DNA binding property and antitumor evaluation of xanthone with dimethylamine side chain

Article abstract of DOI:10.1007/s10895-014-1380-5

In this work, a xanthone derivative was obtained by cationic modification of the free hydroxyl group of xanthone with dimethylamine group of high pKa value. The interactions of xanthones with DNA were investigated by spectroscopic methods, electrophoretic migration assay and polymerase chain reaction test. Results indicate that xanthones can intercalate into the DNA base pairs by the hydrophobic plane and the xanthone with dimethylamine side chain may also bind the DNA phosphate framework by the basic amine alkyl chain, thus showing a better DNA binding ability than the xanthone. Furthermore, inhibition on tumor cells (ECA109, SGC7901, GLC-82) proliferation of xanthones were evaluated by MTT method. Analysis results show that the xanthone with dimethylamine side chain exhibits more effective inhibition activity against three cancer cells than the xanthone. The effects on the inhibition of tumor cells in vitro agree with the studies of DNA binding. It means that the amine alkyl chain would play an important role in its antitumor activity and DNA binding property.

Full text of DOI:10.1007/s10895-014-1380-5

J Fluoresc (2014) 24:959–966
DOI 10.1007/s10895-014-1380-5
ORIGINAL PAPER
DNA Binding Property and Antitumor Evaluation of Xanthone
with Dimethylamine Side Chain
Rui Shen & Weihua Wang & Gengliang Yang
Received: 6 January 2014 /Accepted: 19 March 2014 /Published online: 6 April 2014
#
Springer Science+Business Media New York 2014
Abstract In this work, a xanthone derivative was obtained by
cationic modification of the free hydroxyl group of xanthone
with dimethylamine group of high pKa value. The interactions
of xanthones with DNA were investigated by spectroscopic
methods, electrophoretic migration assay and polymerase
chain reaction test. Results indicate that xanthones can inter-
calate into the DNA base pairs by the hydrophobic plane and
the xanthone with dimethylamine side chain may also bind the
DNA phosphate framework by the basic amine alkyl chain,
thus showing a better DNA binding ability than the xanthone.
Furthermore, inhibition on tumor cells (ECA109, SGC7901,
GLC-82) proliferation of xanthones were evaluated by MTT
method. Analysis results show that the xanthone with
dimethylamine side chain exhibits more effective inhibition
activity against three cancer cells than the xanthone. The
effects on the inhibition of tumor cells in vitro agree with the
studies of DNA binding. It means that the amine alkyl chain
would play an important role in its antitumor activity and
DNA binding property.
on a molecular level becomes important for regulation of gene
expression and study of drugs action in vivo. A better under-
standing of how to target DNA sites specifically will lead not
only to novel chemotherapeutics but also to a greatly expand-
ed ability for chemists to probe DNA and develop highly
sensitive diagnostic agents [1–3]. The various compounds
are being used at the forefront of many of these efforts. These
compounds can non-covalently bind with DNA by intercala-
tion for planar aromatic ring systems, groove binding for large
or flexible molecules, and external electrostatic binding for
cations. The decision about which mode to bind depends
much on the sizes and configuration of the molecules [4–6].
So the stable, inert and water-soluble molecules containing
spectroscopically active centers may be widely exploited for
serving as probes of biological systems and showing excellent
biological activities.
The numerous biological experiments have demonstrated
that DNA is the primary intracellular target of anticancer drugs
due to the interaction between small molecules and DNA.
This interaction can cause DNA damage in cancer cells,
inhibiting the division of cancer cells and resulting in cell
death [7–10]. Therefore, the study of interactions between
anticancer reagents and DNA are also very important to
understand the mechanisms of their anticancer activities
.
.
Keywords Xanthone DNA binding mode Antitumor
evaluation
[11–15]. All the investigations are the basis of new and more
Introduction
efficient anticancer drugs design. We have been focusing on
studying the DNA binding property of xanthones. Xanthons
are symmetrical three-membered ring compounds with eight
substitution positions which could bring a variety of interest-
ing structures with diverse pharmacology activities [16–18].
The previous results indicate that the xanthones could
intercalate into the base pairs of DNA, lead to DNA
damage, and inhibit cell proliferation finally. Furthermore,
the different alkyl substitute groups in xanthones would
affect the DNA binding affinity and the biological activity
significantly [19, 20].
The targeting selectivity between small molecules and biolog-
ical macromolecules may be attributed to the molecule recog-
nition. Particularly, recognition of small molecules with DNA
:
:
R. Shen (*) W. Wang G. Yang
College of Pharmaceutical Sciences, Key Laboratory of
Pharmaceutical Quality Control of Hebei Province, Hebei University,
Baoding 071002, People’s Republic of China
e-mail: shenr05@126.com

9
60
J Fluoresc (2014) 24:959–966
Based on the above results, a xanthone with dimethylamine
(5 mM Tris, 50 mM NaCl and adjusted to pH 7.4 with HCl).
The solution of ct DNA purity (A260: A280>1.80) and con-
side chain was synthesized by incorporating cationic group
with relatively high pKa value to improve the hydrophilicity
of the hydrophobic xanthone scaffold and tune the affinity or
mode of xanthone to DNA. Subsequently, we have investi-
gated the DNA binding property of xanthones and their effects
on the growth of three human cancer cell lines, ECA109
−1
−1
centration (ε=6,600 M cm at 260 nm) was checked by
UV–Vis spectrometer [22, 23]. The electrophoretic migration
assay of plasmid DNA was carried out in Tris–HCl buffer
(pH 7.4). PCR amplification was carried out in Themopol
buffer (20 mM Tris–HCl, 10 mM KCl, 10 mM (NH ) SO ,
4
2
4
(
8
esophagus cancer), SGC7901 (stomach cancer) and GLC-
2 (lung cancer) in vitro. The primary aims of these experi-
2 mM MgSO , 0.1 % Triton X-100, pH 8.8). Xanthones were
4
first dissolved in a minimum amount of DMSO (0.5 % of the
final volume) and then diluted with the corresponding buffer
to the required concentrations.
ments are to gain some insight into the effect of structural
factor in amine group substituted xanthone with DNA binding
and offer an impetus for designing newer DNA directed
therapeutic agents.
Preparation of Xanthones 1–2
Experimental
The synthetic route of xanthone (1) and its dimethylamine side
chain substituent (2) is shown in Fig. 1. Compound 1 was
synthesized from the condensation of γ-resorcylic acid with
resorcinol in the presence of anhydrous zinc chloride and
phosphorus oxychloride as a condensing agent. Aminelation
of 1 with amine alkyl halides in acetone afforded 2 in good
yields. All the crude products were purified by chromatogra-
phy on a silicagel column and recrystallized to afford 1–2 as
yellow solids.
Materials
Xanthones were prepared according to the literatures with
some improvements [18, 21]. Calf thymus DNA (ct DNA)
and ethidium bromide (EB) were purchased from Sigma-
Aldrich Co. LLC. The pUC18 plasmid DNA was purchased
from Takara Biotechnology (Dalian) Co. Ltd. The primes
were purchased from Sangon Biotech (Shanghai) Co. Ltd.
The Taq DNA polymerase was purchased from New England
Biolabs (Beijing) Ltd. Other chemicals were reagent grade
without further purification.
1, 6-dihydroxy-9H-xanthen-9-one (1) Yield 36.5 %, ESI-MS:
+
1
m/z 229.1[M+H] , H NMR (600 MHz, DMSO-d6): δ 12.86
(s, 1 H), 11.22 (s, 1 H), 8.06-8.03 (d, 1 H), 7.71-7.65 (t, 1 H),
7.04-7.02 (d, 1 H), 6.97-6.94 (t, 1 H), 6.93-6.88 (t, 1 H), 6.80-
Measurements
6.78 (d, 1 H) ppm.
Electrospray ionization mass spectra (ESI-MS) were per-
formed on a Bruker apex ultra 7.0 T Fourier transform mass
spectrometer and H NMR spectra were recorded by using a
6-(2-(dimethylamino)ethoxy)-1-hydroxy-9H-xanthen-9-one
+
1
(2) Yield 85.6 %, ESI-MS: m/z 300.1 [M+H] , H NMR
(600 MHz, CDCl ): δ 12.79 (s, 1 H), 8.16–8.18 (d, 1 H),
1
3
Bruker AVANCE III 600 spectrometer. The UV–Vis absorp-
tion spectra were recorded by using a Varian Cary 100 spec-
trophotometer, the fluorescence emission spectra were record-
ed by using a Hitachi F-4600 spectrofluorimeter, and the
circular dichroic (CD) spectra were recorded by using a Bio-
Logic MOS-450 spectrometer, respectively. The polymerase
chain reaction (PCR) was performed on a PE 9700 thermal
cycler. The electrophoresis bands of DNA were imaged by
using a Tanon-1600 gel imager under UV light. The absor-
bance of MTT assay was recorded on a Bio-Tek Microplate
Reader.
7.54–7.57 (t, 1 H), 6.98–6.99 (dd, 1 H), 6.88–6.90 (m, 2 H),
6.78–6.79 (d, 1 H), 4.20–4.22 (t, 2 H), 2.84 (s, 2 H), 2.40 (s,
6 H) ppm.
DNA Interactions
Absorption and fluorescence titration experiments were per-
formed by fixing the xanthones concentration as constant at 5
and 10 μM, respectively, while varying the concentration of ct
DNA. The competitive binding experiment was carried out by
maintaining the EB and ct DNA concentration at 2 and
30 μM, respectively, while increasing the concentration of
xanthones. Fitting was completed by using an Origin 7.5
The measurements involving in the interaction of xan-
thones with ct DNA were carried out in Tris–HCl buffer
Fig. 1 Synthetic route for
xanthones 1–2

J Fluoresc (2014) 24:959–966
961
spreadsheet, where values of the binding constants K and
In Vitro Antitumor Potency
b
quenching constant K were calculated.
q
The CD spectra of DNA were scanned in the range of
00–400 nm by increasing compound/DNA ratio (r=0,
The cells were plated in 96-well culture plates at density of
50,000 cells per well and incubated for 24 h at 37 °C in
2
1
/3) at 25.0 °C. The optical chamber of the CD spectrom-
a water-atmosphere (5 % CO ). The xanthones were
2
eter was deoxygenated with dry nitrogen before use and
kept in a nitrogen atmosphere during experiments. Scans
were accumulated and automatically averaged. The spectra
represented the average of three scans without the buffer
background.
dissolved in DMSO and diluted with culture medium
(DMSO final concentration <0.5 %) to the required con-
centrations prior to use. After addition, the different
concentration of xanthones (10 μL/well) were incubated
with the cells for 68 h, 10 μL of aqueous MTT solution
(5 mg/mL) was added to each well, and the cells were
incubated continually for another 4 h. The medium was
removed and DMSO (100 μL/well) was added. Subsequently,
absorbance was recorded at 570 nm. All experiments were
performed in triplicate and each experiment was repeated at
least three times.
In the electrophoretic migration assays, xanthones and
0.25 μg pUC18 plasmid DNA were mixed and brought to
25 μL by Tris–HCl buffer. All samples were incubated at
25 °C in the dark for 4 h. Then the DNA migration rate was
detected by 1.0 % agarose gel electrophoresis in TBE (Tris-
borate-EDTA) buffer (pH 8.0). The tests were repeated
triplicate.
PCR amplifications were performed in a 25 μL reaction
mixture containing 0.1 μg plasmid pEGFP-N1 DNA, 0.4 μM
of each primer (5′TCAGGTTCAGGGGGAGGTGTG3′
Results and Discussion
(
(
forward) and 5′AAGGCTACGTCCAGGAGCGCA3′
reverse)), 0.2 mM of each dNTP (deoxy-ribonucleoside
Electronic Absorption Spectra
triphosphate), 2.5 μL of 10×Themopol buffer and 1.5 U
DNA Taq polymerase. The parameters were as follows: after
heating at 95 °C for 5 min, 30 cycles were carried out includ-
ing 50 s at 94 °C, 50 s at 55 °C, and 30 s at 72 °C. A final 5 min
elongation was performed at 72 °C. The final product was
analyzed on 1.5 % agarose gel electrophoresis in TBE buffer.
In the experimental group, xanthones and forward primer or
reverse primer were premixed, incubated at 4 °C for 6 h, and
then used for the PCR to study the effect on single stranded
DNA. In the control group, xanthones were added into the
reaction mixtures directly for the PCR to detect the effect on
Taq DNA polymerase. The experiments were repeated
triplicate.
The electronic absorption spectroscopy is one of the most
useful techniques for DNA-binding studies of small mole-
cules. As shown in Fig. 2, in the absence of DNA, the UV–
Vis spectra of 1 has a strong π-π* transitions band at λmax
=
230 nm, a weak π–π* transitions band at λmax=302 nm and a
medium n-π* transitions band at λmax=358 nm, while 2 has a
strong π–π* transitions band at λmax=230 nm, a medium
π–π* transition at λmax=302 nm and a weak n–π* transitions
band at λmax=358 nm. With increasing DNA concentration,
the absorption bands of the two compounds exhibit visible
hypochromism as well as slight bathochromism. These varia-
tions are indicative of the intercalation mode between the
Fig. 2 UV–Vis absorption spectra of 1 (a) and 2 (b) upon addition of ct DNA. Cxanthones=5 μM, CDNA=0, 1, 2, 3, 4, 5, 6 μM. The arrow indicates the
absorbance decreases upon increasing DNA concentration. The inset is plot of [DNA]/(ε –ε ) versus CDNA for the titration of DNA to xanthoes
b
f

9
62
J Fluoresc (2014) 24:959–966
compounds and ct DNA, involving a strong π-stacking inter-
action between the compounds and DNA base pairs [24, 25].
form a polyanion. And the amine moiety with high pKa values
is more likely to be protonated and develop a cationic charge,
which is quenched by the high negative charge of DNA easily.
From the fluorescence change (Fig. 3a–b, inset), 1 follows
nearly linear variation and 2 follows a downward sloping
curve. These indicate only one binding process in 1 to DNA,
and more than one binding process in 2 to DNA. It may be
concluded that 1 binds to DNA solely by intercalation mode
and 2 binds to DNA not only by intercalation mode but also
would be attracted to the electronegative phosphate frame-
work, forming a surface bonding mode.
From the absorption data, the binding constant K is deter-
b
mined by using the Eq. (1),
.
.
.
½
DNAŠ ðε −ε Þ ¼ ½DNAŠ ðε −ε Þ þ 1 K ðε −ε Þ; ð1Þ
a
f
b
f
b
b
f
where [DNA] is the concentration of ct DNA in base pairs, εa,
ε , and ε are the apparent extinction coefficient correspond to
f
b
Aobsd/[M], the extinction coefficient for the free compound
and the extinction coefficient for the compound in the fully
bound form, respectively [26]. In plots of [DNA]/(ε –ε )
a
f
Competitive Binding Experiment
versus [DNA], K is given by the ratio of slope to the
b
intercept (Fig. 2a–b, inset). The binding constant K for 1
As further proof, the DNA-EB adduct fluorescence quenching
method can be used to determine the binding mode and
affinity of the compound to DNA [28]. Figure 4 shows the
emission spectra of DNA-EB system upon the increasing
amounts of xanthones. The emission intensity of DNA-EB
system at 605 nm decreases upon increasing the concentration
of xanthones, which due to the translocation of EB from a
hydrophobic environment to an aqueous environment [29]. It
indicates that xanthones could displace EB from the DNA-EB
system. Such a characteristic change is often observed in
intercalative DNA interactions [30].
b
4
−1
and 2 are (1.58±0.12)×10
M
and (3.26±0.19)×
4
−1
1
0 M , respectively. This means that 2 exhibits stronger
binding affinity towards DNA.
Fluorescence Spectra
Concomitant with the hypochromism in the absorption spectra
of xanthones upon addition of ct DNA, an obvious fluorescent
emission enhancement of 1 at 450 nm occurs (Fig. 3a.). The
result suggests that 1 can be protected efficiently from colli-
sion of water molecules by the hydrophobic environment
inside the DNA helix. It indicates that 1 can insert between
DNA base pairs deeply, which is similar to other intercalators
and is consistent with the above absorption spectra results
According to the classical Stern-Volmer Eq. (2),
.
F0 F ¼ 1 þ Kq½QŠ;
ð2Þ
[
27]. However, the fluorescence intensity of 2 decreases
steadily upon increasing ct DNA concentration at 450 nm
Fig. 3b.). This phenomenon may be attributed to the
where F and F represent the emission intensity in the absence
0
and presence of quencher, respectively, K is a linear Stem-
q
(
Volmer quenching constant and [Q] is the quencher concen-
tration [31]. In the plots of F /F versus [Q], K is the slope.
quenching by the high negative charge of DNA. Because the
phosphate groups of DNA with a negatively charged may
0
q
The quenching plots illustrate that the quenching of EB-DNA
Fig. 3 Fluorescence emission spectra of 1 (a) and 2 (b) upon addition of
ct DNA. (λex=320 nm, λem=350–600 nm) Cxanthones=10 μM, CDNA=0,
changes upon increasing DNA concentration. The inset is plot of F/F
versus [DNA]/[compound]
0
2
.5, 5, 7.5, 10, 12.5, 15 μM. The arrow indicates the fluorescence

J Fluoresc (2014) 24:959–966
963
Fig. 4 Fluorescence emission spectra of DNA-EB in the absence and
12.5, 15, 17.5, 20, 22.5, 25 μM. The arrow indicates the fluorescence
decreases upon increasing DNA concentration. The inset is Stern-Volmer
quenching plots
presence of increasing amounts of 1 (a) and 2 (b). (λex=500 nm, λem
=
5
20–720 nm) CEB =2 μM, CDNA=30 μM, Cxanthones=0, 2.5, 5, 7.5, 10,
adduct by 1 is in good agreement with the linear Stern-Volmer
stacking band [34]. The large decrease in the DNA helicity
band indicates that DNA is unwound upon interaction with the
compounds and then transformed into other conformations.
Furthermore, 2 shows more evident influence than 1 on the
conformation of DNA.
equation (Fig. 8a, inset). And the K value for 1 is 0.67×
q
4
−1
1
0 M , which shows only one quenching process, indicating
that 1 intercalates into DNA. However, there are two
quenching processes in the DNA-EB adduct competitive
binding with 2 (Fig. 8b, inset), the K value is 1.53×
q
4
−1
4
−1
1
0 M and 0.85×10 M , respectively. These indicate 2
Agarose Gel Electrophoresis Assay
can intercalate into the DNA base pairs by the xanthone plane
and bind the DNA phosphate groups by the basic amine alkyl
chain. The results are consistent with the above spectroscopic
analysis.
The binding modes of xanthones to pUC18 plasmid DNA are
further examined by agarose gel electrophoresis assay. As
shown in Fig. 6, the migration rate of DNA decreases obvi-
ously in the Form I (supercoiled form) and the Form II
(relaxed form) with increasing concentrations of 1–2 from
Circular Dichroic Spectra
25 to 50 μM. This phenomenon is similar to that of EB [35].
CD spectra techniques give us useful information on how the
DNA conformation is influenced by the binding of small
molecules. The CD spectrum of free ct DNA consists of a
positive band at 277 nm due to base stacking and a negative
band at 246 nm due to the polynucleotide helicity, which is
characteristic of DNA in the right-handed B form [32]. The
changes in CD signals of DNA are observed on interaction
with small molecules may often be assigned to the corre-
sponding changes in DNA structure. Thus simple groove
binding and electrostatic interaction of small molecules shows
less or no perturbation on the base-stacking and helicity
bands, whereas intercalation enhances the intensities of both
the bands stabilizing the right-handed B conformation of
DNA as observed for the classical intercalator [33].
The migration rate of DNA shows a more obvious decrease in
The CD spectra of DNA are monitored in the presence of
xanthones. The changes are shown in Fig. 5. The large in-
crease in the DNA stacking band reveals the effect of strong
intercalation of the xanthones on base stacking. It is possible
that the extended aromatic rings reduce the helical twist angle
of the DNA base pairs and increase the intensity of the base
Fig. 5 CD spectra of ct DNA (60 μM) in the absence and presence of
xanthones 1–2 (20 μM)

9
64
J Fluoresc (2014) 24:959–966
Fig. 8 Inhibition on various human cancer cells proliferation activity of
xanthones 1–2
Fig. 6 The electrophoretic migration assays of pUC18 DNA incubated
with xanthones 1–2. B represents blank; the concentration of 1–2 is
indicated in the figure
In Vitro Antitumor Potency
To evaluate the potential antitumor activity of xanthones, three
human cancer cell lines (ECA109, SGC7901, GLC-82) are
incubated for 72 h with varying concentrations of them and
the cell viability is determined by the MTT assay in vitro. The
inhibitory effect is increased in response to xanthones 1–2 in a
dose-dependent manner as illustrated in Fig. 8. The two com-
pounds exhibit potent inhibition activity against three human
tumor cell lines. And 2 with the polar amine group has a better
hydrophilicity and penetration for cell membrane, therefore, it
exhibits more significant antitumor activity (Table 1). Com-
bining with the DNA-binding experiment, it may because the
compounds intercalate into the base group pairs of DNA,
which induce damage to DNA in the cancer cells,
inhibiting the division of cancer cells and resulting in cell
death [36]. In addition, amine moiety with high pKa value
is more likely to be protonated and develop a cationic charge,
therefore, binding with the phosphate groups of DNA and
blocking DNA replication.
The flexible chain with active group linked at rigid xan-
thone plane may tune the DNA binding mode and facilitate
the DNA selective binding, which imply that the suitable
substituents in xanthone derivatives might contribute to the
increase of their anticancer activity or to the decrease of their
toxicity. Because of the multiple structures and compositions
in various tumor cell lines, the complicated mechanisms about
the effect of the compounds on the tumor cells are currently
under the way.
the case of 2. This once again confirms a stronger intercalative
effect of 2 to DNA than 1. This result is very intuitive and
agrees with the above spectra results.
PCR Amplification
To study the influence of xanthones on DNA amplification,
the sequences of primer pairs are designated as 5′TCAGGT
TCAGGGGGAGGTGTG3′ (forward) and 5′AAGGCTAC
GTCCAGGAGCGCA3′ (reverse) in order to amplify the
defined fragment between site 950 and 1,491 of plasmid
pEGFP-N1 via PCR. The results are shown in Fig. 7. A band
of 542 bp is seen on agarose gel while xanthones is absent
within PCR system (lane b in Fig. 7). In the control group,
addition of xanthones (5 μM) does not prevented PCR, indi-
cates that they have no effect on Taq DNA polymerase (lane c,
f in Fig. 7). In the experimental group, the PCR product is
barely visible on agarose gel while forward primer or reverse
primer pre-incubated for 6 h at 4 °C with 2 (5 μM) (lane g, h in
Fig. 7). The similar result does not appear in the case of 1 (lane
d, e, in Fig. 7). Therefore, it is concluded from these data that 2
is able to bind single stranded DNA, thereby preventing DNA
amplification. This is a great proof of the spectroscopy
inference.
Table 1 The IC50 values of xanthones 1–2 against various human cancer
cells
Compound
IC50 (μM)
Fig. 7 The effect of xanthones on PCR. a: DNA ladder; b: PCR without
xanthones; c, f: PCR with 1 (5 μM) and 2 (5 μM), respectively; d, e: 1
ECA109
SGC7901
GLC-82
(
5 μM) pre-incubated for 6 h at 4 °C with forward primer and reverse
1
2
25.67
9.56
33.16
13.31
>50
primer, respectively; g, h: 2 (5 μM) pre-incubated for 6 h at 4 °C with
forward primer and reverse primer, respectively
16.05

J Fluoresc (2014) 24:959–966
965
DNA binding and cytotoxicity mechanisms. J Med Chem 56(5):
Conclusion
2
074–2086
9
. Kalaivani P, Prabhakaran R, Poornima P, Dallemer F, Vijayalakshmi
K, Vijaya Padma V, Natarajan K (2012) Versatile coordination be-
havior of salicylaldehydethiosemicarbazone in Ruthenium (II) car-
bonyl complexes: synthesis, spectral, X-ray, electrochemistry, DNA
binding, cytotoxicity, and cellular uptake studies. Organometallics
The DNA binding properties of xanthones have been investi-
gated by spectroscopic methods, electrophoretic migration
assay and polymerase chain reaction test. The results indicate
that xanthones can insert DNA depending on the good pla-
narity of aromatic ring and the xanthone with amine side chain
would bind the DNA phosphate groups, thereby showing a
better DNA binding ability than the xanthone. Comparing the
inhibitory effect in vitro, the xanthone with amine side chain
exhibits more significant antitumor activity, which accord
with the results of DNA binding study. And each compound
would show the cytotoxic activity varying according to the
various tumor cells. We conclude that the xanthones interca-
late into DNA and cause DNA damage in cancer cells, and the
xanthone with amine side chain is able to bind single stranded
DNA to prevent DNA amplification, thus inhibiting the pro-
liferation of cancer cells. Information obtained from the pres-
ent work provides evidence for DNA binding property of
xanthones and is expected to offer further impetus for devel-
oping novel DNA targeted therapeutic agents.
31(23):8323–8332
1
0. Busto N, Valladolid J, Martínez-Alonso M, Lozano HJ, Jalón FA,
Manzano BR, Rodríguez AM, Carrión MC, Biver T, Leal JM,
Espino G, García B (2013) Anticancer activity and DNA
binding of a bifunctional Ru (II) arene aqua-complex with
the 2, 4-diamino-6-(2-pyridyl)-1, 3, 5-triazine ligand. Inorg Chem
5
2(17):9962–9974
11. Martínez R, Chacón-García L (2005) The search of DNA-
intercalators as antitumoral drugs: what it worked and what did not
work. Curr Med Chem 12(2):127–151
2. Zwang TJ, Singh K, Johal MS, Selassie CR (2013) Elucidation of the
molecular interaction between cisplatin and flavonol (s) and their
effect on DNA binding. J Med Chem 56(4):1491–1498
1
1
3. Jarak I, Marjanovi M, Piantanida I, Kralj M, Karminski-Zamola G
(
2011) Novel pentamidine derivatives: synthesis, anti-tumor proper-
ties and polynucleotide-binding activities. Eur J Med Chem 46(7):
807–2815
2
14. Engelhard DM, Pievo R, Clever GH (2013) Reversible stabilization
of transition-metal-binding DNA G-quadruplexes. Angew Chem Int
Edit 52(49):12843–12847
1
5. Ramakrishnan S, Suresh E, Riyasdeen A, Akbarsha MA,
Acknowledgement We are grateful for the financial support of
the Natural Science Foundation of Heibei Province of China
2+
Palaniandavar M (2011) Interaction of rac-[M(diimine)
3
]
(M =
Co, Ni) complexes with ct DNA: role of 5,6-dmp ligand on DNA
binding and cleavage and cytotoxicity. Dalton Trans 40:3245–3256
6. Pouli N, Marakos P (2009) Fused xanthone derivatives as antiprolif-
erative agents. Anticancer Agents Med Chem 9(1):77–98
(
B2012201132) and the Scientific Research Foundation of Heibei
University (2010–204). We are also grateful for the kind help of
Professor Yali Song.
1
1
7. Park SE, Chang IH, Jun KY, Lee E, Lee ES, Na Y, Kwon Y (2013) 3-
(3-Butylamino-2-hydroxy-propoxy)-1-hydroxy-xanthen-9-one acts
as a topoisomerase IIα catalytic inhibitor with low DNA damage.
Eur J Med Chem 69(11):139–145
References
1
8. Zou HX, Koh JJ, Li JG, Qiu SX, Aung TT, Lin HF,
Lakshminarayanan R, Dai XP, Tang C, Lim FH, Zhou L,
Tan AL, Verm C, Tan DTH, Hardy Sze On Chan HSO,
Saraswathi P, Cao D, Liu SP, Beuerman RW (2013) Design
and synthesis of amphiphilic xanthone-based, membrane-
targeting antimicrobials with improved membrane selectivity.
J Med Chem 56(6):2359–2373
1
2
3
4
5
6
. Chen SX, Zhang DY, Seelig G (2013) Conditionally fluorescent
molecular probes for detecting single base changes in double-
stranded DNA. Nat Chem 5(9):782–789
. Gill MR, Thomas JA (2012) Ruthenium(II) polypyridyl complexes
and DNA-from structural probes to cellular imaging and therapeutics.
Chem Soc Rev 41(8):3179–3192
. Keenea FR, Smitha JA, Collins JG (2009) Metal complexes as
structure-selective binding agents for nucleic acids. Coord Chem
Rev 253(15–16):2021–2035
. Muzikar KA, Meier JL, Gubler DA, Raskatov JA, Dervan PB (2011)
Expanding the repertoire of natural product-inspired ring pairs for
molecular recognition of DNA. Org Lett 13(20):5612–5615
. Chenoweth DM, Meier JL, Dervan PB (2013) Pyrrole-imidazole
polyamides distinguish between double-helical DNA and RNA.
Angew Chem Int Edit 52(1):415–418
19. Wang HF, Shen R, Tang N (2009) Synthesis and characteriza-
tion of the Zn (II) and Cu (II) piperidinyl isoeuxanthone com-
plexes: DNA-binding and cytotoxic activity. Eur J Med Chem
44(11):4509–4515
20. Shen R, Wang P, Tang N (2010) Cytotoxic activity and DNA-binding
properties of xanthone derivatives. J Fluoresc 20(6):1287–1297
21. Liu Y, Zou L, Ma L, Chen WH, Wang B, Xu ZL (2006) Synthesis and
pharmacological activities of xanthone derivatives as α-glucosidase
inhibitors. Bioorg Med Chem 14(16):5683–5690
22. Kumar CV, Asuncion EH (1993) DNA binding studies and site
selective fluorescence sensitization of an anthryl probe. J Am Chem
Soc 115(19):8547–8553
23. Huang CZ, Li YF, Feng P (2001) A spectrophotometric study on the
interaction of neutral red with double-stranded DNA in large excess.
Talanta 55(2):321–328
24. Bloomfield VA, Crothers DM, Tinoco I Jr (1974) Phsical chemistry
of nucleic acids. Harper & Row, New York, pp 429–476
25. Kelly JM, Murphy MJ, McConnell DJ, OhUigin C (1985) A com-
parative study of the interaction of 5,10,15,20-tetrakis (N-
methylpyridinium-4-yl)porphyrin and its zinc complex with DNA
using fluorescence spectroscopy and topoisomerisation. Nucleic
Acids Res 13:167–184
. Morinaga H, Bando T, Takagaki T, Yamamoto M, Hashiya K,
Sugiyama H (2011) Cysteine cyclic pyrrole–imidazole polyamide
for sequence-specific recognition in the DNA minor groove. J Am
Chem Soc 133(46):18924–18930
7
. Banerjee S, Veale EB, Phelan CM, Murphy SA, Tocci GM, Gillespie
LJ, Frimannsson DO, Kelly JM, Gunnlaugsson T (2013) Recent
advances in the development of 1, 8-naphthalimide based DNA
targeting binders, anticancer and fluorescent cellular imaging agents.
Chem Soc Rev 42(3):1601–1618
8
. Chtchigrovsky M, Eloy L, Jullien H, Saker L, Ségal-Bendirdjian E,
Poupon J, Bombard S, Cresteil T, Retailleau P, Marinetti A (2013)
Antitumor trans-N-heterocyclic carbene–amine–Pt (II) complexes:
synthesis of dinuclear species and exploratory investigations of

9
2
66
J Fluoresc (2014) 24:959–966
6. Wolf A, Shimer GH Jr, Meehan T (1987) Polycyclic aromatic hy-
drocarbons physically intercalate into duplex regions of denatured
DNA. Biochemistry 26(20):6392–6396
32. Ivanov VI, Minchenkova LE, Schyolkina AK, Poletayev AI (1973)
Different conformations of double-stranded nucleic acid in solution
as revealed by circular dichroism. Biopolymers 12(1):89–110
2
7. Satyanarayana S, Dabrowiak JC, Chaires JB (1992) Neither Δ- nor
Λ-tris(phenanthroline) ruthenium(II) binds to DNA by classical in-
tercalation. Biochemistry 31(39):9319–9324
8. Lippard SJ (1978) Platinum complexes: probes of polynucleotide
structure and antitumor drugs. Acc Chem Res 11(5):211–217
9. Zeng YB, Yang N, Liu WS, Tang N (2003) Synthesis, characteriza-
tion and DNA-binding properties of La (III) complex of chrysin. J
Inorg Biochem 97(3):258–264
33. Lincoln P, Tuite E, Nordén B (1997) Short-circuiting the molecular
2
+
2
wire: cooperative binding of Δ-[Ru(phen) dppz] and Δ-
3+
[Rh(phi)2bipy] to DNA. J Am Chem Soc 119(6):1454–1455
34. Nordén B, Tjerneld F (1982) Structure of methylene blue-DNA
complexes studied by linear and circular dichroism spectroscopy.
Biopolymers 21(9):1713–1734
2
2
35. Baraldi PG, Bovero A, Fruttarolo F, Preti D, Tabrizi MA, Pavani MG,
Romagnoli R (2004) DNA minor groove binders as potential
antitumor and antimicrobial agents. Med Res Rev 24(4):475–
528
3
0. Kumar CV, Barton JK, Turro NJ (1985) Photophysics of ruthenium
complexes bound to double helical DNA. J Am Chem Soc 107(19):
5
518–5523
36. Zuber G, Quada JC Jr, Hecht SM (1998) Sequence selective cleavage
of a DNA octanucleotide by chlorinated bithiazoles and bleomycins.
J Am Chem Soc 120(36):9368–9369
3
1. Eftink MR, Ghiron CA (1981) Fluorescence quenching studies with
proteins. Anal Biochem 114(2):199–227