC-IT-TOF
MS (Shimadzu) mass spectrometers. TLC: precoated silica gel 60 F254
plates (Merck, 0.25 mm thick). Column chromatography: silica gel F60
(Silicycle, 230–400 mesh). High performance liquid column chroma-
4.1.2.2. N’-propyl-2,4-Bis(trifluoromethyl)imidazo[1,2-a][1,8]
naphthyridine-8-carbohydrazide (6b). Yield, 66%; a white solid; 1H NMR
(500 MHz, CDCl3) δ ppm: 9.74 (1H, s), 9.15 (1H, s), 8.61 (1H, s), 8.12
(1H, s), 7.90 (1H, d, J = 12.0), 7.82 (1H, d, J = 8.0), 2.36 (2H, t,
J = 7.0), 1.78 (2H, q, J = 7.5), 1.02 (3H, t, J = 7.5); 13C NMR
tography (HPLC) was performed using
a
Prominence CBM-20A
(125 MHz, DMSO‑d6) δ ppm: 171.7, 160.7, 145.5 (q, J = 29.8),
(Shimadzu) system equipped with a Prominence SPD−20A UV/VIS
detector (Shimadzu).
144.3, 143.7, 139.0, 137.1 (q, J = 33.4), 123.9, 123.6, 122.2, 121.5,
120.1, 118.1, 115.8, 115.4, 35.7, 19.0, 14.1; HR-ESI-MS calcd for
C
17H14F6N5O2 [M + H]+: 434.1052, found: 434.1033.
4.1.1. Synthesis
of
2,4-Bis(trifluoromethyl)imidazo[1,2-a][1,8]
naphthyridine-8-carbohydrazide (4)
4.1.2.3. N’-(2-methoxyacetyl)-2,4-Bis(trifluoromethyl)imidazo[1,2-a]
Hydrazine monohydrate (0.71 mL, 14.5 mmol) was added to a
stirred solution of compound 3 (274.0 mg, 0.727 mmol) in EtOH
(13.0 mL) at room temperature at 65 °C for 4 h. After the reaction
mixture was cooled to room temperature, the precipitate was filtered
and washed with cold ethanol to obtain 240.0 mg (91%) of 4 as a white
solid; 1H NMR (500 MHz, CDCl3) δppm: 9.16 (1H, s), 8.40 (1H, s), 8.12
(1H, s), 7.90 (1H, d, J = 9.0), 7.81 (1H, d, J = 9.5), 4.13 (1H, s), and
3.50 (1H, s).
[1,8]naphthyridine-8-carbohydrazide (6c). Yield, 91%; a white solid; 1
H
NMR (500 MHz, CDCl3) δ ppm: 9.63 (1H, s), 9.14 (1H, s), 8.97 (1H,s),
8.11 (1H, s), 7.90 (1H, d, J = 8.5), 7.82 (1H, d, J = 9.5), 4.13 (2H, s),
3.51 (3H, s) ; 13C NMR (125 MHz, CDCl3) δ ppm: 166.6, 158.8, 146.9
(q, J = 38.1), 144.0, 143.2, 138.2 (q, J = 29.8), 123.2, 122.9, 121.5,
121.2, 119.3, 117.3, 116.1, 114.8, 71.4, 59.6; HR-ESI-MS calcd for
C
16H12F6N5O3 [M + H]+: 436.0844, found: 436.0821.
4.1.2.4. N'-(2-(benzyloxy)acetyl)-2,4-bis(trifluoromethyl)imidazo[1,2-a]
4.1.2. Synthesis of hydrazides 6a–6d
[1,8]naphthyridine-8-carbohydrazide (6d). Yield, 71%; a white solid; 1
NMR (500 MHz, CDCl3) δ ppm: 9.63 (1H, d, J = 5.2), 9.13 (1H, s), 9.04
(1H, d, J = 5.2), 8.11 (1H, s), 7.88 (1H, d, J = 10.0), 7.82 (1H, d,
J = 9.6), 7.38–7.31 (5H, overlapped), 4.66 (2H, s), 4.20 (2H, s); 13C
NMR (125 MHz, CDCl3) δ ppm: 167.0, 159.1, 146.8 (q, J = 37.3),
143.9, 143.2, 138.2 (q, J = 33.4), 138.2, 136.5, 128.7, 128.4, 128.2,
122.9, 121.5, 121.1, 119.3, 117.3, 116.0, 114.8, 73.9, 70.0; HR-ESI-MS
H
4.1.2.1. N’-acetyl-2,4-Bis(trifluoromethyl)imidazo[1,2-a][1,8]
naphthyridine-8-carbohydrazide
(6a). Acetyl
chloride
(4.24 μL,
0.059 mmol) was added to
a stirred solution of compound 4
(19.7 mg, 0.054 mmol) in CH2Cl2 (0.5 mL) and pyridine (0.25 mL) at
0 °C and the mixture was stirred at room temperature for 12 h. The
reaction was quenched with H2O and then whole mixture was extracted
5

N. Takahashi et al.
Bioorganic&MedicinalChemistryxxx(xxxx)xxx–xxx
Fig. 3. Anti-HBV activity of the selected compounds. Primary cultured human hepatocytes, PXB cells, were infected with HBV genotype C for 1 day and cultured for
28 days, and then the cells were treated with indicated concentration of CDM-3008 (1), CDM-3026 (19), CDM-3030 (17), or CDM-3032 (11) for 14 days. Then, cell
viability and cellular HBV DNA copies were measured as described in Experimental section. Data represent the mean
standard error (n = 3).
Table 4
Metabolism of CDM-3008 (1) and CDM-3032 (11).
Compound
T1/2 (mouse hepatic
T1/2 (human hepatic
microsome) (min)
microsome) (min)
CDM-3008 (1)
CDM-3032 (11)
58.2
34.1
> 120
> 120
(23.0 mg, 0.057 mmol) in CH3CN (2.0 mL) at 0 °C and the mixture
was refluxed for 6 h. The reaction was quenched with H2O and sat.
NaHCO3 aq. was added until a pH 8–9 was achived. The whole mixture
was extracted three times with CHCl3, and the combined organic layers
were washed with brine, dried over Na2SO4, and evaporated. The
residue was purified by silica gel flash column chromatography
(AcOEt/CHCl3 = 40:60) to afford 9.0 mg (41%) of CDM-3050 (7a) as
a white solid.
Fig. 4. Effect of the selected compounds on OAS-1 mRNA expression in human
hepatocellular carcinoma, JHH-7 cells.
calcd for C22H16F6N5O2 [M + H]+: 512.1157, found: 512.1118.
CDM-3050 (7a): 1H NMR (500 MHz, CDCl3) δ ppm: 9.27 (1H, s),
8.15 (1H, s), 7.96–7.91 (2H, overlapped), 2.69 (3H, s); 13C NMR
(125 MHz, CDCl3) δ ppm: 164.0, 160.4, 147.0 (q, J = 38.1), 144.3,
143.7, 138.2 (q, J = 25.0), 131.4, 123.0, 122.7, 121.1, 119.2, 117.3,
4.1.3. Synthesis of CDM-3050 (7a), CDM-3049 (7b), CDM-3052 (7c),
and compound 7d
4.1.3.1. CDM-3050
(7a). Phosphorous
trichloride
(21.2 μL,
0.228 mmol) was added to
a
stirred solution of compound 6a
114.7, 114.2, 11.1; HR-ESI-MS calcd for C15H8F6N5O [M + H]+
:
6

N. Takahashi et al.
Bioorganic&MedicinalChemistryxxx(xxxx)xxx–xxx
J = 37.2), 144.0, 142.9, 140.3, 138.0 (q, J = 33.3), 123.5, 122.5,
121.0, 117.2, 115.4, 114.6, 79.8, 46.6, 42.6, 38.7, 32.2, 28.5; HR-ESI-
MS calcd for C23H24F6N5O3 [M + H]+: 532.1783, found:532.1754.
388.0633, found: 388.0634, calcd for C15H7F6N5NaO [M + Na]+
410.0452, found: 410.0443.
:
4.1.3.2. CDM-3049 (7b). Yield, 39%; a white solid; 1H NMR (500 MHz,
CDCl3) δ ppm: 9.26 (1H, s), 8.14 (1H, s), 7.95 (1H, d, J = 9.5), 7.92
(1H, d, J = 10.0), 2.97 (2H, t, J = 7.5), 1.95 (2H, m), 1.08 (3H, t,
J = 7.5); 13C NMR (125 MHz, CDCl3) δ ppm: 167.2, 160.2, 146.9 (q,
J = 36.9), 144.3, 143.7, 138.1 (q, J = 33.4), 131.6, 123.1, 122.7,
121.4, 121.0, 120.9, 119.2, 117.3, 114.7, 114.2, 27.3, 20.1, 13.7; HR-
ESI-MS calcd for C17H12F6N5O [M + H]+: 416.0946, found: 416.0947,
calcd for C17H11F6N5NaO [M + Na]+: 438.0765, found: 438.0737.
4.1.6. Synthesis of CDM-3032 (11)
Compound 10 (523.4 mg, 0.986 mmol) was dissolved in 4 N HCl/
1.4-dioxane (2.0 mL) and stirred at room temperature for 20 min. The
reaction mixture was evaporated and purified by HPLC (PEGASIL ODS
SP100, φ20 × 250 mm, eluent: CH3CN/H2O = 40:60, 0.1% TFA) to
afford CDM-3032 (11, 115.1 mg, 25%) as an orange solid; 1H NMR
(500 MHz, CD3OD) δ ppm: 9.04 (1H, s), 8.32 (1H, s), 8.01 (1H, d,
J = 8.0), 7.91 (1H, d, J = 10.0), 4.24 (1H, m), 3.51 (2H, m), 3.19 (2H,
m), 2.24 (2H, m), 1.96 (2H, m); 13C NMR (125 MHz, CD3OD) δ ppm:
163.6, 146.3 (q, J = 37.0), 145.4, 145.0, 140.5, 137.7 (q, J = 33.4),
124.8, 123.5, 122.9, 122.6, 121.0, 118.8, 116.3, 116.2, 45.8, 44.2,
29.5; HR-ESI-MS calcd for C18H16F6N5O [M + H]+: 432.1259, found:
432.1232.
4.1.3.3. CDM-3052 (7c). Yield, 19%; a white solid; 1H NMR (500 MHz,
CDCl3) δ ppm: 9.29 (1H, s), 8.15 (1H, s), 7.97 (1H, d, J = 9.5), 7.94
(1H, d, J = 10.0), 4.78 (2H, s), 3.53 (3H, s); 13C NMR (125 MHz, CDCl3)
δ ppm: 163.3, 161.1, 147.1 (q, J = 36.5), 144.5, 143.7, 138.2 (q,
J = 33.4), 131.1, 122.7, 121.2, 120.9, 119.2, 117.3, 114.8, 114.7, 63.8,
59.2; HR-ESI-MS calcd for C16H9F6N5NaO2 [M + Na]+: 440.0558,
found: 440.0523.
4.1.7. Synthesis of CDM-3075 (12a), CDM-3074 (12b) and CDM-3020
(12c)
4.1.3.4. Compound 7d. Yield, 7%; a white solid; 1H NMR (500 MHz,
CDCl3) δ ppm: 9.28 (1H, s), 8.16 (1H, s), 7.98 (1H, d, 10.0), 7.95 (1H, d,
J = 10.0), 4.84 (2H, s), 4.72 (2H, s); 13C NMR (125 MHz, CDCl3) δ ppm:
163.6, 161.1, 147.2 (q, J = 37.0), 144.6, 143.8, 138.4 (q, J = 33.4),
136.7, 131.2, 126.7, 128.3, 128.3, 123.2, 122.8, 121.4, 121.0, 117.4,
4.1.7.1. CDM-3075 (12a). NaOH aq. (1 N, 1.0 mL) was added to a
stirred solution of compound 3 (114.3 mg, 0.30 mmol) in THF (4.0 mL)
and the mixture was stirred at 50 °C. After stirring for 18 h, 1 N HCl aq.
was added to the reaction mixture until a pH 2–3 was achieved and the
whole mixture was extracted three times with AcOEt. The combined
organic layers were washed with brine, dried over Na2SO4, and
evaporated to give a crude product that was subjected to the next
reaction without purification.
115.0, 114.8, 73.3, 61.2; HR-ESI-MS calcd for
[M + Na]+: 516.0871, found: 516.0865.
C22H13F6N5NaO2
4.1.4. Synthesis of CDM-3056 (8d)
Pd/C (10%, 1.3 mg) was added to a stirred solution of compound 7d
(6.3 mg, 0.013 mmol) in MeOH (0.8 mL) and the mixture was stirred at
45 °C under H2 atmosphere for 20 h. The mixture was filtered through
Celite and the filtrate was concentrated under reduced pressure. The
residue was purified by silica gel flash column chromatography
(AcOEt/CHCl3 = 50:50) to afford 0.8 mg (15%) of CDM-3056 (8d) as a
white solid; 1H NMR (500 MHz, CDCl3) δ ppm: 9.31 (1H, s), 8.16 (1H,
s), 8.00–7.90 (2H, overlapped), 5.02 (2H, s); 13C NMR (125 MHz,
DMSO‑d6) δ ppm: 166.3, 160.4, 145.1 (q, J = 37.0), 144.6, 143.8,
136.8 (q, J = 33.4), 130.4, 123.1, 121.9, 121.6, 121.3, 117.7, 115.7,
114.4, 53.9; HR-ESI-MS calcd for C15H8F6N5O2 [M + H]+: 404.0582,
found: 404.0614.
HATU (229.0 mg, 0.60 mmol), HOAt (80.7 mg, 0.60 mmol), and
DIEA (0.10 mL, 0.60 mmol) were added to a stirred solution of the
above crude product in dry DMF (2.0 mL) at room temperature under
N2 atmosphere. After stirring for 30 min at the same temperature, 2-
aminopyridine (56.2 mg, 0.60 mmol) was added and the mixture was
stirred at room temperature for 14 h. The reaction was quenched by
adding H2O and the whole mixture was extracted twice with ethyl
acetate. The combined organic layers were washed with brine, dried
over Na2SO4, and evaporated. The residue was purified by silica gel
flash column chromatography (AcOEt /CHCl3 = 5:95) to afford
10.2 mg (8%, 2 steps) of CDM-3075 (12a) as a white solid; 1H NMR
(500 MHz, DMSO‑d6) δ ppm: 10.1 (1H, s), 9.22 (1H, s), 8.48 (1H, s),
8.40 (2H, d, J = 9.0), 8.25 (1H, d, J = 8.0), 8.10 (1H, d, J = 10.5), 7.98
(1H, J = 8.0) 7.88 (1H, dd, J = 7.8, 7.8), 7.20 (1H, dd, J = 6.5, 4.5);
13C NMR (150 MHz, DMF-d7) δ ppm: 161.5, 152.9, 150.1, 147.1 (q,
J = 36.0), 145.7, 145.1, 141.1, 140.0, 138.6 (q, J = 33.7), 125.1,
124.6, 123.4, 123.2, 121.6, 119.5, 117.2, 116.8, 114.9; HR-ESI-MS
calcd for C18H10F6N5O [M + H]+: 426.0790, found: 426.0771.
4.1.5. Synthesis of tert-butyl 4-(2,4-bis(trifluoromethyl)imidazo[1,2-a]
[1,8]naphthyridine-8-carboxamido)piperidine-1-carboxylate (10)
NaOH aq. (1 N, 0.5 mL) was added to a stirred solution of compound
3 (63.7 mg, 0.169 mmol) in THF (2.0 mL) and the mixture was stirred at
50 °C. After stirring for 18 h, 1 N HCl aq. was added to the reaction
mixture until a pH 2–3 was achieved and the whole mixture was ex-
tracted three times with AcOEt. The combined organic layers were
washed with brine, dried over Na2SO4, and evaporated to give a crude
product that was subjected to the next reaction without purification.
HATU (128.5 mg, 0.338 mmol), HOAt (45.6 mg, 0.338 mmol), and
DIEA (58.8 μL, 0.338 mmol) were added to a stirred solution of the
above crude product in dry DMF (1.0 mL) at room temperature under
N2 atmosphere. After stirring for 30 min at the same temperature, tert-
butyl 4-aminopiperidine-1-carboxylate (67.6 mg, 0.338 mmol) was
added and the mixture was stirred at room temperature for 14 h. The
reaction was quenched by adding H2O and the whole mixture was ex-
tracted twice with ethyl acetate. The combined organic layers were
washed with brine, dried over Na2SO4, and evaporated. The residue
was purified by silica gel flash column chromatography (AcOEt/
CHCl3 = 5:95) to afford 45.9 mg (51%, 2 steps) of compound 10 as a
right brown solid; 1H NMR (500 MHz, CDCl3) δppm: 9.13 (1H, s), 8.11
(1H, s), 8.01 (2H, br-s), 7.88 (1H, d, J = 12.5), 7.79 (1H, d, J = 12.5),
4.28–4.10 (3H, overlapped), 2.80 (2H, m), 2.04 (2H, m), 1.50 (2H, m),
1.47 (9H, s); 13C NMR (125 MHz, CDCl3) δ ppm: 161.0, 154.8, 146.9 (q,
4.1.7.2. CDM-3074 (12b). Yield, 83% (2 steps); a white solid; 1H NMR
(500 MHz, DMSO‑d6) δ ppm: 10.8 (1H, s), 9.10 (1H, s), 9.05 (1H, d,
J = 2.5), 8.51 (1H, s), 8.32–8.30 (2H, overlapped), 8.07 (1H, d,
J = 9.5), 7.96 (1H, dd, J = 10.0, 2.0), 7.40 (1H, dd, J = 8.5, 4.5);
13C NMR (150 MHz, DMF-d7) δ ppm: 162.2, 147.0 (q, J = 36.6), 146.4,
145.7, 145.1, 143.8, 141.8, 138.7 (q, J = 33.3), 137.4, 128.6, 125.0,
124.7, 123.3, 122.8, 121.6, 119.4, 117.1, 116.9; HR-ESI-MS calcd for
C
18H10F6N5O [M + H]+: 426.0790, found: 426.0774.
4.1.7.3. CDM-3020 (12c). Yield, 45% (2 steps); a white solid; 1H NMR
(500 MHz, DMSO‑d6) δ ppm: 10.90 (1H, s), 9.15 (1H, s), 8.52 (1H, s),
8.49 (2H, dd, J = 5.0, 2.0), 8.08 (1H, d, J = 10.0), 7.96 (1H, dd,
J = 10.5, 2.0), 7.92 (2H, J = 5.0, 1.0); 13C NMR (150 MHz, DMF-d7) δ
ppm: 162.3, 152.0, 147.3, 146.9 (q, J = 36.0), 145.7, 145.1, 141.5,
138.6 (q, J = 32.7), 125.1, 124.7, 123.3, 123.0, 121.6, 119.4, 117.2,
115.7; HR-ESI-MS calcd for C18H10F6N5O [M + H]+: 426.0790, found:
426.0780.
7

N. Takahashi et al.
Bioorganic&MedicinalChemistryxxx(xxxx)xxx–xxx
4.1.8. Synthesis of ethyl 2-(2-((tert-butoxycarbonyl)amino)ethoxy)-4-
(trifluoromethyl)imidazo[1,2-a][1,8]naphthyridine-8-carboxylate (14)
DEAD in toluene (0.15 mL, 2.2 M, 0.338 mmol) was added to a
stirred solution of ethyl 2-hydroxy-4-(trifluoromethyl)imidazo [1,2-a]
[1,8]naphthyridine-8-carboxylate (13, 55.0 mg, 0.169 mmol), tert-butyl
(2-hydroxyethyl)-carbamate (32.6 mg, 0.203 mmol) and PPh3 (88.5 mg,
0.338 mmol) in DMF (1.0 mL) at 0 °C under N2 atmosphere. After stir-
ring at room temperature for 7 h, the reaction was quenched with H2O
and the whole mixture was extracted three times with CHCl3. The
combined organic layers were washed with brine, dried over Na2SO4,
and evaporated. The residue was purified by silica gel flash column
chromatography (AcOEt /n-hexane = 40:60) to afford 23.2 mg (29%)
of compound 14 as a white solid; 1H NMR (500 MHz, CDCl3) δ ppm:
8.91 (1H, s), 7.75 (1H, d, J = 8.0), 7.62 (1H, d, J = 10.0), 7.28 (1H, s),
4.96 (1H, br-s), 4.62 (2H, m), 4.48 (2H, q, J = 7.5), 3.65 (2H, m), 1.48
(3H, t, J = 7.0), 1.44 (9H, s); 13C NMR (125 MHz, CDCl3) δ ppm: 163.8,
162.2, 155.9, 144.6, 142.9, 138.0 (q, J = 37.0), 123.5, 122.1, 117.3,
116.6, 108.8, 108.6, 79.9, 67.2, 61.4, 39.6, 28.4, 14.6; HR-ESI-MS calcd
for C21H24F3N4O5 [M + H]+: 469.1699, found: 469.1660.
HATU (37.2 mg, 0.098 mmol), HOAt (13.3 mg, 0.098 mmol), and
DIEA (25.6 μL, 0.147 mmol) were added to a stirred solution of the
above crude product in dry DMF (0.8 mL) at room temperature under
N2 atmosphere. After stirring for 30 min at the same temperature, 4-
aminopyridine (9.2 mg, 0.098 mmol) was added and the mixture was
stirred at room temperature for 16 h. The reaction was quenched by
adding H2O and the whole mixture was extracted twice with ethyl
acetate. The combined organic layers were washed with brine, dried
over Na2SO4, and evaporated. The residue was purified by silica gel
flash column chromatography (n-hexane/AcOEt = 20:80) to afford
8.3 mg (33%, 2 steps) of Compound 18 as a yellow solid; 1H NMR
(500 MHz, CDCl3) δppm: 9.60 (1H, s), 9.03 (1H, s), 8.62 (2H, d,
J = 6.5), 7.89 (2H, d, J = 6.5), 7.82 (1H, d, J = 1.5), 7.57 (1H, d,
J = 10.0), 7.31 (1H, s), 4.64 (2H, m), 3.67 (2H, m), 1.46 (9H, s); 13C
NMR (125 MHz, CDCl3) δ ppm: 162.5, 160.9, 155.9, 149.7, 148.3,
143.8, 142.9, 138.5 (q, J = 35.7), 122.8, 116.4, 115.2, 115.0, 114.0,
113.8, 109.2, 108.5, 80.0, 67.2, 39.5, 28.5; HR-ESI-MS calcd for
C
24H24F3N6O4 [M + H]+: 517.1811, found: 517.1764.
4.1.12. Synthesis of CDM-3026 (19)
4.1.9. Synthesis
of
tert-butyl
(2-((8-(1,3,4-oxadiazol-2-yl)-4-
Compound 18 (255.6 mg, 0.495 mmol) was dissolved in 4 N HCl/
1,4-dioxane (5.0 mL) and stirred at room temperature for 20 min. The
reaction mixture was evaporated and purified by HPLC (PEGASIL ODS
SP100, φ20 × 250 mm, eluent: CH3CN/H2O = 25:75, 0.1% TFA) to
afford CDM-3026 (19, 80.4 mg, 39%) as an yellow solid; 1H NMR
(500 MHz, CD3OD) δ ppm: 9.24 (1H, s), 8.68 (2H, br-s), 8.49 (2H, br-s),
7.96 (1H, d, J = 9.5), 7.77 (1H, d, J = 10.0), 7.57 (1H, s), 4.90 (2H,
overlapped), 3.53 (2H, dd, J = 4.5, 4.5); 13C NMR (125 MHz, CD3OD) δ
ppm: 163.6, 144.2, 143.6, 140.2 (q, J = 31.0), 139.2, 125.0, 124.0,
122.8, 118.0, 117.4, 116.4, 110.5, 110.1, 65.3, 39.8; HR-ESI-MS calcd
for C19H16F3N6O2 [M + H]+: 417.1287, found: 417.1331.
(trifluoromethyl)imidazo[1,2-a][1,8]naphthyridin−2-yl)oxy)ethyl)
carbamate (16)
NaOH aq. (1 N, 1.0 mL) was added to a stirred solution of compound
14 (252. mg, 0.54 mmol) in THF (4.0 mL) and the mixture was stirred at
50 °C. After stirring for 18 h, 1 N HCl aq. was added to the reaction
mixture until a pH 2–3 was achieved and the whole mixture was ex-
tracted three times with AcOEt. The combined organic layers were
washed with brine, dried over Na2SO4, and evaporated to give a crude
product that was subjected to the next reaction without purification.
(Isocyanoamino)-triphenylphosphorane (814.0 mg, 2.14 mmol) was
added to a stirred solution of the above crude product in dry CH2Cl2
(6.0 mL) and the mixture was stirred at room temperature for 12 h. The
solvent was evaporated and the residue was purified by silica gel flash
column chromatography (AcOEt /CHCl3 = 10:90) to afford 85.2 mg
(34%, 2 steps) of Compound 16 as a yellow solid; 1H NMR (500 MHz,
CDCl3) δ ppm: 9.05 (1H, s), 8.55 (1H, s), 7.80 (1H, d, J = 9.5), 7.65
(1H, d, J = 9.5), 7.30 (1H, s), 4.63 (2H, m), 3.66 (2H, m); 13C NMR
(125 MHz, CDCl3) δ ppm: 162.4, 161.0, 155.9, 152.7, 145.3, 142.7,
139.5 (q, J = 33.3), 130.3, 123.4, 122.4, 116.7, 113.5, 109.2, 108.5,
4.2. Solubility in aqueous solution
A combined solution of 10% DMSO in H2O was added to an excess
amount of the compounds. The suspension was then shaken for 5 min at
27 °C, and undissolved material was filtrated. For CDM-3032 (11) and
CDM-3026 (19), all the material was dissolved (11; 3.09 mg in 100 μL,
19; 1.54 mg in 50 μL). The resulting solution was injected into the
HPLC, and the peak area was measured by UV detection at 254 nm. The
concentration of the sample solution was calculated using a previously
determined calibration curve.
80.0, 67.2, 39.5, 28.4; HR-ESI-MS calcd for C20H20F3N6O4 [M + H]+
465.1498, found: 465.1468.
:
4.1.10. Synthesis of CDM-3030 (17)
4.3. Biology
Compound 16 (44.1 mg, 0.095 mmol) was dissolved in 4 N HCl/1,4-
dioxane (2.0 mL) and stirred at room temperature for 5 min. The re-
action mixture was evaporated and purified by HPLC (PEGASIL ODS
SP100, φ20 × 250 mm, eluent: CH3CN/H2O = 25:75, 0.1% TFA) to
afford CDM-3030 (17, 4.1 mg, 10%) as an yellow solid; 1H NMR
(500 MHz, CD3OD) δ ppm: 9.18 (1H, s), 9.12 (1H, s), 7.95 (1H, d,
J = 9.5), 7.68 (1H, d, J = 10.0), 7.52 (1H, s), 4.72 (2H, m), 3.23 (2H,
m); 13C NMR (150 MHz, DMSO‑d6) δ ppm: 161.4, 159.9, 154.1, 144.5,
142.1, 137.2 (q, J = 31.6), 129.7, 123.2, 121.7, 116.7, 113.8, 109.1,
4.3.1. Culture of HCV (R6FLR-N) replicon cells and JHH-7 cells
R6FLR-N replicon cells8 were kindly gifted from Dr. Michinori Ko-
hara. The cells were maintained in DMEM (Thermo Fisher: 1569010)
containing 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml
streptomycin, and 500 μg/ml G418 under 37˚C and 5% CO2. JHH-7 cells
were maintained in DMEM (Thermo Fisher: 11965–092) containing
10% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml strepto-
mycin under 37 °C and 5% CO2.
107.7, 63.9, 38.1; HR-ESI-MS calcd for C15H12F3N2O2 [M + H]+
365.0974, found: 365.0958.
:
4.3.2. Culture of primary human hepatocytes (PXB-cells) isolated from
chimeric mice with humanized liver
4.1.11. Synthesis
of
tert-butyl
(2-((8-(pyridin-4-ylcarbamoyl)-4-
PXB cells were purchased from PhoenixBio and cultured on collagen
type I-coated 96 well plate in hepatocyte clonal growth medium
(dHCGM) as previously described9 under 37 °C and 5% CO2.
(trifluoromethyl)imidazo[1,2-a][1,8]naphthyridin-2-yl)oxy)ethyl)
carbamate (18)
NaOH aq. (1 N, 0.2 mL) was added to a stirred solution of compound
14 (23.2 mg, 0.049 mmol) in THF (0.8 mL) and the mixture was stirred
at 50 °C. After stirring for 18 h, 1 N HCl aq. was added to the reaction
mixture until a pH 2–3 was achieved and the whole mixture was ex-
tracted three times with AcOEt. The combined organic layers were
washed with brine, dried over Na2SO4, and evaporated to give a crude
product that was subjected to the next reaction without purification.
4.3.3. Assay of anti-HCV activity using R6FLR-N replicon cells
R6FLR-N replicon cells (3 × 104 cells/well)8 were plated on a 96-
well white plate (Greiner Bio-One). After 1 day of culture, compounds
were added to the cells. After 3 days of incubation, cell viability was
measured by the Cell Proliferation kit II (XTT assay) (Roche) according
to the manufacturer’s instructions. Luciferase activity was assayed using
8

N. Takahashi et al.
Bioorganic&MedicinalChemistryxxx(xxxx)xxx–xxx
the Steady-Glo Luciferase Assay System (Promega) according to the
manufacturer’s instructions and detected by a multimode plate reader
EnSight (Perkin Elmer).
(165 μL), mouse or human hepatic microsomes (20 mg/mL, 25 μL,
Corning), and CDM-3032 (11, 29 μmol/L, 10 μL) were combined in this
order. After 5 min of incubation at 37 °C, a NADPH regenerating system
(50 μL, Corning) was added and further incubation at 37 °C was con-
ducted for 0, 30, 60, or 120 min. Then, 50 μL of the above solution was
poured into ice cold MeOH (200 μL) and the reaction was stopped. After
the addition of 250 μL of an internal standard, the mixture was cen-
trifuged (15 min at 10,000 rpm in 4 °C) and the resultant supernatant
was injected into the HPLC. The peak area of the remaining compound
was measured and the concentration was calculated using a previously
determined calibration curve.
4.3.4. Assay of anti-HBV activity using PXB cells
For the initial confirmation of CDM-3008 activity, PXB cells were
infected with 3 genome equivalents per cell of HBV C_AT9,10, and then
medium was exchanged every 3 or 4 days. After 28 days of infection,
the cells were treated with indicated concentrations of CDM-3008 (1) or
pegylated IFNa2a (Pegasys, Chugai Pharmaceutical) for 7 days.
To compare CDM-3008 (1), 3026 (19), 3030 (17), and 3032 (11)
activity, PXB cells were infected with 3 genome equivalents per cell of
HBV C_AT and simultaneously treated with 0.01–10 μM compounds.
After 1 day of incubation, the cells were maintained in dHCGM con-
taining the compounds, and the medium was exchanged every 3 or
4 days for 14 days.
Acknowledgements
This work was supported in part by research grants from the Japan
Society for the Promotion of Science (JSPS), the Ministry of Education,
Culture, Sports, Science and Technology of Japan (MEXT), and
Research on the Innovative Development and the Practical Application
After infection and treatments, cell viability was measured using the
RealTime-Glo MT Cell Viability Assay (Promega). Cellular DNA was
purified using
a
QIAamp DNA mini kit (Qiagen) or Agencourt
of New Drugs for Hepatitis B Grant (JP17fk0310112 (S.K.),
DNAdvance System (Beckman Coulter). The amount of purified DNA
was measured using a QuantiFluor ONE dsDNA System (Promega). HBV
DNA was measured by qPCR.
JP18fk0310112
(S.K.),
JP17fk03101120401
(H.K.),
and
JP18fk03101120002 (H.K.)) from the Japan Agency for Medical
Research and Development (AMED).
4.3.5. qPCR analysis of HBV DNA
Appendix A. Supplementary data
HBV DNA copy number was determined by quantitative PCR using
TaqMan Gene Expression Master Mix (Thermo Fisher), specific primers,
and probes. The specific primers and probe used in this study were HBV
DNA (forward primer: 5′-ACTCACCAACCTCCTGTCCT-3′, reverse
primer: 5′-GACAAACGGGCAACATACCT-3′, and probe: 5′-[FAM] TAT
CGCTGGATGTGTCTGCGGCGT[TAM]-3′).
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.bmc.2018.11.039.
References
1. Seeger C, Mason WS. Microbiol Mol Biol Rev. 2000;64:51.
2. Chen GF, Wang C, Lau G. Liver Int. 2017;37:59.
4.3.6. Measurement of OAS-1 expression in JHH-7 cells
3. Seckin D, Durusoy C, Sahin S. Pediatr Dermatol. 2004;21:577.
4. van Nunen AB, Hansen BE, Suh DJ, et al. Gut. 2003;52:420.
5. Konishi H, Okamoto K, Ohmori Y, et al. Sci Rep. 2012;2:259.
6. a) Banka AL, Botyanszki J, Burroughs EG, et al. WO2013059559A2. 2013;
Human hepatocellular carcinoma JHH-7 cells were plated on a 24-
well plate. JHH-7 cells were treated with 3 and 30 μM CDM-3008 (1),
CDM-3026 (19), CDM-3030 (17), and CDM-3032 (11) for 3 days. Total
RNAs were purified from the cells using Agencout RNAdvance Cell v2
(Beckman Coulter) and their concentration were measured using a
NanoDrop UV spectrophotometer (Thermo Fisher Scientific). cDNAs
were reversetranscribed from total RNA using PrimeScript RT Master
Mix (Takara) according to the manufacturer’s instruction. OAS-1 ex-
pression levels were measured by qPCR using SYBR Premix ExTaq II
(Takara) and primers (forward: 5′-TCCGTGAAGTTTGAGGTCCA-3′ and
reverse: 5′-ATCAAAGGCAGGCAGCACAT-3′).
b) Huang SD, Qing J, Wang S, Wang H, Zhang LQ, Tang YF. Org Biomol Chem.
2014;12:2344;
c) Wang H, Wang S, Cheng L, et al. ACS Med Chem Lett. 2015;6:977.
7. Souldozi A, Ramazani A. Tetrahedron Lett. 2007;48:1549.
8. Watanabe T, Sudoh M, Miyagishi M, et al. Gene Ther. 2006;13:883.
9. Ishida Y, Yamasaki C, Yanagi A, et al. Am J Pathol. 2015;185:1275.
10. Sugiyama M, Tanaka Y, Kato T, et al. Hepatology. 2006;44:915–924.
11. Tnani M, Bayard BA. Biochim Biophys Acta. 1999;1451:59–72.
4.4. Metabolic stability in mouse or human hepatic microsome
Potassium phosphate buffer (0.2 mol/L, 250 μL), ultra-pure water
9