Characterization of 17β-hydroxysteroid dehydrogenase and regulators involved in estrogen degradation in Pseudomonas putida SJTE-1

Article abstract of DOI:10.1007/s00253-018-9543-y

In bacteria, the enzyme catalyzing the transformation of 17β-estradiol is considered the key enzyme for its metabolism, whose enzymatic activity and regulatory network influence the biodegradation efficiency of this typical estrogen. In this work, a novel 17β-hydroxysteroid dehydrogenase (17β-HSD) was characterized from the estrogen-degrading strain Pseudomonas putida SJTE-1, and two regulators were identified. This 17β-HSD, a member of the short-chain dehydrogenase/reductase (SDR) superfamily, could be induced by 17β-estradiol and catalyzed the oxidization reaction at the C₁₇ site of 17β-estradiol efficiently. Its K_m value was 0.068?mM, and its V_max value was 56.26?μmol/min/mg; over 98% of 17β-estradiol was oxidized into estrone in 5?min, indicating higher efficiency than other reported bacterial 17β-HSDs. Furthermore, two genes (crgA and oxyR) adjacent to 17β-hsd were studied which encoded the potential CrgA and OxyR regulators. Overexpression of crgA could enhance the transcription of 17β-hsd, while that of oxyR resulted in the opposite effect. They could bind to the specific and different sites in the promoter region of 17β-hsd gene directly, and binding of OxyR could be released by 17β-estradiol. OxyR repressed the expression of 17β-hsd by its specific binding to the conserved motif of GATA-N₉-TATC, while CrgA activated the expression of this gene through its binding to the motif of T-N₁₁-A. Therefore, this 17β-HSD transformed 17β-estradiol efficiently and the two regulators regulated its expression directly. This work could promote the study of the enzymatic mechanism and regulatory network of the estrogen biodegradation pathway in bacteria.

Full text of DOI:10.1007/s00253-018-9543-y

Applied Microbiology and Biotechnology
https://doi.org/10.1007/s00253-018-9543-y
ENVIRONMENTAL BIOTECHNOLOGY
Characterization of 17β-hydroxysteroid dehydrogenase and regulators
involved in estrogen degradation in Pseudomonas putida SJTE-1
Pingping Wang1 & Daning Zheng1 & Wanli Peng1 & Yanqiu Wang1 & Xiuli Wang1 & Weiliang Xiong1 & Rubing Liang1
Received: 9 June 2018 /Revised: 16 November 2018 /Accepted: 25 November 2018
#
Springer-Verlag GmbH Germany, part of Springer Nature 2019
Abstract
In bacteria, the enzyme catalyzing the transformation of 17β-estradiol is considered the key enzyme for its metabolism, whose
enzymatic activity and regulatory network influence the biodegradation efficiency of this typical estrogen. In this work, a novel
17β-hydroxysteroid dehydrogenase (17β-HSD) was characterized from the estrogen-degrading strain Pseudomonas putida
SJTE-1, and two regulators were identified. This 17β-HSD, a member of the short-chain dehydrogenase/reductase (SDR)
superfamily, could be induced by 17β-estradiol and catalyzed the oxidization reaction at the C17 site of 17β-estradiol efficiently.
Its Km value was 0.068 mM, and its Vmax value was 56.26 μmol/min/mg; over 98% of 17β-estradiol was oxidized into estrone in
5 min, indicating higher efficiency than other reported bacterial 17β-HSDs. Furthermore, two genes (crgA and oxyR) adjacent to
17β-hsd were studied which encoded the potential CrgA and OxyR regulators. Overexpression of crgA could enhance the
transcription of 17β-hsd, while that of oxyR resulted in the opposite effect. They could bind to the specific and different sites
in the promoter region of 17β-hsd gene directly, and binding of OxyR could be released by 17β-estradiol. OxyR repressed the
expression of 17β-hsd by its specific binding to the conserved motif of GATA-N9-TATC, while CrgA activated the expression of
this gene through its binding to the motif of T-N11-A. Therefore, this 17β-HSD transformed 17β-estradiol efficiently and the two
regulators regulated its expression directly. This work could promote the study of the enzymatic mechanism and regulatory
network of the estrogen biodegradation pathway in bacteria.
.
.
.
.
.
Keywords 17β-hydroxysteroid dehydrogenase 17β-estradiol Estrone OxyR CrgA Biodegradation
Introduction
secondary pollution (Yu et al. 2013; Khanal et al. 2006;
Combalbert and Hernandez-Raquet 2010). Microorganisms
can utilize estrogenic chemicals as their carbon or energy
sources and transform them into non-estrogenic chemicals
(Yu et al. 2013). Strains of bacteria, fungi, and algae with
estrogen degradation capabilities have been found, such as
Sphingomonas spp., Rhodococcus zopfii, Rhodococcus equi,
Nitrosomonas europaea, and Pseudomonas spp. (Hom-Diaz
et al. 2015; Jianghong et al. 2004; Liang et al. 2012; Yang
et al. 2017; Takeshi et al. 2004; Tamagawa et al. 2006; Yu
et al. 2007). Their degradation efficiencies, degradation pe-
riods, and substrate spectrums are varied. For example,
Rhodococcus sp. and Sphingomonas sp. could degrade 50%
of E2 (0.8 mg) in 24 h and 90% of E2 in 120 h (Futoshi et al.
2010). N. europaea can degrade E1 and E2 efficiently but
cannot utilize the synthetic estrogen 17α-ethynylestradiol
(EE2) (Jianghong et al. 2004); while Sphingobacterium sp.
can degrade typical natural estrogens and the synthetic estro-
gen EE2 (Haiyan et al. 2007).
Environmental estrogens (EEs) are important contaminants
that can cause significant hormone disruptions in plants, ani-
mals, and humans (Katori et al. 2002; Yin et al. 2002). Typical
natural estrogens contain 17β-estradiol (E2), estrone (E1), and
estriol (E3), with 17β-estradiol having the highest estrogenic
activity (Luine 2014). Biodegradation using microorganisms
is considered a promising strategy to decompose environmen-
tal estrogens, owing to its high efficiency, low cost, and lack of
Electronic supplementary material The online version of this article
(https://doi.org/10.1007/s00253-018-9543-y) contains supplementary
material, which is available to authorized users.
* Rubing Liang
icelike@sjtu.edu.cn
1
State Key Laboratory of Microbial Metabolism, and School of Life
Sciences and Biotechnology, Shanghai Jiao Tong University,
Shanghai 200240, China

Appl Microbiol Biotechnol
Although several estrogen-degrading strains have been iso-
lated, the mechanisms underlying the degradation of estrogen-
ic chemicals remain unclear. In most bacteria, the transforma-
tion from 17β-estradiol to estrone is considered the first step
in its metabolism. Therefore, the enzyme catalyzing this step
is the key enzyme in this pathway. In humans, hydroxysteroid
dehydrogenases (HSDs), belonging to the short-chain dehy-
drogenase (SDR) family, have been demonstrated to be re-
sponsible for the mutual transformation of active to inactive
forms of estrogens by the NAD(P)H-linked oxidization-
reduction at the 17-position of steroid molecules (Chang
et al. 2010). In bacteria, HSDs also widely exist and were
found to participate in the oxidation/reduction process of ste-
roids. For example, 3α-hydroxysteroid dehydrogenase/
carbonyl reductase (3α-HSD) catalyzed the oxidoreduction
at the 3-position of testosterone in Comamonas testosteroni
(Maser et al. 2001). 17β-hydroxysteroid dehydrogenase
(17β-HSD) was also found to oxidize the 17β-hydroxyl ste-
roids such as 17β-estradiol (Yuanhua et al. 2015; Ye et al.
2017). In addition, several regulators, including Rep1/Rep2,
HsdR, PhaR, TetR, LuxR, and BRP protein, were found to
regulate the expression of 3α-hsd or 3,17β-hsd in C.
testosteroni and are involved in the degradation of testoster-
one (Gong et al. 2012a, b; Ji et al. 2017; Li et al. 2013; Pan
et al. 2015; Wu et al. 2015). However, because of the unclear
genetic backgrounds and various metabolism networks in dif-
ferent estrogen-degrading bacteria, only a few enzymes cata-
lyzing the metabolism of 17β-estradiol were identified; their
characteristics and their regulators were still unclear.
bioremediation (Matsumura et al. 2009; Zeng et al. 2009).
Previously, we have isolated P. putida SJTE-1 (CGMCC
NO. 6585) from sludge and confirmed that it could utilize
17β-estradiol as a sole carbon source and could transform it
into non-estrogenic chemicals efficiently. 17β-estradiol of
1 mg/L or 10 mg/L could be degraded completely in 24 h or
48 h, respectively; it was first converted into estrone, and the
accumulated estrone was then degraded into non-estrogenic
chemicals. The whole genome sequence of this strain has been
obtained, and its comparative proteomics in different culture
environments have also been analyzed (Liang et al. 2012; Xu
et al. 2017). Significant changes were observed in the expres-
sion of proteins involved in carbon catabolism, transportation,
and transcription regulation when exposed to 17β-estradiol
(Xu et al. 2017). Therefore, characterization of the key en-
zyme for 17β-estradiol transformation and identification of
the related regulator could elucidate the estrogen degradation
pathway. In this work, the key 17β-HSD responsible for the
metabolism of 17β-estradiol in P. putida SJTE-1 was charac-
terized, and two novel transcriptional regulators (OxyR and
CrgA) were identified to be involved in this pathway.
Materials and methods
Strains, chemicals, and cultures
All strains and plasmids used in this study are listed in Table 1.
P. putida SJTE-1 (CGMCC No. 6585) was cultured at 30 °C.
Luria-Bertani (LB) medium (tryptone, 10.0 g; yeast extract,
5.0 g; NaCl, 10 g/L) and minimal medium (MM) (K2HPO4,
3.815 g; KH2PO4, 0.5 g; (NH4)2HPO4, 0.825 g; KNO3,
1.2625 g; Na2SO4, 0.2 g; CaCl2, 0.02 g; FeCl3, 0.002 g; and
Pseudomonas spp. strains are known for their remarkable
tolerance to environmental stresses and efficient degradation
capability, and a number of Pseudomonas strains have been
utilized in wastewater treatment and environmental
Table 1 Strains and plasmids used in this study
Name
Description
Source/reference
Strains
P. putida SJTE-1
E. coli DH5α
Strain with the estrogen-degradation capability, wild type (CGMCC NO. 6585)
(Liang et al. 2012)
Invitrogen
F′/endA1 hsdR17 (rK-mK-) glnV44 thi-1 recA1 gyrA (NalR) relA1 Δ (lacIZYA-argF)U169
deoR (Φ80dlacΔ (lacZ)M15)
E. coli BL21 (DE3)
Plasmids
Protein allogeneic expression strains
Novagen
pET28a
E. coli expression plasmid, Kmr
Novagen
pET28a-hsd
Plasmid pET28a inserted with hsd gene at EcoR I/Nde I sites, Kmr
Plasmid pET28a inserted with oxyR gene at EcoR I/Nde I sites, Kmr
Plasmid pET28a inserted with crgA gene at Bam HI/Nde I sites, Kmr
oriT+gene replacement vector derived from pBR322, Apr, Gmr
egfp gene inserted into plasmid pBSPPc-Gm without promoter, Apr, Gmr
egfp gene inserted into plasmid pBSPPc-Gm with promoter of 17β-hsd gene, Apr, Gmr
crgA gene inserted into plasmid pBSPPc-Gm with promoter of lac gene, Apr, Gmr
oxyR gene inserted into plasmid pBSPPc-Gm with promoter of lac gene, Apr, Gmr
This study
This study
This study
(Xu et al. 2013)
This study
This study
This study
This study
pET28a-oxyR
pET28a-crgA
pBSPPc-Gm
pBSPPc-Gm-eGFP
pBSPPc-Phsd-eGFP
pBSPPc-crgA
pBSPPc-oxyR

Appl Microbiol Biotechnol
MgCl2, 0.02 g/L) were used. 17β-estradiol, estrone, estriol,
and testosterone (of HPLC grade, > 99%) were obtained from
Sigma-Aldrich (St. Louis, MO, USA). All other reagents were
of analytical reagent grade. As DMSO could not be utilized by
P. putida SJTE-1, all the estrogenic chemicals were dissolved
in DMSO (Fig. S1). All steroid chemicals were dissolved in
dimethyl sulfoxide (DMSO) to form 10 mg/mL solutions, and
the final concentration in solution ranged from 10 to 20 mg/L.
genome DNA was obtained using the QIAamp DNA minikit
(Qiagen, Shanghai, China). Other general techniques for re-
striction enzyme manipulation, molecular cloning, and aga-
rose gel electrophoresis were carried out with standard proto-
cols. All the constructs were confirmed by DNA sequencing
(Invitrogen, Shanghai, China).
Multiple sequence alignment
Multiple sequence alignment of 17β-HSD/OxyR/CrgA pro-
teins from P. putida SJTE-1 and other organisms was per-
formed with ClustalW software. The phylogenetic tree was
constructed by MEGA 6.0 on the basis of amino acid se-
quences using the neighbor-joining method. The DNA se-
quence conservation analysis was performed with the
Weblogo online software (http://weblogo.berkeley.edu/).
Standard DNA manipulation
Oligonucleotides, used for PCR amplification, reverse tran-
scription (RT), quantitative PCR (q-PCR), homologous re-
combination, plasmid construction, and electrophoretic mo-
bility shift assay (EMSA), were synthesized at Invitrogen
Ltd. (Shanghai, China) and listed in Table 2. Restriction en-
zymes and DNA-modifying enzymes were purchased from
TaKaRa Biocompany (Dalian, China). The PCR protocol
used was first denaturation at 95 °C for 5 min, then denatur-
ation at 95 °C for 1 min, annealing at 55 °C for 1 min, and
elongation at 72 °C for 1.5 min. This process was repeated 30
times, and then elongation was performed at 72 °C for another
5 min. The plasmids were constructed by ligating the restric-
tion enzyme-treated PCR fragments and plasmid bones with
T4 DNA ligase, and chemical transformation was performed
with E. coli DH5α strain to obtain the target plasmids. The
PCR products were separated by agarose gel electrophoresis
and recovered with the QIAquick gel extraction kit (Qiagen,
Shanghai, China). Plasmid DNAs were isolated using the
QIAprep Mini-spin kit (Qiagen, Shanghai, China), and
Expression and purification of the recombinant
proteins
The recombinant 17β-HSD/OxyR/CrgA proteins were
expressed and purified as described previously (Lu et al.
2012). Briefly, plasmid pET28a-hsd/pET28a-oxyR/pET28a-
crgA was transformed into competent E. coli BL21 (DE3)
cells. A single colony was inoculated in 10 mL LB media
containing 50 μg/mL kanamycin and cultured overnight at
37 °C. The cultures were transferred into 1 L fresh LB con-
taining 50 μg/mL kanamycin and cultured at 37 °C until
OD600 = 0.5–0.6. Next, 0.5 mM isopropyl β-D-1-thiogalacto-
pyranoside (IPTG) was added into the culture and then
Table 2 Oligonucleotides used in this study
Primers
Sequences (5′-3′)
Usage
eGFP-F
eGFP-R
GGGGGGAAGCTTATGGTGAGCAAGGGCGAGGAG
GGGGGGGGATCCTTAGTACAGCTCGTCCATGCCGAGA
Primers used for egfp gene amplification
Primers used to amplify the promoter of hsd gene
Primers used for hsd gene amplification
Primers used for oxyR gene amplification
Primers used for crgA gene amplification
Primers used for plasmid detection
Hsd-P-F
Hsd-P-R
GGGGGGCTCGAGAATTAGCAACCAAAGGTTTACTCTG
GGGGAAGCTTGCTGTTCTCCTGCTGGAAG
Hsd-F
Hsd-R
GGGGGGCATATGTCCAAGCAACTTACACTCGAAGG
GGGGGGGAATTCTCAGGCTGCAAACCCACCAT
OxyR-F
OxyR-R
GGGGCATATGATGAACCTCAAGCAGCTCGAATAT
GGGGGAATTCCTAGCCTTTCTGTGCCCCCA
CrgA-F
CrgA-R
GGGGCATATGATGGCCATGGAATCATTCAGCG
GGGGGATCCCTAAAGGGCCTGCAGGGCAT
pBS-T-F
pBS-T-R
TCGACTAACCCAGATGCCG
AGGTAGCGAACCCGTCTC
Hsd-P-F2 (5′-FAM)
Hsd-P-R2
AATTAGCAACCAAAGGTTTACTCTG
GCTGTTCTCCTGCTGGAAG
Primers used to amplify the promoter region
of hsd gene for EMSA detection
Hsd-Q-F
Hsd-Q-R
GGCTGAAGAACTGGTTCGAG
CCAGGTCGAACTCTGTCACC
Primers for the q-PCR amplification of hsd gene
Primers for the q-PCR amplification of oxyR gene
Primers for the q-PCR amplification of crgA gene
OxyR-Q-F
OxyR-Q-R
CATGTTCGTCTGGTGGAGAA
TGTTCCATCACGTCCAGAAA
CrgA-Q-F
CrgA-Q-R
TAGTACCCGCAAGCTGACCT
CAACGGCAACACGTACAAAC

Appl Microbiol Biotechnol
induced for 3 h at 37 °C. Cells were harvested by centrifuga-
tion at 8000 rpm for 10 min at 4 °C and resuspended with
25 mL ice-cold lysis buffer (20 mM Tris-HCl, 300 mM NaCl,
5 mM imidazole, 5 mM β-mercaptoethanol (β-ME), 1 mM
phenylmethanesulfonyl fluoride (PMSF), 10% glycerol,
pH 7.9). The cell solution was sonicated on ice, and then the
supernatant was collected by centrifugation at 4 °C,
12,000 rpm for 30 min. The cell supernatants were loaded
for affinity chromatography of Ni-NTA resin (Bio-Rad, CA,
USA) at 4 °C and washed with 100 mL of washing buffer
(20 mM Tris-HCl, 300 mM NaCl, 5 mM β-ME, 10% glycer-
ol, 1 mM PMSF, and 50 mM imidazole, pH 7.9). Finally, the
recombinant protein was eluted from the column using 5 mL
of elution buffer (20 mM Tris-HCl, 300 mM NaCl, 5 mM β-
ME, 10% glycerol, 1 mM PMSF, 200 mM imidazole, pH 7.9).
All eluted solutions were analyzed by 15% SDS-PAGE
followed by staining with Coomassie Brilliant Blue R250
(Sigma, St. Louis, MO). The eluted recombinant proteins
were dialyzed and stored in the storage buffer (20 mM Tris-
HCl, 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 50% glycerol,
pH 8.0) or 1× PBS buffer (Na2HPO4, 1.42 g/L; KH2PO4,
0.27 g/L; KCl, 0.2 g/L; NaCl, 8.0 g/L; pH 7.4) at − 80 °C.
The concentration of proteins was determined using a BCA
protein assay kit (Takara, Dalian, China).
with standard errors. The quantity of steroids was calculated
from their respective peak areas by using a standard curve of
individual standards. The R2 values for the standard curves
were > 0.99. The presented data are the averages of five inde-
pendent measurements.
RT-qPCR
The transcription profiles of target genes in P. putida SJTE-1
cultured with different carbon sources were detected with RT-
qPCR. The strain was cultured in minimal medium with 0.2%
glucose or 10 mg/L 17β-estradiol to the mid-exponential
phase, and the total RNA was extracted using the total RNA
extraction reagents (Vazyme, Nanjing, China). The yield of
RNA was estimated using a Nanodrop UV spectrometer
(Thermo Scientific, DE, USA). Reverse transcription was
achieved with 1 μg RNA and 20 ng random primers using
the PrimeScript Reverse Transcriptase Kit (TaKaRa, Dalian,
China). Quantitative PCR was performed using the Premix Ex
Taq and gene-specific primers (Table 2) in the IQTM 5
Multicolor Real-time PCR Detection System (Bio-Rad, CA,
USA). The cycling conditions were 95 °C for 3 min, then
40 cycles of 95 °C for 10 s, 57 °C for 30 s, and 72 °C for
30 s. A final melting analysis was obtained by slow heating in
increments of 0.5 °C for 10 s from 57 to 95 °C. The threshold
cycle (Cq) value of each sample was determined during the
exponential phase of amplification, and the relative fold
change in mRNA quantity was calculated using the DDCt
method (Livak and Schmittgen 2001). Five independent ex-
periments were conducted for each RNA sample, and the av-
erage values with the standard errors were calculated.
Enzymatic assay of 17β-HSDs
The enzymatic activity of recombinant 17β-HSD protein was
measured by detecting the yield of NADH at 355 nm (excita-
tion)/460 nm (emission) as described previously (Pan et al.
2015). The reaction system contained 1 × reaction buffer
(20 mM Tris-HCl, 25 mM NaCl), 200 μM NAD+, and differ-
ent concentrations of 17β-HSD protein and 17β-estradiol. A
reaction mixture without 17β-HSD or 17β-estradiol was used
as a blank. The parameters of 17β-HSD (Km, Vmax, optimal
pH, and optimal temperature) were detected. Effect of differ-
ent metal ions (Mg2+, Mn2+, Cu2+, Ca2+, Zn2+, and Ni2+) on
the enzymatic activity was determined. All the experiments
were repeated five times, and the results were the average
values with standard errors.
Green fluorescent protein fluorescence assay
Gene egfp was cloned into vector pBSPPc-Gm to generate
plasmid pBSPPc-eGFP (Table 1). The promoter fragment of
17β-hsd was inserted into the upstream of egfp forming plas-
mid pBSPPc-Ph s d -eGFP (Table 1), which was
electrotransformed into the E. coli BL21(DE3) strain. The
recombinant strain was cultured in MM with 0.2% glucose
or 10 mg/L of 17β-estradiol. The cells were collected at dif-
ferent time points, and the green fluorescent protein (GFP)
fluorescence was measured at the fluorescence microplate
reader with excitation at 485 nm and emission at 527 nm.
Five independent experiments were performed, and the aver-
age values with the standard errors were calculated.
HPLC detection
The solutions of enzymatic reaction were extracted with ethyl
acetate, dried in the nitrogen blowing apparatus, dissolved
with acetonitrile, and detected with HPLC (high-performance
liquid chromatography, Agilent 1260 Infinity LC, USA). The
Agilent Eclipse Plus C18 column (3.5 μm, 4.6 × 150 mm,
Agilent, USA) and diode array detector (DAD) were used
with the mobile phase of acetonitrile and water (1:1, v/v) at a
flow rate of 1 mL/min at 30 °C, and the UV wavelengths were
280 nm (Ribeiro et al. 2010). Five independent experiments
were performed, and results were calculated as average values
Electrophoretic mobility shift assay
Electrophoretic mobility shift assay (EMSA) was performed
to detect the interaction of recombinant protein OxyR or CrgA
with DNA fragments. The upstream DNA regions of 17β-hsd
gene were selected and amplified using primers labeled with

Appl Microbiol Biotechnol
FAM at 5′-site (Table 2). The OxyR or CrgA protein
and the DNA fragments were mixed in different molec-
ular ratios and incubated in binding buffer (20 mM
Tris-HCl, 50 mM NaCl, 1 mM DTT, 0.1 mM EDTA,
pH 7.5) at 37 °C for 30 min. Then the mixture was analyzed
with 8% native polyacrylamide gel, and the gel was displayed
and photographed in the Bio-Rad Imaging System (Bio-Rad,
CA, USA).
This 17β-HSD was induced by 17β-estradiol
and efficiently transformed it into estrone
The transcription and expression levels of 17β-hsd, oxyR, and
crgA genes in P. putida SJTE-1 cultured with 17β-estradiol as
a sole carbon source were measured. Results showed that
when 17β-estradiol was used, the transcription of 17β-hsd
increased approximately 2.6-fold, while there were minimal
changes to the transcription levels of oxyR and crgA (Fig. 2a).
The expression of GFP protein under the promoter of 17β-hsd
gene was also observed with 2.4-fold enhancement after 3 h
by the induction of 17β-estradiol, and this enhancement was
sustained for several hours (Fig. 2b). These demonstrated that
this 17β-HSD in P. putida SJTE-1 could be induced by
strongly 17β-estradiol and may play a role in the metabolism
of this chemical.
Next, the enzymatic characteristics of the 17β-HSD were
studied. This 17β-hsd gene was cloned and expressed in E.
coli BL21 (DE3), and the purified 17β-HSD protein of 27.5
KD was obtained (Fig. 3a). The enzymatic assay showed that
this 17β-HSD protein used NAD+ rather than NADP+ as its
reaction cofactor. Detecting the fluorescence of NADH at
460 nm could quantify the oxidization efficiency of this en-
zyme. Only 17β-estradiol and testosterone could be oxidized
by this 17β-HSD protein in vitro when different estrogenic
substrates used, and the transformation of 17β-estradiol was
more efficient than that of testosterone, indicating a substrate
preference (Table 3). Enzymatic analysis showed that the op-
timal reaction temperature of this 17β-HSD was 37 °C, and
the optimal reaction pH was pH 9.0, similar to other HSDs
(Fig. 3b, c) (Mythen et al. 2018). Mg2+ could significantly
enhance the reaction efficiency while Ca2+ and Cu2+ repressed
the enzyme activity greatly (Fig. 3d). The Km value of the
17β-HSD was 0.068 mM, and its Vmax value was
52.26 μmol/min/mg (Table 4). Further, HPLC detection
showed that estrone was the product of the oxidation reaction
with 17β-estradiol as a substrate, and the transformation effi-
ciency was above 98% within 5 min (Fig. 4). In summary, this
17β-HSD was induced by 17β-estradiol and oxidized it into
estrone efficiently, confirming its involvement in the estrogen
metabolism of P. putida SJTE-1.
Detection of 17β-estradiol effect on protein-DNA
interaction
17β-estradiol was supplied to detect its effect on the binding
of OxyR or CrgA to the upstream region of the 17β-hsd gene.
The control used was 0.5% DMSO. The binding of OxyR or
CrgA to the upstream fragments of 17β-hsd gene was per-
formed as described above. Different concentrations of 17β-
estradiol were supplied and incubated for 15 min at 37 °C.
Then the mixture was analyzed using an 8% native polyacryl-
amide gel and displayed in the Bio-Rad Imaging System (Bio-
Rad, CA, USA).
Results
Sequence alignments showed that the predicted HSD
is a member of 17β-HSD
According to the genome analysis of P. putida SJTE-1,
one gene was predicted as a hsd gene, encoding an
HSD protein (ANI04816.1). Multiple sequence align-
ment showed that the amino acid sequence and the sec-
ondary structure of this protein were consistent with
those of the 17β-HSDs from Rhodococcus sp. P14, E.
coli MG1655, Homo sapiens, C. testosteroni ATCC
11966, Plasmodium falciparum, and Arabidopsis
thaliana (Fig. 1). All these proteins contain two con-
served sequence motifs identical to those of the SDR
family members: the N-terminal Gly-X-X-X-Gly-X-Gly
motif for cofactor binding and the Tyr-X-X-X-Lys motif
for proton acceptance. The secondary structure of this
HSD of P. putida SJTE-1 is also composed of βαβ
units such as a parallel β-sheet sandwiched between
two α-helixes, which exists in many SDR proteins
(Kavanagh et al. 2008). The conserved triad motif of
HSD, Ser-Tyr-Lys (residues 141, 155, 159), was also
observed in this HSD protein of P. putida SJTE-1.
The serine residue probably functions as the active site,
and the highly conserved tyrosine 155 may act as a
proton acceptor (Beck et al. 2017). Therefore, this
HSD is 17β-HSD, a member of SDR family, and its gene
was named 17β-hsd.
OxyR and CrgA could bind to the specific
and conserved sites in the promoter of 17β-hsd gene
and regulate the expression of 17β-HSD
Genome analysis of P. putida SJTE-1 showed that adjacent to
the 17β-hsd gene, there were two genes, oxyR and crgA,
encoding two potential regulators, OxyR (ANI04815.1) and
CrgA (ANI04817.1) (Fig. 5a). Multiple sequence alignment
showed the OxyR and CrgA proteins of P. putida SJTE-1 both
contained a typical helix-turn-helix (HTH) structure, includ-
ing six α-helixes at the N-terminal for sequence-specific DNA

Appl Microbiol Biotechnol
Fig. 1 Multiple sequence
alignment (MSA) of 17β-HSDs.
a The 17β-HSD from P. putida
SJTE-1 (WP_014754112.1),
Rhodococcus sp. P14 (WP_
010595922.1), E. coli MG1665
(WP_001499617.1), Homo sapi-
ens (XP_005263372.1), C.
testosteroni ATCC11966 (WP_
003080542.1), Plasmodium
falciparum (WP_009803484.1),
and Arabidopsis thaliana (NP_
564216.1) was aligned with
ClustalW. Conserved amino acids
were indicated in blue bars, iden-
tical amino acids were marked in
pink bars, and the similar amino
acids were showed in lighter blue
bars. The secondary structure of
seven α-helixes and seven β-
strands was shown in black rect-
angles and arrows. b The phylo-
genetic tree of this 17β-HSD and
other related enzymes was con-
structed by MEGA 6.0 on the ba-
sis of amino acid sequences using
neighbor-joining method. The bar
represents a genetic distance of
0.20
binding and several β-strands in the C-terminal for substrate
binding. The highly conserved motifs LXXXXA, FXRAA,
QXXL, and TXXG of HTH-type regulators used for specific
DNA binding were found in the two regulators (Fig. 5b, c).
Secondary structures showed similarities to those of other
OxyR regulators and CrgA regulators, respectively, which be-
long to the LysR family of regulators (Fig. 5b, c). Therefore,
the two proteins encoded by oxyR and crgA near 17β-hsd were
considered to be the OxyR regulator and the CrgA regulators,
respectively.
Since the transcription of OxyR and CrgA proteins could
be induced by 17β-estradiol, they may regulate the degrada-
tion of this chemical (Fig. 2a). RT-qPCR results showed that
overexpression of CrgA protein could enhance the transcrip-
tion of 17β-hsd approximately 2.1-fold, while overexpression
of OxyR protein could decrease the transcription of 17β-hsd
significantly (Fig. 5d, e). This indicates that the two regulators
may participate in the transformation of 17β-estradiol by reg-
ulating the transcription of 17β-hsd.
To determine whether the OxyR and CrgA proteins were
involved in the regulation of 17β-HSD directly, the two pro-
teins were obtained through heterogeneous expression and
affinity purification, and their molecular weights were 32.4
KD (CrgA) and 34.4 KD (OxyR) (Fig. 5f). EMSA results
showed that the two proteins could both bind to the 118 bp
upstream fragment of 17β-hsd at a low protein/DNA ratio
(Fig. 6a, b). OxyR protein bound to this DNA fragment at a
lower ratio than did CrgA protein, indicating the stronger
binding capability of OxyR from the promoter region of
17β-hsd (Fig. 6a, b). Interestingly, addition of 17β-estradiol

Appl Microbiol Biotechnol
to this DNA fragment could not be released by 17β-estradiol,
and, in fact, seemed to strengthen the binding (Fig. 6d). These
results demonstrated that the OxyR and CrgA regulator could
regulate the expression of 17β-hsd directly by binding to its
promoter region, and 17β-estradiol could influence their bind-
ing abilities.
To find whether the conserved sites for OxyR and
CrgA binding exist in the promoter of 17β-hsd gene, se-
quence alignment and conservation analysis of the up-
stream region of 17β-hsd gene were performed. Results
showed that there existed two conserved recognition and
binding regions of OxyR regulators, GATA-N9-TATC,
similar to that in the promoter region of pdh gene
(Fig. 7a) (Zhang et al. 2015). Two possible binding re-
gions of the CrgA regulator, T-N11-A, were also found in
the crgA-17β-hsd intergenic region (Fig. 7a) (Morelle
et al. 2003). In addition, several sites were found to be
conserved in the promoter of crgA-17β-hsd genes, likely
used as binding sites (Fig. 7b). In summary, the two OxyR
and CrgA regulators encoded by genes (oxyR and crgA)
could directly bind to the specific sites in the promoter
region of 17β-hsd gene and regulate the expression of
17β-HSD in different manners.
Fig. 2 The transcription and expression analysis of 17β-hsd gene. a The
transcription levels of 17β-hsd, oxyR, and crgA genes in P. putida SJTE-1
cultured with glucose or 17β-estradiol for different hours were detected.
b The fluorescence values of E. coli BL21 (DE3) containing plasmid
pBSPPc-Phsd-eGFP were detected by inducing with 17β-estradiol of
20 mg/L for different hours
Discussion
into the reaction mixture could release the binding of OxyR
protein to the DNA fragment (Fig. 6c). However, CrgA bound
Environmental estrogen pollution is considered one of
the most significant environmental problems, and
Fig. 3 Purification and characterization of 17β-HSD. a SDS-PAGE de-
tection of recombinant 17β-HSD protein. Lane 1, protein marker; Lane 2,
the pre-induction cell lysates; Lane3, the post-induction cell lysates; Lane
4, the solution after loading on the column; Lanes 5–9, the eluted protein
solution. b The fluorescence value of NADH detected from the enzyme
reaction performed at different temperatures (20–65 °C). c The
fluorescence value of NADH detected from the enzyme reaction per-
formed under different pHs (pH 5.0–11.0). d The fluorescence value of
NADH detected from the enzyme reaction suppled with different metal
ions of 1 mM (Mg2+, Mn2+, Cu2+, Ca2+, Zn2+, and Ni2+). The average
values of three repeats were calculated and the standard errors were
shown

Appl Microbiol Biotechnol
Table 3 The substrates spectrum
of the recombinant 17β-HSD
protein
Substrates
17β-
estradiol
Testosterone
0.790
Estrone
Estriol
Ethanol
Fluorescence values of NADH at 460 nm
0.937
− 0.165
− 0.006
− 0.145
The reactions were performed in 1 × reaction buffer (20 mM Tris-HCl, 25 mM NaCl), 200 μM NAD+ , 100 μM
steroids, and 150 μM 17β-HSD protein. The reactions were performed at 37 °C for 5 min. Mixture without 17β-
HSD or 17β-estradiol was used as blank
microorganisms with estrogen degradation capabilities could
be used for efficient environmental remediation. In the
steroid-degradation bacteria, the HSDs belonging to the
SDR family were considered the first restriction enzymes to
start the transformation of steroid chemicals (Chang et al.
2010; Maser et al. 2001; Yuanhua et al. 2015; Ye et al.
2017). In humans, HSDs have been well studied and con-
firmed to oxidize/reduce the active and inactive forms of es-
trogens at the C17 site with NAD(P)H as the cofactor (Chang
et al. 2010). Previous reports have shown that bacterial HSDs
could also catalyze the oxidation of testosterone and 17β-
estradiol (Edmund et al. 2001; Yuanhua et al. 2015; Ye et al.
2017). In this work, one 17β-HSD in P. putida SJTE-1 was
identified and confirmed to catalyze the transformation of
17β-estradiol into estrone efficiently, and its enzymatic
activity was similar to or higher than those of reported
HSDs (Yuanhua et al. 2015; Ye et al. 2017). The Km
and Vmax values of the 17β-HSD in Rhodococcus sp.
P14 were 18.9 μM and 12.5 μmol/min/mg; however,
the Vmax value of this 17β-HSD in P. putida SJTE-1
was about 4.2 times higher (52.26 μmol/min/mg).
Although its Km value (0.068 mM) was much larger,
over 98% transformation from 17β-estradiol to estrone
could be observed after 5 min, indicating high catalytic
activity and interaction with substrates of this 17β-HSD
protein. Since it could be induced by 17β-estradiol, this
17β-HSD participated in the transformation of 17β-
hydroxyl steroids in P. putida SJTE-1, and its
oxidization efficiency probably restricted the biodegra-
dation of 17β-estradiol.
motifs GXXXGXG and YXXXK, the classical SDRs also
contain an efficient catalytic center formed by four highly
conserved residues (Asn-Ser-Tyr-Lys), and NAD(P) or
NAD(P)H always acted as their reaction co-factors
(Kavanagh et al. 2008). HSD, a member of SDR family,
also contained typical and conserved structures including
seven parallel β-sheets at the center and three α-helices
on each side. This core structure is the binding site of the
cofactor NAD(P)H and the catalytic center with the con-
served amino acid sequence Tyr-(Xaa)3-Lys (Kallberg
et al. 2010; Kavanagh et al. 2008). For example, 3α-
HSD catalyzed the oxidoreduction at carbon 3 of steroid
hormones in C. testosteroni, and three residues (Ser114,
Tyr155, and Lys159) in 3α-HSD form a triad essential for
the catalysis (Kavanagh et al. 2008). As for the 17β-HSD
of P. putida SJTE-1 studied in this work, the conserved
motifs, the βαβ units of SDR family, and the conserved
Ser-Tyr-Lys-triad (residues 141, 155, 159) of HSDs were
all observed in its sequence and structure; therefore, this
enzyme was a typical HSD.
Although several 3,17β-HSDs have been found to
participate in the metabolism of steroids, especially the
oxidization at 17-position of these chemicals, the enzyme
catalyzing degradation of 17β-estradiol was not yet clear.
This was due to the fact that although the transformation
of 17β-estradiol could be catalyzed by these enzymes
in vitro, the reported 3,17β-HSDs could not be induced
by 17β-estradiol (Gong et al. 2012a, b; Yuanhua et al.
2015). Thus, there must exist multiple isoenzymes for
efficient transformation of 17β-estradiol in vivo.
Previous work showed that P. putida SJTE-1 could uti-
lize 17β-estradiol efficiently as a sole carbon source; its
proteomics analysis indicated the expression of several
hydroxysteroid dehydrogenases changed in the culture
with 17β-estradiol (Liang et al. 2012; Xu et al. 2017).
The 17β-HSD of this work is one of the upregulated
The SDR family consists of over 47,000 members, in-
cluding isomerases, dehydrogenases, and decarboxylases
found in prokaryotes, eukaryotes, and archaea (Kallberg
et al. 2010). Although the identity of these proteins was
only about 20%, the members share some conserved
structures (Kallberg et al. 2010). Besides the classic
Table 4 The enzymatic
characteristics of the recombinant
Enzyme
Km (mM)
Vmax (μmol/min/mg)
Kcat (/s)
Kcat/Km (/s mM)
17β-HSD protein
17β-HSD
0.068
56.26
2.073
30.485
The reactions were performed in 1 × reaction buffer (20 mM Tris-HCl, 25 mM NaCl), 200 μM NAD+ , and 17β-
estradiol and 17β-HSD protein of different concentrations. The reactions were performed at 37 °C for 5 min.
Mixture without 17β-HSD or 17β-estradiol was used as blank

Appl Microbiol Biotechnol
Fig. 4 HPLC detection of the
reaction product of 17β-HSD.
aThe HPLC map of 0.2 μM 17β-
estradiol. b The HPLC result of
0.2 μM estrone. c The HPLC map
of the 17β-HSD oxidation reac-
tion with 17β-estradiol as a sub-
strate. The reaction mixture
contained 0.2 μM of 17β-estra-
diol, 0.4 μM NAD+, and 0.3 μM
17β-HSD in 1 × reaction buffer
(20 mM Tris-HCl, 25 mM NaCl)
and the reaction was performed at
37 °C for 2.5 min
proteins, and its induction by 17β-estradiol was also
confirmed in this work. These results demonstrated this
17β-HSD was probably the key enzyme for estrogen
transformation in P. putida SJTE-1. Considering its high
enzymatic activity, this transformation could be complet-
ed efficiently, achieving the quick utilization of this
chemical and fast energy transfer into the cell growth.
In addition to the uncertainty regarding major en-
zymes for 17β-estradiol transformation, the regulation
networks and potential regulators involved in the biodeg-
radation of 17β-estradiol were also unclear. Several reg-
ulators have been identified to participate in the regula-
tion of the reported HSDs (Gong et al. 2012a, b; Ji et al.
2017; Li et al. 2013; Pan et al. 2015; Wu et al. 2015).
Two repressors, Rep1 and Rep2, could inhibit the expres-
sion of 3α-HSD genes in the absence of substrates; when
there is a substrate, the substrate can prevent the binding
of the transcription suppressors to the promoter region
upstream of the 3α-hsd gene (Gong et al. 2012a).
HsdR belonging to the LysR-type transcriptional regula-
tor (LTTR) family activates the expression of the hsdA
gene in C. testosteroni (Gong et al. 2012b). As to the
regulation of the 3,17β-hsd gene, PhaR, TetR, LuxR, and
BRP proteins were found to regulate the expression of
this enzyme negatively and influence the degradation of
testosterone in C. testosteroni (Ji et al. 2017; Li et al.
2013; Pan et al. 2015; Wu et al. 2015). However, this
regulation was not obvious when 17β-estradiol used, not
only because the utilization of 17β-estradiol in C.
testosteroni was not as good as that of testosterone but
also because the expression of 3,17β-hsd gene could not
be induced by 17β-estradiol in this microorganism
(Hwang et al. 2005; Yuanhua et al. 2015). In addition,
the binding characteristics and regulation mode of these
regulators were still not analyzed clearly. As shown in
this work, the 17β-hsd gene could be strongly induced
by 17β-estradiol, and the transcription levels of the two
genes (oxyR and crgA) also increased with the addition
of 17β-estradiol; overexpression of oxyR or crgA could
generate adverse effects on the transcription of 17β-hsd.
In vitro EMSA detection demonstrated that the OxyR
and CrgA proteins could bind to the promoter region of
the 17β-hsd gene from P. putida SJTE-1 efficiently, and
the specific binding of OxyR to this DNA fragment
could be released by 17β-estradiol. This meant the
OxyR protein probably acts as a repressor of 17β-hsd,
and its transcriptional repression of 17β-HSD could be
relieved by its substrate. In contrast, the CrgA protein is
more likely to work as an activator of this 17β-hsd gene,
and the addition of 17β-estradiol may strengthen its
activation.
Although the OxyR and CrgA proteins were members
of the LysR-type transcription regulator (LTTR) family,
their binding characteristics were specific and varied
from each other. The common features of the LTTR fam-
ily include sequence lengths of around 300 residues, high

Appl Microbiol Biotechnol
Fig. 5 Genes map, sequences
alignment, and proteins
purification of OxyR and CrgA. a
The genes map of oxyR, crgA, and
17β-hsd in the genome of P.
putida SJTE-1. b The OxyR
protein from P. putida SJTE-1
(ANI04815), Magnetospirillum
caucaseum (EME68759.1),
Rhodospirillum rubrum ATCC
11170 (YP_427866.1),
Escherichia coli str. K-12 substr.
MG1655 (NP_418396.1), and
Haemophilus sp. HMSC61B1
(OHR67871.1) was aligned with
ClustalW. c The CrgA protein
from P. putida SJTE-1
(ANI04817.1), Neisseria
meningitides (AAF37819.1), and
Yersinia pestis Pestoides A
(EEO91441.1) was aligned with
ClustalW. Conserved amino acids
were indicated in blue bars, iden-
tical amino acids were marked in
pink bars, and the similar amino
acids were showed in lighter blue
bars. The secondary structure of
seven α-helixes and seven β-
strands was shown in black rect-
angles and arrows. d The tran-
scription levels of 17β-hsd and
oxyR genes in P. putida SJTE-1
containing plasmid pBSPPc-crgA
were detected, which was cul-
tured with 17β-estradiol of
20 mg/L and induced with
0.5 mM IPTG for 3 h. e The
transcription levels of 17β-hsd
and crgA genes in P. putida SJTE-
1 containing plasmid pBSPPc-
oxyR were detected, which was
cultured with 17β-estradiol of
20 mg/L and induced with
0.5 mM IPTG for 3 h. f The SDS-
PAGE profiles of purified OxyR
and CrgA proteins
sequence similarity at the N-terminal HTH motif for
DNA binding, an inducer binding C-terminal domain,
and a homotetrameric quaternary structure of the active
species. Proteins belonging to the LTTR family normally
are dual function regulators acting as both auto-
repressors and activators of target promoters (Xiong
and Maser 2015). It has been demonstrated that there is
a conserved repression binding site (RBS, − 80 to − 50)
and an activation binding site (ABS, − 50 to − 20) in the
target promoters controlled by LTTRs (Schell 1993). The
sequences of conserved recognition and binding region
of the OxyR regulators were -GATA-N9-TATC-, and that
of the CrgA regulators was -T-N11-A- (Morelle et al.
2003; Zhang et al. 2015). In this study, two potential
conserved binding motifs of the OxyR regulator and
two possible binding regions of the CrgA regulator were
found in the crgA-17β-hsd intergenic region. OxyR, act-
ing as a global regulator of oxidative stress response in
E. coli, regulates the expression of genes required for
protection against oxidation toxicity, heat stress, and
phagocyte-mediated killing (Wei et al. 2012; Henikoff
et al. 1988). It can also facilitate the efficient utilization

Appl Microbiol Biotechnol
Fig. 6 EMSA detection of the binding of OxyR and CrgA to the promoter
region of 17β-hsd and the effect of 17β-estradiol. a EMSA results of
OxyR protein to the 5′-FAM labeled 118 bp fragment of 17β-hsd gene.
Two micromolar labeled DNA was used for each reaction. The first lane
(−) was the free-labeled DNA and the second lane (c) was added with
10 μM BSA. Other lanes were supplied with the increased amounts of
OxyR protein in the protein/DNA ratio from 0.1:1, 0.2:1, 0.4:1, 0.6:1,
0.8:1, 1.2:1 to 1.5:1 (lane 3–lane 9). b EMSA results of CrgA protein to
the 5′-FAM labeled 118 bp fragment of 17β-hsd gene. Two micromolar
labeled DNA was used for each reaction. The first lane (−) was the free-
labeled DNA and the second lane (c) was added with 10 μM BSA. Other
lanes were supplied with the increased amounts of CrgA-like protein in
the protein/DNA ratio from 0.2:1, 0.45:1, 1:1 to 1.5:1 (lane 3–lane 6, left)
and 3:1, 4.5:1, 6:1 to 7.5:1 (lane 3′–lane 6′, right). c The effect of 17β-
estradiol on the binding of OxyR to DNA fragment. Two micromolar
labeled DNA was used for each reaction. The first lane was the free-
labeled DNA, and lane 2 was added 1 μL DMSO. Lane 3 was added
with OxyR protein (the protein/DNA ratio was 3:1) and 1 μL DMSO.
Lanes 4–6 was added 5 μM of E2, 10 μM of E2, and 15 μM of E2, all
solved in 1 μL DMSO. d The effect of 17β-estradiol on the binding of
CrgA to DNA fragment. The first lane was the free-labeled DNA, and
lane 2 was added 1 μL DMSO. Lane 3 was added with CrgA protein (the
protein/DNA ratio was 7.5:1) and 1 μL DMSO. Lanes 4–6 was added
5 μM of E2, 10 μM of E2, and 15 μM of E2, all solved in 1 μL DMSO
of limited resources during the oxidative stress condition
by activating crucial cellular mechanisms (Staudinger
et al. 2002). Thus, this OxyR protein of P. putida
SJTE-1 could probably function as a global regulator to
resist the oxidative stress generated by 17β-estradiol and
enhance the transformation of this chemical. On the other
hand, CrgA was initially identified in Neisseria
meningitidis involved in the regulation of cell infection
to human epithelial cells and appears to be a part of a
group of genes that are coordinately upregulated during
initial adhesion (Deghmane et al. 2000; Morelle et al.
2003). The HsdR activating the expression of the hsdA
gene in C. testosteroni was also found to be a CrgA-type
regulator (Gong et al. 2012a). These implied that the
CrgA protein of P. putida SJTE-1 may help the strain’s
fast adaption to the 17β-estradiol environment and facil-
itate the efficient utilization of this chemical. Therefore,
the OxyR regulator and CrgA regulator can both directly
recognize and bind to the specific motifs in the promoter
of 17β-hsd genes, regulate the expression of 17β-hsd in

Appl Microbiol Biotechnol
Fig. 7 Conserved nucleic acid analysis of the promoter region of 17β-hsd
gene. a The sequences and the potential conserved motifs in the promoter
region of 17β-hsd gene. Conserved motif T-N11-A was binding site of
protein CrgA, and that of protein OxyR was motif GATA-NX-TATC. The
big and bold words meant the potential conserved motifs. b The con-
served nucleic acid analysis results of the promoter region of 17β-hsd
gene with MEME software. The big words meant the high conserved
nucleic acids
soil isolates of Rhodococcus sp. and Sphingomonas sp. J Biosci
Bioeng 109:576–582
different patterns, and play important roles in the 17β-
estradiol metabolism in P. putida SJTE-1. In summary,
the degradation of 17β-estradiol in P. putida SJTE-1 was
complex with multiple regulators participating in the pro-
cess; however, further work is needed.
Gong W, Xiong G, Maser E (2012a) Identification and characterization of
the LysR-type transcriptional regulator HsdR for steroid-inducible
expression of the 3α-hydroxysteroid dehydrogenase/carbonyl re-
ductase gene in Comamonas testosteroni. Appl Environ Microbiol
78(4):941–950
Gong W, Xiong G, Maser E (2012b) Oligomerization and negative auto-
regulation of the LysR-type transcriptional regulator HsdR from
Comamonas testosteroni. J Steroid Biochem Mol Biol 132(3–5):
203–211
Funding This work was supported by the National Science Foundation
of China (Grant No. 31370152, 31570099) and the Shanghai Pujiang
Program (14PJD020).
Haiyan R, Shulan J, ud din Ahmad N, Dao W, Chengwu C (2007)
Degradation characteristics and metabolic pathway of 17-alpha-
ethynylestradiol by Sphingobacterium sp. JCR5. Chemosphere 66:
340–346
Compliance with ethical standards
Conflict of interest All authors declare that they have no conflict of
Henikoff S, Haughn GW, Calvo JM, Wallace JC (1988) A large family of
bacterial activator proteins. Proc Natl Acad Sci U S A 85(18):6602–
6606
Hom-Diaz A, Llorca M, Rodríguez-Mozaz S, Vicent T (2015)
Microalgae cultivation on wastewater digestate: β-estradiol and
17α-ethynylestradiol degradation and transformation products iden-
tification. J Environ Manag 155:106–113
interest.
Ethical approval This article does not contain any studies with human
participants performed by any of the authors.
Publisher’s Note Springer Nature remains neutral with regard to
Hwang CC, Chang YH, Hsu CN, Hsu HH, Li CW, Pon HI (2005)
Mechanistic roles of Ser-114, Tyr-155, and Lys-159 in 3alpha-
hydroxysteroid dehydrogenase/carbonyl reductase from
Comamonas testosteroni. J Biol Chem 280(5):3522–3528
Ji Y, Pan T, Zhang Y, Xiong G, Yu Y (2017) Functional analysis of a
novel repressor LuxR in Comamonas testosteroni. Chem Biol
Interact 276:113–120
jurisdictional claims in published maps and institutional affiliations.
References
Beck KR, Kaserer T, Schuster D, Odermatt A (2017) Virtual screening
applications in short-chain dehydrogenase/reductase research. J
Steroid Biochem Mol Biol 171:157–177
Chang YH, Wang YL, Lin JY, Chuang LY, Hwang CC (2010)
Expression, purification, and characterization of a human recombi-
nant 17beta-hydroxysteroid dehydrogenase type 1 in Escherichia
coli. Mol Biotechnol 4:4133
Jianghong S, Satoshi N, Masaaki H (2004) Biodegradation of natural and
synthetic estrogens by nitrifying activated sludge and ammonia-
oxidizing bacterium Nitrosomonas europaea. Water Res 38:2323–
2330
Kallberg Y, Oppermann U, Persson B (2010) Classification of the short-
chain dehydrogenase/reductase superfamily using hidden Markov
models. FEBS J 277(10):2375–2386
Combalbert S, Hernandez-Raquet G (2010) Occurrence, fate, and biodeg-
radation of estrogens in sewage and manure. Appl Microbiol
Biotechnol 86:1671–1692
Deghmane AE, Petit S, Topilko A, Pereira Y, Giorgini D, Larribe M, Taha
MK (2000) Intimate adhesion of Neisseria meningitidis to human
epithelial cells is under the control of the crgA gene, a novel LysR-
type transcriptional regulator. EMBO J 19(5):1068–1078
Futoshi K, Maki O, Satoshi S, Yamazoe A, Yagi O (2010) Degradation of
natural estrogen and identification of the metabolites produced by
Katori Y, Ksu Y, Utsumi H (2002) Estrogen-like effect and cytotoxicity of
chemical compounds. Water Sci Technol 46:363–366
Kavanagh KL, Jörnvall H, Persson B, Oppermann U (2008) Medium-
and short-chain dehydrogenase/reductase gene and protein families:
the SDR superfamily: functional and structural diversity within a
family of metabolic and regulatory enzymes. Cell Mol Life Sci
65(24):3895–3906
Khanal SK, Xie B, Thompson ML, Sung S, Ong SK, Van Leeuwent J
(2006) Fate, transport, and biodegradation of natural estrogens in the

Appl Microbiol Biotechnol
environment and engineered systems. Environ Sci Technol 40:
6537–6546
Li M, Xiong G, Maser E (2013) A novel transcriptional repressor PhaR
for the steroid-inducible expression of the 3,17β-hydroxysteroid
dehydrogenase gene in Comamonas testosteroni ATCC11996.
Chem Biol Interact 202(1–3):116–125
Liang R, Liu H, Liu J (2012) Genome sequence of Pseudomonas putida
strain SJTE-1, a bacterium capable of degrading estrogens and per-
sistent organic pollutants. J Bacteriol 194:4781–4782
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
data using real-time quantitative PCR and the 2−ΔΔCT method.
Methods 25:402–408
Takeshi Y, Fumiko N, Haruji S, Omura H (2004) Degradation of estro-
gens by Rhodococcus zopfii and Rhodococcus equi isolates from
activated sludge in wastewater treatment plants. Appl Environ
Microbiol 10:1128
Tamagawa Y, Yamaki R, Hirai H, Kawai S, Nishida T (2006) Removal of
estrogenic activity of natural steroidal hormone estrone by
ligninolytic enzymes from white rot fungi. Chemosphere 65:97–101
Wei Q, Minh PN, Dötsch A, Hildebrand F, Panmanee W, Elfarash A,
Schulz S, Plaisance S, Charlier D, Hassett D, Häussler S, Cornelis
P (2012) Global regulation of gene expression by OxyR in an im-
portant human opportunistic pathogen. Nucleic Acids Res 40(10):
4320–4333
Lu Z, Liang R, Liu X, Hou J, Liu J (2012) RNase HIII from
Chlamydophila pneumoniae can efficiently cleave double-stranded
DNA carrying a chimeric ribonucleotide in the presence of manga-
nese. Mol Microbiol 83(5):1080–1093
Luine VN (2014) Estradiol and cognitive function: past, present and
future. Horm Behav 66(4):66602–66,618
Maser E, Xiong G, Grimm C, Ficner R, Reuter K (2001) 3α-
Hydroxysteroid dehydrogenase/ carbonyl reductase from
Comamonas testosteroni: biological significance, three-
dimensional structure and gene regulation. Chem Biol Interact
130–132(1–3):707–722
Matsumura Y, Hosokawa C, Sasaki-Mori M, Akahira A, Fukunaga K,
Ikeuchi T, Oshiman K, Tsuchido T (2009) Isolation and characteri-
zation of novel bisphenol-A degrading bacteria from soils.
Biocontrol Sci 14:161–169
Wu Y, Huang P, Xiong G, Maser E (2015) Identification and isolation of a
regulator protein for 3,17β-HSD expressional regulation in
Comamonas testosteroni. Chem Biol Interact 234:197–204
Xiong G, Maser E (2015) Construction of a biosensor mutant of
Comamonas testosteroni for testosterone determination by cloning
the EGFP gene downstream to the regulatory region of the 3,17β-
HSD gene. Chem Biol Interact 234:188–196
Xu Y, Tao F, Xu P (2013) New constitutive vectors: useful genetic engi-
neering tools for biocatalysis. Appl Environ Microbiol 79:2836–
2840
Xu J, Zhang L, Hou J, Liang R (2017) iTRAQ-based quantitative prote-
omic analysis of the global response to 17β-estradiol in estrogen-
degradation strain Pseudomonas putida SJTE-1. Sci Rep 7416821
Yang J, Li W, Ng TB, Deng X, Lin J, Ye X (2017) Laccases: production,
expression regulation, and applications in pharmaceutical biodegra-
dation. Front Microbiol 8:832
Ye X, Xiong G, Hu Z (2017) A novel 17β-hydroxysteroid dehydrogenase
in Rhodococcus sp. P14 for transforming 17β-estradiol to estrone.
Chem Biol Interact 276:105–112
Morelle S, Carbonnelle E, Nassif X (2003) The REP2 repeats of the
genome of Neisseria meningitidis are associated with genes coordi-
nately regulated during bacterial cell interaction. J Bacteriol 185(8):
2618–2627
Mythen SM, Devendran S, Méndez-García C, Cann I, Ridlon JM (2018)
Targeted synthesis and characterization of a gene cluster encoding
NAD(P)H-dependent 3α-, 3β-, and 12α-hydroxysteroid dehydro-
genases from Eggerthella CAG:298, a Gut Metagenomic Sequence.
Appl Environ Microbiol 84(7)
Pan T, Huang P, Xiong G, Maser E (2015) Isolation and identification of a
repressor TetR for 3,17β-HSD expressional regulation in
Comamonas testosteroni. Chem Biol Interact 234:205–212
Ribeiro AR, Tiritan ME, Castro PM (2010) Microbial degradation of
17β-estradiol and 17α-ethinylestradiol followed by a validated
HPLC-DAD method. J Environ Sci Health A 45:265–273
Schell MA (1993) Molecular biology of the LysR family of transcription-
al regulators. Annu Rev Microbiol 47:597–626
Yin GG, Kookana RS, Ru YJ (2002) Occurrence and fate of hormone
steroids in the environment. Environ Int 28:545–551
Yu CP, Roh H, Chu KH (2007) 17β-Estradiol-degrading bacteria isolated
from activated sludge. Environ Sci Technol 41:486–492
Yu CP, Deeb RA, Chu KH (2013) Microbial degradation of steroidal
estrogens. Chemosphere 91:1225–1235
Yuanhua Y, Chuanzhi L, Baoxue W (2015) Characterization of 3,17β-
hydroxysteroid dehydrogenase in Comamonas testosteroni. Chem
Biol Interact 234:221–228
Zeng Q, Li Y, Gu G, Zhao J, Zhang C, Luan J (2009) Sorption and
biodegradation of 17β-estradiol by acclimated aerobic activated
sludge and isolation of the bacterial strain. Environ Eng Sci 26:
783–790
Staudinger BJ, Oberdoerster MA, Lewis PJ, Rosen H (2002) mRNA
expression profiles for Escherichia coli ingested by normal and
phagocyte oxidase-deficient human neutrophils. J Clin Invest
110(8):1151–1163
Zhang Y, Ujor V Wick M, Ezeji TC. (2015) Thaddeus chukwuemeka
ezeji, identification, purification and characterization of furfural
transforming enzymes from Clostridium beijerinckii NCIMB
8052. Anaerobe 33:124-131