Synthesis of novel caffeic acid derivatives and their protective effect against hydrogen peroxide induced oxidative stress via Nrf2 pathway

Article abstract of DOI:10.1016/j.lfs.2020.117439

Aim: This study was aimed to synthesize novel caffeic acid derivatives and evaluate their potential applications for the treatment of oxidative stress associated disease. Main methods: Caffeic acid sulfonamide derivatives were synthesized by coupling sulf

Full text of DOI:10.1016/j.lfs.2020.117439

Journal Pre-proof
Synthesis of novel caffeic acid derivatives and their protective
effect against hydrogen peroxide induced oxidative stress via Nrf2
pathway
Xiaoyu Peng, Gang Wu, Anran Zhao, Kelin Huang, Ling Chai,
Bharathi Natarajan, Songxin Yang, Hailan Chen, Cuiwu Lin
PII:
S0024-3205(20)30187-9
https://doi.org/10.1016/j.lfs.2020.117439
LFS 117439
DOI:
Reference:
To appear in:
Life Sciences
Received date:
Revised date:
Accepted date:
25 December 2019
3 February 2020
14 February 2020
Please cite this article as: X. Peng, G. Wu, A. Zhao, et al., Synthesis of novel caffeic acid
derivatives and their protective effect against hydrogen peroxide induced oxidative stress
via Nrf2 pathway, Life Sciences(2020), https://doi.org/10.1016/j.lfs.2020.117439
This is a PDF file of an article that has undergone enhancements after acceptance, such
as the addition of a cover page and metadata, and formatting for readability, but it is
not yet the definitive version of record. This version will undergo additional copyediting,
typesetting and review before it is published in its final form, but we are providing this
version to give early visibility of the article. Please note that, during the production
process, errors may be discovered which could affect the content, and all legal disclaimers
that apply to the journal pertain.
© 2020 Published by Elsevier.

Journal Pre-proof
Synthesis of novel caffeic acid derivatives and their protective effect against hydrogen
peroxide induced oxidative stress via Nrf2 pathway
Xiaoyu Peng1,3, Gang Wu 2, Anran Zhao4, Kelin Huang3, Ling Chai5, Bharathi Natarajan6,
Songxin Yang2, Hailan Chen*2, Cuiwu Lin*1
1 School of Chemistry and Chemical Engineering, Guangxi University, Nanning, Guangxi, 530004,
China
2 College of Animal Science and Technology, Guangxi University, Nanning, Guangxi, 530005,
China
3 China Academy of Science and Technology Development Guangxi Branch, Nanning, Guangxi
530022, China
4 First affiliated hospital of Guangxi Medical University, Nanning, Guangxi, 530021, China
5
Guangxi Key Laboratory of Traditional Chinese Medicine Quality Standards, Guangxi Institute
of Traditional Medical and Pharmaceutical Sciences, Nanning, Guangxi, 530022, China
6 College of Medicine, Jiaxing University, Jiaxing, Zhejiang, 314001, China
Corresponding author:
Dr. Hailan Chen
Room 124, College of Animal Science and Technology, Guangxi University,
100 Daxue Road, Xixiangtang District, Nanning, Guangxi 530004, China
Fax: +86-771-3270149;
Tel: +86-771-3235635;
E-mail: hlchen319@163.com
Dr. Cuiwu Lin
Room 114, School of Chemistry and Chemical Engineering, Guangxi University,
100 Daxue Road, Xixiangtang District, Nanning, Guangxi 530004, China
Fax: +86-771-3275878;
Tel: +86-771-3233718;
E-mail: cuiwulin@163.com
1

Journal Pre-proof
Abstract
Aim: This study was aimed to synthesize novel caffeic acid derivatives and evaluate their
potential applications for the treatment of oxidative stress associated disease.
Main methods: Caffeic acid sulfonamide derivatives were synthesized by coupling sulfonamides
to the backbone of caffeic acid and fully characterized by melting points test, FT-IR, MS, NMR,
UV-vis and n-octanol–water distribution assay. Their free radical scavenging ability was evaluated
using DPPH assay and cytotoxicity against A549 cells were determined by MTT assay. The
protective effect of these derivatives against hydrogen peroxide (H2O2) induced oxidative injury
was assessed in A549 cells from cell viability, production of reactive oxygen species (ROS) and
malondialdehyde (MDA), alternation of antioxidase activities, and expressions of Nrf2 and its
target genes.
Key findings: Six novel caffeic acid sulfonamide derivatives were obtained. The derivatives
showed better liphophilicity than the parent caffeic acid. CASMZ, CAST and CASQ exhibited
similar DPPH scavenging capability as caffeic acid, while the protection of hydroxyl groups on
the benzene ring with acetyl groups caused decrease in radical scavenging activity. No inhibitory
effect on the proliferation of A549 cells were observed up to a concentration of 50 μM.
Pretreatment of cells with these derivatives strongly inhibited H2O2 induced decrease of cell
viability, reduced the production of ROS and MDA, promoted antioxidase activities, and further
upregulated the expression of Nrf2 and its target genes.
Significance: Caffeic acid sulfonamide derivatives were synthesized with simple reactions under
mild conditions. They might protect cells from H2O2-induced oxidative injury via Nrf2 pathway.
Key words: caffeic acid sulfonamide derivative, free radical, H2O2, oxidative stress, Nrf2
1 Introduction
Reactive oxygen species (ROS), including oxygen superoxide anion (O2·-), hydrogen
peroxide (H2O2), hydroxyl radical (·OH), and nitric oxide (NO), are the middle products of normal
metabolism in human or animal body playing important roles in signal transduction and regulation
of cell functions [1, 2]. However, large amounts of ROS are produced under the conditions of
bacterial and viral infection, heavy metal exposure, stress, radiation, chemotherapy drugs
2

Journal Pre-proof
administration, and other pathological conditions. When the balance between the production of
ROS and their clearance by endogenous antioxidative system is destroyed, oxidative stress is
created [3]. Excess ROS can damage cell proteins, lipids, DNA, and other cellular components,
leading to cell death and tissue injury. Researchers believe that free radicals induced
macromolecules destroy and cell damage is the basic cause of aging, cancer and other diseases [4].
Modern medicine and free radical science have also increasingly shown that free radicals are
closely associated to many diseases, such as cancer, arteriosclerosis, myocardial ischemia
reperfusion injury, cataracts, neurological disorders, hypertension, arthritis and rheumatoid
arthritis [5, 6]. Many studies suggested that the use of exogenous antioxidants can eliminate
excess ROS, alleviate oxidative stress induced cell and tissue injury, and is helpful for the
treatment of oxidative stress-related diseases [7, 8].
Caffeic acid is a secondary metabolite of plants which is found in almost all plants.
Antioxidative, anti-cancer and anti-virus activities have been frequently reported in studies on
caffeic acid [9, 10]. However, the low solubility and compatibility of caffeic acid in common
solvent systems, difficulties in penetrating biomembranes, and the limited availability of natural
derivatives of caffeic acid, are limiting the widely application of caffeic acid in the biomedical
field [11, 12]. In recent years, the chemical modification of caffeic acid produce various
derivatives and these new compounds exhibit excellent scavenging capability on free radicals and
strong inhibitory activity on lipid peroxidation [13]. For example, caffeic acid phenethyl ester
(CAPE) could decrease the levels of malondialdehyde (MDA), myeloperoxidase (MPO) and
catalase (CAT), and increase the activities of superoxide dismutase (SOD) and xanthine oxidase
(XO) in the lung tissue of burned rats [14, 15]. Thus, the synthesis of caffeic acid derivatives not
only maintain its biological activity, but also expand the scope of applications.
In our previous studies, several active phenolic acids, including caffeic acid,
chlorogenic acid and gallic acid, have been isolated from Blumea riparia DC. Series
phenolic acid derivatives were synthesized by modulating the chemical structure of these
phenolic acids. Obtained compounds exhibited strong activities of antioxidation, thrombin
inhibition, anticancer and chondrocytes proliferative promotion [16-18]. In this study, six
novel caffeic acid sulfonamide derivatives were synthesized through simple reaction steps under
mild conditions. Their physicochemical properties were fully characterized using melting points
3

Journal Pre-proof
(mp), mass spectra (MS), nuclear magnetic resonance (NMR), Fourier transfer-infrared
spectrometry (FT-IR), and ultraviolet spectroscopy (UV). Their radical scavenging activity was
evaluated by DPPH assay and cytotoxicity was determined via MTT assay. Their protective effect
against oxidative stress associated damage was studied using H2O2-induced oxidative stress A549
cell models according to cell viability, ROS and MDA production, endogenous antioxidative
enzymes activities and transcription of Nrf2 pathway associated genes.
2 Material and methods
2.1 Material
Caffeic acid with a purity of 99% was purchased from Zhuhai Jiaxinkang Pharmaceutical
Technology Co. (Zhuhai, China). Sulfamethoxazole (SMZ), sulfathiazole sodium (ST) and
4-amino-N-(2-quinoxalinyl)benzenesulfonamide sodium (SQ-Na) were purchased from Shenzhen
Remote Technology Development Co. 2,7-dichlorodi-hydrofluorescein diacetate (DCFH-DA) and
3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazoliumbromide (MTT) were bought from
Sigma–Aldrich, USA. High glucose Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine
serum (FBS), penicillin sodium and streptomycin were purchased from Gibco, USA. Commercial
kits for the determination of malondialdehyde (MDA) contents and activities of superoxide
dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) were obtained from
Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). Other reagents in research grade
were supplied by Xilong Scientific Co. and were used as received.
2.2 Synthesis of caffeic acid sulfonamide derivatives
Caffeic acid sulfonamide derivatives were prepared from caffeic acid and SMZ, ST or SQ-Na
following the synthetic scheme in Fig.1. Firstly, 9.0 g caffeic acid was reacted with 80 mL acetic
anhydride at room temperature for 24 h, followed by a concentration process using rotary
evaporation. The obtained product was purified by recrystallizing in ethanol and then reacted with
thionyl
chloride
(SOCl2)
to
produce
the
intermediate
produce
of
(E)-4-(3-chloro-3-oxoprop-1-en-1-yl)-1-2-phenlene diacetate (CPD). CPD was then dissolved in
45 mL tetrahydrofuran (THF) by stirring for 1 min and standing for 12 hours without stirring at
room temperature. SMZ, ST or SQ-Na and 10 mL of pyridine was added sequentially to above
solution. The mixture was stirred at 0 °C for 6 hours and at room temperature for another 24 hours.
Upon completion, THF and pyridine was removed by vacuum evaporation. Obtained product was
4

Journal Pre-proof
washed by distilled water and purified by recrystallizing in a THF-methanol system. One kind of
white powder and two kind of pale yellow power were obtained and named as
(Z)-4-(3-(4-(N-(5-methylisoxazol-3-yl)sulfamoyl)phenylamino)-3-oxoprop-1-enyl)-1,2-phenylene
diacetate (ACASMZ), (Z)-4-(3-oxo-3-(4-(N-thiazol-2-ylsulfamoyl)phenylamino)prop-1-enyl)-
1,2-phenylene diacetate (ACAST) and (Z)-4-(3-oxo-3-(4-(N- quinoxalin-2-ylsulfamoyl)
phenylamino)prop-1-enyl)-1,2-phenylene diacetate (ACASQ), respectively. Acetyl groups
protecting hydroxyl groups on the benzene ring of ACASMZ, ACAST and ACASQ were removed
by reacting with hydrochloric acid in THF at 55°C for 4 hours. After removing excess THF
solvent
and
purifying
by
recrystallization,
(Z)-3-(3,4-dihydroxyphenyl)-N-(4-(N-
(5-methylisoxazol-3-yl)sulfamoyl)phenyl)acrylamide (CASMZ), (Z)-3-(3,4-dihydroxyphenyl)-
N-(4-(N-thiazol-2-ylsulfamoyl)phenyl)acrylamide (CAST) and (Z)-4-(3-oxo-3-(4-(N-thiazol-2-
ylsulfamoyl)phenylamino)prop-1-enyl)-1,2-phenylene diacetate (CASQ) were obtained.
Fig. 1 Synthesis route of caffeic acid sulfonamide derivatives.
2.3 Characterization of caffeic acid sulfonamide derivatives
The mp of obtained caffeic acid sulfonamide derivatives were measured using an XT-4 micro
melting apparatus (Beijing Tech Instruments, China). Electrospray ionization mass spectra
(EIS-MS) was recorded by Shimadzu LC-MS 2010A (Shimadzu，Japan). 1H-NMR and 13C-NMR
spectra scanning were carried out at 25°C using a Bruker Advance III 300 (Bruker, Swiss). The
5

Journal Pre-proof
1
frequency for H-NMR and 13C-NMR were set as 400 Hz and 125 Hz, respectively. For the
description of the spin multiplicities, ―s‖ represented ―singlet‖ and d denoted ―duplet‖. FT-IR
spectra were measured on a Nicolet 380 spectrophotometer (Thermo Fisher Scientific, USA). The
UV absorption spectra was determined using an UV-2600 (Shimadzu, Japan).
ACASMZ: C23H21N3O8S, white powder, ESI-MS: 498[M-H]- mp: 244-246 ℃; 1H-NMR (300
MHz, DMSO-d6): δ11.25 (s, 1H, SO2-NH), 10.57 (s, 1H, CO-NH), 7.76 (d, J =9.1 Hz, 4H,
4×Ar-H), 7.52 (d, J =8.2 Hz, 2H, Ar-H), 7.49 (s, 1H, Ar-H), 7.25 (d, J = 15.1 Hz, 1H, CO-CH), 6.7
(d, J =15.7 Hz, 1H, Ar-CH), 6.03 (s, 1H, C-CH), 2.30 (d, J =0.6 Hz, 9H, C-CH3). 13C-NMR (75
MHz, DMSO): δ 168.77, 164.26, 150.07, 145.58, 143.60, 142.82, 139.89, 134.90, 133.92, 128.94,
126.67, 125.71, 125.21, 119.25, 20.89, 12.68.
CASMZ: C19H17N3O6S, light yellow powder, ESI-MS: 414[M-H]-; mp: 258-260℃; 1H-NMR
(300 MHz, DMSO-d6): 11.23 (s, 1H, SO2-NH), 10.39 (s, 1H, CO-NH), 9.55-9.24 (s, 2H, Ar-OH),
7.90-7.76 (d, J =9.08 Hz, 4H, 4×Ar-H), 7.26 (d, J = 15.55 Hz, 1H, CO-CH), 6.96(d, J =8.2 Hz,,
2H, Ar-H), 6.69 (s, 1H, Ar-H), 6.45 (d, J =15.6 Hz, 1H, Ar-CH), 6.08(s, 1H, C-CH), 2.30(d, J =0.6
Hz, 3H, C-CH3). 13C-NMR (75 MHz, DMSO) δ170.74, 168.77, 165.02, 158.29, 151.55, 150.09,
145.11, 143.35, 143.83, 142.83, 139.90, 134.94, 129.15, 124.71, 123.18, 119.25, 106.05, 12.68.
ACAST: C22H19N3O7S2, yellow powder, ESI-MS:500[M-H]-; mp: 142-145℃; 1H-NMR(300
MHz, DMSO-d6): δ 12.59 (s, 1H, SO2-NH), 10.51 (s, 1H, CO-NH), 7.83-7.58 (d, J =8.89 Hz, 4H,
4×Ar-H), 7.50 (d, J = 15.1 Hz, 1H, CO-CH), 7.41 (d, J = 4.6 Hz, 1H, S-CH), 7.37 (d, J =1.9 Hz,
2H, Ar-H), 7.20 (d, J = 4.6 Hz, 1H, N-CH), 7.09 (d, J = 8.3 Hz, 1H, Ar-H), 6.69 (d, J =15.7 Hz,
1H, Ar-CH), 2.14(d, J =4.6 Hz, 6H, C-CH3). 13C-NMR (75 MHz, DMSO) δ169.27, 168.73,
164.07, 143.54, 142.81, 139.88, 136.87, 133.66, 127.61, 126.69, 124.89, 123.14, 119.30, 118.74,
108.77, 20.88.
1
CAST: C18H15N3O5S2, yellow powder, ESI-MS:416[M-H]-; mp:176-179℃; H-NMR(300
MHz, DMSO-d6): 10.94 (s, 1H, SO2-NH), 10.53 (s, 1H, CO-NH), 7.87-7.76 (d, J =8.89 Hz, 4H,
4×Ar-H), 7.49 (d, J = 15.1 Hz, 1H, CO-CH), 7.19 (d, J = 4.6 Hz, 1H, S-CH), 7.02(d, J =1.9 Hz,
2H, Ar-H), 6.82 (d, J = 4.6 Hz, 1H, N-CH), 6.79 (d, J = 8.3 Hz, 1H, Ar-H), 6.63 (d, J =15.6 Hz,
1H, Ar-CH). 13C-NMR (75 MHz, DMSO) δ169.25, 165.05, 148.31, 146.06, 143.14, 142.34,
136.66, 127.46, 126.42, 124.95, 121.64, 119.19, 118.46, 116.23, 114.74.
1
ACASQ: C27H22N4O7S, white powder, ESI-MS:545[M-H]-; mp: 242-244℃; H-NMR(300
6

Journal Pre-proof
MHz, DMSO-d6): δ 12.01 (s, 1H, SO2-NH), 10.59 (s, 1H, CO-NH), 8.59 (s, 1H, N-CH), 7.95 (d, J
=8.8 Hz, 4H, 4×Ar-H), 7.83 (d, J = 15.7 Hz, 1H, CO-CH), 7.70 (d, J = 8.5 Hz, 1H, Ar-H), 7.56 (d,
J = 10.30 Hz, 2H, C-CH), 7.51 (d, J = 10.30 Hz, 2H, CH-CH), 7.49 (s, 1H, Ar-H), 7.27 (d, J = 8.5
Hz, Ar-H), 6.73 (d, J = 15.7 Hz, 1H, Ar-CH), 2.21 (d, J = 2.29 Hz, 6H, CO-CH3). 13C-NMR (75
MHz, DMSO) δ168.74, 164.26, 146.63, 143.58, 143.34, 142.81, 139.95, 133.80, 131.39, 129.21,
128.78, 128.35, 127.88, 127.03, 126.68, 124.73, 123.18, 119.16, 118.63, 118.52, 118.06, 20.81.
1
CASQ: C23H18N4O5S, yellow powder, ESI-MS:461[M-H]-; mp:255-258℃; H-NMR(300
MHz, DMSO-d6): 11.79 (s, 1H, SO2-NH), 10.47 (s, 1H, CO-NH), 9.44 (s, 1H, Ar-OH), 9.18 (s, 1H,
Ar-OH), 8.54 (s, 1H, N-CH), 7.90 (d, J =8.3 Hz, 4H, 4×Ar-H), 7.60 (d, J = 7.3 Hz, 2H, C-CH),
7.50 (d, J = 7.5 Hz, 2H, CH-CH), 7.35 (d, J = 15.5 Hz, 1H, CO-CH), 6.87 (dd, J = 1.9 Hz, 2H,
Ar-CH), 6.69 (d, J = 8.1 Hz, 1H, Ar-H), 6.43 (d, J = 15.6 Hz, 1H, Ar-CH). 13C-NMR (75 MHz,
DMSO) δ165.53, 165.03, 148.57, 146.65, 146.10, 144.11, 142.62, 131.40, 128.93, 127.95, 126.42,
121.65, 118.45, 118.26, 116.30, 114.49.
2.4 Lipophilicity determination
N-octanol–water distribution coefficient was used to determine the lipophilicity of caffeic
acid sulfonamide derivatives. Firstly, series concentrations of caffeic acid sulfonamide derivatives
in PBS saturated n-octanol were prepared and absorbance at respective peak wavelength was
measured to plot the standard curves. To determine the lipophilicity of these caffeic acid
derivatives, 40 μL of the derivatives (5 μM) was added into 10 mL of PBS saturated n-octanol and
thoroughly mixed with a vortex. The obtained emulsion was then centrifuged at 4000 rpm for 5
min to separate the aqueous and organic phases. The UV absorption of caffeic acid derivatives in
the organic phase was measured and their concentrations were determined according to respective
standard curves. Log P was defined as the logarithm of the ratio between the compound
concentration in the organic and that in the aqueous phases, and calculated as
Log[C(organic)]/[C(aqueous) ] [19]. C(organic) and C(aqueous) represent the concentration of caffeic acid
sulfonamide derivatives in the organic and aqueous phase, respectively.
2.5 DPPH Scavenging capacity evaluation
DPPH assay was used to evaluate the radical scavenging capacity of synthesized caffeic acid
sulfonamide derivatives. Briefly, 3.94 mg DPPH was dissolved in 100 ml of anhydrous ethanol
and 2 mL of this solution was mixed with series concentrations of derivatives in ethanol. The
7

Journal Pre-proof
mixture was kept at room temperature in dark for 30 min before measuring the absorbance at 519
nm using an UVmini-1285 (Shimadzu, Japan). The DPPH scavenging activity was calculated as
percentage of (A(control) – A(sample))/A(control). A(control) and A(sample) represent the absorbance of control
sample and samples with caffeic acid sulfonamide derivatives, respectively.
2.6 In vitro cytotoxicity assay
Human lung carcinoma A549 cells, purchased from the cell bank of the Chinese Academy of
Science (Shanghai, China), were cultured in completed DMEM medium supplemented with 10%
fetal bovine serum, 100 U/mL of penicillin and 100 U/mL streptomycin. They were maintained in
humidified atmosphere at 37°C with 5% CO2. The cytotoxicity of synthesized compounds against
A549 cells was evaluated to access their potential safety issues using MTT assay. Briefly, cells
were seeded in 96-well plates with a concentration of 5×104 cells/mL and 100 μL per well. After
12 h, the supernatant was replaced with new medium containing series concentrations of caffeic
acid sulfonamide derivatives and cells were cultured for another 48 h later. The medium was
discarded and 100 μL of MTT (0.5 mg/mL in DMEM) was added into each well. After incubating
at 37°C for another 4 h, the supernatant was carefully removed and the purple MTT crystals were
dissolved in DMSO. The absorbance at 490 nm were measured using a multi-functional
microplate reader (TECAN, Switzerland) and cell viability was calculated as percentage of (OD(test)
– OD(blank))/(OD(control)- OD(blank)). OD(control) and OD(test) represent the optical density of cells
without and with caffeic acid sulfonamide derivatives pre-treatment, respectively. OD(blank) denote
the optical density of wells without cells and drugs.
2.7 Effects of caffeic acid sulfonamide derivatives on H2O2 induce oxidative stress
2.7.1 Determination of H2O2 concentration
A549 cells were cultured in 96-well plates with 5000 cells per well for 36 h and then
incubated in series concentrations of H2O2 diluted with serum-free culture medium for 4 h.
Cell viability was measured according to the method described in 2.6. The concentration of
H2O2 causing around 50% decrease in cell viability was selected for following experiments
and the concentration was determined to be 800 μM.
2.7.2 Cell viability
A549 cells were seeded into 96-well plates with a concentration of 5x104 cell/mL and
100 μL per well. After overnight cultured, cells were treated with series concentration of
8

Journal Pre-proof
caffeic acid sulfonamide derivatives for 24 h, followed by administration with 800 μM of
H2O2 for 4 h. Cell viability was measured following the procedure described in 2.6.
2.7.3 ROS generation
To analyze the ROS production, cells cultured in 12-well and 48-well plates were treated
with caffeic acid sulfonamide derivatives (12.5 μM) for 24 h and then administrated with H2O2
(800 μM) for 4 h. Cells in 24-well plates were collected using trypsin and incubated with 10 µM
of DCFH-DA in serum free DMEM at 37°C for 30 min in dark, followed by washing twice with
serum-free DMEM. Fluorescence intensity was measured using a flow cytometry (BD, USA) and
data was analyzed using FlowJo software. Cells cultured in 48-well plates were labeled with
DCFH-DA and imaged on an inverted microscope (Nikion, Japan).
2.7.4 MDA production
Cells were cultured in 6-well plates with a concentration of 5x104 cell/mL and 2 mL per well.
After treating with 12.5 μM of caffeic acid sulfonamide derivatives for 24 h, cells were then
administrated with 800 μM of H2O2 for 4 h. Cells were harvested using 0.25% trypsin followed
and collected by centrifugation at 1500 rpm for 5 min. These cells were disrupted by
ultrosonication on ice, followed by centrifugation at 3000 rpm for 10 min at 4°C. MDA levels in
the supernatant were measured using commercial assay kits following the manufacturer’s
instructions.
2.7.5 Intracellular antioxidative enzyme activities analysis
The activities of SOD, GSH-Px and CAT in the supernatant prepared in 2.6.5 were analyzed
using commercial assay kits according to the manufacturer’s instructions.
2.7.6 mRNA levels of Nrf2 pathway associated genes
Cells in control, model group and caffeic acid sulfonamide derivatives treated groups were
lysed using Trizol and total mRNA was extracted using Total RNA Extraction Reagent (Vazyme,
China). mRNA was reverse transcribed into cDNA using HiScript III RT SuperMix for qPCR kit
(Vazyme, China). SYBR-Green I PCR kit (Vazyme, China) was used to amplify cDNA using the
following conditions: initial denaturation at 95°C for 30 sec, followed by 35 amplification cycles
at 95°C for 10 sec, 55°C for 10 sec, 72°C for 15 sec, and a final extension at 72°C for 10 min.
β-actin was used as an internal reference gene. Relative values for mRNA levels were calculated
using 2-ΔΔCq methods and presented as fold change of internal reference gene β-actin. Primers used
9

Journal Pre-proof
for Nrf2, NQO1, HO-1 and TXNRD1 are listed in table 1.
Table 1 Sequence of the primers for qRT-PCR.
Gene
Nrf2
Forward primer (5’→3’)
GAGACAGGTGAATTTCTCCCAAT
AAGAAAGGATGGGAGGTGGT
GGAACTAGATGGGGTCTCGG
AAGACTGCGTTCCTGCTCAAC
GATCATTGCTCCTCCTGAGC
Reverse primer (5’→3’)
GGGAATGTGGGCAACCTGGG
GCTTCTTTTGTTCAGCCACA
TCTTGCAGGGCTTGTCCTAA
AAAGCCCTACAGCAACTGTCG
ACTCCGCTTGCTGATCCAC
NQO1
TXNRD1
HO-1
β-actin
2.8 Statistical analysis
All assays were repeated at least thrice. Data were presented as means ± SD. For all statistical
comparison, one way analysis of variance (ANOVA) followed by LSD post hoc test was used. P
value < 0.05 was considered as statistically significant.
3 Results
3.1 Characterization of caffeic acid sulfonamide derivatives
The six compounds were characterized by melting points test and it was found that ACAST
exhibited the lowest mp of 142-145℃, and CASMZ showed the highest mp of 258-260℃. From
the ESI-MS results, the molecular ion peaks of m/z for these caffeic acid sulfonamide derivatives
range from 414 to 545 (Fig .S1 - S6). The NMR spectra showed that the proton of the SO2-SH
group were highly reactive and the proton peak corresponding to this proton disappeared after
exchange with heavy water. The proton peaks denoting the –OH group of CASMZ, CAST and
CASQ were found at δ 9.55 - 9.18 (Fig. S13 - S18), while the proton peaks for the carbon of the
–CH3 group in ACASMZ, ACAST and ACASQ were appeared at δ 20.81 - 20.80 (Fig. S19 - S24).
In the IR spectra, the absorption peaks of the O-H group in CASMZ, CAST and CASQ were
observed between 3374.61-3525.53 cm-1, whereas the C=O group of ester group in ACASMZ,
ACAST and ACASQ were found between 1765.69-1772.16 cm-1. The absorption peaks of the two
-NH groups were ranged from 3028.85-3263.80 cm-1, and the peaks of C=O group adjacent to the
amide group of sulfonamide were found between 1664.57-1682.34 cm-1.
3.2 Lipophilicity of caffeic acid sulfonamide derivatives
The UV spectra of caffeic acid sulfonamide derivatives in water, ethanol, PBS saturated
10

Journal Pre-proof
n-octanol and n-octanol saturated PBS between 250~600 nm was obtained on a UV-2600
.
There is a sharp absorption peak at ~316 nm and a broad absorption peak at ~340 nm in the
spectrum of CASMZ, CAST and CASQ (Fig. 2A). The protection of hydroxyl groups on
the benzene ring of caffeic acid backbone resulted in the disappearance of the broad peak
at ~340 nm and thus only one sharp peak at ~316 nm was observed at the spectrum of
ACASMZ, ACAST and ACASQ. Similar spectrum was obtained when different solvents
were used and absorption peaks were appeared at the same wavelength. The maximum
peak wavelengths for ACASMZ, CASMZ, ACAST, CAST, ACASQ, CASQ and caffeic acid
were determined to be 316, 342, 316, 338, 316, 342 and 324 nm, respectively.
Standard curves exhibited good linear relationship between the UV absorbance and the
concentrations of caffeic acid derivatives in the PBS-saturated n-octanol with R2 of 0.999
(Fig. 2B). The linear range for caffeic acid was 0.312~5.0 μM and those for all caffeic acid
sulfonamide derivatives were 1.25~20.0 μM. According to standard curves, concentrations
of caffeic acid sulfonamide derivatives in the PBS-saturated n-octanol and that in the
n-octanol saturated PBS were obtained according to their absorbance at peak wavelength.
Their oil-water distribution coefficient (Log P) was calculated according to the
concentration of derivatives in these two phase and results were shown in table 2. The
conjugation of sulfonamides to the backbone of caffeic acid significantly increased its
oil-water distribution coefficient. ACAST exhibited the strongest lipophilicity with an Log
P of 1.6414, followed by CAST, ACASQ, CASQ, ACASMZ, and CASMZ with Log P of
1.4738, 1.1748, 0.9864, 0.6577, 0.3482 and 0.3482, respectively. Protection of hydroxyl
groups in the benzene ring of caffeic acid increases the oil-water distribution coefficient.
However, caffeic acid exhibited a negative Log P of -1.4171
.
11

Journal Pre-proof
Fig. 2 UV spectrum of caffeic acid sulfonamide derivatives (A) and standard curves prepared by
measuring the absorbance at peak wavelength of series concentration of these derivatives in
n-octanol saturated PBS (B).
Table 2 Standard curves and Log P of caffeic acid sulfonamide derivatives.
Compound name
ACASMZ
CASMZ
slope
Y-intercept
0.2235
0.1735
0.2377
0.1724
0.2171
0.1543
0.1773
R2
Log P
0.6577
0.3482
1.6414
1.4738
1.1748
0.9864
-1.4171
0.07376
0.05879
0.08156
0.06593
0.08018
0.0955
0.9999
0.9990
0.9998
0.9994
0.9993
0.9996
0.9994
ACAST
CAST
ACASQ
CASQ
Caffeic acid
0.03432
3.3 DPPH scavenging capacity
From Fig. 3, the radical scavenging rate increased as the concentration of caffeic acid
derivatives increased, exhibiting a dose-dependent manner (Fig. 3). Table 3 showed that
the IC50 is between 40~50 μM for derivatives with two active hydroxyl groups on the
benzene ring, and these derivatives included CASMZ, CAST and CASQ. Protection of
hydroxyl groups with acetyl groups resulted in almost five times higher IC50, which were
182.7, 185.7 and 189.8 μM for ACASMZ, ACAST and ACASQ, respectively.
12

Journal Pre-proof
Fig. 3 Radical scavenging capacity of caffeic acid sulfonamide derivatives.
Table 3 Radical scavenging capacity of caffeic acid sulfonamide derivatives.
Compounds
IC50 (μM）
R2
ACASMZ
182.7
0.9951
CASMZ
ACAST
CAST
42.2
185.7
49.5
0.9986
0.9980
0.9626
0.9970
0.9959
0.9955
ACASQ
CASQ
189.8
45.5
Caffeic acid
40.9
3.4 In vitro cytotoxicity of caffeic acid sulfonamide derivatives against A549 cells
Safety issue is the most important concern in drug develpment. Hence, cytotoxicity of caffeic
acid sulfonamide derivatives was firstly evluated using A549 cells. From Fig. 4, the viability of
A549 cells was higher than 80% of control for all tested derivatives at a concentration ≤200 μM.
Except 200 μM of ACAST (P＜0.05), 200 μM of CAST (P＜0.01), 100 μM (P＜0.05) and 200
μM (P＜0.01) of ACASQ, no significance on cell viability was observed between derivatives
treated cells and control cells.
13

Journal Pre-proof
Fig. 4 Cytotoxicity of caffeic acid sulfonamide derivatives against A549 cells. A: ACASMZ, B:
CASMZ, C: ACAST, D: CAST, E: ACASQ, F: CASQ. *, ** and *** indicate statistical difference
from control in significant levels of P<0.05, P<0.01, P<0.001. (n=4)
3.5 Effect of caffeic acid sulfonamide derivatives on H2O2 induced oxidative stress in A549
cells
3.5.1 Determination of H2O2 concentration
Viability of A549 cells decrease as the concentration of H2O2 increase. Significantly
lower viability was observed in cells treated with H2O2 in concentrations higher than 50
μM (P＜0.05) and the cell viability decreased to 61.61% and 50% when cells were
administrated with 800 μM and 1000 μM H2O2, respectively (Fig. 5). To maintain sufficient
number of cells to study other parameters, 800 μM of H2O2 was chosen for following
experiments.
14

Journal Pre-proof
Fig. 5 Viability of A549 cells administrated with series concentrations of H2O2 for 4 h. *, ** and
*** indicate statistical difference from control in significant levels of P<0.05, P<0.01, P<0.001; #,
## and ### indicate statistical difference from model group in significant levels of P<0.05, P<0.01,
P<0.001. (n=4)
3.5.2 Caffeic acid sulfonamide derivatives reduced H2O2 induced cell death
From Fig. 6, 800 μM H2O2 treatment resulted in ~40% drop in the viability of A549
cells comparing to control. However, pretreatment of cells with series concentration of
caffeic acid sulfonamide derivatives for 24 h significantly inhibited H2O2 induced decrease
of cell viability. Over tested concentrations, the best preventive effect for most of these
derivatives was obtained when a concentration of 12.5 μM was used and thus 12.5 μM was
chosen for the following experiments.
15

Journal Pre-proof
Fig. 6 Viability of A549 cells pretreated with series concentrations of caffeic acid sulfonamide
derivatives for 24 h and then administrated with 800 μM of H2O2 for 4 h. A: ACASMZ, B:
CASMZ, C: ACAST, D: CAST, E: ACASQ, F: CASQ. *, ** and *** indicate statistical difference
from control in significant levels of P<0.05, P<0.01, P<0.001; #, ## and ### indicate statistical
difference from model group in significant levels of P<0.05, P<0.01, P<0.001. (n=4)
3.5.3 Caffeic acid sulfonamide derivatives inhibited ROS generation
The content of ROS generation was analysed by DCFH-DA fluorescent probes using both
flow cytometry and fluorescent microscope. From Fig. 7, brighter green fluorescence and larger
number of green cells were observed in H2O2 group, comparing to control. Pre-treatment of cells
with 12.5 μM of caffeic acid sulfonamide derivatives significantly reduced the green
fluorescent intensity and the number of cells showing bright green color. From the optical
microscopic images, the number of cells in H2O2 group was much smaller than that of control
16

Journal Pre-proof
and those of derivatives treated groups, which was in consistent with cell viability results. From
the flow cytometry results, significantly higher level of ROS content was observed in cells
stimulated with 800 μM H2O2, while derivatives pre-treatment strongly inhibited ROS generation
upon H2O2 stimulation (Fig. 8A). Among these derivatives, CASQ exhibited the strongest
inhibitory effect on ROS generation in H2O2 stimulated cells.
Fig. 7 Optical and fluorescent microscopic images of A549 cells pretreated with 12.5 μM of
caffeic acid sulfonamide derivatives for 24 h and then administrated with 800 μM of H2O2 for 4 h.
Fig. 8 Effect of caffeic acid sulfonamide derivatives on the production of ROS and MDA in A549
cells pretreated with 12.5 μM of caffeic acid sulfonamide derivatives for 24 h and then
administrated with 800 μM of H2O2 for 4 h. *, ** and *** indicate statistical difference from
17

Journal Pre-proof
control in significant levels of P<0.05, P<0.01, P<0.001; #, ## and ### indicate statistical
difference from model group in significant levels of P<0.05, P<0.01, P<0.001. (n=4)
3.5.4 Caffeic acid sulfonamide derivatives reduced MDA production
From Fig. 8B, H2O2 stimulation induced the generation of MDA, showing significantly
higher MDA level compared to control cells (P＜0.001). Pre-treatment of cells with ACASMZ,
CASMZ, ACASQ and CASQ before H2O2 treatment strongly inhibited the production of MDA,
showing significantly lower MDA levels compared to that of model group (P＜0.001). Among
these derivatives, CASMZ and CASQ exhibited the strongest protective effect against H2O2
induced lip peroxidation.
3.5.5 Caffeic acid sulfonamide derivatives increased activities of antioxidative enzymes
Fig. 9 shows the activities of SOD, CAT and GSH-Px, three important endogenous
antioxidative enzymes, after H2O2 stimulation. 800 μM H2O2 treatment significantly reduced the
enzyme activities (P<0.001), while pre-treatment with caffeic acid derivatives strongly attenuated
H2O2 induced reduction of enzyme levels in significant level of 0.05 or 0.001. Among test
derivatives, CASMZ and CASQ exhibited the strongest preventive effect on endogenous
antioxidative enzymes against H2O2 exposure.
18

Journal Pre-proof
Fig. 9 Effect of caffeic acid sulfonamide derivatives on the activities of endogenous antioxidative
enzymes in A549 cells pretreated with 12.5 μM of caffeic acid sulfonamide derivatives for 24 h
and then administrated with 800 μM of H2O2 for 4 h. A: SOD, B: CAT and C: GSH-Px. *, ** and
*** indicate statistical difference from control in significant levels of P<0.05, P<0.01, P<0.001; #,
## and ### indicate statistical difference from model group in significant levels of P<0.05, P<0.01,
P<0.001. (n=4)
3.5.6 Caffeic acid sulfonamide derivatives upregulated critical gene expressions
qRT-PCR was used to analyze the mRNA expression of Nrf2 and Nrf2 target genes upon
H2O2 exposure and relative mRNA expression levels were shown in Fig. 10. It was found that
H2O2 administration stimulate the transcription of Nrf2, HO-1, NQO1 and TXNRD1.
Pre-treatment of cells with caffeic acid sulfonamide derivatives further upregulated the mRNA
levels of these genes. Among the tested derivatives, ACASQ and CASMZ exhibited the strongest
19

Journal Pre-proof
promoted effect on Nrf2 expression, while CASQ and CASMZ presented stronger effect on the
transcription of HO-1, NQO1 and TXNRD1.
Fig. 10 Relative mRNA expression levels of Nrf2 (A), HO-1 (B), NQO1 (C) and TXNRD1 (D) in
A549 cells pretreated with 12.5 μM of caffeic acid sulfonamide derivatives for 24 h and then
administrated with 800 μM of H2O2 for 4 h. *, ** and *** indicate statistical difference from
control in significant levels of P<0.05, P<0.01, P<0.001; #, ## and ### indicate statistical
difference from model group in significant levels of P<0.05, P<0.01, P<0.001. (n=4)
4 Discussion
Based on the free radical theory of aging, Harmna firstly proposed the concept of oxidative
stress in 1956. This theory holds that aging and malignant disease such as cancer are caused by
free radical attack of biological macromolecules induced cell and tissue damages [20]. Studies
have shown that oxidative damage is also directly related to cardiovascular disease,
neurodegeneration, cancer, metabolic syndrome, inflammation and other important diseases [21,
22]. In recent years, researchers have screened and verified many traditional Chinese medicines,
extracts from plants and algae, or well-structured monomers, which exhibit definite activities of
anti-oxidative stress. They are helpful in the treatment of oxidative stress associated disease by
scavenging excess free radicals and enhancing the activity of antioxidative enzymes [23, 24].
Caffeic acid and its derivatives have strong antioxidative activity, which come from the
20

Journal Pre-proof
combination of free radical elimination and metal ion chelation. In this study, six novel caffeic
acid sulfonamides derivatives were synthesized by simple reaction steps under mild conditions. In
particular, the purification procedure is extremely simple, without using complicated separation
technology such as column chromatography. Final product with high purity was obtained via
simple recrystallization based on the difference in physicochemical property between the final
product and the raw materials, making it suitable for industrial production.
The antioxidative capacity of chemical compounds usually depends on the number of
hydroxyl groups, the presence of adjacent hydroxyl groups in the benzene ring, and the number of
hydrogen donor groups (-NH, -SH) [25, 26]. In emulsion systems such as biomenbrane, the
antioxidative activity is also associated to the oil-water Partition Coefficient (Log p) and its
hydrophobicity [26, 27]. In this study, the lipophilicity of the derivatives obtained by conjugating
different sulfonamides to the backbone of caffeic acid was significantly increased, which might be
helpful for their diffusion in the lipid bilayer of cell membranes to exhibit antioxidative effect
inside target cells [28, 29]. The positions and number of hydroxyl groups in the benzene rings of
CASMZ, CAST and CASQ were the same as those of caffeic acid, thus similar IC50 values was
obtained for these derivatives in the DPPH scavenging assays. The protection of hydroxyl groups
on the benzene ring resulted in significant decrease of their radical scavenging ability, showing
much higher IC50 values in the DPPH radical scavenging assays. However, besides chemical
structure characteristics, the antioxidative activity of the chemicals in living cells or organisms
also affected by their absorption and distribution, and a Log p between -1 and 2 is usually
favorable for the chemical to pass through intestinal epithelial cells [28, 29].
Safety issue is a primary concern in drug development, and in vitro cell cytotoxicity assay is
often used to verify the biological safety of chemicals in the very early period of drug
development. The cytotoxicity of caffeic acid sulfonamide derivatives on A549 cells was assessed
by MTT assay in this study. It was found that these derivatives did not show inhibitory effect on
cell growth and proliferation at concentrations below 50 μM, suggesting that these derivatives is
safe to the cells in vitro at concentrations below 50 μM.
H2O2 is a stable reactive oxygen species that can freely crossover cell membrane to enter
cells. In the presence of transition metals, H2O2 convert to highly reactive hydroxyl groups, which
can cause DNA damage and mitochondrial dysfunction, even lead to cell death [30, 31]. Thus,
21

Journal Pre-proof
H2O2 is often used to establish oxidative stress models for the study of oxidative stress-associated
physiological and pathological changes in the organism, and for the evaluation of antioxidative
properties of traditional Chinese medicines, extracts from plants, or well-structured monomers
[32]. In this study, the antioxidative activity of caffeic acid sulfanilamide derivatives was
evaluated by H2O2 induced oxidative stress model in A549 cells, and the functional mechanism
was preliminary studied based on the expression level of Nrf2 and Nrf2 target genes.
The concentration of H2O2 for cell treatment was firstly determined from the viability of
A549 cells administrated with series amount of H2O2. 800 μM of H2O2 caused 40% decrease of
cell viability and it was chosen for the following experiments, because this concentration not only
clearly distinguished the difference between model group and control group, but also reserved
enough cells for the following analysis of oxidative stress products, endogenous antioxidative
enzymes activity and the genes expressions. It is worth to mention that this dose of H2O2 is quite
high comparing to the concentration used in the literature for other kind of cells. It might be
associated with different tolerance of various kind of cells against oxidative stress. A549 is a
cancerous lung epithelial cell that can use oxidative stress to form neo-antigens to escape the host
immune surveillance. Thus, they are more resistant to certain degree of oxidative stress from
serious cell damage comparing to other kind of cells, such as neural cells and primary cells [6].
However, 800 μM of H2O2 can cause 50% drop of cell viability when pig Alveolar macrophage
was used in studies carried out by other group members.
After administrated with 800 μM of H2O2 for 4 h, ROS and MDA levels in A549 cells
significantly increased, indicating the formation of oxidative stress and lipid peroxidation. The
excess ROS not only attacked biomacromolecules but also depleted endogenous antioxidative
enzymes. That is why the activities of SOD, CAT and GSP-Px significantly decreased upon H2O2
stimulation. In order to resist oxidative stress caused damages, Nrf2 signal pathway was activated
and the expression of its target genes was upregulated [33, 34]. These genes include HO-1, NQO1
and TXNRD that encoding antioxidative and detoxification enzymes[35]. Antioxidant treatments
not only directly scavenge ROS, block lipid peroxidation, inhibit ROS production, but also
regulate Nrf2 signaling pathways to strengthen the endogenous antioxidative system [4]. The high
lipophilicity of caffeic acid sulfonamide derivatives enable them to cross over the cell membrane
and enter the cell. The derivatives then reduced the H2O2 induced cell damage by eliminating ROS
22

Journal Pre-proof
and inhibiting its production, and thus decreased ROS generation and reduced MDA production
were observed. The less ROS consumed less antioxidative enzymes and thus higher activities of
SOD, CAT and GSH-Px were found in cells pretreated with caffeic acid derivatives. Besides, the
mRNA levels of Nrf2 and its target antioxidative and detoxification enzymes, including HO-1,
NQO1 and TXNRD1 were further upregulated in derivatives pretreated cells to enhance their
resist to oxidative damage. These results were in consistent with other studies on oxidative stress
[36-38].
Conclusion
In this study, six novel caffeic acid sulfonamides derivatives were synthesized through simple
chemical reactions under mild conditions. The products were easy to purify and the yield is high.
They were fully characterized and it was found that they exhibited higher lipophilicity than the
parent caffeic acid. The caffeic acid sulfonamide derivatives exhibited good DPPH radical
scavenging activity and strong ability to protect A549 cells against damage caused by
H2O2-induced oxidative stress. They inhibited H2O2-induced decline in cell activity, ROS
generation, MDA production, and consumption of endogenous antioxidative enzymes. The
regulation of Nrf2 signaling pathway may be a mechanism by which they enhance the ability of
cells to resist oxidative stress.
Acknowledgement
We thank Dr. Palanisamy Kannan for the language help on the preparation of this manuscript.
Funding
This work was supported by the Guangxi natural Science Foundation
[2016GXNSFBA380053] and the Guangxi Key Laboratory of Traditional Chinese Medicine
Quality Standards [guizhongzhongkai 201504].
Reference
[1] I. Peluso, G. Morabito, L. Urban, F. Ioannone, M. Serafini. Oxidative stress in atherosclerosis
development: the central role of LDL and oxidative burst, Endocr. Metab. Immune. Disord Drug
Targets 12(4) (2012) 351-60. doi:10.2174/187153012803832602.
23

Journal Pre-proof
[2] D.X. Zhang, D.D. Gutterman. Mitochondrial reactive oxygen species-mediated signaling in
endothelial cells, Am. J. Physiol. Heart. Circ. Physiol. 292(5) (2007) H2023-31.
doi:10.1152/ajpheart.01283.2006.
[3] F. Palade, I.D. Alexa, D. Azoicai, L. Panaghiu, G. Ungureanu. [Oxidative stress in atherosclerosis],
Rev. Med. Chir. Soc. Med. Nat. Iasi. doi:107(3) (2003) 502-11.
[4] H. Hong, G. Liu. Scutellarin attenuates oxidative glutamate toxicity in PC12 cells, Planta medica
70(5) (2004) 427-31. doi:10.1055/s-2004-818970
[5] S.C. Gupta, D. Hevia, S. Patchva, B. Park, W. Koh, B.B. Aggarwal. Upsides and downsides of
reactive oxygen species for cancer: the roles of reactive oxygen species in tumorigenesis, prevention,
and therapy, Antioxid. Redox. Signal. 16(11) (2012) 1295-322. doi:10.1089/ars.2011.4414.
[6] S. Upadhyay, S. Vaish, M. Dhiman. Hydrogen peroxide-induced oxidative stress and its impact on
innate immune responses in lung carcinoma A549 cells, Mol. Cell Biochem. 450(1-2) (2019) 135-147.
doi:10.1007/s11010-018-3380-2.
[7] Q. Song, Y. Zhao, Q. Li, X. Han, J. Duan. Puerarin protects against iron overload-induced retinal
injury through regulation of iron-handling proteins, Biomed. Pharmacother. 122 (2019) 109690.
doi:10.1016/j.biopha.2019.109690.
[8] Y. Fu, L. Jiang, W. Zhao, X.-N. Meng, S. Huang, J. Yang, T. Hu, H. Chen. Immunomodulatory and
antioxidant effects of total flavonoids of Spatholobus suberectus Dunn on PCV2 infected mice, Sci.
Rep. 7(1) (2017) 8676. doi:10.1038/s41598-017-09340-9
[9] A. Colonnello, G. Aguilera-Portillo, L. Rubio-López, B. Robles-Bañuelos, E. Rangel-López, S.
Cortez-Núñez, Y. Evaristo-Priego, A. Silva-Palacios, S. Galván-Arzate, R. García-Contreras, I. Túnez,
P. Chen, M. Ashner, A. Santamaría. Comparing the Neuroprotective Effects of Caffeic Acid in Rat
Cortical Slices and Caenorhabditis elegans: Involvement of Nrf2 and SKN-1 Signaling Pathways,
Neurotox. Res. (2019). doi:10.1007/s12640-019-00133-8.
[10] K.D. Pantoja Pulido, A.J. Colmenares Dulcey, J.H. Isaza Martinez. New caffeic acid derivative
from Tithonia diversifolia (Hemsl.) A. Gray butanolic extract and its antioxidant activity, Food Chem.
Toxicol. 109(Pt 2) (2017) 1079-1085. doi:10.1016/j.fct.2017.03.059.
[11] Q. Wei, H. Jiang, J. Zhang, P. Guo, H. Wang. Synthesis of N-hydroxycinnamoyl amino acid ester
analogues and their free radical scavenging and antioxidative activities, Med. Chem. Res. 21(8) (2012)
1905-1911. doi:10.1007/s00044-011-9713-2.
24

Journal Pre-proof
[12] R.W. Jiang, K.M. Lau, P.M. Hon, T.C. Mak, K.S. Woo, K.P. Fung. Chemistry and biological
activities of caffeic acid derivatives from Salvia miltiorrhiza, Curr. Med. Chem. 12(2) (2005) 237-46.
doi:10.2174/0929867053363397.
[13] Y.J. Yoo, D.H. Nam, S.Y. Jung, J.W. Jang, H.J. Kim, C. Jin, A.N. Pae, Y.S. Lee. Synthesis of
cinnamoyl ketoamides as hybrid structures of antioxidants and calpain inhibitors, Bioorg. Med. Chem.
Lett. 21(10) (2011) 2850-4. doi:10.1016/j.bmcl.2011.03.077.
[14] A. Gurel, F. Armutcu, M. Hosnuter, M. Unalacak, E. Kargi, C. Altinyazar. Caffeic acid phenethyl
ester improves oxidative organ damage in rat model of thermal trauma, Physiol. Res. 53(6) (2004)
675-82. doi:10.1086/381465.
[15] P. Zhang, Y. Tang, N.-G. Li, Y. Zhu, J.-A. Duan. Bioactivity and Chemical Synthesis of Caffeic
Acid Phenethyl Ester and Its Derivatives, Molecules 19(10) 16458-16476.
[16] J. Wei, K. Liu, F. Lin, C. He, X. Luo, J. Zou, W. He, W. Nong, C. Lin. Synthesis, and antioxidant,
thrombin-inhibitory, and anticancer activities of hydroxybenzamide derivatives, Appl. Biol. Chem.
59(2) (2016) 271-281. doi:10.1007/s13765-016-0157-8.
[17] S. Wei, Z. Lu, Y. Zou, X. Lin, C. Lin, B. Liu, L. Zheng, J. Zhao. A Novel Synthesized
Sulfonamido-Based Gallate—JEZ-C as Potential Therapeutic Agents for Osteoarthritis, PLOS ONE
10(6) (2015) e0125930. doi:10.1371/journal.pone.0125930.
[18] Q. Liu, M.Y. Li, X. Lin, C.W. Lin, B.M. Liu, L. Zheng, J.M. Zhao. Effect of a novel synthesized
sulfonamido-based gallate-SZNTC on chondrocytes metabolism in vitro, Chem. Biol. Interact. 221
(2014) 127-38. doi:10.1016/j.cbi.2014.08.002.
[19] E. Atrián-Blasco, S. Gascón, M.J. Rodrıguez-Yoldi, M. Laguna, E. Cerrada. Novel Gold(I)
́
Thiolate Derivatives Synergistic with 5-Fluorouracil as Potential Selective Anticancer Agents in Colon
Cancer, Inorg. Chem. 56(14) (2017) 8562-8579. doi:10.1021/acs.inorgchem.7b01370.
[20] D. Harman. Aging: a theory based on free radical and radiation chemistry, J. Gerontol. 11(3)
(1956) 298-300. doi:10.1093/geronj/11.3.298.
[21] T. Jiang, Q. Sun, S. Chen. Oxidative stress: A major pathogenesis and potential therapeutic target
of antioxidative agents in Parkinson's disease and Alzheimer's disease, Prog. Neurobiol. 147 (2016)
1-19. doi:10.1016/j.pneurobio.2016.07.005.
[22] Z. Liu, T. Zhou, A.C. Ziegler, P. Dimitrion, L. Zuo. Oxidative Stress in Neurodegenerative
Diseases: From Molecular Mechanisms to Clinical Applications, Oxid. Med. Cell Longev. 2017 (2017)
25

Journal Pre-proof
2525967. doi:10.1155/2017/2525967.
[23] E. Stelmashook, N. Isaev, E. Genrikhs, S. Novikova. Mitochondria-Targeted Antioxidants as
Potential Therapy for the Treatment of Traumatic Brain Injury, Antioxidants 8 (2019) 124.
doi:10.3390/antiox8050124.
[24] H. Jin, J. Randazzo, P. Zhang, P.F. Kador. Multifunctional Antioxidants for the Treatment of
Age-Related Diseases, J. Med. Chem. 53(3) (2010) 1117-1127. doi:10.1021/jm901381j.
[25] S. Fiuza, C. Gomes, L. Teixeira, M.G.d. Cruz, M. Cordeiro, N. Milhazes, F. Borges, M. Marques.
Phenolic acid derivatives with potential anticancer properties--a structure-activity relationship study.
Part 1: methyl, propyl and octyl esters of caffeic and gallic acids, Bioorg. Med. Chem. 12(13) (2004)
3581-9. doi:10.1016/j.bmc.2004.04.026.
[26] S. Son, B.A. Lewis. Free Radical Scavenging and Antioxidative Activity of Caffeic Acid Amide
and Ester Analogues: Structure-Activity Relationship, J. Agric. Food Chem. 50(3) (2002) 468-472.
doi:10.1021/jf010830b.
[27] D. Chavarria, C. Fernandes, B. Aguiar, T. Silva, J. Garrido, F. Remião, P. Oliveira, E. Uriarte, F.
Borges. Insights into the Discovery of Novel Neuroprotective Agents: A Comparative Study between
Sulfanylcinnamic Acid Derivatives and Related Phenolic Analogues, Molecules (Basel, Switzerland)
24(23) (2019) undefined. doi:10.3390/molecules24234405.
[28] D.J. Abraham. Burger`s Medicinal Chemistry and Drug Discovery, Volume 2, Drug Discovery and
Drug Development, 6th Edition, 2003.
[29] E. Atrián-Blasco, S. Gascón, M.R. Guez-Yoldi, M. Laguna, E. Cerrada. Novel Gold(I) Thiolate
Derivatives Synergistic with 5-Fluorouracil as Potential Selective Anticancer Agents in Colon Cancer,
Inorg. Chem. 56(14) (2017) 8562-8579. doi:10.1021/acs.inorgchem.7b01370.
[30] N.M. Mishina, P.A. Tyurin-Kuzmin, K.N. Markvicheva, A.V. Vorotnikov, V.A. Tkachuk, V.
Laketa, C. Schultz, S. Lukyanov, V.V. Belousov. Does cellular hydrogen peroxide diffuse or act
locally?, Antioxid. Redox Signal. 14(1) (2011) 1-7. doi:10.1089/ars.2010.3539.
[31] M.V. Naval, M.P. Gómez-Serranillos, M.E. Carretero, A.M. Villar. Neuroprotective effect of a
ginseng (Panax ginseng) root extract on astrocytes primary culture, J. Ethnopharmacol.112(2) (2007)
0-270. doi: 10.1016/j.jep.2007.03.010.
[32] R. Cui, L. Tian, D. Lu, H. Li, J. Cui. Exendin-4 Protects Human Retinal Pigment Epithelial Cells
from H2O2-Induced Oxidative Damage via Activation of NRF2 Signaling, Ophthalmic Res. (2019)
26

Journal Pre-proof
1-9. doi:10.1159/000504891.
[33] G. Szklarz. Role of nrf2 in oxidative stress and toxicity, Annu. Rev Pharmacol. Toxicol. 53(1)
(2013) 401. doi:10.1146/annurev-pharmtox-011112-140320
[34] P.K. Leong, P.Y. Chiu, N. Chen, H. Leung, K.M. Ko. Schisandrin B elicits a glutathione
antioxidant response and protects against apoptosis via the redox-sensitive ERK/Nrf2 pathway in
AML12 hepatocytes, Free Radic. Res. 45(4) (2011) 483-95. doi:10.3109/10715762.2010.550917.
[35] E. Kobayashi, S. Takafumi, Y. Masayuki. Roles Nrf2 Plays in Myeloid Cells and Related
Disorders, Oxid. Med. Cell. Longev. 2013 (2013) 1-7. doi:10.1155/2013/529219
[36] W. Ying, Z.-c. Li, Y. Li-qing, L. Mai, T. Mei. Schisandrin B alleviates acute oxidative stress via
modulating Nrf2/Keap1-mediated antioxidant pathway, Appl. Physiol. Nutr. Metab. 44(1) (2018) 1-6.
doi:10.1139/apnm-2018-0251
[37] E. Jiang, H. Li, C. Yu, C. Yu, S. Jing, H. Sun, C. Wang, X. Fan, J. Chen, S. Wang. Schisandrin B
protects PC12 cells against oxidative stress of neurodegenerative diseases, Neuroreport 26(6) (2016)
360-366. doi:10.1097/WNR.0000000000000354.
[38] R. Jia, H. Zhang, Z. Yang, H. Zhao, F. Liu, H. Wang, M. Miao, Q. Wang, Y. Liu. Protective effects
of Schisandrin B on cigarette smoke-induced airway injury in mice through Nrf2 pathway, Int.
Immunopharmacol. 53 (2017) 11-16. doi:10.1016/j.intimp.2017.09.030.
27

Journal Pre-proof
Graphical abstract
28

Journal Pre-proof
Highlights
1. Caffeic acid derivatives were obtained with simple reactions and high yield.
2. Sulfonamide conjugation increase lipophilicity of caffeic acid.
3. Obtained derivatives exhibit strong radical scavenging abilities.
4. Derivatives protect cells from H2O2 induced cell damage via Nrf2 pathway.
29