Targeted degradation of the enhancer lysine acetyltransferases CBP and p300

Article

Targeted degradation of the enhancer lysine

acetyltransferases CBP and p300

Graphical Abstract

Authors

Raghu Vannam, Jan Sayilgan,

Samuel Ojeda, ..., Wilhelm Haas,

Michael Lawrence, Christopher J. Ott

Correspondence

christopher.ott@mgh.harvard.edu

In Brief

Vannam et al. report the design and

characterization of dCBP-1, a potent and

selective heterobifunctional degrader of

the acetyltransferases p300 and CBP.

Using in silico modeling to enable efﬁcient

molecular design, the authors

demonstrate the enhanced effects of

dCBP-1 on p300/CBP activity compared

with catalytic and bromodomain

inhibitors.

Highlights

d

In silico-guided design of dCBP-1, a heterobifunctional

degrader of p300 and CBP

dCBP-1 hijacks the E3 ubiquitin ligase CRBN for selective

degradation of p300/CBP

Degradation of p300/CBP by dCBP-1 leads to effective

multiple myeloma cell killing

dCBP-1 ablates oncogenic enhancer activity driving MYC

expression

Vannam et al., 2021, Cell Chemical Biology 28, 503–514

April 15, 2021 ª 2020 Elsevier Ltd.

https://doi.org/10.1016/j.chembiol.2020.12.004

ll

Article

Targeted degradation of the enhancer

lysine acetyltransferases CBP and p300

Raghu Vannam,^1,2Jan Sayilgan,¹Samuel Ojeda,¹Barbara Karakyriakou,¹Eileen Hu,¹Johannes Kreuzer,^1,2

Robert Morris,^1,2Xcanda Ixchel Herrera Lopez,¹Sumit Rai,^1,2Wilhelm Haas,^1,2Michael Lawrence,^1,2,3

and Christopher J. Ott^1,2,3,4,

*

¹Massachusetts General Hospital Cancer Center, Charlestown, MA 02129, USA

²Department of Medicine, Harvard Medical School, Boston, MA 02115, USA

³Broad Institute of MIT & Harvard, Cambridge, MA 02142, USA

⁴Lead contact

*Correspondence: christopher.ott@mgh.harvard.edu

https://doi.org/10.1016/j.chembiol.2020.12.004

SUMMARY

The enhancer factors CREB-binding protein (CBP) and p300 (also known as KAT3A and KAT3B) maintain

gene expression programs through lysine acetylation of chromatin and transcriptional regulators and by

scaffolding functions mediated by several protein-protein interaction domains. Small molecule inhibitors

that target some of these domains have been developed; however, they cannot completely ablate p300/

CBP function in cells. Here we describe a chemical degrader of p300/CBP, dCBP-1. Leveraging structures

of ligand-bound p300/CBP domains, we use in silico modeling of ternary complex formation with the E3 ubiq-

uitin ligase cereblon to enable degrader design. dCBP-1 is exceptionally potent at killing multiple myeloma

cells and can abolish the enhancer that drives MYC oncogene expression. As an efﬁcient degrader of this

unique class of acetyltransferases, dCBP-1 is a useful tool alongside domain inhibitors for dissecting the

mechanism by which these factors coordinate enhancer activity in normal and diseased cells.

INTRODUCTION

function mutations have been observed in both hematologic

and solid tumors (Attar and Kurdistani, 2016; Kitabayashi et al.,

The paralogous chromatin regulators CREB-binding protein 2001; Panagopoulos et al., 2001). p300/CBP may also function

(CBP) and p300 are factors critical for establishing and activating as critical secondary regulators of oncoproteins and thus repre-

enhancer-mediated transcription (Merika et al., 1998). These sent a unique category of nononcogene dependencies (Luo

large proteins (~300 kDa) are made up of at least 10 distinct func- et al., 2009). As an example, p300 has been shown to be essen-

tional domains and are known to interact with over 400 other tial for the leukemogenicity of the fusion oncoprotein AML1-ETO

proteins, including DNA-binding transcription factors, other through acetylation of a single lysine on AML1 (Wang et al.,

chromatin regulators, and components of the general transcrip- 2011). Additionally, inhibition of p300/CBP activity can have syn-

tion apparatus (Bedford et al., 2010; Dancy and Cole, 2015). In thetic lethal effects on tumors that harbor inactivating mutations

addition to mediating protein-protein interactions on chromatin, in either factor (Ogiwara et al., 2016).

p300/CBP exert enzymatic activity through a lysine acetyltrans-

Over the last 2 decades, many efforts have focused on pro-

ferase (KAT) domain. Originally described as having histone ace- ducing pharmacologic ligands of p300/CBP. Early studies

tyltransferase capability, they are now understood to dynami- demonstrated the KAT-inhibitory effects of bisubstrate ana-

cally acetylate ~21,000 lysines on over 5,000 proteins, logues that link acetyllysine to the p300/CBP cofactor coenzyme

including more than three dozen known enhancer-associated A (Cebrat et al., 2003; Karukurichi and Cole, 2011; Lau et al.,

regulators (Bannister and Kouzarides, 1996; Ogryzko et al., 2000; Sagar et al., 2004). The chemical probe C646 was discov-

1996; Weinert et al., 2018). Given the vast repertoire of biochem- ered by virtual screening methods and has been used by many

ical activities associated with p300/CBP and their near-ubiqui- groups to study p300/CBP KAT activity in cellular model sys-

tous expression patterns in tissues, they represent central nodes tems, yet its utility is limited by apparent off-target and pan-

for diverse cellular signaling pathways that include growth and assay inhibitory effects (Bowers et al., 2010; Dahlin et al.,

proliferation, differentiation, development, and homeostasis. In 2017; Shrimp et al., 2015). Recently KAT domain inhibitors

cancer, p300/CBP have been implicated as both oncogenes have been developed with improved potency, selectivity, and

and tumor suppressors. Recurrent translocations between either drug-like properties that have enabled in vivo proof-of-concept

the CBP-coding gene CREBBP or the p300-coding gene EP300 studies validating inhibition of p300/CBP catalytic activity as a

are found in subtypes of acute myeloid leukemias, and loss-of- promising cancer therapeutic strategy (Lasko et al., 2017;

Cell Chemical Biology 28, 503–514, April 15, 2021 ª 2020 Elsevier Ltd. 503

ll

Article

Michaelides et al., 2017; Wilson et al., 2020; Yang et al., 2020). We reasoned that initiation of chemistry efforts to ensure the

Beyond direct inhibitors of the KAT domain, ligand development generation of a potent and selective compound should start

has been successful for other p300/CBP domains that mediate with a best-in-class ligand optimized for ligand efﬁciency and

protein-protein interactions. Several potent and selective com- selectivity over other structurally homologous factors such as

pounds have been described that target the bromodomain, a BRD4. The recently described p300/CBP bromodomain inhibi-

protein module that binds acetyllysine on histones and other pro- tor GNE-781 has a half maximal inhibitory concentration (IC₅₀

teins (Crawford et al., 2016; Hammitzsch et al., 2015; Picaud of 1.2 nM and 0.9 nM against p300 and CBP, respectively, as

et al., 2015; Romero et al., 2017; Taylor et al., 2016). measured by biochemical peptide displacement assays (TR-

)

The development of these inhibitors has provided a unique FRET, time-resolved ﬂuorescence resonance energy transfer)

toolset for chromatin and chemical biologists to probe various and is greater than 4,000-fold selective for the p300/CBP bro-

p300/CBP functions at enhancers. While a comprehensive eval- modomains over BRD4 (Figure 1A) (Romero et al., 2017). This

uation of the comparative biochemical and phenotypic effects of activity is superior to other structurally distinct bromodomain

p300/CBP KAT domain and bromodomain inhibition has yet to be inhibitors such as CBP30, I-CBP112, CPI-637, and the early-

described, evidence suggests that these different inhibitor clas- generation compound GNE-272 (Crawford et al., 2016; Ham-

ses have distinct effects on lysine acetylation patterns and chro- mitzsch et al., 2015; Picaud et al., 2015; Taylor et al., 2016). At

matin dynamics. While catalytic inhibitors largely phenocopy the the time we initiated these efforts, A-485 was the most well-vali-

reduced acetylation observed in dual genetic knockout models of dated p300/CBP KAT domain ligand, with a reported biochem-

p300/CBP, bromodomain inhibitors only modestly reduce lysine ical IC₅₀of 9.8 nM and 2.6 nM for p300 and CBP, respectively,

acetylation of known p300/CBP targets (Weinert et al., 2018). as measured by acetylation of an immobilized histone peptide

Focused studies of histone acetylation effects with a p300/CBP (TR-FRET) (Lasko et al., 2017). To determine which ligand,

bromodomain inhibitor have also shown the potential for selec- GNE-781 or A-485, may yield a more efﬁcient degrader through

tive depletion of acetylated histone H3 lysine 27 (H3K27ac) over linkage to a thalidomide-based CRBN ligand, we performed in

other histone acetyllysines, although the biochemical mecha- silico docking of the ligand-bound KAT domain or bromodomain

nism for this selectivity is unclear (Raisner et al., 2018).

with CRBN. Previous studies have demonstrated that modeling

Inanother recentstudy, treatment of prostate cancer cells witha CRBN interactions with other protein domains using the Rosetta

p300/CBP catalytic inhibitor in combination with a bromodomain software package can reveal minimal-energy binding land-

inhibitor led to synergistic antiproliferative activity (Zucconi et al., scapes of ternary complexes that enable the design of heterobi-

2019). Chromatin immunoprecipitation analysis of p300 sug- functional degraders (Li et al., 2019; Nowak et al., 2018). We

gested that this treatment combination leads to reduced occu- performed docking with 20,000 models of the co-crystal struc-

pancy of these factors on chromatin compared with treatment ture of GNE-781 bound to the bromodomain of CBP (PDB:

with each compound alone. Thus, simultaneous inhibition of the 5W0E) and the co-crystal structure of A-485 bound to the KAT

multiple functional domains, or even complete protein depletion, domain of p300 (PDB: 5KJ2) with the co-crystal structure of le-

is required to ablate the enhancer activity mediated by p300/ nalidomide bound to CRBN (PDB: 4TZ4) (Figure 1B) (Chamber-

CBP. To pursue this goal further and to provide the research com- lain et al., 2014; Lasko et al., 2017; Romero et al., 2017). GNE-

munity with additional tools to probe the function of this important 781 offers several solvent-exposed sites for potential linker

class of chromatin regulators, we describe here our efforts to attachment, including a tetrahydropyran ring system that ex-

design and characterize a heterobifunctional chemical degrader tends over the bromodomain BC loop, a central tetrahydroqui-

of p300/CBP. Bifunctional, or chimeric, degraders that leverage noline system, and an N-methyl pyrazole that extends over

the activity of E3 ligases such as cereblon (CRBN) through chem- the bromodomain LPF shelf region (Romero et al., 2017). For

ical-induced proximity to proteins of interest have transformed the A-485, two regions of the molecule seemed feasible for linker

capabilities for chemical degradation (Burslem and Crews, 2020; attachment: a solvent-exposed methylurea or a triﬂuoromethyl

Lu et al., 2015; Winter et al., 2015). Aided by in silico modeling of moiety potentially reachable through a narrow channel in the

aternarycomplexofligand-boundCRBNwiththeKATandbromo- KAT substrate pocket (Lasko et al., 2017). We measured dis-

domains of p300/CBP, we were able to efﬁciently synthesize a tances between selected atoms of these potential linker attach-

highly potent and selective degrader, dCBP-1. Using dCBP-1 as ment sites with the phthalimide ring (carbon 5) of CRBN-bound

a tool, we proﬁle the consequences of complete p300/CBP loss lenalidomide across all 20,000 poses predicted by Rosetta (Fig-

in cellular models of multiple myeloma, a tumor type uniquely ad- ures 1C and S1). This revealed that the greatest number of min-

dicted to the activity of both p300 and CBP. Epigenomic proﬁles of imal-distance poses were obtained between CRBN and the

gene expression and chromatin structures with dCBP-1 treatment CBP bromodomain via the tetrahydropyran ring system of

reveal augmented effects of oncogene expression compared with GNE-781. Indeed, this ring system was the only site evaluated

˚

inhibitors alone or in combination, with complete ablation of onco- that had >50% of docking poses within 20 A of lenalidomide

˚

genic enhancer activity.

(Figure 1D). As 20 A roughly corresponds to the length of a poly-

ethylene glycol-4 (PEG-4) linker, a linkage distance that has

previously been described to induce efﬁcient ternary complex

formation with CRBN in cells, we chose to synthesize dCBP-1

by replacing the tetrahydropyran ring with a conjugatable piper-

RESULTS

Design and activity of a p300/CBP degrader

The recent advances in small molecule ligand discovery for both idine and linking PEG-4 to thalidomide via an amine substituted

the KAT and bromodomains of p300/CBP permit many possibil- off carbon 5 of the phthalimide ring (Zorba et al., 2018)

ities for potential heterobifunctional degrader molecule design. (Figure 1E).

504 Cell Chemical Biology 28, 503–514, April 15, 2021

ll

Article

A

B

C

D

E

Figure 1. Design of dCBP-1, a heterobifunctional degrader of p300/CBP

(A) Domain structure of the homologous lysine acetyltransferase (KAT) chromatin factors CBP and p300, highlighting the ligandable bromodomain and catalytic

KAT domain. Selected validated small molecule ligands along with reported biochemical activities are shown below. NRID, nuclear receptor interaction domain;

TAZ, transcriptional adaptor zinc ﬁnger; IHD, interferon binding homology domain; KIX, kinase-inducible interacting domain; PHD, plant homeodomain ﬁnger; ZZ,

ZZ zinc ﬁnger; SID, Sin3 interacting domain; NCBD, nuclear coactivator binding domain; PxP, proline motif.

(B) Co-crystal structures of the bromodomain ligand GNE-781 bound to the CBP bromodomain (PDB: 5W0E) (top) and the KAT domain ligand A-485 bound to the

p300 KAT domain (PDB: 5KJ2). Small molecules are depicted in gray, with potential linker attachment sites highlighted in red. Atom numbers refer to PDB ﬁle

annotations.

(C) Distance (in angstroms) between selected linker attachment site atoms and the phthalimide ring (carbon 5) of lenalidomide bound to CRBN. Violin plots

represent values derived from 20,000 independent docking poses. See also Figure S1.

˚

(D) Quantiﬁcation of poses with distances less than 20 A derived from (C).

(E) Molecular structure of dCBP-1.

We assessed p300/CBP degradation by immunoassays using substitution off the thalidomide glutarimide ring that blocks

capillary-based electrophoresis with validated selective anti- CRBN engagement (Figures 2C, S2A, and S2B).

bodies for CBP or p300 (Figures 2A and 2B). Treatment of the hu-

We also assessed dCBP-1 effects on the global proteome of

man haploid cell line HAP1 for 6 h with dCBP-1 revealed almost HAP1 cells, which revealed that both p300 and CBP were among

complete loss of both CBP and p300 between 10 and 1,000 nM the most downregulated proteins after 3 h of dCBP-1 treatment

doses. A time course analysis with 250 nM dCBP-1 revealed (Figure 2D, Table S1). No appreciable loss of GSPT1 was

almost complete degradation of p300/CBP within an hour of observed, a degradation target of other carbon 5-substituted

treatment. p300/CBP degradation was rescued by co-incuba- thalidomide analogues and heterobifunctional degraders (Ishoey

tion with the proteasome inhibitor carﬁlzomib, the NAE1 inhibitor et al., 2018; Matyskiela et al., 2016). The bromodomain-and-ex-

MLN4924, and by excess free GNE-781 or pomalidomide, traterminal domain (BET) family protein levels (BRD2, BRD3,

demonstrating that dCBP-1 mechanistically functions through BRD4) are also not affected by dCBP-1 treatment (Figure S2C).

engaging both CRBN and the p300/CBP bromodomain and is We did observe other proteins signiﬁcantly downregulated at

dependent both on neddylation to activate CRBN E3 ligase ac- similar levels to CBP and p300 at this time point, yet none of

tivity and on proteasome activity (Lu et al., 2014; Sufan and the proteins on the leading edge are known to directly interact

Ohh, 2006) (Figure 2C). Degradation was also abrogated upon with p300/CBP, suggesting that their downregulation is a result

genetic knockout of CRBN in HAP1 cells and upon treatment of early transcriptional effects or signaling network changes

with dCBP-1-bump, an analogue of dCBP-1 with an N-methyl induced by p300/CBP loss. Two of these proteins (EHHADH,

Cell Chemical Biology 28, 503–514, April 15, 2021 505

ll

Article

DOCK2) have recently been shown to be deacetylated upon

p300/CBP inhibition, suggesting that they may be direct targets

of p300/CBP acetyltransferase activity, which may function to

stabilize these proteins (Weinert et al., 2018). Taken together,

our molecular modeling enabled the efﬁcient synthesis of

dCBP-1, a highly potent, selective, and rapid dual degrader of

CBP and p300, empowering further studies of p300/CBP cellular

activity.

A

p300/CBP degradation in cellular models of multiple

myeloma

B

Several tumor types have been shown to be reliant on p300/CBP

activity for proliferation and survival, including breast cancer,

lung cancer, lymphoma, prostate cancer, and multiple myeloma

(Conery et al., 2016; Garcia-Carpizo et al., 2019; Jin et al., 2017;

Lasko et al., 2017; Picaud et al., 2015; Qin et al., 2015). We per-

formed a survey of p300/CBP dependency across a large collec-

tion of human cancer cell lines using data generated through

CRISPR-based genetic knockout followed by ﬁtness assess-

ments performed by the Broad Institute’s Dependency Map

Project team (www.depmap.org). Notably, across all tumor

types for which p300 and CBP knockout data are available, mul-

tiple myeloma cells are the most dependent on both p300 and

CBP (Figure 3A). Dependency on each factor is highly correlated

across tumor types, suggesting that p300/CBP regulate coordi-

nated and co-dependent signaling nodes when co-expressed in

selected lineage-deﬁned tumors, such as breast cancer, leuke-

mia, lymphoma, and most signiﬁcantly multiple myeloma (Fig-

ure 3B). To assess the capability of dCBP-1 to degrade p300/

CBP in multiple myeloma cells, we treated the multiple myeloma

cell line MM1S for 6 h with ﬁve different dose levels (Figure 3C).

We observed near-complete degradation of p300/CBP between

10 and 1,000 nM dCBP-1. A time course of 100 nM dCBP-1

treatment revealed rapid degradation with near-complete loss

of p300/CBP after 2 h (Figure 3D). dCBP-1 was also able to

induce near-complete p300/CBP degradation across other mul-

tiple myeloma cell lines tested, including MM1R, KMS-12-BM,

and KMS34 (Figure 3E). We then compared the activity of

dCBP-1 with that of A-485 and GNE-781 in phenotypic cell

viability assays (Figure 3F). We also tested pomalidomide alone,

a potent CRBN-binding analogue of thalidomide and lenalido-

mide that induces degradation of the zinc ﬁnger transcription

factors IKZF1 and IKZF3 in lymphoid cells and is used clinically

C

D

Figure 2. dCBP-1 promotes efﬁcient cellular degradation of CBP

and p300

(A) Immunoassay measurements of CBP and p300 levels with dCBP-1 treat-

ment in dose-response experiments in HAP1 cells. Vinculin is shown as a

loading control for each.

(B) Time course immunoassay measurements of CBP and p300 levels with

dCBP-1 treatment over 6 h in HAP1 cells.

(C) CBP and p300 levels following 6 h of pre-treatment with indicated inhibitor

(GNE-781, 10 mM; Pom, 10 mM; Carf, 400 nM; MLN4924 1 mM) followed by 2 h

of treatment with dCBP-1 (100 nM) in HAP1 cells. Shown at right are CBP and

p300 levels with dCBP-1 treatment (100 nM) in CRBN-null HAP1 cells. Vinculin

antibody used as loading control.

(D) Global proteomic assessment of dCBP-1 treatment (250 nM, 3 h) in HAP1

cells. Highlighted are CBP, p300, BRD4, and GSPT1, a known degradation

target of some carbon 5-substituted thalidomide analogues.

See also Figure S4, Tables S3 and S4.

510 Cell Chemical Biology 28, 503–514, April 15, 2021

ll

Article

likely that the acute effects of p300/CBP loss on chromatin

composition and enhancer structures are distinct (Lim et al.,

2019). The addition of dCBP-1 to the toolbox of chromatin regu-

lator-targeting degraders (along with degraders of BET factors,

BRD9, TRIM24, SMARCA2/4, CDK9, EED/EZH2, PCAF/GCN5,

HDAC1/2/3) will thus enable precise investigation of their unique

functions (Bassi et al., 2018; Farnaby et al., 2019; Gechijian et al.,

2018; Hsu et al., 2019; Olson et al., 2018; Potjewyd et al., 2019;

Remillard et al., 2017; Smalley et al., 2020; Winter et al., 2015).

Further studies will also assess the tolerability of p300/CBP

degradation in animal models, which will enable additional eval-

uation of the therapeutic potential of dCBP-1 and other pharma-

cologically optimized analogues.

A

SIGNIFICANCE

The chromatin regulators CBP and p300 play important roles

in maintaining enhancer-driven gene transcription in normal

and malignant cells. Their enzymatic activity through ε-N-

lysine acetylation establishes these posttranslational marks

on histones, transcription factors, and an array of other

chromatin regulators. In addition to their acetyltransferase

activity, p300/CBP also possess a number of other func-

tional domains that mediate protein:protein interactions

and scaffolding functions at enhancers. Several high-quality

selective chemical inhibitors of p300/CBP function have

been developed, and efforts to develop them as cancer ther-

apeutics are underway. However, inhibition of single do-

mains alone cannot completely ablate p300/CBP activity in

cells. We have discovered a highly potent chemical degrader

of both p300 and CBP, dCBP-1, that potently ablates

enhancer-mediated transcription. We envision that dCBP-1

will be a useful tool for studying the acute effects of p300/

CBP loss and may lead to new therapeutic strategies in can-

cers such as multiple myeloma that are often driven by onco-

genic enhancer activity.

B

STAR+METHODS

Detailed methods are provided in the online version of this paper

and include the following:

d KEY RESOURCES TABLE

d RESOURCE AVAILABILITY

B Lead contact

Figure 5. dCBP-1 treatment reduces enhancer histone acetylation

and chromatin accessibility

(A) Heatmaps of H3K27ac ChIP-seq proﬁles of MM1S cells following treatment

with vehicle (DMSO), A-485, GNE-781, dCBP-1 (100 nM for 6 h), or the com-

bination of A-485 and GNE-781 (100 nM each). Shown are the top 10,000

peaks in the vehicle (control) sample as measured by peak intensity. MM1S

ChIP-seq enrichment of p300 and CBP is shown at right.

B Materials availability

B Data and code availability

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

B Cell lines

d METHOD DETAILS

(B) p300, CBP, H3K27ac ChIP-seq, and ATAC-seq proﬁles of the IgH enhancer

that drives high MYC expression in MM1S cells. Chromosome coordinates are

based on the hg19 human genome build.

B Tertiary complex docking

B CRISPR editing of HAP1 cells

B Immunoassays

enhancer chromatin accessibility and H3K27 acetylation that

cannot be achieved with equivalent doses of free inhibitors.

While CRBN-based heterobifunctional degraders of BET pro-

teins have similar antiproliferative and anti-MYC effects in

cellular models of multiple myeloma, the functional domains

outside their bromodomains are largely divergent, and so it is

B Multiplexed quantitative proteomics

B Cell viability assays

B mRNA sequencing

B ChIP-seq

B ATAC-seq

B Compound synthesis

Cell Chemical Biology 28, 503–514, April 15, 2021 511

ll

Article

d QUANTIFICATION AND STATISTICAL ANALYSIS

Conery, A.R., Centore, R.C., Neiss, A., Keller, P.J., Joshi, S., Spillane, K.L.,

Sandy, P., Hatton, C., Pardo, E., Zawadzke, L., et al. (2016). Bromodomain in-

hibition of the transcriptional coactivators CBP/EP300 as a therapeutic strat-

egy to target the IRF4 network in multiple myeloma. eLife 5 , 777.

SUPPLEMENTAL INFORMATION

Supplemental information can be found online at https://doi.org/10.1016/j.

chembiol.2020.12.004.

Corces, M.R., Trevino, A.E., Hamilton, E.G., Greenside, P.G., Sinnott-

Armstrong, N.A., Vesuna, S., Satpathy, A.T., Rubin, A.J., Montine, K.S., Wu,

B., et al. (2017). An improved ATAC-seq protocol reduces background and en-

ables interrogation of frozen tissues. Nat. Methods 14 , 959–962.

ACKNOWLEDGMENTS

Crawford, T.D., Romero, F.A., Lai, K.W., Tsui, V., Taylor, A.M., Boenig, G.de L.,

Noland, C.L., Murray, J., Ly, J., Choo, E.F., et al. (2016). Discovery of a potent

and selective in vivo probe (GNE-272) for the bromodomains of CBP/EP300.

J. Med. Chem. 59 , 10549–10563.

J.S. acknowledges support from a Fulbright scholarship. M.L. is supported by

MGH institutional start-up funds. C.J.O. acknowledges support from a V Foun-

dation Scholar Award, a Leukemia Research Foundation Hollis Brownstein

Research Grant, a Pablove Foundation Research Grant, and an NIH R00

award (R00CA190861). NMR spectroscopy was supported by an NIH Shared

Instrument grant (S10OD025234). We thank T. Graubert, M. Hudlikar, C.

Payne, and R. Mazitschek for thoughtful discussion and technical advice.

Dahlin, J.L., Nelson, K.M., Strasser, J.M., Barsyte-Lovejoy, D., Szewczyk,

M.M., Organ, S., Cuellar, M., Singh, G., Shrimp, J.H., Nguyen, N., et al.

(2017). Assay interference and off-target liabilities of reported histone acetyl-

transferase inhibitors. Nat. Commun. 8 , 1527.

Dancy, B.M., and Cole, P.A. (2015). Protein lysine acetylation by p300/CBP.

AUTHOR CONTRIBUTIONS

Chem. Rev. 115 , 2419–2452.

C.J.O. conceived and supervised the study and wrote the manuscript. R.V. de-

signed and synthesized the compounds. J.S. performed molecular modeling,

with supervision from M.L. S.O., B.K., E.H., and S.R. performed biological

studies. J.K., R.M., and X.I.H.L. performed proteomics analysis with supervi-

sion from W.H. All authors gave feedback on the manuscript.

Dib, A., Gabrea, A., Glebov, O.K., Bergsagel, P.L., and Kuehl, W.M. (2008).

Characterization of MYC translocations in multiple myeloma cell lines. JNCI

Monogr. 25–31, https://doi.org/10.1093/jncimonographs/lgn011.

Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut,

P., Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq

aligner. Bioinformatics 29 , 15–21.

DECLARATION OF INTERESTS

Dobrovolsky, D., Wang, E.S., Morrow, S., Leahy, C., Faust, T., Nowak, R.P.,

Donovan, K.A., Yang, G., Li, Z., Fischer, E.S., et al. (2019). Bruton tyrosine ki-

nase degradation as a therapeutic strategy for cancer. Blood 133 , 952–961.

The authors declare no competing interests.

Received: September 14, 2020

Revised: November 15, 2020

Accepted: December 9, 2020

Published: January 4, 2021

Edwards, A., and Haas, W. (2015). Proteomics in systems biology, methods

and protocols. Methods Mol. Biol. Clifton N J 1394 , 1–13.

Elias, J.E., and Gygi, S.P. (2007). Target-decoy search strategy for increased

conﬁdence in large-scale protein identiﬁcations by mass spectrometry. Nat.

Methods 4 , 207–214.

REFERENCES

Eng, J.K., McCormack, A.L., and Yates, J.R. (1994). An approach to correlate

tandem mass spectral data of peptides with amino acid sequences in a protein

database. J. Am. Soc. Mass Spectr. 5 , 976–989.

Anders, S., Pyl, P.T., and Huber, W. (2015). HTSeq—a Python framework to

work with high-throughput sequencing data. Bioinformatics 31 , 166–169.

Farnaby, W., Koegl, M., Roy, M.J., Whitworth, C., Diers, E., Trainor, N.,

Zollman, D., Steurer, S., Karolyi-Oezguer, J., Riedmueller, C., et al. (2019).

BAF complex vulnerabilities in cancer demonstrated via structure-based

PROTAC design. Nat. Chem. Biol. 15 , 672–680.

Attar, N., and Kurdistani, S.K. (2016). Exploitation of EP300 and CREBBP

lysine acetyltransferases by cancer. CSH Perspect. Med. 7 , a026534.

Babicki, S., Arndt, D., Marcu, A., Liang, Y., Grant, J.R., Maciejewski, A., and

Wishart, D.S. (2016). Heatmapper: web-enabled heat mapping for all.

Nucleic Acids Res. 44 , W147–W153.

Garcia-Carpizo, V., Ruiz-Llorente, S., Sarmentero, J., Gonz a ´ lez-Corpas, A.,

and Barrero, M.J. (2019). CREBBP/EP300 bromodomain inhibition affects

the proliferation of AR positive breast cancer cell lines. Mol. Cancer Res. 17 ,

720–730.

Bannister, A.J., and Kouzarides, T. (1996). The CBP co-activator is a histone

acetyltransferase. Nature 384 , 641–643.

Bassi, Z.I., Fillmore, M.C., Miah, A.H., Chapman, T.D., Maller, C., Roberts, E.J.,

Davis, L.C., Lewis, D.E., Galwey, N.W., Waddington, K.E., et al. (2018).

Modulating PCAF/GCN5 immune cell function through a PROTAC approach.

ACS Chem. Biol. 13 , 2862–2867.

Gechijian, L.N., Buckley, D.L., Lawlor, M.A., Reyes, J.M., Paulk, J., Ott, C.J.,

Winter, G.E., Erb, M.A., Scott, T.G., Xu, M., et al. (2018). Functional TRIM24

degrader via conjugation of ineffectual bromodomain and VHL ligands. Nat.

Chem. Biol. 14 , 405–412.

Bedford, D.C., Kasper, L.H., Fukuyama, T., and Brindle, P.K. (2010). Target

gene context inﬂuences the transcriptional requirement for the KAT3 family

of CBP and p300 histone acetyltransferases. Epigenetics 5 , 9–15.

Grant, B.J., Rodrigues, A.P.C., ElSawy, K.M., McCammon, J.A., and Caves,

L.S.D. (2006). Bio3d: an R package for the comparative analysis of protein

structures. Bioinformatics 22 , 2695–2696.

Bowers, E.M., Yan, G., Mukherjee, C., Orry, A., Wang, L., Holbert, M.A.,

Crump, N.T., Hazzalin, C.A., Liszczak, G., Yuan, H., et al. (2010). Virtual ligand

screening of the p300/CBP histone acetyltransferase: identiﬁcation of a selec-

tive small molecule inhibitor. Chem. Biol. 17 , 471–482.

Hammitzsch, A., Tallant, C., Fedorov, O., O’Mahony, A., Brennan, P.E., Hay,

D.A., Martinez, F.O., Al-Mossawi, M.H., Wit, J., de Vecellio, M., et al. (2015).

CBP30, a selective CBP/p300 bromodomain inhibitor, suppresses human

Th17 responses. Proc. Natl. Acad. Sci. U S A 112 , 10768–10773.

Burslem, G.M., and Crews, C.M. (2020). Proteolysis-targeting chimeras as

Hsu, J.H.-R., Rasmusson, T., Robinson, J., Pachl, F., Read, J., Kawatkar, S.,

Donovan, D.H.O., Bagal, S., Code, E., Rawlins, P., et al. (2019). EED-targeted

PROTACs degrade EED, EZH2, and SUZ12 in the PRC2 complex. Cell Chem.

Biol. 27 , 41–46.

therapeutics and tools for biological discovery. Cell 181 , 102–114.

Cebrat, M., Kim, C.M., Thompson, P.R., Daugherty, M., and Cole, P.A. (2003).

Synthesis and analysis of potential prodrugs of coenzyme A analogues for the

inhibition of the histone acetyltransferase p300. Bioorg. Med. Chem. 11 ,

3307–3313.

Huttlin, E.L., Jedrychowski, M.P., Elias, J.E., Goswami, T., Rad, R., Beausoleil,

S.A., Vill e ´ n, J., Haas, W., Sowa, M.E., and Gygi, S.P. (2010). A tissue-speciﬁc

atlas of mouse protein phosphorylation and expression. Cell 143 , 1174–1189.

Chamberlain, P.P., Lopez-Girona, A., Miller, K., Carmel, G., Pagarigan, B.,

Chie-Leon, B., Rychak, E., Corral, L.G., Ren, Y.J., Wang, M., et al. (2014).

Structure of the human Cereblon-DDB1-lenalidomide complex reveals basis

for responsiveness to thalidomide analogs. Nat. Struct. Mol. Biol. 21 , 803–809.

Ishoey, M., Chorn, S., Singh, N., Jaeger, M.G., Brand, M., Paulk, J., Bauer, S.,

€

Erb, M.A., Parapatics, K., Muller, A.C., et al. (2018). Translation termination

512 Cell Chemical Biology 28, 503–514, April 15, 2021

ll

Article

factor GSPT1 is a phenotypically relevant off-target of heterobifunctional

Matyskiela, M.E., Ito, T., Pagarigan, B., Lu, C.-C., Miller, K., Fang, W., Wang,

N.-Y., Nguyen, D., Houston, J., Carmel, G., et al. (2016). A novel cereblon

modulator recruits GSPT1 to the CRL4CRBN ubiquitin ligase. Nature 535 ,

252–257.

phthalimide degraders. ACS Chem. Biol. 13 , 553–560.

Jiang, B., Wang, E.S., Donovan, K.A., Liang, Y., Fischer, E.S., Zhang, T., and

Gray, N.S. (2019). Development of dual and selective degraders of cy-

clin-dependent kinases 4 and 6. Angew. Chem. Int. Ed. 58 , 6321–6326.

McAlister, G.C., Nusinow, D.P., Jedrychowski, M.P., Wuhr, M., Huttlin, E.L.,

Erickson, B.K., Rad, R., Haas, W., and Gygi, S.P. (2014). MultiNotch MS3 en-

ables accurate, sensitive, and multiplexed detection of differential expression

across cancer cell line proteomes. Anal. Chem. 86 , 7150–7158.

Jin, L., Garcia, J., Chan, E., Cruz, C.de la, Segal, E., Merchant, M., Kharbanda,

S., Raisner, R., Haverty, P.M., Modrusan, Z., et al. (2017). Therapeutic target-

ing of the CBP/p300 bromodomain blocks the growth of castration-resistant

prostate cancer. Cancer Res. 77 , 5564–5575.

McNicholas, S., Potterton, E., Wilson, K.S., and Noble, M.E.M. (2011).

Presenting your structures: the CCP4mg molecular-graphics software. Acta

Crystallogr. D Biol. Crystallogr. 67 , 386–394.

Karukurichi, K.R., and Cole, P.A. (2011). Probing the reaction coordinate of the

p300/CBP histone acetyltransferase with bisubstrate analogs. Bioorg. Chem.

39 , 42–47.

Merika, M., Williams, A.J., Chen, G., Collins, T., and Thanos, D. (1998).

Recruitment of CBP/p300 by the IFN b enhanceosome is required for synergis-

tic activation of transcription. Mol. Cell 1 , 277–287.

Kitabayashi, I., Aikawa, Y., Yokoyama, A., Hosoda, F., Nagai, M., Kakazu, N.,

Abe, T., and Ohki, M. (2001). Fusion of MOZ and p300 histone acetyltrans-

ferases in acute monocytic leukemia with a t(8;22)(p11;q13) chromosome

translocation. Leukemia 15 , 89–94.

Michaelides, M.R., Kluge, A., Patane, M., Drie, J.H.V., Wang, C., Hansen, T.M.,

Risi, R.M., Mantei, R., Hertel, C., Karukurichi, K., et al. (2017). Discovery of

spiro oxazolidinediones as selective, orally bioavailable inhibitors of p300/

CBP histone acetyltransferases. ACS Med. Chem. Lett. 9 , 28–33.

Kreuzer, J., Edwards, A., and Haas, W. (2019). Multiplexed quantitative phos-

phoproteomics of cell line and tissue samples. Methods Enzymol. 626 , 41–65.

Nabet, B., Roberts, J.M., Buckley, D.L., Paulk, J., Dastjerdi, S., Yang, A.,

Leggett, A.L., Erb, M.A., Lawlor, M.A., Souza, A., et al. (2018). The dTAG sys-

tem for immediate and target-speciﬁc protein degradation. Nat. Chem. Biol.

14 , 431–441.

Kr o ¨ nke, J., Udeshi, N.D., Narla, A., Grauman, P., Hurst, S.N., McConkey, M.,

Svinkina, T., Heckl, D., Comer, E., Li, X., et al. (2014). Lenalidomide causes se-

lective degradation of IKZF1 and IKZF3 in multiple myeloma cells. Science

343 , 301–305.

Nalawansha, D.A., and Crews, C.M. (2020). PROTACs: an emerging therapeu-

Lai, A.C., Toure, M., Hellerschmied, D., Salami, J., Jaime-Figueroa, S., Ko, E.,

Hines, J., and Crews, C.M. (2015). Modular PROTAC design for the degrada-

tion of oncogenic BCR-ABL. Angew. Chem. Int. Ed. 55 , 807–810.

tic modality in precision medicine. Cell Chem. Biol. 27 , 998–1014.

Nowak, R.P., DeAngelo, S.L., Buckley, D., He, Z., Donovan, K.A., An, J.,

Safaee, N., Jedrychowski, M.P., Ponthier, C.M., Ishoey, M., et al. (2018).

Plasticity in binding confers selectivity in ligand-induced protein degradation.

Nat. Chem. Biol. 14 , 706–714.

Langmead, B., and Salzberg, S.L. (2012). Fast gapped-read alignment with

Bowtie 2. Nat. Methods 9 , 357–359.

Lapek, J.D., Greninger, P., Morris, R., Amzallag, A., Pruteanu-Malinici, I.,

Benes, C.H., and Haas, W. (2017). Detection of dysregulated protein-associa-

tion networks by high-throughput proteomics predicts cancer vulnerabilities.

Nat. Biotechnol. 35 , 983–989.

Ogiwara, H., Sasaki, M., Mitachi, T., Oike, T., Higuchi, S., Tominaga, Y., and

Kohno, T. (2016). Targeting p300 addiction in CBP-deﬁcient cancers causes

synthetic lethality by apoptotic cell death due to abrogation of MYC expres-

sion. Cancer Discov. 6 , 430–445.

Lasko, L.M., Jakob, C.G., Edalji, R.P., Qiu, W., Montgomery, D.,

Digiammarino, E.L., Hansen, T.M., Risi, R.M., Frey, R., Manaves, V., et al.

(2017). Discovery of a selective catalytic p300/CBP inhibitor that targets line-

age-speciﬁc tumours. Nature 550 , 128–132.

Ogryzko, V.V., Schiltz, R.L., Russanova, V., Howard, B.H., and Nakatani, Y.

(1996). The transcriptional coactivators p300 and CBP are histone acetyltrans-

ferases. Cell 87 , 953–959.

Olson, C.M., Jiang, B., Erb, M.A., Liang, Y., Doctor, Z.M., Zhang, Z., Zhang, T.,

Kwiatkowski, N., Boukhali, M., Green, J.L., et al. (2018). Pharmacological

perturbation of CDK9 using selective CDK9 inhibition or degradation. Nat.

Chem. Biol. 14 , 163–170.

Lau, O.D., Kundu, T.K., Soccio, R.E., Ait-Si-Ali, S., Khalil, E.M., Vassilev, A.,

Wolffe, A.P., Nakatani, Y., Roeder, R.G., and Cole, P.A. (2000). HATs off selec-

tive synthetic inhibitors of the histone acetyltransferases p300 and PCAF. Mol.

Cell 5 , 589–595.

Orlando, D.A., Chen, M.W., Brown, V.E., Solanki, S., Choi, Y.J., Olson, E.R.,

Fritz, C.C., Bradner, J.E., and Guenther, M.G. (2014). Quantitative ChIP-Seq

normalization reveals global modulation of the epigenome. Cell Rep. 9 ,

1163–1170.

Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G.,

Abecasis, G., and Durbin, R.; Subgroup, 1000 Genome Project Data

Processing (2009). The sequence alignment/Map format and SAMtools.

Bioinformatics 25 , 2078–2079.

Panagopoulos, I., Fioretos, T., Isaksson, M., Samuelsson, U., Billstrom, R.,

Strombeck, B., Mitelman, F., and Johansson, B. (2001). Fusion of the MORF

and CBP genes in acute myeloid leukemia with the t(10;16)(q22;p13). Hum.

Mol. Genet. 10 , 395–404.

Li, Z., Pinch, B.J., Olson, C.M., Donovan, K.A., Nowak, R.P., Mills, C.E., Scott,

D.A., Doctor, Z.M., Eleuteri, N.A., Chung, M., et al. (2019). Development and

characterization of a wee1 kinase degrader. Cell Chem. Biol. 27 , 57–65.

Lim, S.L., Damnernsawad, A., Shyamsunder, P., Chng, W.J., Han, B.C., Xu, L.,

Pan, J., Pravin, D.P., Alkan, S., Tyner, J.W., et al. (2019). Proteolysis targeting

chimeric molecules as therapy for multiple myeloma: efﬁcacy, biomarker and

drug combinations. Haematologica 104 , 1209–1220.

Picaud, S., Fedorov, O., Thanasopoulou, A., Leonards, K., Jones, K., Meier, J.,

Olzscha, H., Monteiro, O., Martin, S., Philpott, M., et al. (2015). Generation of a

selective small molecule inhibitor of the CBP/p300 bromodomain for leukemia

therapy. Cancer Res. 75 , 5106–5119.

Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold

Potjewyd, F., Turner, A.-M.W., Beri, J., Rectenwald, J.M., Norris-Drouin, J.L.,

Cholensky, S.H., Margolis, D.M., Pearce, K.H., Herring, L.E., and James, L.I.

(2019). Degradation of polycomb repressive complex 2 with an EED-targeted

bivalent chemical degrader. Cell Chem. Biol. 27 , 47–56.

change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15 , 550.

Lu, G., Middleton, R.E., Sun, H., Naniong, M., Ott, C.J., Mitsiades, C.S., Wong,

K.-K., Bradner, J.E., and Kaelin, W.G. (2014). The myeloma drug lenalidomide

promotes the cereblon-dependent destruction of ikaros proteins. Science

343 , 305–309.

Qin, Y., Chen, W., Xiao, Y., Yu, W., Cai, X., Dai, M., Xu, T., Huang, W., Guo, W.,

Deng, W., et al. (2015). RFPL3 and CBP synergistically upregulate hTERT ac-

tivity and promote lung cancer growth. Oncotarget 6 , 27130–27145.

Lu, J., Qian, Y., Altieri, M., Dong, H., Wang, J., Raina, K., Hines, J., Winkler,

J.D., Crew, A.P., Coleman, K., et al. (2015). Hijacking the E3 ubiquitin ligase

cereblon to efﬁciently target BRD4. Chem. Biol. 22 , 755–763.

Raisner, R., Kharbanda, S., Jin, L., Jeng, E., Chan, E., Merchant, M., Haverty,

P.M., Bainer, R., Cheung, T., Arnott, D., et al. (2018). Enhancer activity requires

CBP/P300 bromodomain-dependent histone H3K27 acetylation. Cell Rep. 24 ,

1722–1729.

Luo, J., Solimini, N.L., and Elledge, S.J. (2009). Principles of cancer therapy:

oncogene and non-oncogene addiction. Cell 136 , 823–837.

€

Ram ı ´rez, F., Ryan, D.P., Gruning, B., Bhardwaj, V., Kilpert, F., Richter, A.S.,

Martin, M. (2011). Cutadapt removes adapter sequences from high-

€

Heyne, S., Dundar, F., and Manke, T. (2016). deepTools2: a next generation

throughput sequencing reads. EMBnet J. 17 , 10–12.

Cell Chemical Biology 28, 503–514, April 15, 2021 513

ll

Article

web server for deep-sequencing data analysis. Nucleic Acids Res. 44 ,

Fragment-based discovery of a selective and cell-active benzodiazepinone

CBP/EP300 bromodomain inhibitor (CPI-637). ACS Med. Chem. Lett. 7 ,

531–536.

W160–W165.

Remillard, D., Buckley, D.L., Paulk, J., Brien, G.L., Sonnett, M., Seo, H.-S.,

€

Dastjerdi, S., Wuhr, M., Dhe-Paganon, S., Armstrong, S.A., et al. (2017).

Ting, L., Rad, R., Gygi, S.P., and Haas, W. (2011). MS3 eliminates ratio distor-

Degradation of the BAF complex factor BRD9 by heterobifunctional ligands.

tion in isobaric multiplexed quantitative proteomics. Nat. Methods 8 , 937–940.

Angew. Chem Int. Ed. 129 , 5832–5837.

Wang, L., Gural, A., Sun, X.-J., Zhao, X., Perna, F., Huang, G., Hatlen, M.A., Vu,

L., Liu, F., Xu, H., et al. (2011). The leukemogenicity of AML1-ETO is dependent

on site-speciﬁc lysine acetylation. Science 333 , 765–769.

Ritchie, M.E., Phipson, B., Wu, D., Hu, Y., Law, C.W., Shi, W., and Smyth, G.K.

(2015). Limma powers differential expression analyses for RNA-sequencing

and microarray studies. Nucleic Acids Res. 43 , e47.

¨

Weinert, B.T., Narita, T., Satpathy, S., Srinivasan, B., Hansen, B.K., Scholz, C.,

Romero, F.A., Murray, J., Lai, K.W., Tsui, V., Albrecht, B.K., An, L., Beresini,

M.H., Boenig, G.de L., Bronner, S.M., Chan, E.W., et al. (2017). GNE-781, a

highly advanced potent and selective bromodomain inhibitor of cyclic adeno-

sine monophosphate response element binding protein, binding protein

(CBP). J. Med. Chem. 60 , 9162–9183.

Hamilton, W.B., Zucconi, B.E., Wang, W.W., Liu, W.R., et al. (2018). Time-

resolved analysis reveals rapid dynamics and broad scope of the CBP/p300

acetylome. Cell 174 , 1–27.

Wilson, J.E., Patel, G., Patel, C., Brucelle, F., Huhn, A., Gardberg, A.S., Poy, F.,

Cantone, N., Bommi-Reddy, A., Sims, R.J., et al. (2020). Discovery of CPI-

1612: a potent, selective, and orally bioavailable EP300/CBP histone acetyl-

transferase inhibitor. ACS Med. Chem. Lett. 11 , 1324–1329.

Sagar, V., Zheng, W., Thompson, P.R., and Cole, P.A. (2004). Bisubstrate

analogue structure–activity relationships for p300 histone acetyltransferase in-

hibitors. Bioorgan Med. Chem. 12 , 3383–3390.

Schmidl, C., Rendeiro, A.F., Shefﬁeld, N.C., and Bock, C. (2015).

ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription

factors. Nat. Methods 12 , 963–965.

Winter, G.E., Buckley, D.L., Paulk, J., Roberts, J.M., Souza, A., Dhe-Paganon,

S., and Bradner, J.E. (2015). DRUG DEVELOPMENT. Phthalimide conjugation

as a strategy for in vivo target protein degradation. Science 348 , 1376–1381.

Shrimp, J.H., Sorum, A.W., Garlick, J.M., Guasch, L., Nicklaus, M.C., and

Meier, J.L. (2015). Characterizing the covalent targets of a small molecule in-

hibitor of the lysine acetyltransferase P300. ACS Med. Chem. Lett. 7 , 151–155.

Winter, G.E., Mayer, A., Buckley, D.L., Erb, M.A., Roderick, J.E., Vittori, S.,

Reyes, J.M., Iulio, J., di Souza, A., Ott, C.J., et al. (2017). BET bromodomain

proteins function as master transcription elongation factors independent of

CDK9 recruitment. Mol. Cell 67 , 5–18.

Sircar, A., Chaudhury, S., Kilambi, K.P., Berrondo, M., and Gray, J.J. (2010). A

generalized approach to sampling backbone conformations with RosettaDock

for CAPRI rounds 13–19. Proteins Struct. Funct. Bioinform 78 , 3115–3123.

Yang, Y., Zhang, R., Li, Z., Mei, L., Wan, S., Ding, H., Chen, Z., Xing, J., Feng,

H., Han, J., et al. (2020). Discovery of highly potent, selective, and orally efﬁca-

cious p300/CBP histone acetyltransferases inhibitors. J. Med. Chem. 63 ,

1337–1360.

Smalley, J.P., Adams, G.E., Millard, C.J., Song, Y., Norris, J.K.S., Schwabe,

J.W.R., Cowley, S.M., and Hodgkinson, J.T. (2020). PROTAC-mediated

degradation of class I histone deacetylase enzymes in corepressor com-

plexes. Chem. Commun. 56 , 4476–4479.

Zhang, Y., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein, B.E.,

Nusbaum, C., Myers, R.M., Brown, M., Li, W., et al. (2008). Model-based anal-

ysis of ChIP-seq (MACS). Genome Biol. 9 , R137.

Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L.,

Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., et al.

(2005). Gene set enrichment analysis: a knowledge-based approach for inter-

preting genome-wide expression proﬁles. Proc. Natl. Acad. Sci. U S A 102 ,

15545–15550.

Zorba, A., Nguyen, C., Xu, Y., Starr, J., Borzilleri, K., Smith, J., Zhu, H., Farley,

K.A., Ding, W., Schiemer, J., et al. (2018). Delineating the role of cooperativity

in the design of potent PROTACs for BTK. Proc. Natl. Acad. Sci. U S A 115 ,

E7285–E7292.

Sufan, R.I., and Ohh, M. (2006). Role of the NEDD8 modiﬁcation of Cul2 in the

sequential activation of ECV complex. Neoplasia 8 , 956–963.

Zucconi, B.E., Makofske, J.L., Meyers, D.J., Hwang, Y., Wu, M., Kuroda, M.I.,

and Cole, P.A. (2019). Combination targeting of the bromodomain and acetyl-

transferase active site of p300/CBP. Biochemistry 58 , 2133–2143.

ˆ

Taylor, A.M., Cote, A., Hewitt, M.C., Pastor, R., Leblanc, Y., Nasveschuk, C.G.,

´

Romero, F.A., Crawford, T.D., Cantone, N., Jayaram, H., et al. (2016).

514 Cell Chemical Biology 28, 503–514, April 15, 2021

ll

Article

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE

Antibodies

SOURCE

IDENTIFIER

Vinculin

Bethyl

Cat#A302-535A;

RRID: AB_1999080

CBP

Cell Signaling

Sigma

Cat#D6C5;

RRID: AB_2616020

p300

Cat#D2X6N;

RRID: AB_2799450

GAPDH

CRBN

MYC

Cat#14C10;

RRID: AB_561053

Cat#HPA045910;

RRID: AB_10960409

Santa Cruz

Bethyl

Cat#N-262;

RRID: AB_631276

IKZF1

IKZF3

BRD2

BRD3

BRD4

H3K27ac

Cat#A303-516A;

RRID: AB_10952216

Cell Signaling

Bethyl

Cat#D1C1E;

RRID: AB_2744524

Cat#IHC-00612;

RRID: AB_10755275

Bethyl

Cat#A302-368A;

RRID: AB_1907251

Bethyl

Cat#A301-985A;

RRID: AB_1576498

Abcam

Cat#ab4729;

RRID: AB_2118291

Chemicals, Peptides, and Recombinant Proteins

dCBP-1

This study

N/A

dCBP-1-bump

MLN4929

Carﬁlzomib

GNE-781

A-485

This study

N/A

Cayman Chemical

MedChem Express

Selleck Chemicals

Sigma

Cat#15217

Cat#HY-10455

Cat#HY-108696

Cat#6387

Cat#S8762

Cat#P0018

dBET6

Pomalidomide

Critical Commercial Assays

QuantSeq 3’ mRNA-Seq FWD library kit

Nextera DNA Library Preparation Kit

Lexogen

Illumina

Cat#015.24

Cat#FC-121-1030

Deposited Data

Proteomics upon dCBP-1 treatment

This study

MassIVE: MSV000086457

GEO: GSE160337

RNA-seq upon CBP/p300 inhibition and

degradation

ChIP-seq: H3K27ac, CBP, p300

ATAC-seq upon dCBP-1 treatment

This study

GEO: GSE160337

PDB ID: 5W0E

This study

GNE-781/CBP bromodomain crystal

structure

Romero et al., 2017

A-485/p300 KAT domain crystal structure

lenalidomide/CRBN crystal structure

Lasko et al., 2017

PDB ID: 5KJ2

PDB ID: 4TZ4

Chamberlain et al., 2014

(Continued on next page)

Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021 e1

ll

Article

Continued

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Human genome build hg19/GRch37

Genome Reference Consortium

ncbi.nlm.nih.gov/projects/genome/

assembly/grc/human/

Broad Institute DepMap Project

www.depmap.org

2020Q2 Avana Public

Experimental Models: Cell Lines

HAP1

Horizon Discovery

ATCC

RRID: CVCL_Y019

RRID: CVCL_8792

RRID: CVCL_8794

RRID: CVCL_0566

RRID: CVCL_1600

RRID: CVCL_8226

RRID: CVCL_2989

RRID: CVCL_1334

RRID: CVCL_1333

RRID: CVCL_2990

RRID: CVCL_2992

RRID: CVCL_2993

RRID: CVCL_2996

RRID: CVCL_2981

RRID: CVCL_1625

RRID: CVCL_0012

RRID: CVCL_1357

RRID: CVCL_2030

RRID: CVCL_2124

RRID: CVCL_1806

RRID: CVCL_1823

RRID: CVCL_1699

W.G. Kaelin lab, DFCI

N/A

MM1S

MM1R

ATCC

U266

ATCC

H929

ATCC

RPMI-8226

KMS11

ATCC

JCRB

KMS-12-BM

KMS-12-PE

KMS20

JCRB

KMS26

JCRB

KMS27

JCRB

KMS34

JCRB

KMM1

JCRB

OPM2

DSMZ

LP1

DSMZ

L363

DSMZ

EJM

DSMZ

MOLP-8

AMO-1

DSMZ

Karpus-620

SKMM2

DSMZ

MM1S CRBN KO

HAP1 CRBN KO

Lu et al., 2014

This study

Oligonucleotides

sgRNA CRBN: CAGGACGCUGCGCAC

AACAUGUUUUAGAGCUAUGCU

IDT

N/A

Software and Algorithms

Rosetta (v3.11)

Rosetta Commons

Grant et al., 2006

Kassambara, Mundt

McNicholas et al., 2011

GraphPad

rosettacommons.org

cran.r-project.org

ccp4.ac.uk/MG

bio3d (v2.4.1)

factoextra (v1.0.6)

CCP4mg (v2.10.6)

GraphPad PRISM (v8.2.1)

LIMMA (v3.12)

graphpad.com

Ritchie et al., 2015

ENCODE

cran.r-project.org

github.com.ENCODE-DCC

ENCODE ChIP-seq analysis

pipeline (v1.5.1)

ENCODE ATAC-seq analysis

pipeline (v1.8.0)

ENCODE

github.com.ENCODE-DCC

Bowtie2 (v2.4.1)

Langmead and Salzberg, 2012

Subramanian et al., 2005

Li et al., 2009

bowtie-bio.sourceforge.net

gsea-msigdb.org

Gene Set Enrichment Analysis (v4.1.0)

Samtools (v1.3; v1.10)

Picard (v2.23.3)

htslib.org

Broad Institute

broadinstitute.github.io/picard/

github.com/macs3-project/MACS

deeptools.readthedocs.io

jgi.doe.gov

MACS2 (v2.2.7.1)

Zhang et al., 2008

deepTools (v3.5.0)

Ram ı ´rez et al., 2016

Joint Genome Institute

Dobin et al., 2013

bbduk (v35.92)

STAR aligner (v2.5.2a)

github.com/alexdobin/STAR

(Continued on next page)

e2 Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021

ll

Article

Continued

REAGENT or RESOURCE

SOURCE

IDENTIFIER

HTSeq-count (v0.6.0)

DESeq2 (v3.12)

Cutadapt (v2.10)

Heatmapper

Broad Institute

cutadapt.readthedocs.io

heatmapper.ca

Morpheus

https://software.broadinstitute.org/

morpheus/

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulﬁlled by the Lead Contact, Chris-

topher Ott (christopher.ott@mgh.harvard.edu).

Materials availability

All unique reagents described in this study are available upon request.

Data and code availability

All datasets associated with this study are available on the public repositories NCBI Gene Expression Omnibus (RNA-seq, ChIP-seq,

ATAC-seq; accession #GSE160337) and MassIVE (proteomics; accession #MSV000086457).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell lines

HAP1 cells [male] were obtained from Horizon Discovery and grown in IMDM media supplemented with 10% fetal bovine serum

(FBS). Multiple myeloma lines were obtained from ATCC (MM1S [female], MM1R [female], U266 [male], H929 [female], RPMI-

8226 [male]), JCRB (KMS11 [female], KMS-12-BM [female], KMS-12-PE [female], KMS20 [female], KMS26 [male], KMS27 [male],

KMS34 [female], KMM1 [male]), or DSMZ (OPM2 [female], LP1 [female], L363 [female], EJM [female], MOLP-8 [male], AMO-1 [fe-

male], Karpus-620 [female], SKMM2 [male]). Cells were cultured in RPMI medium with 10% FBS (MM1S, MM1R, U266, H929,

RPMI-8226, KMS-11, KMS-12-BM, KMS-12-PE, KMS20, KMS26, KMS27, KMS34, KMM1, OPM2, L363) or 20% FBS (MOLP-8,

AMO-1, Karpus-620, SKMM2); or with IMDM media supplemented 10% FBS (EJM) or 20% FBS (LP1) per supplier recommendation.

MM1S CRBN knockout cells were kindly provided by W. Kaelin, Dana-Farber Cancer Institute (Lu et al., 2014). All cell lines were

cultured at 37 ^ꢁC with 5% CO₂.

METHOD DETAILS

Tertiary complex docking

The structures of GNE-781/CBP bromodomain (PDB ID: 5W0E), the A-485/p300 KAT domain (PDB ID: 5KJ2), and of lenalidomide/

CRBN (PDB ID: 4TZ4) were obtained from the Protein Data Bank (www.rcsb.org). For protein-protein docking simulations, Rosetta

3.11 was used (Sircar et al., 2010). The relevant PDB structure coordinates were combined into an input ﬁle for the docking sim-

ulations which was prepared for docking by applying the Rosetta Docking Prepack protocol. Twenty thousand docking poses

were generated with the following command line options: partners A_B -dock_pert 8 18 -ex1 -ex2aro -nstruct 20000. The land-

scape of docking poses was reﬁned by ﬁrst selecting the top 200 lowest scoring poses, and then hierarchically clustering

them according to the orientations of the proteins and the distances between the small molecule ligands. Distances were calcu-

lated between the selected set of atoms on GNE-781, on A-485, and lenalidomide (see highlighted atoms in Figure 1B). The R

packages bio3d and factoextra were used for data analysis, and CCP4mg was used for structure visualization (Grant et al.,

2006; McNicholas et al., 2011).

CRISPR editing of HAP1 cells

Cas9 ribonucleoprotein (RNP) was freshly prepared for the experiment. crRNA that targets the ﬁrst exon of CRBN (CAGGACGC

UGCGCACAACAUGUUUUAGAGCUAUGCU) and Alt-R CRISPR-Cas9 tracrRNA (IDT) were resuspended in nuclease free duplex

buffer (IDT) to a ﬁnal concentration of 100 pM/ml. The crRNA and tracrRNA were mixed in equimolar concentrations and allowed

to anneal by heating them to 95 ^ꢁC for 5 mins followed by cooling at RT for 15 min. 40 pmol of the annealed gRNA was mixed

with 60 pmol of HiFi Cas9 (IDT) and incubated for 20 min at RT. One hundred thousand HAP1 cells, resuspended in Buffer R,

Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021 e3

ll

Article

were gently mixed with the Cas9-gRNA complex and electroporated using the Neon Electroporation System (Thermo Fisher) using

the following parameters: 1575V/10ms/3 pulses. The electroporated cells were immediately transferred to pre-warmed media and

allowed to recover for two days. Electroporated cells were treated with 400 nM of the BET degrader dBET6 (Selleck) to ensure

efﬁcient outgrowth of CRBN-null cells (Winter et al., 2017). Single clones were isolated and conﬁrmation of CRBN loss was performed

at a protein level using immunoassay (WES).

Immunoassays

For all immunoassays, cells were plated into 6-well plates followed by overnight incubation before treatment. Cells were harvested

and lysed in RIPA buffer containing HALT protease inhibitor cocktail (Pierce). Protein extraction was facilitated by passing all samples

through a Gauge 28 Micro-Fine IV insulin syringe (BD). Capillary-based immunoassays were performed using a standard WES (Sim-

ple Western) protocol (proteinsimple). Lysates were loaded onto WES plates at 0.8 mg/mL total protein. WES staining was conducted

using the following antibodies: Vinculin (Bethyl, A302-535A), CBP (Cell Signaling, D6C5), p300 (Cell Signaling, D2X6N), GAPDH (Cell

Signaling, 14C10), CRBN (Sigma, HPA045910), MYC (Santa Cruz, N-262), IKZF1 (Bethyl, A303-516A), IKZF3 (Cell Signaling, D1C1E),

BRD2 (Bethyl, IHC-00612), BRD3 (Bethyl, A302-368A), BRD4 (Bethyl, A301-9851). All antibodies were diluted to 1:20 in WES anti-

body diluent except for GAPDH (1:200).

Multiplexed quantitative proteomics

Samples for proteomic analysis were prepared following previously reported procedures (Edwards and Haas, 2015). Frozen cell

pellets were lysed by addition of 500 mL Lysis buffer (75 mM NaCl, 50 mM HEPES pH 8.5, 10 mM sodium pyrophosphate,

10 mM sodium ﬂuoride, 10 mM B-glycerophosphate, 10 mM sodium orthovanadate, complete mini EDTA-free protease inhib-

itors (Roche), 3% SDS, 10 mM PMSF). The disulﬁde bonds were reduced by adding dithiothreitol (DTT) to a ﬁnal concentration

of 5 mM with incubation at 56 ^ꢁC for 30 min followed by adding iodoacetamide at a ﬁnal concentration of 15 mM followed by

incubation in the dark at RT for 20 min. The reaction was stopped by adding DTT to a ﬁnal concentration of 5 mM with incu-

bation in the dark at RT for 15 minutes. Protein was isolated by adding one part trichloroacetic acid to four parts of protein

solution and incubation for 10 min on ice. The precipitated protein was pelleted by centrifugation (15,000 g, 10 min, 5 ^ꢁC)

and washed twice with prechilled acetone (-20 ^ꢁC, 300 mL, 15,000 g, 10 min, 5 ^ꢁC). The remaining protein pellets were resus-

pended in 500 mL 1 M urea, 50 mM HEPES (pH 8.5) and digested overnight at room temperature with 1 mg/mL endoproteinase

Lys-C (Wako) followed by digestion with sequencing-grade trypsin (Promega) at a ﬁnal concentration of 1 ng/mL 6 h at 37 ^ꢁC.

The digestion was quenched with 1% triﬂuoroacetic acid (TFA), and peptides were desalted using Sep-Pak C18 solid-phase

extraction (SPE) cartridges (Waters). The peptide concentration of each sample was determined using a BCA assay (Thermo

Scientiﬁc).

For labeling with TMT11-plexed reagents (Thermo Scientiﬁc), 50 mg of peptides were dried and resuspended in 50 mL of

200 mM HEPES (pH 8.5), 30% acetonitrile (ACN). Labeling was performed by adding 150 mg TMT reagent in anhydrous ACN

and incubating at room temperature for 1 h. The reaction was stopped by the addition of 5% (w/v) hydroxylamine in

200 mM HEPES (pH 8.5) to a ﬁnal concentration of 0.5% hydroxylamine and incubation at room temperature for 15 min. Sam-

ples were acidiﬁed with 1% TFA, and samples were combined. The pooled samples were desalted using Oasis HLB cartridges

(Waters) (Kreuzer et al., 2019). The combined multiplexed samples underwent a prefractionation on an HPLC under basic pH

and fractions were dried. A total of two TMT sets were analyzed, with twelve fractions assayed for each set. To enable a quan-

titative comparison of all analyzed samples, we used a common ‘‘bridge’’ sample in both TMT sets comprising all studied sam-

ples (Lapek et al., 2017). The dried peptides were resuspended in 5 % ACN/5 % formic acid and subjected to LC-MS2/MS3

analysis on an Orbitrap Fusion of an Orbitrap Lumos mass spectrometer. Peptides were separated on an in-house pulled,

in-house packed microcapillary column (inner diameter, 100 mm; outer diameter, 360 mm). Columns were packed to a ﬁnal

˚

length of 30 cm with GP-C18 (1.8 mm, 120 A, Sepax Technologies). Peptides were eluted with a linear gradient of increasing

ACN in 0.125 % formic acid over 165 minutes at a ﬂow rate of 300 nL/minute while the column was heated to 60ꢀC. Electrospray

ionization was achieved by applying 1800 V through a stainless-steel T-junction at the inlet of the microcapillary column. The

mass spectrometers were operated in a data-dependent mode, with a survey scan performed over an m/z range of 500-1,200 in

the Orbitrap with a resolution of 6x10⁴, automatic gain control (AGC) of 5 x 10⁵(Fusion) and 4 x 10⁵(Lumos), and maximum

injection time of 100 ms (Fusion) and 50 ms (Lumos). The most abundant ions detected in the survey scan were subjected

to MS2 and MS3 experiments to be acquired in a 5 second experimental cycle. For MS2 analysis, doubly charged ions

were selected from an m/z range of 600-1200, and triply and quadruply charged ions from an m/z range of 500-1200. The

ion intensity threshold was set to 5x10⁴, and the isolation window to 0.5 m/z. Peptides were isolated using the quadrupole

and fragmented using CID at 30% normalized collision energy at the rapid scan rate using an AGC target of 1 x 10⁴(Fusion)

and 2 x 10⁴(Lumos) and a maximum ion injection time of 35 ms. MS3 analysis was performed using synchronous precursor

selection (SPS) (McAlister et al., 2014; Ting et al., 2011). Up to 10 MS2 (Fusion, 5 for Lumos) precursors were simultaneously

isolated and fragmented for MS3 analysis with an isolation window of 2.5 m/z (Fusion) and 1 m/z (Lumos) and HCD fragmen-

tation at 55% normalized collision energy. MS3 spectra were acquired at a resolution of 6 x 10⁴(Fusion) and 5x10⁴(Lumos) with

an AGC target of 1 x 10⁵(Fusion) and 4.5 x 10⁵(Lumos) and a maximum ion injection time of 100 ms (Fusion) and

150 ms (Lumos).

e4 Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021

ll

Article

Cell viability assays

Cells were plated into 384-well tissue-culture treated plates with 2,000 cells per well in 70 mL of appropriate media. The last col-

umn of each plate was seeded with media containing no cells. Plates were centrifuged at 350 g to remove bubbles and placed in

an incubator overnight. One day after seeding, cells were treated with 35 nL of dCBP-1, pomalidomide (Sigma), A-485 (Tocris), or

GNE-781 (MedChem Express) resuspended in DMSO with 384-pin disposable replicators (Scinomix). Plates were centrifuged at

350 g again to ensure proper mixing of the compounds in each well and placed in an incubator. Four days after treatment 7 mL of

alamarBlue (Invitrogen) was added per well and incubated for 24 hours. After incubation, individual well ﬂuorescence was read on

an Envision multi-well plate reader (PerkinElmer). Dose-response curves were generated by normalizing signal to DMSO-treated

wells. AUC values were calculated using GraphPad PRISM software. For growth-over-time assays, MM1S cells were plated at a

density of 3 x 10⁵cells/mL in 24-well low-attachment tissue culture plates. One day following seeding, cells were treated in trip-

licate with 100 nM of each compound and cultures were counted manually by hemocytometer over the course of ﬁve days of

treatment.

mRNA sequencing

One million MM1S cells were treated for six hours, harvested, pelleted by centrifugation and resuspended in 500 mL Trizol re-

agent (Invitrogen). RNA was puriﬁed using an RNA Plus Mini kit (Qiagen). Sequencing libraries were prepared using the Quant-

Seq 3’ mRNA-Seq FWD library prep kit (Lexogen), and libraries were sequenced on a single ﬂow cell on a NextSeq 500 (Illu-

mina) with 75 bp single-end reads. Sequencing reads were trimmed for low quality reads, polyA tails, and adapter

contamination with bbduk (v35.92). Trimmed reads were aligned using the STAR aligner (v2.5.2a) and indexed with samtools

index (v1.3) (Dobin et al., 2013; Li et al., 2009). Raw gene read counts were generated using HTSeq-count (v0.6.0) (Anders

et al., 2015).

ChIP-seq

Thirty million MM1S cells were treated with DMSO, A-485, GNE-781, or dCBP-1 for six hours; cells for CBP and p300 ChIP were

untreated. Cells were crosslinked with 11% formaldehyde for 10 min at RT and then quenched with 2.5 M glycine at 5% of the

culture volume, spun at 4^ꢁC at 1350 g for 5 min, washed twice with cold PBS, ﬂash frozen with liquid nitrogen and stored at -80 ^ꢁC

overnight. Crosslinked cells were thawed and three million crosslinked Drosophila S2 cells were spiked in for downstream normal-

ization. Cells were resuspended in 30 mL cold lysis buffer 1 (50 mM HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, pH 8, 10%

v/v glycerol, 0.5% v/v NP-40, 0.25% v/v Triton X-100), washed for ten minutes, pelleted, then lysed again in 30 mL cold lysis buffer

2 (10mM Tris-HCL, pH8, 200mM NaCl, 1mM EDTA, pH 8, 0.5mM EGTA, pH 8). After washing and pelleting, cells were then re-

suspended in sonication buffer (50 mM HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, pH 8, 1 mM EGTA, pH 8, 1% v/v Triton

X-100, 0.1% v/v Na-deoxycholate, 1% v/v SDS) and were sonicated with a QSonica to shear chromatin to a 500 bp average

length. 10% of the sonicated volume was set aside to be used as input (non-IP control). The remaining sheared chromatin was

diluted in a sonication buffer solution without SDS such that total % SDS was less than 0.1%. Prepared bead-antibody complex

was mixed with Protein G DynaBeads (Invitrogen) and H3K27ac (Abcam, ab4729), CBP (Cell Signaling, D6C5), or p300 (Cell

Signaling, D2X6N) antibodies at 0.6 mg/mL concentration and rotated end-over-end at 4^ꢁC overnight. Antibody-bead complex

was washed and resuspended with cold blocking buffer (0.5% bovine serum albumin diluted in PBS), then bead suspension

was added to sonicated chromatin and IP was performed rotating end-over-end at 4^ꢁC overnight. Bead-antibody-chromatin

mix was washed 3x with blocking buffer and IPs were tagmented using the ChIPmentation procedure as described (Schmidl

et al., 2015). DNA was eluted and crosslinks were reversed at 65 ^ꢁC overnight. Eluted DNA was treated with RNase A and Pro-

teinase K, then puriﬁed using MinElute PCR Puriﬁcation Kit (Qiagen). Library DNA was ampliﬁed with 12 PCR cycles using custom

barcoded primers (Nextera) and sequenced using 75 bp single-end reads on an NextSeq 500 (Illumina). Sequencing reads were

processed with the ENCODE Histone ChIP-seq pipeline (v1.5.1) (github.com/ENCODE-DCC) and were aligned to the human

genome (hg19) and to the Drosophila melanogaster genome (dm3) using Bowtie2 (v2.4.1) with minimum read length set at 2 (Lang-

mead and Salzberg, 2012). Unmapped/low quality reads were ﬁltered using samtools (v1.10) and duplicated reads were removed

using Picard (v2.23.3).

ATAC-seq

Fifty thousand MM1S cells treated with DMSO, A-485, GNE-781, or dCBP-1 for six hours were washed with 1 mL cold PBS and

then resuspended in 50 mL cold Omni-ATAC lysis buffer (10 mM Tris-HCl, pH 7.5, 10 mM NaCl, 3 mM MgCl₂, 0.1% v/v NP-40,

0.1% v/v Tween-20, 0.01% v/v digitonin), incubated on ice for 3 min, then resuspended in 1 mL Omni-ATAC wash buffer

(10 mM Tris-HCl, pH 7.5, 10 mM NaCl, 3 mM MgCl₂, 0.1% v/v Tween-20). Nuclei were pelleted by centrifugation and resuspended

in 50 mL Omni-ATAC transposition reaction mixture (25 mL Nextera TD buffer, 16.5 mL PBS, 0.1% v/v Tween-20, 0.01% v/v digi-

tonin, 2.5 mL Tn5 transposase) and incubated at 37 ^ꢁC for 30 minutes. DNA was puriﬁed using a MinElute PCR puriﬁcation kit

(Qiagen). PCR ampliﬁcation using qPCR side-reactions to determine total cycles was performed to generate libraries as described

(Corces et al., 2017). Libraries were puriﬁed and sequenced using 75 bp single-end reads on an NextSeq 500 (Illumina). Reads

were processed with the ENCODE ATAC-seq pipeline (v1.8.0) and were aligned to the human genome (hg19) (github.com/

Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021 e5

ll

Article

ENCODE-DCC). Adapters were trimmed with Cutadapt (v2.10) and reads were aligned with Bowtie2 (Langmead and Salzberg,

2012; Martin, 2011). Unmapped/low quality reads were ﬁltered with Samtools (v1.10) and duplicated reads were removed with

Picard (v2.23.3).

Compound synthesis

All reactions were conducted under Argon (Ar) atmosphere, unless otherwise mentioned. All commercially available reagents

and solvents were used as is. Reactions were either monitored by TLC (silica gel HL, w/UV254, 250 mm) and visualized either

under UV lamp or by charring with ceric ammonium molybdate or potassium permanganate stain solutions or an Agilent 1260

system (UV detection at 220, 254 and 280 nm) coupled to an Agilent Technologies 6130 Quadrupole MS system using the

following methods: Mobile Phases: A: H₂O (+ 0.1% formic acid, v/v) B: CH₃CN (+ 0.1% formic acid, v/v) Method 1: Column:

Phenomenex Luna, C18 (2), 5 mm, 100 X 2 mm column, ﬂow rate: 0.7 mL min^-1using Method-1: Mobile Phase B : 5 to 95%

for 7 min. Flash chromatography was performed on a Combiﬂash (ISCO) instrument using prepacked commercially available

columns. ¹H NMR and ¹³C NMR spectra were recorded on either a 500 MHz Varian or 400 MHz Bruker Avance III spectrometer

with chemical shifts referenced to (CH₃)₄Si (d_H0.00 ppm) or the residual peak in CDCl₃(d_H7.24 ppm). HRMS was performed on

an Agilent 6210 TOF-LC/MS.

Retrosynthetic analysis of dCBP-1

dCBP-1 synthesis

Quinoline-7-carbaldehyde S2: A solution of 7-methylquinoline S1 (10 g, 69.8 mmol) and SeO₂(7.7 g, 69.8 mmol) in xylene (20 mL)

was heated at 170 ^ꢁC for 24 h. After cooling the reaction mixture to room temperature, DCM (100 mL) and ethylacetate (100 mL) were

added and the resulting solution was ﬁltered through a pad of Celite. The ﬁltrate fractions were combined and concentrated in vacuo.

The solids were triturated with heptanes (100 mL) for 30 min, ﬁltered and dried to obtain the quinoline-7-carbaldehyde S2 (4.5 g, 41%)

as a white solid.

e6 Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021

ll

Article

¹H NMR (500 MHz, CHLOROFORM-D) d 10.23 (s, 1H), 9.02 (s, 1H), 8.55 (s, 1H), 8.21 (d, 1H), 8.02 (d, 1H), 7.91 (d, 1H), 7.53 (m, 1H).

7-(diﬂuoromethyl)quinoline S3: To a solution of quinoline-7-carbaldehyde S2 (1.2 g, 7 mmol) in DCM (15 mL) 0 ^ꢁC was

added DAST (5 g, 35 mmol) dropwise over 20 min. The mixture was allowed to stir at room temperature for 16 h. The mixture

was poured into satd. aq. NaHCO₃(100 mL) at 0 ^ꢁC (caution! gas evolution) and extracted with DCM (2 x 100 mL). The com-

bined organic layers were dried over anhydrous Na₂SO₄, ﬁltered, and concentrated in vacuo. The resulting residue was pu-

riﬁed by silica gel chromatography (heptanes/ethylacetate 4:1) to give 7-(diﬂuoromethyl)quinoline S3 (1 g, 80%) as a yellow oil.

¹H NMR (500 MHz, CHLOROFORM-D) d 8.98 (dd, J = 4.1, 1.7 Hz, 2H), 8.24 – 8.17 (m, 4H), 7.92 (d, J = 8.4 Hz, 2H), 7.69 (d, J = 8.5 Hz,

2H), 7.48 (dd, J = 8.4, 4.2 Hz, 2H), 6.84 (s, 1H).

7-(diﬂuoromethyl)-1,2,3,4-tetrahydroquinoline S4: To a solution of 7-(diﬂuoromethyl)quinoline S3 (0.7 g 3.9 mmol) and

ꢁ

NaBH₃CN (1.25 g, 20 mmol) in MeOH (20 mL) at 0 C was added boron triﬂuoride diethyl etherate (2.0 mL, 8 mmol) dropwise

over 10 min. The mixture was heated to 90 ^ꢁC for 24 h. After cooling the reaction to room temperature, the reaction mixture was

poured into satd. aq. NaHCO₃(100 mL) at 0^ꢁC (caution! gas evolution) and extracted with DCM (100 mL, 2 times). The combined

organic layers were dried over Na₂SO₄, ﬁltered, and concentrated in vacuo. The crude residue was puriﬁed by silica gel chro-

matography 5% ethylacetate/heptanes to give the 7-(diﬂuoromethyl)-1,2,3,4-tetrahydroquinoline S4 (350 mg 42%) as a

white solid.

¹H NMR (500 MHz, CHLOROFORM-D) d 6.98 (d, J = 7.6 Hz, 1H), 6.68 (dd, J = 7.5, 1.6 Hz, 1H), 6.61 – 6.55 (m, 1H), 3.96 (s, 1H), 3.34 –

3.28 (m, 2H), 2.76 (t, J = 6.4 Hz, 2H), 1.93 (dt, J = 11.4, 6.3 Hz, 2H).

6-bromo-7-(diﬂuoromethyl)-1,2,3,4-tetrahydroquinoline S5: To a solution of 7-(diﬂuoromethyl)-1,2,3,4-tetrahydroquinoline S4

(0.143 g, 0.78 mmol) in dry DCM at 0 ^ꢁC was added N-Bromo succinimide (0.153 g, 0.85 mmol) portion wise over 20 min. After

20 min reaction was warmed to room temperature and was stirred for 16 h. The reaction mixture was poured into water (20 mL)

and back-extracted with DCM (2 x 25 mL). The combined organic layer was dried over Na₂SO₄, ﬁltered, and concentrated in vacuo.

The crude residue was puriﬁed by silica gel chromatography (0-5% ethylacetate in heptane) to give the 6-bromo-7-(diﬂuoromethyl)-

1,2,3,4-tetrahydroquinoline S5 (204 mg, 55%) as a light-yellow oil.

¹H NMR (500 MHz, CHLOROFORM-D) d 7.13 – 7.09 (m, 1H), 6.76 (s, 1H), 6.70 (s, 1H), 3.32 – 3.27 (m, 3H), 2.73 (t, J = 6.4 Hz, 3H),

1.90 (p, J = 5.9 Hz, 3H).

7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-1,2,3,4-tetrahydroquinoline S7: To a solution of 7-(diﬂuoromethyl)-1,2,3,4-

tetrahydroquinoline S5 (40 mg, 0.17mmol) in dioxane (1.9 mL) and H₂O (0.5 mL) was added K₂CO₃(43 mg, 0.35 mmol),

[1,1⁰bis (diphenylphosphino) ferrocene] dichloropalladium(II) (11.2 mg, 0.017 mmol), and 1-methyl-4-(4,4,5,5-tetramethyl-

1,3,2-dioxaborolan-2-yl)-1H-pyrazole S6 (48 mg, 0.26 mmol). The mixture was heated to 110 ^ꢁC for 15 h under argon atmo-

sphere. After cooling the reaction to room temperature, the mixture was concentrated in vacuo and dissolved in ethyl acetate

(50 mL) and was ﬁltered through celite. The crude residue was puriﬁed by silica gel chromatography (15 to 25% acetone in

heptanes) to give 7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-1,2,3,4-tetrahydroquinoline S7 (40.1 mg, 87%) as a yellowish

white solid.

¹H NMR (500 MHz, CHLOROFORM-D) d 7.50 (d, J = 0.8 Hz, 2H), 7.38 (s, 2H), 6.94 (t, J = 1.2 Hz, 2H), 6.79 (s, 2H), 6.51 (s,

1H), 3.93 (s, 6H), 3.36 – 3.30 (m, 4H), 2.78 (t, J = 6.5 Hz, 4H), 1.99 – 1.91 (m, 4H), 1.24 (s, 1H), 0.81 (d, J = 15.1 Hz, 1H), 0.06 (s,

1H).

Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021 e7

ll

Article

2-(2,6-dioxopiperidin-3-yl)-5-ﬂuoroisoindoline-1,3-dione S10: To a solution of 5-ﬂuoroisobenzofuran-1,3-dione S8 (2.0 g,

12 mmol) and 3-aminopiperidine-2,6-dione S9 (2.2 g, 13.2 mmol) in AcOH (4 mL) was added KOAc (3.6 g, 37.3 mmol) and heat-

ed to 110 ^ꢁC for 24 h, then water (100 mL) was added, ﬁltered and dried. The resulting crude (black solid) was dissolved in 10%

methanol in DCM (500 mL) and ﬁltered through a silica bed (10 g, 2 inches), and rotavaped; the resulting gray solid was tritu-

rated with isopropanol (50 mL) to yield 2-(2,6-dioxopiperidin-3-yl)-5-ﬂuoroisoindoline-1,3-dione S10 (1.5 g, 45.5%) as a light-

gray solid.

¹H NMR (500 MHz, DMSO-D₆) d 11.11 (s, 1H), 7.97 (dd, J = 8.2, 4.5 Hz, 1H), 7.82 (dd, J = 7.4, 2.3 Hz, 1H), 7.69 (ddd, J = 10.6, 8.2,

2.3 Hz, 1H), 5.13 (dd, J = 12.9, 5.4 Hz, 1H), 2.85 (ddd, J = 17.0, 13.9, 5.4 Hz, 1H), 2.61 – 2.47 (m, 2H), 2.03 (dtd, J = 12.9, 5.4,

2.3 Hz, 1H).

tert-butyl1-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxapentadecan-15-oate S12: To a 25 mL

round bottom ﬂask was added 2-(2,6-dioxopiperidin-3-yl)-5-ﬂuoroisoindoline-1,3-dione S10 (0.06 g, 0.21 mmol), amino-PEG4-

ꢁ

OtBu S11 (0.083 g, 0.26 mmol) and DIPEA (0.11 mL, 0.6 mmol) in dry DMF (2 mL). The reaction mixture was heated to 80 C for

16 h. The resulting mixture was diluted with water (10 mL) and extracted with ethylacetate (2 x 25 mL). The ethylacetate extract

was dried over MgSO₄and the solvents were evaporated under vacuum. The crude product was subjected to silica gel chromatog-

raphy using THF/heptanes and 2-(2,6-dioxopiperidin-3-yl)-5-ﬂuoroisoindoline-1,3-dione S12 (30 mg, 25%) was isolated as a yel-

low oil.

¹H NMR (500 MHz, CHLOROFORM-D) d 8.24 (s, 1H), 7.57 (d, J = 8.3 Hz, 1H), 6.95 (d, J = 2.6 Hz, 2H), 6.76 (dd, J = 8.3, 2.2 Hz, 1H),

5.35 (s, 1H), 4.91 (dd, J = 12.1, 5.3 Hz, 1H), 3.76 – 3.66 (m, 5H), 3.65 (s, 9H), 3.65 – 3.56 (m, 5H), 3.37 (q, J = 4.4, 3.9 Hz, 2H), 2.89 – 2.65

(m, 4H), 2.47 (t, J = 6.6 Hz, 2H), 2.25 (s, 1H), 2.10 (ddd, J = 10.2, 5.2, 2.7 Hz, 1H), 2.03 (d, J = 2.8 Hz, 1H), 1.86 – 1.80 (m, 1H), 1.41

(d, J = 4.0 Hz, 14H).

LC-MS Mass m/z: 578.26 [M+H]⁺. 1-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxapentadecan-

15-oicacid S13: To the solution of 2-(2,6-dioxopiperidin-3-yl)-5-ﬂuoroisoindoline-1,3-dione S12 (0.020 g) was added DCM/THF

(1:1, 2 mL) and stirred for 30min, then rotavaped, dried to get compound S13 (0.020 g, 100%) and used in the next reaction without

further puriﬁcation.

LC-MS Mass m/z: 522.20 [M+H]⁺.

tert-butyl1-(1-((benzyloxy)carbonyl)piperidin-4-yl)-3-bromo-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate S16: To

a solution of tert-butyl 3-bromo-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate S14 (0.060g, 0.2 mmol) in DMF

(4 mL) was added_ꢁCs₂CO₃(0.160 g, 0.5 mmol) and tetrahydrofuran-3-yl methanesulfonate S15 (0.124g, 0.4 mmol). The mixture

was heated to 90 C for 12 h then cooled to RT and added to ice cold water (10 mL) and brine (5 mL), then extracted with ethyl-

acetate (3 x 20 mL) and dried with MgSO₄. The crude residue was puriﬁed by silica gel using 0-15% EtOAc/DCM to obtain tert-

butyl1-(1-((benzyloxy)carbonyl)piperidin-4-yl)-3-bromo-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate S16 (0.05g,

38.8%) as a colorless oil.

¹H NMR (500 MHz, CHLOROFORM-D) d 7.35 (s, 3H), 7.39 – 7.28 (m, 2H), 5.12 (d, J = 3.7 Hz, 2H), 4.35 (s, 1H), 4.26 (s, 2H), 3.69 (s,

2H), 2.89 (s, 2H), 2.64 (d, J = 6.0 Hz, 2H), 2.13 (d, J = 13.1 Hz, 2H), 1.86 (s, 2H), 1.55 (s, 4H), 1.47 (s, 8H).

LC-MS Mass m/z: 519.15 [M+H]⁺. tert-butyl 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinolin-1(2H)-yl)-1-

(piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate S17: To

a solution of tert-butyl1-(1-((benzyloxy)

carbonyl)piperidin-4-yl)-3-bromo-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate S16 (0.02g, 0.075 mmol) and 7-(di-

ﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-1,2,3,4-tetrahydroquinoline S7 (0.048g, 0.09 mmol) in dioxane (1.5 mL) was added Pd-

PEPPSI-IPent (0.06g, 0.0075 mmol) and NaOtBu (0.0.36 g, 0.375 mmol). The mixture was heated to 120^ꢁC for 12 h. The solvents

were evaporated under reduced pressure and puriﬁed by ﬂash reverse phase column chromatography using methanol and water

e8 Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021

ll

Article

to obtain tert-butyl 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinolin-1(2H)-yl)-1-(piperidin-4-yl)-1,4,6,7-tetra-

hydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate S17 (0.006 g, 25%) as a light-yellow oil.

¹H NMR (300 MHz, Chloroform-d) d 7.54 (s, 1H), 7.41 (s, 1H), 7.28 (s, 1H), 7.02 (s, 1H), 6.88 (s, 1H), 6.53 (s, 1H), 5.04 (s, 7H), 4.27 –

3.84 (m, 6H), 3.83 – 3.37 (m, 6H), 3.11 – 2.62 (m, 6H), 2.43 – 1.85 (m, 10H), 1.45 (s, 9H).

¹³C NMR (75 MHz, CDCl₃) d 138.91, 130.77, 129.42, 129.14, 121.17, 119.54, 113.63, 110.70, 107.13, 53.45, 49.43, 43.01, 39.01,

30.03, 28.38, 27.53, 22.45, 22.34

LC-MS Mass m/z: 568.3 [M+H]⁺. Note: Cbz was selectively deprotected under the reaction conditions.

tert-butyl 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinolin-1(2H)-yl)-1-(1-(1-((2-(2,6-dioxopiperidin-3-

yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxapentadecan-15-oyl)piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]

pyridine-5-carboxylate S18: To the solution of 1-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraox-

apentadecan-15-oic acid S13 (0.01 g, 0.019 mmol) in DMF (1 mL) was added HATU (0.14 g, 0.038 mmol) and DIEA (50 ul,

0.038 mmol) and then after 5 min was added the compound tert-butyl 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-

dihydroquinolin-1(2H)-yl)-1-(piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate

S17

(0.01

g,

0.017 mmol) in DMF (1 mL) and stirred overnight at RT. The solvents were removed under vacuum and puriﬁed by C18

silica gel chromatography (0-100% Methanol in water, 30min) to yield tert-butyl 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyra-

zol-4-yl)-3,4-dihydroquinolin-1(2H)-yl)-1-(1-(1-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxa-

pentadecan-15-oyl)piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate S18 (0.010 g, 55%) as a yel-

low oil.

¹H NMR (500 MHz, CHLOROFORM-D) d 8.21 (s, 1H), 7.58 (d, J = 8.3 Hz, 1H), 7.51 (s, 1H), 7.38 (s, 1H), 6.97 (s, 1H), 6.84 (s,

1H), 6.78 (d, J = 8.3 Hz, 1H), 6.49 (s, 1H), 5.55 (s, 1H), 4.90 (dd, J = 12.3, 5.4 Hz, 1H), 4.68 (d, J = 13.4 Hz, 1H), 4.08 (d, J =

10.4 Hz, 2H), 4.03 (d, J = 29.5 Hz, 1H), 3.97 (s, 1H), 3.93 (s, 3H), 3.79 (d, J = 6.3 Hz, 1H), 3.79 – 3.69 (m, 4H), 3.64 (s, 14H),

3.37 (q, J = 5.2 Hz, 2H), 3.11 (t, J = 12.8 Hz, 1H), 2.89 – 2.82 (m, 1H), 2.85 – 2.80 (m, 2H), 2.82 – 2.73 (m, 1H), 2.71 (dt, J =

11.3, 5.0 Hz, 4H), 2.64 (q, J = 8.6, 6.9 Hz, 2H), 2.12 (s, 2H), 2.13 – 2.07 (m, 1H), 2.03 (p, J = 6.6, 5.3 Hz, 3H), 1.93 (t, J =

14.6 Hz, 2H), 1.75 (s, 4H), 1.42 (s, 10H).

LC-MS Mass m/z: 1072.2 [M+H]⁺. 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinolin-1(2H)-yl)-1-(1-(1-((2-

(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxapentadecan-15-oyl)piperidin-4-yl)-N-methyl-1,4,6,7-

tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide dCBP-1: The compound tert-butyl 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyr-

Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021 e9

ll

Article

azol-4-yl)-3,4-dihydroquinolin-1(2H)-yl)-1-(1-(1-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxapentade-

can-15-oyl)piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate S18 (0.010 g, 0.01 mmol) was dissolved in 1:1

DCM:TFA (1 mL) and stirred for 30 min. The solvents were evaporated under reduced pressure and the crude reaction mixture was dis-

solved in DCM (1 mL); TEA (0.1 mL) and N-methyl-1H-imidazole-1-carboximide (3.5 mg, 0.03 mmol) was added at RT and stirred over-

night. Volatiles were evaporated and the crude reaction mixture was puriﬁed by ISCO using C18 (14g) column, 0-100% MeOH/water to

yield dCBP-1 (0.008 g, 80%) as a yellow oil.

¹H NMR (500 MHz, Chloroform-d) d 7.58 (d, J = 8.3 Hz, 1H), 7.52 (s, 1H), 7.39 (s, 1H), 7.02 (s, 1H), 6.97 (d, J = 2.3 Hz, 1H), 6.82 (s,

1H), 6.78 (dd, J = 8.2, 2.1 Hz, 1H), 6.52 (t, J = 55.6 Hz, 1H), 5.29 (s, 2H), 4.90 (dd, J = 12.5, 5.3 Hz, 1H), 4.69 (d, J = 13.5 Hz, 1H), 4.40 (d,

J = 4.9 Hz, 1H), 4.11 (td, J = 11.6, 10.9, 5.5 Hz, 1H), 3.99 (d, J = 15.0 Hz, 1H), 3.94 (s, 6H), 3.82 – 3.65 (m, 8H), 3.64 (s, 12H), 3.37 (t, J =

5.1 Hz, 2H), 3.19 (s, 3H), 3.12 (t, J = 12.8 Hz, 1H), 2.98 – 2.90 (m, 2H), 2.89 – 2.81 (m, 3H), 2.81 – 2.67 (m, 8H), 2.64 (t, J = 6.8 Hz, 2H),

2.18 – 2.06 (m, 2H), 2.04 (dt, J = 12.2, 5.8 Hz, 4H), 1.92 (s, 2H), 1.24 (s, 2H).

¹³C NMR (101 MHz, CDCl₃) d 171.17, 169.20, 168.48, 168.00, 167.48, 158.30, 154.00, 148.41, 142.04, 138.87, 137.46, 134.59,

130.84, 129.08, 126.34, 125.44, 119.39, 118.00, 116.47, 113.62, 110.25, 106.24, 105.93, 70.59, 70.51, 70.48, 70.44, 70.37, 68.85,

67.41, 55.48, 49.52, 49.05, 44.61, 43.14, 41.34, 40.67, 40.54, 39.08, 33.46, 31.99, 31.48, 27.68, 27.56, 22.77, 22.36, 22.18, 1.02.

LC-MS Mass m/z: 1028.4 [M+H]⁺. HRMS m/z calcd for C₅₁H₆₃F₂N₁₁O₁₀[M+H]⁺1028.4800, found 1028.4770

dCBP-1-bump synthesis

5-ﬂuoro-2-(1-methyl-2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione S19: To a solution of 2-(2,6-dioxopiperidin-3-yl)-5-ﬂuoroisoin-

doline-1,3-dione S10 (0.150g, 0.54 mmol ) in DMF (2.5 mL) was added NaH (60% in mineral oil) (0.021g, 0.59 mmol)) and MeI

(0.037 mL, 0.59 mmol) at 0 ^ꢁC; after 1 h at RT water (50 mL) was added and extracted with ethylacetate (2 x 50 mL), combined or-

ganics were washed with brine (1 x 50 mL), dried with MgSO₄. The resulting crude reaction mixture was puriﬁed by ISCO using a 14 g

silica column, 0-20% MeOH/DCM to give 5-ﬂuoro-2-(1-methyl-2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione S19 (0.008 g, 80%) as a

white solid.

LC-MS Mass m/z: 291.0 [M+H]⁺. tert-butyl1-((2-(1-methyl-2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tet-

raoxapentadecan-15-oate S20: To a 25 mL round bottom ﬂask was added compound 5-ﬂuoro-2-(1-methyl-2,6-dioxopiperidin-3-

yl)isoindoline-1,3-dione S19 (0.052 g, 0.18 mmol), amino-PEG4-OtBu S11 (0.052 g, 0.26 mmol) and DIPEA (0.095 mL, 0.5 mmol) in

dry NMP (2 mL). The reaction mixture was heated to 110 ^ꢁC for 2 h. The resulting mixture was diluted with water (10 mL) and ex-

tracted with ethylacetate (2 x 25 mL). The ethyl acetate layer was washed with water (2 x 25 mL) and brine (2 x 25 mL) and extract

was dried over MgSO₄and solvents were evaporated. The crude product was subjected to silica gel chromatography using meth-

anol/DCM to isolate the compound 5-ﬂuoro-2-(1-methyl-2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione S20 (21 mg, 20%) as a yel-

low oil.

LC-MS Mass m/z: 592.3 [M+H]⁺. 1-((2-(1-methyl-2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxapenta-

decan-15-oic acid S21: To the solution of compound 5-ﬂuoro-2-(1-methyl-2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione S20 (0.015

g) was added DCM/THF (1:1, 1.2 mL) and stirred for 30 min, then rotavaped, dried to yield 1-((2-(1-methyl-2,6-dioxopiperidin-3-yl)-

1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxapentadecan-15-oic acid S21 (0.015 g, 100%) which was used in the next reaction

without further puriﬁcation.

e10 Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021

ll

Article

LC-MS Mass m/z: 536.2 [M+H]⁺.

tert-butyl 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinolin-1(2H)-yl)-1-(1-(1-((2-(1-methyl-2,6-dioxopiperi-

din-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxapentadecan-15-oyl)piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-

c]pyridine-5-carboxylate S22: To the solution of compound 1-((2-(1-methyl-2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-

3,6,9,12-tetraoxapentadecan-15-oic acid S21 (0.010g, 0.017 ) in DMF (1 mL) was added HATU (0.14g, 0.038 mmol) and DIEA (50ul,

0.038 mmol) and then after 5 min, the compound tert-butyl 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinolin-

1(2H)-yl)-1-(piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate S17 (0.01 g, 0.017 mmol) was added in

DMF (1 mL) and stirred overnight at RT. The solvents were removed under vacuum and puriﬁed by C18 silica gel chromatography

(0-100% methanol in water, 30min) to give the product tert-butyl 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroqui-

nolin-1(2H)-yl)-1-(1-(1-((2-(1-methyl-2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxapentadecan-15-oyl)

piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate S22 (0.007g, 40%) as a yellow oil.

LC-MS Mass m/z: 1085.5 [M+H]⁺. 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinolin-1(2H)-yl)-N-methyl-1-

(1-(1-((2-(1-methyl-2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxapentadecan-15-oyl)piperidin-4-yl)-

1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide dCBP-1-bump: The compound tert-butyl 3-(7-(diﬂuoromethyl)-6-(1-

methyl-1H-pyrazol-4-yl)-3,4-dihydroquinolin-1(2H)-yl)-1-(1-(1-((2-(1-methyl-2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)

amino)-3,6,9,12-tetraoxapentadecan-15-oyl)piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxylate

S22

(0.006 g, 0.05 mmol) was dissolved in 1:1 DCM: TFA (1 mL) and stirred for 30 min. The solvents were evaporated under reduced pres-

sure and the crude reaction mixture was dissolved in DCM (1 mL); TEA (0.1 mL) and N-methyl-1H-imidazole-1-carboximide (3.5mg,

0.03 mmol) was added at RT and stirred overnight. Volatiles were evaporated and the crude reaction mixture was puriﬁed by ISCO

using C18 14g column, 0-100% MeOH/Water, to yield 3-(7-(diﬂuoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinolin-1(2H)-

yl)-N-methyl-1-(1-(1-((2-(1-methyl-2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-5-yl)amino)-3,6,9,12-tetraoxapentadecan-15-oyl)pi-

peridin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide dCBP-1-bump (0.003 g, 45%) as a yellow oil.

¹H NMR (500 MHz, Chloroform-d) d 8.35 (d, J = 10.6 Hz, 1H), 7.58 (d, J = 8.3 Hz, 1H), 7.52 (s, 1H), 7.39 (s, 1H), 7.02 (s, 1H), 6.97 (dd,

J = 2.2, 0.0 Hz, 1H), 6.82 (s, 1H), 6.79 (d, J = 8.3 Hz, 1H), 6.52 (t, J = 55.6 Hz, 1H), 5.57 (s, 1H), 4.89 (dd, J = 12.2, 5.4 Hz, 1H), 4.68 (d, J =

13.6 Hz, 1H), 4.41 (q, J = 4.6 Hz, 1H), 4.12 – 4.06 (m, 1H), 3.94 (s, 4H), 3.78 (p, J = 7.2, 6.7 Hz, 2H), 3.72 (q, J = 5.1 Hz, 2H), 3.72 – 3.66

(m, 1H), 3.65 (dd, J = 9.8, 7.4 Hz, 2H), 3.64 (s, 6H), 3.41 – 3.32 (m, 2H), 3.10 (t, J = 13.0 Hz, 1H), 2.89 – 2.62 (m, 9H), 2.62 (d, J = 6.9 Hz,

1H), 2.06 (s, 1H), 2.14 – 1.99 (m, 3H), 1.69 (s, 5H).

HRMS m/z calcd for C₅₂H₆₆F₂N₁₁O₁₀[M+H]⁺1042.4957, found 1042.4926

NMR spectra for dCBP-1, dCBP-1-bump, and selected intermediates are included in Data S1.

Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021 e11

ll

Article

QUANTIFICATION AND STATISTICAL ANALYSIS

For multiplexed proteomics, data were processed using an in-house developed software suite (Huttlin et al., 2010). MS2 data were

annotated using the Sequest algorithm to search the Uniprot database of human protein sequences (03/17/2020) including known

contaminants such as trypsin, and a target-decoy database strategy was applied to measure false-discovery rates of peptide and

protein identiﬁcations (Eng et al., 1994). Searches were performed with a 50 ppm precursor mass tolerance; 10-plex TMT tags on

lysine residues and peptide n-termini (+229.162932 Da) and carbamidomethylation of cysteines (+57.02146 Da) were set as static

modiﬁcations and oxidation of methionine (+15.99492 Da) as a variable modiﬁcation. Data were ﬁltered to a peptide and protein false

discovery rate of less than 1 % using the target-decoy search strategy (Elias and Gygi, 2007). Peptides that matched to more than one

protein were assigned to that protein containing the largest number of matched redundant peptide sequences following the law of

parsimony (Huttlin et al., 2010). TMT reporter ion intensities were extracted from the MS3 spectra selecting the most intense ion within

a 0.003 m/z window centered at the predicted m/z value for each reporter ion and spectra were used for quantiﬁcation if the average

S/N value per reporter ions (over all channels) was R 30 (Fusion) and 20 (Lumos) and the isolation speciﬁcity for the precursor ion was

R 0.75 (Ting et al., 2011). Protein intensities were calculated by summing the TMT reporter ions for all peptides assigned to a protein.

Intensities were ﬁrst normalized by the average intensity across all samples relative to the median average across all proteins. In a

second normalization step protein intensities measured for each sample were normalized by the average of the median protein in-

tensities measured across the samples (Lapek et al., 2017). Differentially expressed proteins between dCBP-1 and DMSO vehicle

control-treated samples was performed using the LIMMA R package (Ritchie et al., 2015). A linear model was ﬁt to the data and a

moderated t-statistic was used to generate p-values. Only peptides that could be uniquely assigned to a protein were considered

for quantiﬁcation. Proteins quantiﬁed by less than 2 peptides were excluded from analysis. All mass spectrometer RAW ﬁles can

be accessed through the MassIVE data repository (massive.ucsd.edu) under the accession number MSV000086457.

For analysis of CRISPR dependency datasets and cell viability experiments (Figure 3), all statistical tests were performed using

GraphPad PRISM software (v8.2.1).

For mRNA-seq experiments, differential expression of transcripts was performed using the DESeq2 R package (v3.12) (Love et al.,

2014). Raw read counts were normalized to account for differences in sequencing depth using a sample-speciﬁc size factor. Size

factors were calculated by the median ratio method using read counts from ERCC RNA spike-in controls. The count data was ﬁtted

to a negative binomial distribution with a ﬁtted mean and a gene-speciﬁc variance estimate. Log₂fold change and p-value estimates

were calculated per gene for each pairwise comparison of experimental treatment versus DMSO vehicle-control. Raw data is depos-

ited under GEO accession #GSE160337. GSEA was performed using the C3 transcription factor targets gene set from the MSigDB

collection (gsea-msigdb.org) (Subramanian et al., 2005).

For ChIP-seq experiments, ﬁltered reads were normalized using a normalization factor calculated by mapped reads to the

1

N_d

Drosophila genome (dm3) using the ChIP-R_xprocedure (Orlando et al., 2014). The normalization formula used is a = where a is

the normalization factor and N_dis the number of mapped reads per million to the reference (dm3) genome. Fragment lengths

were estimated with cross-correlation analysis; enriched regions were identiﬁed and signal tracks with ChIP fold-enrichment-

over-input scores were generated using MACS2 (v2.2.7.1) with p-value threshold set to 0.01 (Zhang et al., 2008). The deepTools

(v3.5.0) computeMatrix tool was used to create a matrix of the top 10,000 peaks signal and plotted using deepTools plotHeatmap

(Ram ı ´rez et al., 2016). Raw data is deposited under GEO accession #GSE160337. For ATAC-seq, peaks were identiﬁed and signal

tracks were generated with MACS2 (v2.2.7.1) with call-peak p-value threshold set to 0.01 and irreproducible discovery rate (IDR)

threshold was set to 0.05. Raw data is deposited under GEO accession #GSE160337.

e12 Cell Chemical Biology 28, 503–514.e1–e12, April 15, 2021

Article Doi

Targeted degradation of the enhancer lysine acetyltransferases CBP and p300

DOI: 10.1016/j.chembiol.2020.12.004

Source and publish data:

Authors:

Article abstract of DOI:10.1016/j.chembiol.2020.12.004

Full text of DOI:10.1016/j.chembiol.2020.12.004

Products guided by the article

R&D Labs maybe for 49573-30-0

Relevant to this article

Hot Product