Degradation of cyhalofop-butyl (CyB) by Pseudomonas azotoformans strain QDZ-1 and cloning of a novel gene encoding CyB-hydrolyzing esterase

Article abstract of DOI:10.1021/jf200397t

Cyhalofop-butyl (CyB) is a widely used aryloxyphenoxy propanoate (AOPP) herbicide for control of grasses in rice fields. Five CyB-degrading strains were isolated from rice field soil and identified as Agromyces sp., Stenotrophomonas sp., Aquamicrobium sp., Microbacterium sp., and Pseudomonas azotoformans; the results revealed high biodiversity of CyB-degrading bacteria in rice soil. One strain, P. azotoformans QDZ-1, degraded 84.5% of 100 mg L^-1 CyB in 5 days of incubation in a flask and utilized CyB as carbon source for growth. Strain QDZ-1 could also degrade a wide range of other AOPP herbicides. An esterase gene, chbH, which hydrolyzes CyB to cyhalofop acid (CyA), was cloned from strain QDZ-1 and functionally expressed. A chbH-disrupted mutant dchbH was constructed by insertion mutation. Mutant dchbH could not degrade and utilize CyB, suggesting that chbH was the only esterase gene responsible for CyB degradation in strain QDZ-1. ChbH hydrolyzed all AOPP herbicides tested as well as permethrin. The catalytic efficiency of ChbH toward different AOPP herbicides followed the order quizalofop-P-ethyl ≈ fenoxaprop-P-ethyl > CyB ≈ fluazifop-P-butyl > diclofop-methyl ≈ haloxyfop-P-methyl; the results indicated that the chain length of the alcohol moiety strongly affected the biodegradability of the AOPP herbicides, whereas the substitutions in the aromatic ring had only a slight influence.

Full text of DOI:10.1021/jf200397t

ARTICLE
pubs.acs.org/JAFC
Degradation of Cyhalofop-butyl (CyB) by Pseudomonas
azotoformans Strain QDZ-1 and Cloning of a Novel Gene
Encoding CyB-Hydrolyzing Esterase
Zhi-Juan Nie,|| Bao-Jian Hang,|| Shu Cai, Xiang-Ting Xie, Jian He,* and Shun-Peng Li
Key Laboratory of Microbiological Engineering of Agricultural Environment, Ministry of Agriculture,
Life Sciences College of Nanjing Agricultural University, Nanjing, Jiangsu 210095, People’s Republic of China
ABSTRACT: Cyhalofop-butyl (CyB) is a widely used aryloxyphenoxy propanoate (AOPP) herbicide for control of grasses in rice
fields. Five CyB-degrading strains were isolated from rice field soil and identified as Agromyces sp., Stenotrophomonas sp.,
Aquamicrobium sp., Microbacterium sp., and Pseudomonas azotoformans; the results revealed high biodiversity of CyB-degrading
bacteria in rice soil. One strain, P. azotoformans QDZ-1, degraded 84.5% of 100 mg Lꢀ1 CyB in 5 days of incubation in a flask and
utilized CyB as carbon source for growth. Strain QDZ-1 could also degrade a wide range of other AOPP herbicides. An esterase gene,
chbH, which hydrolyzes CyB to cyhalofop acid (CyA), was cloned from strain QDZ-1 and functionally expressed. A chbH-disrupted
mutant dchbH was constructed by insertion mutation. Mutant dchbH could not degrade and utilize CyB, suggesting that chbH was
the only esterase gene responsible for CyB degradation in strain QDZ-1. ChbH hydrolyzed all AOPP herbicides tested as well as
permethrin. The catalytic efficiency of ChbH toward different AOPP herbicides followed the order quizalofop-P-ethyl ≈
fenoxaprop-P-ethyl > CyB ≈ fluazifop-P-butyl > diclofop-methyl ≈ haloxyfop-P-methyl; the results indicated that the chain
length of the alcohol moiety strongly affected the biodegradability of the AOPP herbicides, whereas the substitutions in the aromatic
ring had only a slight influence.
KEYWORDS: cyhalofop-butyl (CyB), microbial degradation, Pseudomonas azotoformans strain QDZ-1, CyB-hydrolyzing esterase
gene, molecular structure and biodegradability
’ INTRODUCTION
group.10,12 However, up to now, no report was available in the
literature regarding the microbial degradation of CyB by a pure
bacterial culture. Some important questions, such as which kinds
of microorganisms are involved in CyB residue degradation in
the environment, the microbial metabolic pathway, and the
relationship between chemical hydrolysis and microbial degrada-
tion, were still unanswered.
In the present study, five CyB-degrading strains were isolated
and identified. A novel esterase gene, chbH, with responsibility for
the cleavage of the ester linkage of CyB was cloned and function-
ally expressed. The influence of the molecular structure of the
AOPP herbicides on their biodegradability was also analyzed.
Cyhalofop-butyl (CyB), 2-[4-(4-cyano-2-fluorophenoxy)
phenoxy]propanoic acid, butyl ester (R), is a widely used
aryloxyphenoxy propanoate (AOPP) herbicide for the poste-
mergence control of grasses in rice fields.2 Although herbicides
are typically applied to the crop and weed canopy, substantial
quantities of the active ingredient penetrate to the soil surface.
Therefore, great concerns have been raised about the occurrence
and fate of the herbicides in the environment.
In general, CyB and other AOPP analogues in the environ-
ment are degraded by both abiotic and biotic pathways, including
photooxidation, and chemical and microbial degradation.9 La-
boratory and field studies have demonstrated that microbial
metabolism is the most important factor in the fate of AOPP
herbicides in soil, water, and sediment. Up to now, several AOPP
herbicide degrading strains have been described. Smith-Greenier
and Adkins15 isolated six diclofop-methyl-degrading strains from
Manitoba soil. Liang et al.7 reported that Brevundimonas sp. LY-2,
isolated from a soil sample that had been exposed to lactofen for
many years, could metabolize lactofen to 1-(carboxy)ethyl-5-(2-
chloro-4-(trifluoromethyl)phenoxy)-2-nitrobenzoate. Jackson
and Douglas9 demonstrated that the initial degradation of CyB
in soil and water was due to a combination of microbial and
chemical processes but that subsequent degradation was pre-
dominantly a microbial process. The metabolic pathway of CyB
in soil and sediment/water systems was also studied; CyB was
rapidly degraded to CyA through cleavage of the ester linkage.
The acid was further transformed to cyhalofop amide (CyAA)
and cyhalofop diacid (CyD) by sequential oxidation of the cyano
’ MATERIALS AND METHODS
Chemicals and Media. CyB, diclofop-methyl, haloxyfop-P-methyl,
quizalofop-P-ethyl, fenoxaprop-P-ethyl, and fluazifop-P-butyl were ob-
tained from Sigma-Aldrich Chemical Co. (Shanghai, China). Permethrin,
bifenthrin, and malathion were obtained from Yangnong Chemical
Group Co., Ltd., Jiangsu province, China. All of the above chemicals
were of analytical grade. The LuriaꢀBertani (LB) medium consisted of
thefollowingcomponents (ing Lꢀ1): 10.0 tryptone, 5.0yeast extract, and
5.0 NaCl. Mineral salts medium (MSM) consisted of the following
components (in g Lꢀ1): 1.0 (NH4)2SO4, 1.0 NaCl, 1.5 K2HPO4, 0.5
KH2PO4, and 0.2 MgSO4 7H2O, pH 7.0. For solid medium, 15.0 g of
3
Received: January 28, 2011
Revised:
April 27, 2011
Accepted: May 2, 2011
Published: May 02, 2011
r
2011 American Chemical Society
6040
dx.doi.org/10.1021/jf200397t J. Agric. Food Chem. 2011, 59, 6040–6046
|

Journal of Agricultural and Food Chemistry
ARTICLE
agar was added per liter. Medium was sterilized at 121 °C for 30 min.
The stock solutions of the above herbicides or insecticides (1%, w/v)
were prepared in methanol and sterilized by membrane filtration (pore
size = 0.22 μm).
were used for the nucleotide sequence and deduced amino acid identity
searches (www.ncbi.nlm.nih.gov/Blast), respectively.
Gene Expression and Purification of the Recombinant
ChbH. The open reading frame (ORF) of chbH without its translation
Isolation and Identification of CyB-Degrading Bacteria. The
soil sample used as initial inoculants was collected from the surface layer
(0ꢀ10 cm) of a rice field, which had been exposed to CyB for many years,
in Jiangsu province, China. About 1.0 g of the soil sample was added to a
150 mL Erlenmeyer flask containing 50 mL of MSM supplemented with
100 mg Lꢀ1 CyB as carbon sources; CyB was first dissolved in methanol
and then transferred into the medium. The culture was incubated at 30 °C
on a rotary shaker at 150 rpm for about 5 days. Five milliliters of the
enrichment culture was transferred into another 50 mL of fresh enrich-
ment medium for another 5 days. Then the enrichment culture was spread
on MSM agar plates supplemented with 100 mg Lꢀ1 CyB. Bacterial
colonies producing a visible transparent halo duetoCyB degradationwere
picked out, purified by repeated streaking, and tested for their degrading
capabilities.
The isolates were characterized and identified by morphological,
physiological, and biochemical characteristics and 16S rRNA gene
analysis. The morphological and physiological and biochemical charac-
terizations were carried out according to the diagnostic tables of bacteria
proposed by Cowan and Steel.4 Genomic DNA was extracted by a high-
salt precipitation method.14 The 16S rRNA gene sequence was amplified
by PCR as described by Wang et al.19 using a set of universal primers, 50-
AGAGTTTGATCCTGGCTCAG-30 (Escherichia coli bases 8ꢀ27) and
50-TACCTTGTTACGACTT-30 (E. coli bases 1507ꢀ1492), originally
presented by Lane.6 The PCR product was purified by PCR purification
kit (Axygen) and ligated into the vector pMD18-T (TaKaRa Biotechnol-
ogy, Dalian, China) and then transformed into E. coli DH5R. An
automatic sequencer (Applied Biosystem, model 3730) was used to
determine the16SrRNA gene sequence. Pairwise sequence similarity was
calculated by using a global alignment algorithm, implemented at the
EzTaxon server.3 Phylogenetic analysis was performed by using the
software package MEGA version 4.116 after multiple alignment of the
sequence data with CLUSTAL_X.17 The GþC content of the genomic
DNA was determined by thermal denaturation11 using E. coli K-12 DNA
as reference. DNAꢀDNA hybridizations were performed according to
the method of Ezaki et al.5
stop codon was amplified by PCR with one primer pair [chbF1,
ATGCGGTACCATGGCTGTCGAATGGGTTGTCG (KpnI, corre-
sponding to sites 1ꢀ22 of the chbH gene), and chbR1, ATGCCTC-
GAGCTGGCTCGCCAGGGCGACAGG (XhoI, corresponding to
sites 976ꢀ996 of the chbH gene)] and inserted into the KpnIꢀXhoI
site of pET29a(þ) to generate the recombinant plasmid pet-chbH. The
recombinant plasmid pet-chbH then transformed into E. coli BL21-
(DE3). The induction and purification of the recombinant ChbH were
carried out according to the methods described by Wang et al.18 The
protein concentration was quantified by the Bradford method using
bovine serum albumin as the standard.1
Enzyme Assay. Enzymatic activities toward CyB and other AOPP
herbercides were performed in 50 mM sodium phosphate buffer (pH
7.5) at 37 °C. One microliter of chemical solution was added to 3 mL of
the preincubated enzyme solution. The enzyme mixture was incubated
for 10 min. No more than 10% of the substrate was hydrolyzed during
the assay. The esterase activities against p-nitrophenyl acetate, perme-
thrin, bifenthrin, and malathion were performed as described by Liang
et al.8 One activity unit was defined as the amount of enzyme required to
catalyze the formation or hydrolysis of 1 μmol of product or substrate
per minute. For kinetic studies, a stock solution of substrate was
appropriately diluted in methanol into at least five different concentra-
tions around the Km values. Kinetic values were obtained from Line-
weaverꢀBurk plots against various substrate concentrations.
Construction of chbH-Disrupted Mutant. A 524 bp fragment
(corresponding to sites 198ꢀ721 of the chbH gene) used for the
homologous recombination directing sequence was amplified from the
genomic DNA of strain QDZ-1 with one primer pair [chbF2, AC-
CTGGATCCGGGCAGTAGTCGCAACCTGACCTATGC (BamHI,
corresponding to sites 198ꢀ224 of the chbH gene), and chbR2,
GCTTCTGCAGGGTCGTTGACCCGGTTGATCTCG (PstI, corre-
sponding to sites 699ꢀ721 of the chbH gene)] and inserted into the
BamHIꢀPstI site of the suicide plasmid pJQ200SK (Gm resistant,
Quandt and Hynes13) to yield pJQdchbH. Then plasmid pJQdchbH
was introduced into strain QDZ-1 (Ap resistant) by triparental con-
jugation using pRK2013 as the helper plasmid. A mutant with single
recombination events was selected on the basis of resistance to Ap and
Gm on LB plates. One of the selected mutant strains was designated
dchbH. The chbH gene of the mutant was divided into two separate parts
by the integrated plasmid pJQ200SK.13 The single recombination event
was checked by PCR using two primer pairs: chbF1 and chbR1; and
chbF1 and R3 (GCGAGTCAGTGAGCGAGGAA, corresponding to
sites 497ꢀ477 downstream of PstI in the plasmid pJQ200SK). Theore-
tically, when chbF1 and chbR1 were used as primers, a fragment of 1016
bp would be yielded for wild type and no fragment would be yielded for
mutant dchbH; when chbF1 and R3 were used as primers, a fragment of
1228 bp would be yielded for mutant dchbH, and no fragment would be
yielded for wild type.
Growth and Degradation Experiments. The isolate growing
in LB medium for about 12 h was harvested by centrifugation (5000 rpm,
10 min) and washed twice with fresh MSM. After the cell density had
been adjusted to about 1.0 ꢁ 108 cfu mLꢀ1, an aliquot (1%, v/v) was
inoculated into 20 mL of MSM supplemented with 100 mg Lꢀ1 CyB as
carbon source in a 50 mL Erlenmeyer flask. The cultures were incubated
at 30 °C and 150 rpm on a rotary shaker. At an interval of 24 h, three
culture flasks were removed from incubation. Bacterial growth was
monitored by measuring the colony forming units (CFU mLꢀ1), and
concentrations of CyB were determined by HPLC analysis as described
below. Each treatment was performed in three replicates, and the control
experiments without inoculation and without substrate were carried out
under the same conditions.
Degradation of other AOPP herbercides (diclofop-methyl, haloxy-
fop-P-methyl, quizalofop-P-ethyl, fenoxaprop-P-ethyl, and fluazifop-P-
butyl) by the strain was also studied at the same conditions.
Two methods were used to determine the CyB-degrading activities of
wild-type strain QDZ-1 and mutant dchbH. In method I, the wild-type
strain QDZ-1 and mutant dchbH were inoculated on MSM plate
supplemented with 200 mg Lꢀ1 CyB and incubated at 30 °C for 3 days
and then investigated as to whether the growth and transparent halo
occurred. In method II, the wild-type strain QDZ-1 and mutant dchbH
were cultivated in 20 mL of LB medium for about 12 h, harvested by
centrifugation, and inoculated into 20 mL of MSM supplemented with
100 mg Lꢀ1 CyB. After incubation at 30 °C on a rotary shaker for 2 days,
the CyB concentrations of the cultures were determined by HPLC
analysis as described below. The control experiments without inocula-
tion were carried out under the same conditions.
Cloning of the chbH Gene Encoding CyB-Hydrolyzing
Esterase. DNA manipulation was carried out as described by Sam-
brook et al.14 The genomic DNA library of strain QDZ-1 was con-
structed according to the method of Wang et al.18 with some
modification. The insertion fragments in the transforms were about
4ꢀ6 kb. Colonies that produced clear transparent halos on LB plates
supplemented with 100 mg Lꢀ1 CyB were screened and further tested
for degrading capabilities. Nucleotide and deduced amino acid sequence
analyses were performed using Omiga software 2.0. BlastN and BlastP
6041
dx.doi.org/10.1021/jf200397t |J. Agric. Food Chem. 2011, 59, 6040–6046

Journal of Agricultural and Food Chemistry
ARTICLE
Figure 1. Phylogenetic tree based on the 16S rRNA gene sequences of the CyB-degrading strains and related species. The GenBank accession number
for each microorganism used in the analysis is shown after the species name. The scale bar indicates 0.02 substitution per nucleotide position. Bootstrap
values obtained with 1000 resamplings are indicated as percentages at all branches.
Chemical Analysis. CyB and other AOPP herbercides in cultures
were extracted by the addition of an equal volume of dichloromethane
followed by 1 h of shaking using a reciprocal shaker. The dichloro-
methane phase was dried over anhydrous Na2SO4, and then the
dichloromethane was removed using a stream of nitrogen at room
temperature. The residues were dissolved in 200 μL of methanol. The
chemical concentrations in samples were analyzed by HPLC equipped
with a Zorbax C-18 ODS Spherex column (250 mm ꢁ 4.6 mm). The
mobile phase was methanol/water (85:15, v/v), and the flow rate was
1.0 mL minꢀ1. Column elutions were monitored by measuring at
230 nm with a Waters 2487 wavelength absorbance detector, and the
injection volume was 20 μL. The recovery rates of CyB from liquid
culture at concentrations of 0.1, 1.0, 10.0, and 100.0 mg Lꢀ1 were
determined to be 88.5 ( 5.1, 92.7 ( 3.9, 98.1 ( 3.3, and 96.4 ( 2.1%,
which indicated that the procedure was efficient in extracting CyB from
liquid culture.
Nucleotide Sequence Accession Numbers. The nucleotide
sequences of the 16S rRNA genes of strains QDZ-A, QDZ-B, QDZ-C,
QDZ-D, and QDZ-1 were deposited in the GenBank database under
accession numbers HQ713375, HQ890469, HQ890470, HQ890471,
and HM807308, respectively. The accession number of the chbH gene
was HQ733860.
’ RESULTS AND DISCUSSION
Strain Isolation and Identification. CyB is an ester with low
water solubility (0.44 mg Lꢀ1 at pH 7), whereas its degradation
product, CyA, is more soluble (251 mg Lꢀ1 at pH 7). An agar
plate supplemented with 100 mg Lꢀ1 CyB appeared opaque due
to the poor solubility of CyB. When a CyB-degrading strain was
inoculated on this agar plate, a visible transparent halo around the
colony would be produced due to the fact that CyB was
transformed to CyA. In this study, we used this transparent halo
as a CyB-degrading activity indicator to isolate CyB-degrading
strains and to screen the CyB-hydrolyzing esterase gene from
the genomic library. Five pure cultures, designated QDZ-A,
QDZ-B, QDZ-C, QDZ-D, and QDZ-1, were isolated from the
Identification of the Metabolite of CyB Degradation by
ChbH. The enzyme mixture was supplemented with 50 mg/L CyB and
incubated for 2 h; control experiments with heat-inactivated enzyme
were carried out under the same conditions. The solution mixture was
extracted as described above. The metabolite was identified by LC-MS as
described by Liang et al.7
6042
dx.doi.org/10.1021/jf200397t |J. Agric. Food Chem. 2011, 59, 6040–6046

Journal of Agricultural and Food Chemistry
ARTICLE
Figure 4. Wild-type strain QDZ-1 (A) and mutant dchbH (B) grown
on MSM plate supplemented with 200 mg Lꢀ1 CyB.
Table 1. Degradation of CyB by Strain QDZ-1 and Mutant
dchbH
Figure 2. Degradation and utilization of CyB during growth of strain
QDZ-1 in MSM: (9) CyB control; (0) CyB inoculated; (2, ꢁ) cell
density of strain QDZ-1 with the addition of CyB and without addition
in MSM medium, respectively. Error bars represent the standard error of
three replicates.
mutant
control
strain QDZ-1
dchbH
residual concentration
of CyBa (mg Lꢀ1
98.5 ( 4.1 a
24.3 ( 2.1 b
96.7 ( 5.5 a
)
a Different letters indicate significant differences (p < 0.05, LSD test).
Figure 3. PCR analysis of the single recombination event. Lanes: 1,
DL2000 marker; 2, amplified fragment by primer piar chbF1 and R3
using mutant dchbH DNA as template; 3, amplified fragment by primer
pair chbF1 and chbR1 using mutant dchbH DNA as template; 4,
amplified fragment by primer pair chbF1 and R3 using wild-type strain
QDZ-1 DNA as template; 5, amplified fragment by primer pair chbF1
and chbR1 using wild-type strain QDZ-1 DNA as template.
Figure 5. SDS-PAGE analysis of the purified ChbH (lane 2) and
protein markers (lane 1) stained with Coomassie brilliant blue G250.
Strain QDZ-1 is non-spore-forming, Gram-negative, short
rod-shaped (approximately 1.5ꢀ2.2 μm in length and 0.6ꢀ0.8
μm in width), and motile with polar flagella. Colonies grown on
LB agar for 1ꢀ2 days are circular, convex with entire margins,
and pale yellow. Fluorescent pigment is produced after 2 days of
incubation. Growth is observed over a temperature range of
15ꢀ37 °C (optimum 25ꢀ30 °C), a salinity range of 0ꢀ3.5%
NaCl (optimum 0.5% NaCl), and a pH range of 5.5ꢀ10.0
(optimum 7.0). The strain is positive for cytochrome oxidase,
gelatin liquefaction, nitrate reduction. The DNA GþC content is
62.5 mol %.
An almost-complete 16S rRNA gene sequence (1372 nts) was
determined for strain QDZ-1. Phylogenetic analysis of the 16S
rDNA gene sequences revealed that strain QDZ-1 grouped
among Pseudomonas species and formed a subclade with Pseu-
domonas azotoformans IAM1603T (similarity = 99.6%) with a
high bootstrap value of 95% (Figure 1). Strain QDZ-1 showed
a relatively high DNAꢀDNA relatedness to P. azotoformans
enrichment culture. On the basis of the results of morphological
and physiological characteristics and phylogenetic analysis of the
16S rDNA sequence (Figure 1), the five strains were identified
preliminarily as Agromyces sp. (strain QDZ-A), Stenotrophomonas
sp. (strain QDZ-B), Aquamicrobium sp. (strain QDZ-C), Micro-
bacterium sp. (strain QDZ-D), and Pseudomonas sp. (strain QDZ-
1). When inoculated into MSM supplemented with 100 mg Lꢀ1
CyB and incubated at 30 °C for 5 days, strains QDZ-A, QDZ-B,
QDZ-C QDZ-D, and QDZ-1 were able to degrade about 61.7,
72.4, 44.5, 67.8, and 85.3% of the initially added CyB, respectively.
The results gave the most direct evidence that indigenous
microorganisms were involved in the CyB degradation in soil
and also revealed the high biodiversity of CyB-degrading bacteria
in rice soil. Strain QDZ-1 was selected for further study due to its
relatively high degrading efficiency and the fact that isolates in the
genus Pseudomonas play a very important role in the degradation
of a wide variety of xenobiotic pollutants.
6043
dx.doi.org/10.1021/jf200397t |J. Agric. Food Chem. 2011, 59, 6040–6046

Journal of Agricultural and Food Chemistry
ARTICLE
Figure 6. LC-MS spectrum of the dichloromethane extracts from the control with added CyB and heat-inactivated ChbH (A, B) and from the treatment
with added CyB and ChbH (C, D).
IAM1603T (76.4%; reciprocal, 81.2%), the value was above the
threshold of 70% recommended for the delineation of bacterial
species.20 Thus, on the basis of the above characteistics, strain
QDZ-1 was identified as P. azotoformans.
Degradation of CyB and Other AOPP Herbercides by Strain
QDZ-1. The growth of strain QDZ-1 on liquid MSM supplemen-
ted with 100 mg Lꢀ1 CyB and its ability to degrade CyB are shown
in Figure 2. The growth curve showed a steady increase in bacterial
population after a short lag phase (about 24 h). Simultaneously,
HPLC analysis showed a substantial reduction in the concentra-
tions of CyB. After incubation for 5 days, about 84.5% of the 100
mg Lꢀ1 CyB initially added was degraded by strain QDZ-1;
correspondingly, the cell densities were increased from about
1.3 ꢁ 106 to 1.4 ꢁ 107 cfu mLꢀ1. No significant change in CyB
concentration was observed in cultures that were not inoculated
with strain QDZ-1, and no growth was observed for strain QDZ-1
when it was inoculated into the culture without the addition of
CyB. Thus, we concluded that strain QDZ-1 was able to degrade
CyB and utilize it as carbon source for growth. HPLC-MS analysis
demonstrated that CyB was degraded to CyA through cleavage of
the ester linkage in strain QDZ-1 (data not shown).
When other AOPP herbicides were used as substrates, strain
QDZ-1 could degrade 68.9% diclofop-methyl, 64.6% haloxyfop-
P-methyl, 92.6% quizalofop-P-ethyl, 90.8% fenoxaprop-P-ethyl,
and 79.6% of fluazifop-P-butyl and used these AOPP herbicides
as carbon sources for growth.
Cloning of the chbH Gene Encoding CyB-Hydrolyzing
Esterase. A positive clone that produced a transparent halo
6044
dx.doi.org/10.1021/jf200397t |J. Agric. Food Chem. 2011, 59, 6040–6046

Journal of Agricultural and Food Chemistry
ARTICLE
Table 2. Kinetic Constants for Hydrolysis of Various Chemicals
substrate
specific activity (μmol minꢀ1 mgꢀ1
)
kcat (sꢀ1
)
Km (μM)
kcat/Km (μMꢀ1 sꢀ1
)
CyB
2.76 ( 0.24
2.45 ( 0.12
3.95 ( 0.21
4.12 ( 0.25
2.15 ( 0.11
2.02 ( 0.12
0.11 ( 0.01
0
1.53 ( 0.13
1.27 ( 0.06
2.19 ( 0.12
2.43 ( 0.12
1.21 ( 0.04
1.15 ( 0.03
0.05 ( 0.01
0
0.41 ( 0.04
0.35 ( 0.02
0.36 ( 0.03
0.37 ( 0.02
0.59 ( 0.03
0.61 ( 0.04
0.17 ( 0.02
NMa
3.73
3.63
6.08
6.57
2.05
1.89
0.29
NMa
NMa
NMa
fluazifop-P-butyl
fenoxaprop-P-ethyl
quizalofop-P-ethyl
diclofop-methyl
haloxyfop-P-methyl
permethrin
bifenthrin
malathion
0
0
NMa
NMa
p-nitrophenyl acetate
0
0
a NM, not measurable. Km and kcat/Km could not be calculated due to no specific activity data available.
around the colony was screened from approximately 5000
transformants. The inserted fragment in the transformant was
5560 bp and contained four complete ORFs. The four ORFs were
then subcloned into the linear vector pMD18-T and transformed
into competent E. coli DH5R. One ORF was confirmed to be the
target gene encoding the CyB-hydrolyzingesterase. Thisgenewas
designated chbH. Sequence analysis indicated that the chbH gene
consisted of 996 bp encoding a protein of 332 amino acids. The
deduced protein was compared with the known enzymes available
from the Protein Data Bank (NCBI database). ChbH showed the
highest similarity with several hypothetical proteins (esterase or
hydrolase), for example, a lactone-specific esterase from Pseudo-
monas fluorescens (82% identity), a hydrolase or acyltransferase
from Ralstonia eutropha H16 (50% identity), and an R/ hydrolase
from Burkholderia multivorans ATCC 17616 (48% identity).
Esterases are a group of related enzymes that catalyze the
hydrolysis of a wide range of ester-containing endogenous and
xenobiotic compounds. They are involved in the degradation or
detoxification of numerous toxic pesticides and drugs in microbes,
animals, and plants. Some esterase genes responsible for the
deesterification of organophosphates, pyrethroids, and carba-
mates have been cloned from pesticide-degrading bacteria.18 To
our knowledge, chbH is the first identified esterase for AOPP
herbicide hydrolysis in microorganisms.
Functional Confirmation of chbH Gene in Strain QDZ-1.
To address the function of chbH gene in strain QDZ-1, a chbH-
disrupted mutant dchbH was constructed by insertion of a
suicide vector pJQ200SK into the chbH gene. The single
recombination event was confirmed by PCR analysis (Figure 3).
The CyB-degrading activities were investigated using wild-
type strain QDZ-1 and mutant dchbH. Wild-type strain QDZ-1
was able to grow on a MSM plate supplemented with 200 mg Lꢀ1
CyB and produced a visible transparent halo due to CyB
degradation around the colony, whereas mutant dchbH could
not, indicating that mutant dchbH lost the CyB-degrading ability
(Figure 4). When wild-type strain QDZ-1 and mutant dchbH
were inoculated on liquid MSM medium supplemented with 100
mg Lꢀ1 CyB, about 75.3% of 100 mg Lꢀ1 CyB initially added was
degraded by strain QDZ-1 within 2 days, whereas no obvious
CyB degradation was observed for mutant dchbH (Table 1). The
results indicated that chbH was the only esterase gene responsible
for the degradation of CyB in strain QDZ-1.
single band on SDS-PAGE (Figure 5). The molecular mass of the
denatured enzyme was approximately 36 kDa, which was in good
agreement with the molecular mass deduced from the amino acid
sequence. HPLC-MS analysis demonstrated that ChbH catalyzed
the hydrolysis of CyB to butyl alcohol and cyhalofop acid
(Figure 6).
The enzyme was strongly inhibited by many metal ions (Ni2þ
,
Cu2þ, Hg2þ, and Zn2þ; 0.5 mM) and surfactants SDS and
Tween 80 (10 mM). Chelating agents EDTA and 1,10-phenan-
throline had little effect on the enzyme activity, indicating that
ChbH apparently had no requirement for metal ions. The
optimal pH was observed to be approximately 7.0. The enzyme
was very stable at pH 6.0ꢀ9.5 and temperature up to 50 °C.
Kinetic Analysis of the Enzyme. The substrate specificities
of the enzyme were tested with various AOPP herbicides,
p-nitrophenyl acetate, malathion, bifenthin, and permethrin, as
the substrates (Table 2). The results indicated that ChbH was
able to hydrolyze all of the AOPP herbicides tested with different
hydrolysis rates, indicating that the enzyme has potential applica-
tions in biotransformation and in situ bioremediation of diphenyl
ester herbicide residues, where they cause environmental con-
tamination problems. Quizalofop-P-ethyl was hydrolyzed most
rapidly; the catalytic efficiency value (kcat/Km) of fenoxaprop-
P-ethyl was a little lower than that of quizalofop-P-ethyl, but was
about 1.7-fold higher than that of CyB and fluazifop-P-butyl and
about 3.0-fold higher than that of diclofop-methyl and haloxyfop-
P-methyl. The results indicated that the chain length of the
alcohol moiety strongly affected the biodegradability of the
AOPP herbicides. However, to our surprise, different AOPP
herbicides with the same alcohol moiety have about the same
degradation efficiencies, suggesting that the substitutions in the
aromatic ring have only slight influence on the degradation
efficiency. ChbH showed weak activity to permethrin (a kind
of pyrethroid pesticide). No hydrolysis activities were observed
when p-nitrophenyl acetate, malathion, and bifenthin were used
as substrates. AOPP herbicides and permethrin have an arylox-
yphenoxy group, whereas p-nitrophenyl acetate, malathion, and
bifenthrin have no such structure. These results suggested that
maybe the aryloxyphenoxy group was necessary for the enzymeꢀ
substrate interaction.
’ AUTHOR INFORMATION
Gene Expression and Purification of the Recombinant
ChbH. The recombinant ChbH was produced in E. coli BL21-
(DE3) and purified from the crude extract using Niꢀnitrilotriace-
tic acid affinity chromatography. The purified enzyme gave a
Corresponding Author
*E-mail: hejian@njau.edu.cn. Phone: þ86-25-84396685. Fax:
þ86-25-84396314.
6045
dx.doi.org/10.1021/jf200397t |J. Agric. Food Chem. 2011, 59, 6040–6046

Journal of Agricultural and Food Chemistry
ARTICLE
Author Contributions
Both authors contributed equally to this work.
(18) Wang, B. Z.; Guo, P.; Hang, B. J.; Li, L.; He, J.; Li, S. P. Cloning
of a novel pyrethroid-hydrolyzing carboxylesterase gene from Sphingo-
bium sp. strain JZ-1 and characterization of the gene product. Appl.
Environ. Microbiol. 2009, 75, 5496–5500.
Funding Sources
This work was supported by the National Natural Science
Foundation of China (30830001, 30970099) and the Transfor-
mation Fund for Agricultural Science and Technology Achieve-
ments (2009GB23600516).
(19) Wang, B. Z.; Guo, P.; Zheng, J. W.; Hang, B. J.; Li, L.; He, J.; Li,
S. P. Sphingobium wenxiniae sp. nov., a synthetic pyrethroids-degrading
bacterium isolated from activated sludge of a SPs-manufacturing waste-
water treatment facility. Int. J. Syst. Evol. Microbiol. 2010, doi:10.1099/
ijs.0.023309-0.
(20) Wayne, L. G.; Brenner, D. J.; Colwell, R. R. International
Committee on Systematic Bacteriology. Report of the ad hoc committee
on reconciliation of approaches to bacterial systematics. Int. J. Syst.
Bacteriol. 1987, 37, 463ꢀ464.
’ REFERENCES
(1) Bradford, M. M. A rapid and sensitive method for the quantita-
tion of microgram quantities of protein utilizing the principle of
proteinꢀdye binding. Anal. Biochem. 1976, 72, 248–254.
(2) Buendía, J.; Barotti, R.; Fullick, K.; Thompson, A.; Velilla, J.
Cyhalofop, a new postemergence herbicide for grass control in rice. In
6th EWRS Mediterranean Symposium, Montpellier, France, 1998.
(3) Chun, J.; Lee, J.-H.; Jung, Y.; Kim, M.; Kim, S.; Kim, B. K.; Lim,
Y. W. EzTaxon: a web-based tool for the identification of prokaryotes
based on 16S ribosomal RNA gene sequences. Int. J. Syst. Evol. Microbiol.
2007, 57, 2259–2261.
(4) Cowan, S. T.; Steel, K. J. Manual for the Identification of Medical
Bacteria; Cambridge University Press: London, U.K., 1965.
(5) Ezaki, T.; Hashimoto, Y.; Yabuuchi, E. Fluorometric deoxyribo-
nucleic acid-deoxyribonucleic acid hybridization in microdilution wells
as an alternative to membrane filter hybridization in which radioisotopes
are used to determine genetic relatedness among bacterial strains. Int. J.
Syst. Bacteriol. 1989, 39, 224–229.
(6) Lane, D. J. 16S/23S rRNA sequencing. In Nucleic Acid Techni-
ques in Bacterial Systematics; Stackebrandt, E., Goodfellow, M., Eds.;
Wiley: Chichester, U.K., 1991; pp 115ꢀ175.
(7) Lang, B.; Zhao, Y. K.; Lu, P.; Li, S. P.; Huang, X. Biotransforma-
tion of the diphenyl ether herbicide lactofen and purification of a
lactofen esterase from Brevundimonas sp. LY-2. J. Agric. Food Chem.
2010, 58, 9711–9715.
(8) Liang, W. Q.; Wang, Z. Y.; Li, H.; Wu, P. C.; Hu, J. M.; Luo, N.;
Cao, L. X.; Liu, Y. H. Purification and characterization of a novel
pyrethroid hydrolase from Aspergillus niger ZD11. J. Agric. Food Chem.
2005, 53, 7415–7420.
(9) Jackson, R.; Douglas, M. An aquatic risk assessment for cyhalo-
fop-buthyl: a new herbicide for control of barnyard grass in rice. XI
Symposium Pesticide Chemistry: Human and Environmental Exposure to
Xenobiotics, Cremona, Italy, 1999; pp 345ꢀ354.
(10) Jilisa, K. M.; Zhu, G. N.; Zhao, L.; Chen, Y. X. Degradation of
cyhalofop-butyl in soil. Acta Agric. Zhejiangensis 2002, 14 (4), 205–209.
(11) Mandel, M.; Marmur, J. Use of ultraviolet absorbanceꢀ
temperature profile for determining the guanine plus cytosine content
of DNA. Methods Enzymol. 1968, 12B, 195–206.
(12) Maria, V. P.; Ilaria, B.; Sonia, B.; Carlo, E. G.; Alba, P.
Hydrolysis and adsorption of cyhalofop-butyl and cyhalofop-acid on
soil colloids. J. Agric. Food Chem. 2008, 56 (13), 5273–5277.
(13) Quandt, J.; Hynes, M. F. Versatile suicide vectors which allow
direct selection for gene replacement in Gram-negative bacteria. Gene
1993, 127, 15–21.
(14) Sambrook, J.; Russell, D. W. Molecular Cloning: a Laboratory
Manual, 3rd ed.; Cold Spring Harbor Laboratory: Cold Spring Harbor,
NY, 2001.
(15) Smith-Grenier, L. L.; Adkins, A. Isolation and characterization
of soil microorganisms capable of utilizing the herbicide diclofop-methyl
as a sole source of carbon and energy. Can. J. Microbiol. 1996, 42 (3),
227–233.
(16) Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: molecular
evolutionary genetic analysis (MEGA) software version 4.0. Mol. Biol.
Evol. 2007, 24, 1596–1599.
(17) Thompson, J. D.; Gibson, T. J.; Plewniak, F.; Jeanmougin, F.;
Higgins, D. G. The CLUSTAL-X windows interface: flexible strategies
for multiple sequence alignment aided by quality analysis tools. Nucleic
Acids Res. 1997, 25, 4876–4882.
6046
dx.doi.org/10.1021/jf200397t |J. Agric. Food Chem. 2011, 59, 6040–6046