Triazolylpyrenes: Synthesis, fluorescence properties, and incorporation into DNA

Article abstract of DOI:10.1021/ol8006474

Synthesis of 1,6- and 1,8-triazolylpyrenes and their incorporation into oligonucleotides is described. In hybrids, trlazolylpyrenes adopt interstrand stacking interactions. Exciton coupling is observed for the duplex containing a pair of the 1,6-isomer indicating a well-defined helical arrangement of the triazolylpyrene building blocks. Triazole substitution results in pronounced red-shifts of monomer as well as excimer fluorescence. Furthermore, quantum yields of the formed excimers are remarkably high.

Full text of DOI:10.1021/ol8006474

ORGANIC
LETTERS
2008
Vol. 10, No. 10
2011-2014
Triazolylpyrenes: Synthesis, Fluorescence
Properties, and Incorporation into DNA
Sarah Werder, Vladimir L. Malinovskii, and Robert Häner*
Department of Chemistry and Biochemistry, UniVersity of Bern, Freiestrasse 3,
CH-3012 Bern, Switzerland
robert.haener@ioc.unibe.ch
Received March 20, 2008
ABSTRACT
Synthesis of 1,6- and 1,8-triazolylpyrenes and their incorporation into oligonucleotides is described. In hybrids, triazolylpyrenes adopt interstrand
stacking interactions. Exciton coupling is observed for the duplex containing a pair of the 1,6-isomer indicating a well-defined helical arrangement
of the triazolylpyrene building blocks. Triazole substitution results in pronounced red-shifts of monomer as well as excimer fluorescence.
Furthermore, quantum yields of the formed excimers are remarkably high.
Nucleic acids are of interest as nanometer-sized functional
matter.1,2 The highly reliable recognition pattern of the
natural bases allows the well-designed construction of large
assemblies. Introduction of unnatural building blocks into
oligonucleotides greatly enhances the number of possible
architectures and allows the design of DNA-like constructs
which are highly diverse with regard to structural and
functional properties.3,4 The incorporation of simple, non-
nucleosidic types of aromatic building blocks into oligo-
nucleotides is intensively studied.5–10 They are used as
hairpin replacements11–17 or as units for conformational
control in DNA.18–20 Recently, the helical arrangement of
polyaromatic compounds within a DNA framework was
reported.21–24 In particular, extended stretches of achiral
pyrene building blocks (A, Figure 1) were found to form
double-helical self-assemblies.22,25
Due to their many interesting fluorescence properties, such
as long lifetime, high quantum yield, and the possibility to
form excimers, pyrene and its derivatives are of considerable
interest for the development of sensors and diagnostic
tools.26–30 In addition, the photophysical properties of pyrene
derivatives render them promising candidates for applications
in materials sciences, e.g., as components in OLEDs.31,32
(10) Wang, W.; Li, A. D. Q. Bioconjugate Chem. 2007, 18, 1036–1052.
(11) Lewis, F. D.; Liu, X.; Wu, Y.; Miller, S. E.; Wasielewski, M. R.;
Letsinger, R. L.; Sanishvili, R.; Joachimiak, A.; Tereshko, V.; Egli, M.
J. Am. Chem. Soc. 1999, 121, 9905–9906.
(12) Stutz, A.; Langenegger, S. M.; Ha¨ner, R. HelV. Chim. Acta 2003,
86, 3156–3163.
(13) Bianke´, G.; Ha¨ner, R. Nucleosides, Nucleotides Nucleic Acids 2007,
26, 949–952.
(1) Feldkamp, U.; Niemeyer, C. M. Angew. Chem., Int. Ed. 2006, 45,
1856–1876
.
(14) Bianke´, G.; Ha¨ner, R. ChemBioChem 2004, 5, 1063–1068.
(15) Lewis, F. D.; Zhang, L. G.; Kelley, R. F.; McCamant, D.;
Wasielewski, M. R. Tetrahedron 2007, 63, 3457–3464.
(16) Nakamura, M.; Ueda, M.; Watanabe, S.; Kumamoto, S.; Yamana,
K. Tetrahedron Lett. 2007, 48, 6159–6162.
(2) Seeman, N. C. Mol. Biotechnol. 2007, 37, 246–257
(3) Rosi, N. L.; Mirkin, C. A. Chem. ReV. 2005, 105, 1547–1562
(4) Wengel, J. Org. Biomol. Chem. 2004, 2, 277–280
.
.
.
(5) Christensen, U. B.; Pedersen, E. B. Nucleic Acids Res. 2002, 30,
4918–4925
.
(17) Looser, V.; Langenegger, S. M.; Ha¨ner, R.; Hartig, J. S. Chem.
Commun. 2007, 4357–4359.
(6) Samain, F.; Malinovskii, V. L.; Langenegger, S. M.; Ha¨ner, R.
Bioorg. Med. Chem. 2008, 16, 27–33
.
(18) Yamana, K.; Yoshikawa, A.; Nakano, H. Tetrahedron Lett. 1996,
37, 637–640.
(7) Langenegger, S. M.; Ha¨ner, R. Chem. Commun. 2004, 2792–2793
.
(8) Langenegger, S. M.; Ha¨ner, R. HelV. Chim. Acta 2002, 85, 3414–
(19) Asanuma, H.; Ito, T.; Yoshida, T.; Liang, X. G.; Komiyama, M.
Angew. Chem., Int. Ed. 1999, 38, 2393–2395.
3421
.
(9) Kashida, H.; Asanuma, H.; Komiyama, M. Angew. Chem., Int. Ed.
(20) Lewis, F. D.; Wu, Y. S.; Liu, X. Y. J. Am. Chem. Soc. 2002, 124,
12165–12173.
2004, 43, 6522–6525
.
10.1021/ol8006474 CCC: $40.75
Published on Web 04/24/2008
2008 American Chemical Society

reaction centers. The obtained alcohols were further con-
verted into the phosphoramidites 5 and 6. The two building
blocks so obtained were subsequently incorporated into oligo-
nucleotides (Table 1). Oligomers 7-12 were prepared by
standard oligonucleotide synthesis, purified by reversed-phase
HPLC and characterized by ESI-TOF MS (Supporting
Information).
The properties of the triazolylpyrene-modified oligonucle-
otides were analyzed by thermal denaturation experiments as
well as by UV-vis, fluorescence, and CD spectroscopy. Data
were collected in two different buffer systems: Tris-HCl, which
is commonly used in studies with DNA-based diagnostic tools,
and phosphate buffer which is advised for temperature depend-
ent measurements (Table 1). Hybrids 9*10 and 11*12 each
contain an equal pair of the 1,6- or 1,8-bistriazolylpyrene
isomers, while 9*12 and 11*10 are examples of hybrids with
unequal building blocks. As shown in Table 1, replacement of
an AT base pair with triazolylpyrenes generally results in a slight
increase of hybrid stability.
Figure 1. Carboxamide- (A) and triazolyl-substituted (B) pyrenes
as building blocks in oligonucleotides.
As part of our efforts to develop new functional building
blocks maintaining a high level of duplex organization, we have
envisaged the synthesis of π-extended pyrene systems, such as
the bistriazolyl derivative B. Besides their attractive electronic
properties, triazoles are of particular interest in the present
context, since they have been used as isosteric replacements of
carboxamides.33 However, except for one recent publication
reporting the postmodification of oligonucleotides with azi-
dopyrene,34 no accounts on triazole substituted pyrenes exist
in the literature. Here, we describe the synthesis and properties
of bistriazolylpyrenes, as well as their effects on DNA hybrid
stability and helical organization.
The synthesis of the target compounds is shown in Scheme
1. The known 1,8- or 1,6-isomeric diethynylpyrenes 1 and
235 were treated with a 1:1 mixture of unprotected and 4,4′-
dimethoxytrityl (DMT)-protected 1,3-azidopropanol, which
are best prepared in situ from a mixture of the corresponding
bromides.36,37 After reaction at 50 °C for 15 h in the presence
of cuprous iodide and sodium ascorbate, the bistriazolyl-
pyrenes 3 and 4 were isolated after column chromatography.
The Huisgen 1,3-dipolar cycloaddition is widely used for
the preparation of 1,2,3-triazoles, in particular due to the
finding that the presence of Cu(I) enhances rate as well
as regioselectivity of the reaction between alkynes and
azides.38,39 The overall yields of 26 and 19% are appreciable
since the method involves a two-step procedure and multiple
Cooperativity of duplex formation and melting was con-
firmed by monitoring the hybridization process at different
wavelengths, which showed that the stacking events in the DNA
segments and in the pyrene region occur simultaneously.
As expected, single strands 9-12, which contain one
triazolylpyrene building block, show monomer fluorescence
on excitation at 350 nm (Figure 2, top). The notable
differences in fluorescence intensity can be ascribed on the
one hand to the quenching effect of the neighboring bases40
(single strands 10 and 12) but obviously also to the
regioisomeric substitution pattern of the pyrenes, since
oligomer 9 containing a 1,6-triazolylpyrene shows a con-
siderably higher fluorescence intensity than oligomer 11
having a 1,8-isomer. These differences are also reflected in
the respective fluorescence quantum yields (Φf) given in
Table 2. In contrast to the single strands, all hybrids show
intensive excimer emission with a maximum intensity at 520
nm (Figure 2, bottom), which indicates an interstrand
stacking arrangement of the triazolylpyrenes. In agreement
with this, duplex melting is accompanied with an excimer-
to-monomer change of the fluorescence signals (Figure 3).
Tm values determined by fluorescence measurements (Sup-
Scheme 1. Synthesis of Bistriazolylpyrene Building Blocks
2012
Org. Lett., Vol. 10, No. 10, 2008

Table 1. Influence of Triazolylpyrenes on Duplex Stabilitya
b
b
hybrid
Tm (∆Tm)c (°C)d
Tm (∆Tm)c (°C)e
7
8
5′AGCTCGGTCATCGAGAGTGCA
3′TCGAGCCAGTAGCTCTCACGT
70.1
71.2
9
10
5′AGCTCGGTCAY1.6CGAGAGTGCA
3′TCGAGCCAGTY1.6GCTCTCACGT
72.4 (2.3)
72.0 (1.9)
70.8 (0.7)
69.3 (-0.8)
72.8 (1.6)
71.5 (0.3)
71.7 (0.5)
70.7 (-0.5)
11
12
5′AGCTCGGTCAY1.8CGAGAGTGCA
3′TCGAGCCAGTY1.8GCTCTCACGT
9
12
5′AGCTCGGTCAY1.6CGAGAGTGCA
3′TCGAGCCAGTY1.8GCTCTCACGT
11
10
5′AGCTCGGTCAY1.8CGAGAGTGCA
3′TCGAGCCAGTY1.6GCTCTCACGT
a Conditions: 1.0 µM oligomer concentration; 100 mM NaCl. b Tm at 260 nm; c difference in Tm relative to duplex 7*8. d 10 mM Tris-HCl buffer, pH
7.4. e 10 mM phosphate buffer, pH 7.0.
porting Information) correspond very well with the ones
obtained from UV absorbance (Table 1). Furthermore,
substitution with two triazole rings exhibits a distinct red-
shift for monomer as well as excimer emissions (∼20 and
∼40 nm, respectively) compared to unsubstituted pyrene.
Sensitivity of pyrene fluorescence emission to the environ-
ment and conformational changes is of fundamental importance
for the design of molecular probes. Quantum yields of pyrene,
as well as other fluorescent dyes, are often significantly
decreased in aqueous buffered systems.40,41 In light of this,
the high quantum yields of the triazolylpyrene-modified
hybrids 9*10 and 11*12 (0.42 and 0.53, Table 2) are
Table 2. Emission Maxima and Quantum Yields (Φf) of Single
Strands 9-12 and Hybrids 9*10 and 11*12 at 20 °C in
Phosphate Buffer, pH 7.0 (Quinine Sulfate as Standard, Φf )
0.546)
9
10
11
12
9*10 11*12
λmax (nm) 406, 425 408, 429 406, 425 408, 429 520
520
Φf 0.27 0.05 0.09 0.06 0.42 0.53
noteworthy. To the best of our knowledge, these are the
highest excimer quantum yields reported so far for pyrene-
containing DNA conjugates (see, e.g., refs 41 and 42).
Excitation spectra of triazolylpyrene-modified single strands
and hybrids show distinct differences, which are in agreement
with interstrand stacking of the triazolylpyrene units in the
duplex: vibronic bands are better resolved and maxima are
Figure 2. Emission spectra of single strands 9-12 (top) and hybrids
9*10, 9*12, 11*10, and 11*12 (bottom). Conditions: oligomer
concentration 1.0 µ M, 10 mM phosphate buffer, 100 mM NaCl,
pH 7.0, 20 °C; excitation wavelength 350 nm.
Figure 3. Temperature-dependent fluorescence spectrum of hybrid
11*12: emission changes from excimer to monomer upon hybrid
melting. For conditions, see Figure 2.
Org. Lett., Vol. 10, No. 10, 2008
2013

slightly blue-shifted in the hybrids (Supporting Information).
Similar differences between single strands and hybrids are also
observed in the UV-vis spectra (Supporting Information).
These differences can be explained by a reduced flexibility of
the triazolylpyrene rings within the duplex. Similar spectroscopic
changes of the vibronic band intensities and shifts upon associa-
tion/dissociation were reported for a perylene-modified DNA.15
Further insight on the structural details in the pyrene region
was obtained by circular dichroism (CD) analysis. The CD
spectrum of hybrid 9*10, which contains a pair of the 1,6-isomer
of bistriazolylpyrene, showed exciton coupling of the pyrene
units, whereas only a chirally induced CD but no signal splitting
could be detected for the hybrid 11*12 (Figure 4). Notably,
non-nucleosidic pyrenes with a rigid helical conformation in a
duplex.
In conclusion, 1,6- and 1,8-triazolylpyrenes were synthesized
from the respective diethynylpyrenes via alkyne azide “click”
cycloaddition. The compounds were further transformed into
phosphoramidites and incorporated into oligonucleotides. Re-
placement of a natural AT base pair with two triazolylpyrenes
results in a slight stabilization of the duplex. Quantum yields
of excimers formed on hybridization are in the range of 0.5,
which is significantly higher than those of known pyrene-
containing DNA hybrids. CD spectroscopy revealed exciton
coupling for the duplex containing a pair or 1,6-isomers (hybrid
9*10), indicating a well-defined helical arrangement of the tri-
azolylpyrene building blocks. No exciton coupling was observed
in hybrids containing the 1,8-isomer. Stability of hybrids,
different interstrand organization, and attractive fluorescence
properties render triazolylpyrenes promising candidates for use
in DNA-based diagnostics and applications in materials sciences.
Acknowledgment. This work was supported by the Swiss
National Foundation (Grant No. 200020-117617).
Supporting Information Available: Experimental and
analytical details; UV-vis, CD, and fluorescence spectra. This
material is available free of charge via the Internet at
http://pubs.acs.org.
OL8006474
(21) Kashida, H.; Tanaka, M.; Baba, S.; Sakamoto, T.; Kawai, G.;
Asanuma, H.; Komiyama, M. Chem. Eur. J. 2006, 12, 777–784.
(22) Malinovskii, V. L.; Samain, F.; Ha¨ner, R. Angew. Chem., Int. Ed.
2007, 46, 4464–4467.
(23) Nakamura, M.; Shimomura, Y.; Ohtoshi, Y.; Sasa, K.; Hayashi,
H.; Nakano, H.; Yamana, K Org. Biomol. Chem 2007, 5, 1945–1951.
(24) Mayer-Enthart, E.; Wagner, C.; Barbaric, J.; Wagenknecht, H. A.
Tetrahedron 2007, 63, 3434–3439.
(25) Malinovskii, V. L.; Bittermann, H.; Ha¨ner, R. Nucleic Acids Symp.
Ser. 2007, 31–32.
(26) Ranasinghe, R. T.; Brown, T. Chem. Commun. 2005, 5487–5502.
(27) Marti, A. A.; Jockusch, S.; Stevens, N.; Ju, J.; Turro, N. J. Acc.
Chem. Res. 2007, 40, 402–409.
(28) Trkulja, I.; Biner, S. M.; Langenegger, S. M.; Ha¨ner, R. Chem-
BioChem 2007, 8, 25–27.
(29) Trkulja, I.; Ha¨ner, R. Bioconjugate Chem. 2007, 18, 289–292.
(30) Wilson, J. N.; Kool, E. T. Org. Biomol. Chem. 2006, 4, 4265–
4274.
(31) Tang, C.; Liu, F.; Xia, Y. J.; Lin, J.; Xie, L. H.; Zhong, G. Y.;
Fan, Q. L.; Huang, W. Org. Electron. 2006, 7, 155–162.
(32) Shimizu, H.; Fujimoto, K.; Furusyo, M.; Maeda, H.; Nanai, Y.;
Mizuno, K.; Inouye, M. J. Org. Chem. 2007, 72, 1530–1533.
(33) Bock, V. D.; Hiemstra, H.; van Maarseveen, J. H. Eur. J. Org.
Chem. 2006, 51–68.
Figure 4. Temperature-dependent CD spectra of hybrids 9*10 (top)
and 11*12 (bottom). Conditions: 5.0 µM oligomer concentration, 10
mM phosphate buffer, 100 mM NaCl, pH 7.0; ∆ꢀ (mol-1·dm3·cm-1).
(34) Geci, I.; Filichev, V. V.; Pedersen, E. B. Chem. Eur. J. 2007, 13,
6379–6386.
(35) Leroy-Lhez, S.; Fages, F. Eur. J. Org. Chem. 2005, 2684–2688.
(36) Kacprzak, K. Synlett 2005, 943–946.
the duplex 9*10 also showed the highest melting temperature
of all hybrids (see Table 1). One possible explanation is that
the local flexibility in the pyrene region is significantly decreased
in the hybrid 9*10 in comparison to hybrid 11*12. Thus, the
1,6-isomer of bistriazolylpyrene would adopt a more rigid,
twisted arrangement, whereas the 1,8-isomer leads to a more
flexible local structure. Exciton-coupled CD spectra were re-
ported previously for a system containing non-nucleosidic pery-
lene building blocks,43 as well as for oligonucleotides containing
extended stretches of pyrenebisamides.22 No helical organization
was observed, however, for a single pyrene pair.6 Thus, the
present finding is the first example of a single pair of
(37) The corresponding stepwise procedure was inferior to the one
described here due to very poor solubility of the intermediate triaz-
olylpyrenediols.
(38) Kolb, H. C.; Finn, M. G.; Sharpless, K. B. Angew. Chem., Int. Ed.
2001, 40, 2004–2021.
(39) Brase, S.; Gil, C.; Knepper, K.; Zimmermann, V. Angew. Chem.,
Int. Ed. 2005, 44, 5188–5240.
(40) Manoharan, M.; Tivel, K. L.; Zhao, M.; Nafisi, K.; Netzel, T. L. J.
Phys. Chem. 1995, 99, 17461–17472.
(41) Wilson, J. N.; Cho, Y. J.; Tan, S.; Cuppoletti, A.; Kool, E. T.
ChemBioChem 2008, 9, 279–285.
(42) Astakhova, I. V.; Malakhov, A. D.; Stepanova, I. A.; Ustinov, A. V.;
Bondarev, S. L.; Paramonov, A. S.; Korshun, V. A Bioconjugate Chem.
2007, 18, 1972–1980.
(43) Zheng, Y.; Long, H.; Schatz, G. C.; Lewis, F. D. Chem. Commun.
2005, 4795–4797.
2014
Org. Lett., Vol. 10, No. 10, 2008