Disruption of redox homeostasis with synchronized activation of apoptosis highlights the antifilarial efficacy of novel piperine derivatives: An in vitro mechanistic approach

Article abstract of DOI:10.1016/j.freeradbiomed.2021.04.026

A series of novel piperine derivatives were synthesized with high yield and were evaluated for its antifilarial potential against the bovine filarial parasite Setaria cervi. Among 21 (3a-3u) compounds screened, three of them (3k, 3l, 3s) showed significan

Full text of DOI:10.1016/j.freeradbiomed.2021.04.026

Free Radical Biology and Medicine 169 (2021) 343–360
Contents lists available at ScienceDirect
Free Radical Biology and Medicine
journal homepage: www.elsevier.com/locate/freeradbiomed
Disruption of redox homeostasis with synchronized activation of apoptosis
highlights the antifilarial efficacy of novel piperine derivatives: An in vitro
mechanistic approach
,
,
Nikhilesh Joardara 1, Pradip Shitb 1, Satyajit Halderb, Utsab Debnathc, Sudipto Sahad,
Anup Kumar Misrab **, Kuladip Janab ***, Santi P. Sinha Babua
,
,
,*
a Parasitology Laboratory, Department of Zoology, Siksha-Bhavana, Visva-Bharati, Santiniketan, 731235, West Bengal, India
b Bose Institute, Division of Molecular Medicine, P-1/12, C.I.T. Scheme VII M, Kolkata, 700054, India
c School of Health Science, University of Petroleum and Energy Studies, Dehradun, 248007, India
d Bose Institute, Division of Bioinformatics, P-1/12, C.I.T. Scheme VII M, Kolkata, 700054, India
A R T I C L E I N F O
A B S T R A C T
Keywords:
A series of novel piperine derivatives were synthesized with high yield and were evaluated for its antifilarial
potential against the bovine filarial parasite Setaria cervi. Among 21 (3a-3u) compounds screened, three of them
(3k, 3l, 3s) showed significant potential against all the developmental stages (oocytes, microfilariae and adult) of
the filarial worm in time and dose dependent manner. 3l showed the highest efficacy among the selected three
compounds. These three compounds were further evaluated for both in vitro and in vivo toxicity analyses which
further fortified the benign nature of the selected compounds. The antifilarial activities they exhibited were
clearly fuelled through disparity of the internal redox homeostasis as evidenced from the alterations in the
enzymatic and non-enzymatic antioxidants level which ultimately shifted towards activation of pro-apoptotic
signaling cascade eventually leading to the death of the parasites. The ability of the compound 3l to bind thi-
oredoxin reductase and CED-3 protein are the key findings of this study. The present study supported with
several biological experiments is therefore a maiden report on the antifilarial effectiveness of these novel
piperine derivatives.
Lymphatic filariasis
Piperine derivative
Reactive oxygen species
Apoptosis
Antifilarials
1. Introduction
deformities as well as disabilities caused due to LF have extensive eco-
nomic and psychosocial impacts on the infected individuals [4].
Lymphatic filariasis (LF) is a major vector borne parasitic disease
caused by Wuchereria bancrofti, Brugia malayi, and B. timori. LF majorly
prevails throughout the tropics and subtropics with a heterogeneous
distributional pattern [1,2]. As per March 2020 report of World Health
Organization (WHO) on filariasis states that, 893 million people in 49
countries are living in areas requiring preventive chemotherapy to
impede the flow of infection [3]. Moreover, the same report states that
nearly 597 million people across the globe now no longer require
deterrent therapies [3]. Filarial parasites can persist for years inside the
human body particularly in the lymphatics resulting in lymphatic
damages and dysfunctions ultimately leading to elephantiasis [4]. The
To deal with the disease, extensive research works have revealed
handful of chemicals of both natural and synthetic origins that are
known to be effective against the filarial parasites, however unfortu-
nately they are not in use yet [5,6]. Diethyl carbamazine citrate, iver-
mectin, albendazole, doxycycline, suramin, levamisole are in use as
antifilarials but are associated with major drawbacks such as poor sol-
ubility, small plasma half-life, wide bio-distribution, instability, low
gastrointestinal tract uptake, rapid clearance by the immune cells, lower
molecular weight, toxicity and various adverse side effects [7–10].
Therapeutic molecules with greater adulticidal effectiveness as well as
less toxicity profiles are of choice. Therefore, the quest for effective
* Corresponding author.
** Corresponding author.
*** Corresponding author.
E-mail addresses: akmisra69@gmail.com (A.K. Misra), kuladip.jana@gmail.com (K. Jana), spsinhababu@gmail.com (S.P. Sinha Babu).
1
Equal contribution.
https://doi.org/10.1016/j.freeradbiomed.2021.04.026
Received 4 January 2021; Received in revised form 5 April 2021; Accepted 17 April 2021
Available online 23 April 2021
0891-5849/© 2021 Elsevier Inc. All rights reserved.

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
therapeutic molecules is still on.
under reduced pressure. The reaction mixture was acidified with 2 N HCl
and the resulting precipitate was filtered and washed with cold H2O to
give (2E,4E)-piperinic acid 2 (6.9 g, 90%). A solution of compound 2 (1
g, 4.58 mmol) and Et3N (1.15 mL, 8.25 mmol) in anhydrous CH2Cl2 (50
mL) was cooled to 0 ◦C. To the cooled reaction mixture was added
CH3SO2Cl (0.53 mL, 6.84 mmol) and the reaction mixture was stirred at
0 ◦C for 45 min till complete consumption of the starting material. To the
reaction mixture was added amine (5 mmol) and the reaction mixture
was stirred at room temperature for 2 h. The reaction mixture was
diluted with CH2Cl2 (100 mL) and the organic layer washed with satd.
NaHCO3 (50 mL) and H2O (50 mL), dried (Na2SO4) and concentrated.
The crude product was purified over SiO2 using hexane-EtOAc (4:1) as
eluant to give pure compounds 3a-u.
On this context, piperine a major bio-active alkaloid component of
black pepper (Piper nigrum) has been taken into account. Piperine and its
derivatives are known to exhibit a plethora of biological activities [11].
It has been found to be enormously effective on Gram positive and Gram
negative bacteria [12,13]; on the other hand, antimalarial effect has also
been reported recently by Thiengsusuk et al. [14] and Samuel et al. [15].
Additionally, piperine and its derivatives have shown trypanocidal ef-
ficacy [11].
Taking clues from the earlier biological studies of Piperine, it was
decided to evaluate the therapeutic potential of Piperine and its close
analogs against filarial nematode to develop novel anti-filarial agents.
With this intention, a series of piperine derivatives were synthesized
starting from piperine and evaluated against a model filarial nematode
Setaria cervi, found in the abdominal cavity of cows. S. cervi resembles
Wuchereria bancrofti in its nocturnal periodicity, antigenic profile and is
therefore used as a model parasite for screening of the compounds
[16–18]. Our previous experiences on anti filarial compound screening
of both synthetic and natural origin clearly state that there are several
key attributes that are essential for the death of the parasitic nematodes
[16–18]. Several important genes such as (EGL-1, CED-9, CED-4, CED-3,
Cps-6, Crn-1, and Nuc-1) are important for the initiation of death
signaling in the filarial parasites [19–22]. Moreover, a plethora of an-
tioxidants (both enzymatic and non-enzymatic) are also essential for the
survival of the pathogens that can be selectively targeted for the
development of flourishing antifilarial drug moieties [23]. Therefore,
induction of oxidative stress by means of administering a compound
with concomitant death of the parasite is always preferred; however, the
toxic side effects should also be kept on mind. In this context, synthesis
of a series of novel piperine derivatives and their bioevaluation against
filarial nematodes is presented herein. Additionally, an in-depth study at
the molecular level on the mechanism of action of the active molecule
(3l) with detailed toxicity profile has also been presented.
2.2.1. Analytical data of the most active synthesized compounds (3k, 3l,
3s), which were not reported earlier
Compound 3k: 1H NMR (500 MHz, CDCl3): δ 8.65–8.62 (m, 1 H),
7.63–7.51 (m, 1 H), 7.50–7.47 (m, 1 H), 7.40–7.28 (m, 2 H), 7.15–7.00
(m, 1 H), 6.99–6.83 (m, 2 H), 6.80–6.70 (m, 2 H), 6.09–6.06 (m, 1 H),
5.98 (br s, 2 H); 13C NMR (125 MHz, CDCl3): δ 163.8, 148.7, 143.8,
140.8, 135.8, 131.9, 131.6, 130.6, 129.5, 124.3, 124.0, 123.0, 122.3,
121.3, 108.6, 105.9, 101.3 (CH2); HRMS [M+1]+: Calcd. for
C18H13Cl2NO3: 362.0350; found: 362.0342.
Compound 3l: 1H NMR (500 MHz, CDCl3): δ 7.95–7.90 (m, 1 H),
7.51–7.45 (m, 1 H), 7.27–7.15 (m, 3 H), 7.10–7.00 (m, 2 H), 6.92–6.85
(m, 1 H), 6.83–6.68 (m, 3 H), 6.09–6.04 (m, 1 H), 5.98 (br s, 2 H),
2.30–2.25 (m, 3 H); 13C NMR (125 MHz, CDCl3): δ 164.5, 148.7, 143.8,
142.9, 139.8, 130.8, 126.7, 122.9, 108.7, 105.8, 101.3 (CH2), 18.3
(CH3); HRMS [M+1]+: Calcd. for C19H17NO3: 308.1286; found:
308.1276.
Compound 3s: 1H NMR (500 MHz, CDCl3): δ 7.58–7.50 (m, 2 H),
7.27–7.18 (m, 1 H), 7.02–7.00 (m, 1 H), 6.99–6.87 (m, 2 H), 6.80–6.70
(m, 3 H), 6.06–5.95 (m, 3 H) 3.93–3.83 (m, 6 H); 13C NMR (125 MHz,
CDCl3): δ 164.5, 148.5, 148.3, 142.3, 139.8, 130.8, 124.5, 123.3, 122.9,
118.7, 111.3, 108.6, 106.0, 105.9, 105.8, 101.6, 101.5, 101.2 (CH2),
56.2 (OCH3), 56.0 (OCH3); HRMS [M+1]+: Calcd. for C20H19NO5:
354.1341; found: 354.1334.
2. Materials & methods
2.1. Chemicals and reagents
2.3. Collection, maintenance of filarial parasite and treatment procedure
Highest purity grade chemical solvents and Milli-Q water (Milli-Q
Academic with 0.22 μm Millipak R-40) were used in all the experiments.
This entire study was conducted on bovine filarial parasite Setaria
cervi. Adult parasites were collected from the peritoneal cavity of the
butchered cows from the local abattoirs and stored in normal saline.
Microfilariae (Mf) and oocytes were dissected out from the uterus of a
gravid female parasite [16,17]. Approximately 1.0 × 106 oocytes and
1.0 × 105 Mf and 2 gravid female (0.50 gm each) S. cervi were separately
incubated to avoid any aberrant results with different doses of piperine
RPMI-1640 medium and DMEM was purchased from Hi-Media
Laborotories, (Mumbai, India), fetal bovine serum was obtained from
Gibco (USA). MTT, NBT and DMSO were procured from Merck (India),
Trizin for RNA extraction was purchased from GCC Biotech (Joy-
chandipur, West Bengal, India), cDNA synthesis kit was purchased from
Thermo Fisher Scientific (Maharashtra, India), Taq DNA polymerase was
obtained from Bio-Bharati Life Science Private Limited (Kolkata, West
Bengal, India), Ivermectin, Apoptosis Detection Kit, N-acetyl-L-cysteine
(NAC), Propidium iodide, Hoechst, and, 2′,7′-dichlorofluorescein diac-
etate (H2DCFDA) were obtained from Sigma-Aldrich Co. (St. Louis, MO,
USA), Caspase assay kit (CaspACE™ Assay System) was obtained from
Promega (USA) and Z-VAD-FMK were purchased from BioVision
Incorporated, (USA) respectively, JC-1 (5,5′,6,6′-tetrachloro-1,1′,3,3′-
tetra-ethylbenzimidazolylcarbocyanineiodide) kit was purchased from
EnzoLife Sciences, (Switzerland). Primary antibodies, alkaline phos-
phatase and horseradish peroxidase conjugated secondary antibodies
were purchased from Santa Cruz Biotechnology (Santa Cruz, CA),
Sigma-Aldrich (MO, USA), Cell Signaling Technologies (USA), and Bio
Bharati Life Sciences Pvt. Ltd (Kolkata, West Bengal, India).
derivatives 3a-3u (1–100
μg/ml) along with the mother compound
piperine and a standard antifilarial compound ivermectin in sterile tis-
sue culture flasks. For culturing the parasites, RPMI-1640 medium
supplemented with 10% FBS was used. The entire set up was kept in 5%
CO2 at 37οC. Each incubation experiments were set in triplicate and
replicated for at least five times. After screening, further studies were
carried out using compounds 3k, 3l, and 3s at doses 6.25, 12.5 and 25
μ
g/ml for Mf and 25, 50, 100 μg/ml for adult parasites for the duration
of maximum of 12 h.
2.4. MTT reduction assay
Percent viabilities of the 3a-3u treated parasites were determined by
the classical 3-(4, 5-dimethyl-thiazol-2-yl)-2, 5-diphenyltetrazolium
bromide (MTT) reduction assay [24] and LC50 values were calculated
[16,17]. In brief, control and treated parasites (1.0 × 105 Mf and 2
gravid female for each compounds in triplicate) were harvested after
incubation through centrifugation at 7500×g for 5 min in room tem-
perature. Parasites were washed in 50 mM PBS (pH 7.4) and incubated
2.2. Synthesis of compounds 3a-u
To a solution of Piperine (1; 10 g, 35 mmol) in CH3OH (200 mL) was
added powdered KOH (20 g) and the reaction mixture was stirred at
room temperature for 48 h. The reaction mixture was concentrated
344

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
500
μ
l of MTT (0.5 mg/ml in PBS) solution and 2 h at 37οC at dark. The
paraformaldehyde were stained with propidium iodide stain following
Riccardi et al. [33] with certain modification and photomicrographed
under inverted fluorescence microscope (Leica, Germany).
formazan crystals thus formed were solubilized in 100 μl of DMSO; color
intensity was measured at 595 nm using a microplate reader (Bio-Rad,
USA). Each experiment was conducted in three sets and repeated for at
least five times.
2.10. RT-PCR analysis of DNA degradation and apoptogenic genes
2.5. Assessment of parasite mortality and determination of IC50 value
Briefly, total RNAs were isolated from the control and 3l treated
adult S. cervi (n = 2, gravid females for each treatment set) using the
Trizin Reagent (GCC Biotech, India), following the method described
earlier [32]. All the isolated RNAs were quantified using a nanodrop
spectrophotometer (Eppendorf, Germany). Oligo (dT)18 primed reverse
transcription (RT) was performed with a First Strand cDNA Synthesis Kit
(Thermofisher). RT-PCR experiments were done according to the pro-
After the completion of the defined period of incubation, 10
μ
l of the
culture containing Mf from each treatment panel was collected on glass
slides and to it, 2
μl of Trypan Blue was added. The mortality of the
parasites was assessed microscopically and IC50 values were calculated
for all the compounds along with the standard antifilarial compound
Ivermectin [25]. The entire experiment was carried out in quadruplicate
and repeated at least five times.
cess described earlier [32] with little modifications. Further, 7 μl of each
PCR amplified products were ran on 1.5% agarose gel, stained in EtBr
and analyzed under the gel documentation system (Bio-Rad, USA) [25].
Primers were designed using National Center for Biotechnology Infor-
mation (NCBI) database (http://blast.ncbi.nlm.nih.gov) and the
Primer3 Software Input (version 0.4.0). Primer sequences with their
annealing temperatures are provided in Table 1.
2.6. Morphological alteration in the 3k, 3l and 3s treated adult S. cervi
Following incubation with 3k, 3l, 3s at 50 and 100 μg/ml both
treated and control adult parasites were processed for histology studies
and stained with Hematoxylin-Eosin dye following Joardar et al. [26]
with acceptable modifications.
2.7. Scanning electron microscopic studies
2.11. Immunoblotting
The tissue preparation for the scanning electron microscopic studies
was done following Ratanatham et al. [27] with acceptable modifica-
tion. Briefly, the control and 3l treated Mf were fixed in 2.5% glutar-
aldehyde dissolved in 100 mM phosphate buffer. Furthermore, post
fixation of the tissue samples was done using osmium tetroxide (OsO4).
The samples were dehydrated in graded alcohol and undergone critical
point drying. Mounted dried specimens were sputter-coated with 25 nm
gold particles and then examined, viewed and photographed with a
scanning electron microscope (Zeiss, Germany).
Changes in the expression patterns of different protein markers (pro,
antiapoptotic and oxidative stress) were analyzed through immuno-
blotting [16,34]. Briefly, before immunoblotting, the extracted proteins
(80 μg) from the treated and control adult parasites were resolved in
15% SDS-PAGE and electrotransferred to polyvinylidene difluoride
(PVDF) membranes, blocked with 10% skimmed milk dissolved in Tris
base saline Tween-20 (TBST), and incubated with specific anti-goat
primary antibodies viz. EGL-1, CED-9, CED-4, CED-3, Nrf-2, Keap-1,
TrxR, GST, Cyt-c, Cas-8, Cas-9, Cas-3 for at least 16 h at 4 ◦C. The
membranes were thereafter washed in TBST and further incubated in
either HRP conjugated donkey anti-goat secondary antibody or alkaline
phosphatase conjugated secondary IgG for at least 12h. Alterations in
the expression patterns of various apoptogenic proteins were examined
by adding 3,3′,5,5′-tetramethylbenzidine (TMB)-H2O2 or BCIP/NBT
substrate (Bangalore GeNei, India). Anti-GAPDH (BioBharati Life Sci-
ence Pvt. Ltd.) was used as loading control. The visible bands were
detected in Gel documentation system equipped with the Quantity One
densitometry software (Bio-Rad, USA).
2.8. Determination of oxidative stress induced by compounds 3k, 3l, 3s
For the determination of the oxidative stress level induced by the
selected compounds 3k, 3l, and 3s two gravid female worms weighing
0.50 gm each for respective doses was considered. The level of malon-
dialdehyde (MDA) in the control or 3k, 3l, 3s treated parasiteswas
measured using thiobarbituric acid reaction following Garcia et al. [28]
with certain modifications. Nitro blue tetrazolium (NBT) assay was
carried out for measuring superoxide anion (Oꢀ2 ) level following Choi
et al. [29]. Level of H2O2 in the control and treated S. cervi homogenates
was also estimated following our previous report with modifications
[16]. Reduced glutathione (GSH), Superoxide dismutase (SOD), gluta-
thione peroxidase (GPx), Catalase, glutathione S-transferase (GST), and
glutathione reductase (GR) activities in the lysates of control and 3k, 3l,
3s treated filarids were determined following our previous publications
[16,17,22].
2.12. Quantitative determination of apoptosis and loss of mitochondrial
membrane potential (Δψm)
To affirm the initiation of apoptosis following 3l treatment, S. cervi
Mf (~1 × 105) were dissected out from the gravid females and treated
with 6.25 and 25 μ
g/ml of 3l for 8 h in 5% CO2 at 37 ◦C. After incubation
Induction of oxidative stress in adult parasites was determined by
H2DCFDA. The detailed procedure of this study was adopted following
Sardar et al. [30] with acceptable modifications. Further quantification
was done through flow cytometric analyses of the treated Mf.
Mf were, vigorously aspirated to avoid any sort of clumping and form
single cell suspension. % viability of these suspensions was also deter-
mined before proceeding for each flow cytometry based analysis.
For the sorting experiment, parasites were collected by centrifuging
at 7500×g for 5 min at 25 ◦C. The obtained Mf pellets were washed twice
with phosphate-buffer saline (PBS). Mf were stained with AnnexinV-
FITC and propidium iodide supplied with Apoptosis Detection Kit
(Sigma, USA) following manufacturer’s protocol and analyzed by flow
cytometer (BD FACSVerse) [34].
2.9. Hoechst and PI staining for detection of DNA damage
Chromatin condensation in the treated Mf was detected flowcyto-
metrically by staining with Hoechst (H6024, Sigma Aldrich, USA)
following the protocol described in Su et al. [31] and Nayak et al. [32]
with considerable modification. Briefly, after treatment Mf were washed
in PBS and fixed in paraformaldehyde. After fixation, Mf were stained
with Hoechst (1 mg/ml) for 5 min. Worms are again washed in PBS and
processed for flowcytometric analysis.
Mitochondrial membrane potential damage was also analyzed using
JC-1 stain. Following treatment (6 h) of Mf with 3l at 6.25 and 25
μ
g/ml,
Mf were washed in PBS and incubated with the JC-1 dye (5
μM final
concentration) at 37 ◦C for 30 min in the dark. The samples were washed
twice in 500
[34].
μl of PBS and resuspended for flow cytometric evaluation
On the other hand control and treated oocytes fixed in
345

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
Table 1
The primers used for RT-PCR.
Genes
Forward primer (5’ꢀ 3’)
Reverse primer (5’ꢀ 3’)
Anneal. Temp.
Amp. size (bp)
EGL-1
CED-9
CED-4
CED-3
Nuc-1
Cps-6
CTCTGAGAGAGATCAGCAGCATCG
GTTACTCCAGCGCCAATCAT
CGAAAGAGCTTGTGATGCAA
TCAGCAGCTCAACAAACATCC
CTCGACGACAACGACCAAGCA
TAAATGCTGATGCAATGGGA
CGAGGCTCCATGCGAGGCAG
TGCGCACGATGGTCGCACAC
GCGAAAAAGTCCAGAAGACG
CAAGTGCGAAACCTCTTCGT
CAATTTTCCCGACAAATGCT
GCAAGTTCAGCAAGTGTGTGGA
TCTCCGATGCACACCCACGG
AGATGTCCACGATCGAATCC
GCCTTCTTAGGCCCGACGCCA
GCAGGCGATCACTGGCGGAA
52.5 ◦
C
215
200
198
176
103
98
47 ◦
44 ◦
47 ◦
C
C
C
59.2 ◦
C
C
49 ◦
C
Crn-1
β-actin
60.6 ◦
105
183
55 ◦
C
2.13. Caspase assay
used for docking the molecules. The docking was done with 100 runs.
The molecules were allowed to flexibly dock into the protein coordinates
to take their final conformation. The best docked conformers were
collected from a population of 150 samples from 2.5 million energy
evaluations. Along with AUTODOCK, Pymol [44] and Discovery studio
visual software [41] were used to visualize the interactions of protein
and docked molecules.
Caspase activity in the adult parasite homogenates (control and
treated) was determined using CaspACE™ Assay System (Promega,
USA) following manufacturer’s protocol. P-nitroaniline labeled DEVD
peptide was used as substrate while Z-VAD-FMK was used as inhibitor
[16,17,34].
2.16. Assessment of in vitro toxicity of 3k, 3l and 3s in RAW 264.7
macrophage cells
2.14. Molecular docking studies
To investigate whether the selected compound has the ability to bind
filarial Thioredoxin reductase (TrxR), Brugia malayi TrxR was used to
model the 3D protein structure in I-TASSER. The modeled protein
structure was used as receptor and the ligand was modeled using
CORINA classic demo version for docking experiment. Thioredoxin
glutathione reductase from Schistosoma mansoni, one of the templates
used by I-TASSER is found in complex with a ligand (1, 4-Bis (2-
hydroxyethyl) piperazine) with protein data bank (PDB) id 6FMZ. The
modeled structure was superposed and compared with 6FMZ to deter-
mine the grid required for docking. The docking was performed in
AutoDock 4.2. The structures and docked complex were visualized in
Discovery Studio.
In vitro toxicity of 3k, 3l and 3s was evaluated using RAW 264.7
macrophages. In brief, approx 1 × 106 RAW 264.7 (NCCS, Pune) were
grown in six-well tissue culture plates following Roy et al. [45]. Cells
were treated with the 25 and 100 μg/ml of the selected compounds (3k,
3l, and 3s) for 12 h duration. After incubation, cells were scrapped out
using cell scrapper and centrifuged at 5000×g for 5 min at 25 ◦C. The
cell pellets were washed twice with ice cold PBS and cell viability was
determined by MTT assay (described earlier) and the obtained results
were expressed as percent viability. Furthermore to assess the
morphology of the treated RAW 264.7 cells Giemsa’s staining was per-
formed [46]. Briefly, RAW 264.7 MФs adhered on 6 well culture plate
(Tarson, India) were washed twice with ice cold PBS and further fixed in
chilled 4% (v/v) paraformaldehyde for 1 h. After fixation in para-
formaldehyde, cells were again washed in chilled PBS and were made
permeabilized using chilled methanol for 15 min. Plate was dried at
room temperature and the cells were stained with Giemsa’s stain for 10
min at room temperature. Excess stain was destained using single
distilled water, dried at room temperature and micrographed under a
bright filed inverted optical microscope (Leica, Germany).
On the other hand, interaction of the selected compound (3l) with
the final execution caspase i.e. CED-3 was also evaluated in silico. The
ced-3 protein sequence of C. elegans from uniprot with uniprot id of
P42573 was used to identify the relevant residues for substrate binding
site on NCBI’s Conserved Domain Database (CDD) search web server
[35,36]. The structure of ced-3 protein was obtained from Protein Data
Bank with PDB id of 4M9R [37,38]. The ligand structure was drawn and
converted to 3D using CORINA classic demo version [39]. The down-
loaded 3D structure of ced-3 and the ligand structure were processed in
AutoDock Tools for docking [40]. The docking was performed using
Autodock 4.2 on a grid of 20 × 20 × 22 Å3 incorporating the substrate
binding residues. The docked complex was visualized in Discovery
Studio [41].
2.17. Assessment of toxicity of 3k, 3l and 3s in rat model
The protocols of the in vivo toxicity studies were approved by Insti-
tutional Animal Ethical Committee (Ref. No. VB/CPCSEA/IAEC/II-08
dated October 17, 2020) and performed abiding by the guidelines of
Committee for the Purpose of Control and Supervision of Experiments of
Animals (CPCSEA); Govt. of India (Registration number: 1819/GO/Ere/
S/15/CPCSEA). The animals had free access to food and water and were
maintained at 27 ± 2 ◦C temperature with 12 h light and dark cycle in
the institutional animal house.
2.15. Structure activity relationship(SAR) analysis
Docking study was performed in AUTODOCK 4.2 [42]. Prior to the
docking, structures of all synthesized molecules were prepared in chem
draw. Subsequently these structures were structurally used for
geometrical optimization using the Powell energy minimization algo-
rithm, Gasteiger-Huckel charges, and 0.001 kcal/(mol. Å) as conver-
gence criteria [43]. The coordinates of the homology modeled
thioredoxin reductase protein was considered for investigating the
binding mode of our newly synthesized molecules. For docking study,
the protein was prepared in AUTODOCK by making use of the same
procedure as adopted in case of study molecule. Here, residues-based
docking method was carried out to dock all the molecules near to the
TrxR receptor binding domain. The prepared protein and the corre-
sponding study molecules were considered in AUTODOCK for the
docking experiments. The grid size for the search of docking space was
set at 60 × 60 × 60 distributed around the binding domain with a default
grid spacing of 0.375 Å [43]. The Lamarckian genetic algorithm was
In vivo toxicity analysis was performed by administering 3k, 3l and
3s orally at doses (500 μg/kg body weight and 1000 μg/kg body weight)
to the Wister rats (130 ± 5 gm) for a stretch of seven days. After the
course of treatment, rats were euthanized and organs (liver, spleen and
kidney) were collected and perfused with chilled PBS and processed for
histological preparation. In brief, tissues were fixed in the Bouins for 24
h, dehydrated with graded alcohol, embedded in paraffin and subjected
to ultramicrotomy. Blood from the treated rats was collected by cardiac
puncture for hematological and serological studies. The collected blood
samples were further processed following our earlier published reports
[17,22].
346

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
2.18. Statistical analyses
3.2. 3k, 3l, and 3s exert considerable lethal action against oocytes, mf
and adult filarial parasite
All the experimental data are represented as mean ± SD. Significance
level (p value < 0.05) between the means of control and 3l, 3k, 3s-
treated parasites were analyzed by One-way ANOVA with Tukey’s post-
hoc test using GraphPad Prism 5.0. *p < 0.05, **p < 0.001, ***p <
0.0001 are considered as statistically significant. Densitometry analysis
was done using Image J software and represented as arbitrary units.
Experimental evidences have confirmed that, piperine derivatives 3l,
3k and 3s exerted potential lethal action against all the developmental
stages (oocytes, Mf and adult) of the filarial nematode S. cervi in a time
and dose dependent manner (Fig. 1a–c). It was found that 3l, 3k and 3s
significantly induced mortality of the adult parasites at reasonably low
IC
and LC50 (Table 2a). Intriguingly, activity of 3l was found to be
3. Results
hig5h0est among all the derivatives (Tables 2a and b). Based on the
screening of potent adulticidal compounds 3k, 3l and 3s was of best
choice. Interestingly, microscopic observations of the Hematoxylin-
Eosin stained adult filarial parasites revealed considerable amount of
shrinkage and damage throughout the body walls of the treated para-
sites, visible alterations in the epithelial lining, muscle layers (longitu-
dinal and hypodermal) and predominantly at the cuticular region with
disintegrated epicuticle lining in the treated parasites with respect to the
control were noted (Fig. 2a, marked with black bold arrow). Further-
more, the scanning electron micrographs of the treated Mf exhibited
deformed surface morphology compared to the control parasites
(Fig. 2b). More interestingly, marked increase in the fluorescence in-
tensity of the propidium iodide stained treated oocytes further fortify
the damaging potential of the compound 3l (Fig. 2c). These obtained
experimental findings encouraged us to study the molecular mechanism
of action of the most potent compound 3l responsible for worm killing.
3.1. Synthesis of piperine analogs (3a-u)
Piperine was treated with potassium hydroxide in methanol to give
(2E,4E)-piperinic acid (2) in 90% yield [47]. Compound 2 was
sequentially treated with methanesulfonyl chloride in the presence of
triethylamine in CH2Cl2 to give corresponding sulfonyl ester which on
subsequent treatment with aliphatic and aromatic amines in the same
pot furnished piperine analogs (3a-u) in very good yield (Scheme 1). All
synthesized compounds were unambiguously characterized using NMR
and mass spectroscopic analysis. Compounds 3f [48], 3j [49], 3l [50],
3o [51], 3p [49], 3q [52], 3r [53], 3t [53] have been synthesized earlier
under different reaction conditions.
Scheme 1. Synthesis of a library of piperine analogs; Reagents and condition: (a) KOH, CH3OH, 48 h, 90%; (b) (i) CH3SO2Cl, Et3N, CH2Cl2, 0 ◦C, 30 min; (ii) amine,
0 ◦C – room temperature, 2 h.
347

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
Fig. 1. In vitro antifilarial efficacy of 3k, 3l and 3s against the developmental stages of (a) adult, (b) microfilariae and (c) oocytes of S. cervi. Each experiment was
performed in triplicate and repeated for at least five times. Data were expressed as mean ± SD and *p < 0.05, **p < 0.001, ***p < 0.0001 are considered as sta-
tistically significant compared to control.
348

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
PCR analyses of the DNA degradation pathway marker genes (Cps-6,
Crn-1, and Nuc-1) were found to be upregulated upon treatment with the
compound 3l (Fig. 5c and d). It is apparent from our earlier reports that
induction of oxidative stress augments apoptosis in the treated parasites
eventually leading to the death of the parasites [16,17]. Based on this
proposition, we further studied whether the compound 3l bears the
ability to initiate oxidative stress mediated apoptotic pathway in S. cervi.
RT-PCR analysis of the 3l treated adult parasites revealed a clear in-
crease in the expression of pro-apoptotic gene (EGL-1, CED-4, CED-3)
and down regulation of anti-apoptotic CED-9 with respect to the control
parasite (Fig. 6d and e). Moreover, the up-regulated expression of the
proapoptotic proteins (EGL-1, CED-4, and CED-3) and down-regulated
expression of the anti-apoptotic protein CED-9 clearly corroborated
with the obtained result of RT-PCR (Fig. 6f and g). RT-PCR analyses as
well as the western blotting together fortify our proposition that
piperine derivative 3l causes death of the parasites by triggering
apoptosis. The classical apoptotic pathway in nematode is comprised of
EGL-1/CED-9/CED-4/CED-3 and induction of this pathway is antici-
pated to be ROS dependent as the application of ROS scavenger NAC
reversed the entire phenomenon (Fig. 6f and g). Flow cytometry based
analysis of apoptosis induction in the treated Mf confirmed that majority
of the treated parasites (Mf) have reached early apoptotic phase within
8 h of treatment however, co-treatment with NAC decreased the level of
apoptosis occurrence (Fig. 6a). More interestingly, 3l treatment of the
Mf significantly disrupted the mitochondrial membrane potential as
evidenced from the flowcytometry based JC-1 staining. A clear shift
from red to green fluorescence is an indicative of mitochondrial damage,
however, in this experiment too, NAC somewhat restored the mito-
chondrial integrity [34] (Fig. 5f). Therefore, there remains a clear
indication of the involvement of mitochondrial arm in induction of
apoptosis in the treated parasites. Enhanced expression of Cyt-C and
subsequent increase in the Caspase-3 activity further strengthen the fact
that upon treatment with the compound 3l both the intrinsic and
extrinsic pathways of apoptosis inside the filarial parasites were trig-
gered (Fig. 7a and b). Our obtained data was further fortified through
Caspase assay where it was found that in 3l treated parasites, caspase
activation was maximum which got downregulated upon Z-VAD-FMK
treatment (Fig. 6c). However, the other two compounds i.e. 3k and 3s
also have the potency to induce caspase activity inside the parasites but
3l showed the maximum efficacy. It is quite apparent from the obtained
results that apoptosis induction in the treated parasites was due to in-
duction of oxidative stress.
Table 2a
Screening of compounds (3a-3u) for antifilarial activity (adulticidal).
Sl. No
Compound
MIC (
μg/ml)
IC50
(μg/ml)
LC50 (μg/ml)
Piperine
3a
5.09 ± 1.09
14.04 ± 1.26
10.25 ± 1.36
13.98 ± 1.43
12.59 ± 0.95
11.64 ± 1.25
12.05 ± 1.02
13.78 ± 1.32
14.54 ± 1.78
10.65 ± 1.67
9.89 ± 1.24
3.78 1.57
3.05 1.07
11.77 ± 2.34
10.78 ± 2.56
25.02 ± 3.56
10.65 ± 2.76
12.52 ± 2.98
11.91 ± 2.3
3.84 1.54
25.1 ± 3.73
12.72 ± 1.98
13.11 0.75
16.38 ± 1.25
28.09 ± 2.36
20.5 ± 1.87
27.96 ± 1.98
25.18 ± 1.32
23.28 ± 2.04
24.11 ± 1.58
27.56 ± 1.32
29.07 ± 1.56
21.31 ± 1.76
19.78 ± 1.98
7.56 1.63
6.09 1.45
23.55 ± 3.87
21.56 ± 2.57
50.05 ± 4.67
21.30 ± 3.23
25.05 ± 3.19
23.81 ± 3.15
7.68 1.67
50.20 ± 4.89
25.45 ± 3.26
26.25 0.10
31.08 ± 1.28
56.36 ± 2.65
41.01 ± 1.94
55.92 ± 2.43
50.36 ± 1.74
46.56 ± 1.86
48.25 ± 2.16
55.15 ± 2.18
58.17 ± 2.87
42.6 ± 2.68
1
2
3b
3
3c
4
3d
3e
5
6
3f
7
3g
8
3h
3i
9
10
11
12
13
14
15
16
17
18
19
20
21
3j
39.56 ± 2.63
30.24 3.29
24.38 2.69
94.2 ± 7.89
3k
3l
3 m
3n
3o
86.24 ± 7.56
200.23 ± 8.96
85.21 ± 3.23
100.23 ± 5.67
95.25 ± 4.35
30.72 1.04
200.83 ± 10.02
101.78 ± 9.87
59.25 0.51
3p
3q
3r
3s
3t
3u
IVM
Table 2b
Minimum inhibitory concentration (MIC), IC50, and LC50 values of 3k, 3l, and 3s
(Microfilaricidal activity).
Compound
MIC (
μg/ml)
IC50
(μ
g/ml)
LC50 (μg/ml)
Piperine
3.09 ± 1.01
3.28 ± 1.21
1.58 ± 1.07
2.53 ± 1.25
8.19 ± 1.08
8.73 ± 1.55
3.25 ± 1.45
8.25 ± 1.31
16.47 ± 1.74
28.52 ± 2.25
15.68 ± 1.02
21.72 ± 1.22
3k
3l
3s
3.3. Piperine derivatives 3l, 3k and 3s induced oxidative stress in the
adult parasites
Prior experiences and experimental investigations, findings and re-
ports from our laboratory have revealed that phytochemicals and syn-
thetic compounds have the capacity to trigger oxidative damages that
cause worm mortality [16,17]. H2DCFDA based flurimetric analyses of
the treated parasites had revealed that 3l treatment caused marked in-
crease in the total ROS level in the parasite, however, treatment with
N-acetyl cysteine reversed the scenario (Fig. 4a), furthermore, data ob-
tained from flow cytometry was found to be congruent with the acquired
flurimetric data (Fig. 4c). Interestingly, marked elevation in the level of
MDA, superoxide anion and H2O2 level in the treated adult parasites was
observed (Fig. 3a–i). Increase in the level of the enzymatic anti-oxidants
(catalase, superoxide dismutase, glutathione-S-transferase (GST),
glutathione reductase (GR) and glutathione peroxidase (GPx) and
depleted level of non-enzymatic antioxidant (GSH) (Fig. 3a–i) syner-
gistically suggested that 3k, 3l and 3s induced death of S. cervi caused
due to disruption in the internal redox homeostasis of the treated par-
asites. On the other hand, Western blot analyses of the oxidative stress
markers revealed that a sharp upregulation in the Nrf2, GST and down
regulation of Keap-1 and thioredoxin reductase (TrxR) which clearly
indicate enhanced accumulation of free radicals upon treatment with
the compound 3l (Fig. 4d and e).
3.5. In silico docking of the selected compound (3l) confirms its ability to
bind thioredoxin reductase and CED-3 proteins
The superposed structures of Brugia malayi and Schistosoma mansoni
Thioredoxin reductase and the grid box are shown in Fig. 7c. The best
docked complex of the ligand and Brugia malayi Thioredoxin reductase
has binding free energy of ꢀ 5.72 kcal/mol. The ligand forms three bonds
with the protein; one h-bond with Thr511 and two hydrophobic in-
teractions with Leu480 and Cys198 as shown in Fig. 7c.
The CDD search shown that Y235 to P496 of ced-3 is Caspase domain
and R259, G316, Q356, R363, V426–S431, S435 and W436 are residues
in substrate pocket as shown in Fig. 7d. The lowest binding free energy
observed for the best docked conformation is ꢀ 5.71 kcal/mol. The
visualization of the docked complex shows presence of 3 hydrogen
bonds between the ligand and R429, S358 and E317 of ced-3 as shown
in Fig. 7d. R429 is one of the substrate pocket residue. In silico studies
show that 3l (ligand) binds with ced-3 in the substrate binding site.
3.4. Death of the exposed parasites followed the classical nematode
apoptotic pathway
3.6. Analysis of the SAR study
The flowcytometric data of the Hoechst (Sigma, USA) stained Mf
revealed that maximum chromatin condensation was observed in the 3l
treated samples in comparison to the control (Fig. 5b). However,. RT-
To understand the structure activity relationship of synthesized
compounds we have performed docking analysis. The docking scores
give an opportunity to predict the activity of compounds. Keeping this in
349

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
Fig. 2. (a) Hematoxylin-eosin staining showing dose dependent changes in tissue architecture. Damages upon treatment with the compounds are marked with black
arrows. (b) Scanning electron micrograph showing alterations in the surface morphology of the Mf of S. cervi upon treatment with the most active compound 3l.
Distortion in the surface topography has been pointed with white arrows and recovery after NAC treatment is pointed in red arrow. (c) Propidium iodide stained
oocyte of S. cervi depicting the dose dependent damage after 3l treatment. (For interpretation of the references to color in this figure legend, the reader is referred to
the Web version of this article.)
350

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
Fig. 3. 3k, 3l and 3s induce oxidative stress in S. cervi adults. Treatment with the compounds resulted into altered (a) MDA level; (b) generation of Superoxide anion;
(c) H2O2 production, (d) SOD, (e) GPx, (f) GSH, (g) Catalase, (h) GST, (i) Glutathione reductase with respect to the control. Each experiment was performed in
triplicate and repeated for at least five times. Data were expressed as mean ± SD and *p < 0.05, **p < 0.001, ***p < 0.0001 are considered as statistically significant
compared to control.
view, the docking experiments of all synthesized compounds (Supple-
mentary Table 2) were carried out to examine the scope of its gross
agreement with the inhibitory activity and probe their possible in-
teractions with the binding pocket of thioredoxin reductase enzyme
(TrxR). In this study, we have seen that compounds, 3k, 3l and 3s
showed excellent binding affinity (ΔG = 8.13 kcal/mol; ΔG = 8.22 kcal/
mol and ΔG = 8.52 kcal/mol respectively) with the catalytic site of the
protein (Supplementary Table 3). 3D – view of the docked conformation
of most active molecules clearly highlighted the importance of hydro-
phobic nature as well as electrostatic nature requirements of the binding
site for better inhibitory activity. Strong h-bond interaction with some
specific amino acids (Lys 201, Tyr 335, Thr 510 and Thr 511)
351

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
Fig. 4. 3l treatment increased the total ROS level as evident from (a) flurimetric H2DCFDA and (b) % viability of the cells processed for flowcytometric analysis of
H2DCFDA (c) flow cytometry based H2DCFDA analyses of the treated Mf. (d) 3l caused alterations in the expression patterns of the Nrf2, Keap-1, GST and TrxR with
respect to the control. (e) Quantitative densitometric analysis through Image J software.
significantly increases the binding affinity with this enzyme. Compound
3s showed very strong hydrogen bond interaction with different two
amino acids Thr 510 and Thr 511 which are placed very close to the
catalytic site of TrxR. This interaction probably induces favorable
binding affinity. The benzo [d] [1,3]dioxole group at site A position is
not only used to make h-bond interaction with all nearby amino acids of
the pocket but also improve the enzyme inhibitory activity by providing
π-π and CH-π van der Waals interaction with surrounding aromatic and
hydrophobic amino acids including Phe 513, Val 336, Thr 481, Tyr 335,
Leu 480 etc. (Supplementary Table 3, Fig. 8). Presence of the “R” group
352

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
(caption on next page)
353

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
Fig. 5. (a) % viability of the cells processed for flowcytometric analysis of Hoechst (b) 3l treatment caused DNA damage as evident from Hoechst stained based
flowcytometric analysis of Mf, (c) RT-PCR analyses of the DNA degradation pathway intermediates Cps-6, Crn-1, Nuc-1also got upregulated dose dependently
compared to the control, (d) Quantitative densitometric analysis of the RT-PCR, (e) % viability of the cells processed for JC-1-based flowcytometric analysis, (f) 3l
treatment effected mitochondrial membrane potential as evidenced from the flowcytometry based analyses (shift from red to green fluorescence) of JC-1 stained Mf
(c). (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
at site B of the general structure is crucial to maintain the bioactive
conformation the moiety. It has been seen that nature of replacement at
position “R” interestingly control the active/less active docked confor-
mation into the binding site. Any hydrophobic replacement at this po-
sition can abstemiously improve the binding interaction through proper
penetration inside the pocket. Therefore, compounds 3c, 3d, 3e, 3j, 3m
etc gives moderate binding affinity which is almost parallel with their
inhibitory activity. In addition, the presence aromatic hydrophobic
[55]. An imbalance between the concentration between the generated
ROS and antioxidants will shift the environment to an oxidatively
stressful one [56–58].
Earlier studies on the assessment of antifilarial potential of various
synthetic and natural compounds from our laboratory have routinely
evaluated the level of various enzymatic and non-enzymatic antioxi-
dants in the control and treated filarial parasites in order to estimate the
generated oxidative stress [16,17]. In congruence to our previous works,
herein also, we have observed a dose-dependent increase in superoxide
anion and hydrogen peroxide levels in the treated adult parasites which
clearly advocates ROS generation. Moreover, the increased ROS level
again settled down nearly to the normal level upon treatment with NAC.
Apart from superoxide anion and H2O2, a dose dependent enhancement
in the level of SOD was also recorded in treated parasites. Theoretically,
SOD helps in catalyzing the dismutation of superoxide radical into H2O2
and O2 and confers protection against free radical induced oxidative
stress [59]. Administration of the compounds (3k, 3l, and 3s) resulted
into a dose-dependent decrease in reduced glutathione (GSH) level in
the treated worms with respect to control. A dose dependent increase in
the GST level was observed which was thought to protect the parasites
and withstand the generated oxidative stress but failed to do so. Addi-
tionally, catalase along with GPx soothe the generation of free radicals
by eliminating potential oxidants or by converting them into stable
compounds [34]. A dose dependent reduction in the GR level in the
treated parasites corroborated with the loss of GSH in the parasitic
system. Interestingly, dose-dependent increase in both catalase and GPx
levels further advocates a sharp change in the oxidative stress response
of exposed parasites. Earlier studies have revealed that ROS have the
capacity to interact with cellular biomolecules [60]. On the other hand,
ROS also have the capabilities to initiate various cellular processes such
as apoptosis, proliferation etc. [34,61].
substitution at “R” position is more favorable to improve π-π and CH-π
van der Waals interaction (compound 3k, 3l, 3j and 3s). On the other
hand, incorporation of any less hydrophobic/polar substituent like
morpholine, furan, pyridine, 2-hydroxy nitro benzene, benzo nitraile,
etc. (Compounds 3b, 3h, 3o, 3p, 3t etc.) can change the docked
conformation in such a way so that compounds were wrongly penetrated
into the binding pocket of TrxR enzyme and showed minimum inhibi-
tory activity.
3.7. The selected three piperine compounds (3k, 3l and 3s) are non-toxic
in nature
The in vitro studies on the effect of 3k, 3l and 3s on RAW 264.7
macrophage cell line revealed no significant cellular death up to 100 μg/
ml dose (Supplementary Fig. 1) and cellular morphologies were appar-
ently seen normal (Supplementary Fig. 1). Furthermore, no toxic alter-
ations were apparent after in vivo toxicity analyses of 3k, 3l and 3s on
Wister rat. Histological studies of treated rat liver, spleen and kidney
sections revealed no notable changes in the architecture (Supplementary
Figs. 2 and 3). In addition, hematological analyses of the major pa-
rameters viz. TC, DC, Hb etc. and serological studies viz. SGOT, SGPT,
ALP and bilirubin were found at par to the control animals (Tables 3 and
4).
Therefore, nematode antioxidant enzymes and non-enzymes safe-
guard the parasites from host induced oxidative stress which fuels the
sustained survival of the parasites inside human [62]. Marked
enhancement in the level of pro-oxidants is lethal for the parasites as the
generated free radicals destroy important cellular biomolecules [63]. It
is quite apparent that the three selected compounds triggered ROS
production, additionally substantial decline in the antioxidant responses
convergently destabilized the internal redox homeostasis. Our previous
works have revealed that generation of oxidative stress is directly linked
with apoptosis activation [16,17,22,25]. Herein, similar hypothesis can
be made in favor of this series of compounds. The elevated MDA level
indicates that the selected compounds (3k, 3l, and 3s) potentially
induce membrane damage following lipid peroxidation. This destabili-
zation in the architecture of the biological membrane has potential le-
thal effect on the survivability of an organism [64]. Moreover, lipid
peroxidation further increased the level of ROS. As evident from the
obtained data, levels of superoxide anion, H2O2, and total ROS got
expressively higher in the parasite tissue after treatment. Inabilities of
the enzymatic antioxidants to counter the generated oxidative stress
further worsen the scenario. Interestingly, destabilization of the internal
redox balance can also fuel to activate other cell death pathways such as
necroptosis and ferroptosis. However, here in this article our conducted
experiments as well as the obtained result firmly fortify the initiation of
apoptosis upon treatment with these compounds.
4. Discussion
Effectiveness of the present treatment procedures against lymphatic
filariasis is limited only to the microfilarial stage of the parasites with
inadequate efficacy on the adult parasites. Additionally, emergence of
drug resistant strains of the filarial parasites is of massive concern [54].
Lack of thorough understandings on the mechanisms of action of these
widely used antifilarial drugs (DEC and Ivermectin) make the situation
more unpleasant [34]. Therefore, natural compounds and/or synthetic
chemical derived from natural sources are comparatively safe and
effective for therapeutic interventions [34].
In this study, we have evaluated the antifilarial potential of a series of
novel piperine derivatives (3a-3u) among which 3l showed maximum
effectiveness on the bovine filarial parasite S. cervi. 3l was found to be
effective in killing all the developmental stages (oocytes, Mf, adult) of
the filarial parasite at considerably low dose. The striking efficacy of the
compound in relatively low dose as compared to the standard antifilarial
drug ivermectin tempted us to study further its underlying mode of
action. From the obtained experimental data one can clearly conclude
that 3l significantly generates oxidative stress by destabilizing the in-
ternal redox balance of the parasite shifting towards a pro-oxidative
state which eventually leads to death of the filarial worms (Fig. 9).
During the course of usual cellular metabolism, generation of reac-
tive oxygen species (ROS) such as hydrogen peroxide (H2O2), superox-
ide (Oꢀ 2), and hydroxyl radicals (OH˙) is obvious and a number of
intracellular antioxidant enzymes, like catalase, SOD, GR, GPx, GST and
TrxR are responsible for harmonizing the generated oxidative stress
Furthermore, the results obtained from western blotting, PCR and
flow cytometry fortify the fact that the compound 3l upon treatment
caused mitochondrial membrane potential damage which further trig-
gered the mitochondrial arm of apoptosis induction.
354

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
355

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
Fig. 6. (a) % viable cells for apoptosis detection, (b) Induction of apoptosis was evident upon 3l exposure through Annexin-V/FITC and Propidium iodide based flow
cytometric analysis of the treated Mf, (c)
activation of caspase upon 3l treatment, (d)
RT-PCR analyses of the pro-apoptotic (EGL-
1, CED- 4 and CED-3) and anti-apoptotic
gene (CED-9), (e) Quantitative densito-
metric analysis through Image J software. (f)
Western blot analyses of the pro (EGL-1,
CED-3, CED-4) and antiapoptotic (EGL-1)
proteins, (g) Quantitative densitometric
analysis of the bands analyzed through
Image J software.
Fig. 7. (a) Western blot analyses of the
intrinsic and extrinsic apoptotic proteins, (b)
Quantitative densitometric analysis of the
bands analyzed through Image J software,
Bioinformatic analysis of the binding of 3l
with (c) The 6FMZ is shown in yellow, its
ligand is shown in blue and the modeled
structure is shown in red. The grid of 24 ×
24 × 24 Å3was used for docking considering
the ligand binding region to be similar in
both the thioredoxin. The docked complex of
the ligand (red) and the modeled protein
(blue) is shown with the labeled interacting
residues.(d)The graphical summary of CDD
search using ced-3 sequence showing the
domains. The docked complex of ced-3
(magenta) and ligand (blue) showing the
hydrogen bonds (dotted lines) between the
ligand and the residues (labeled in black).
(For interpretation of the references to color
in this figure legend, the reader is referred to
the Web version of this article.)
356

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
Fig. 8. Docking analysis of synthesized compounds. Figure (a) depicting the docked conformations of most active and less active compounds in the binding pocket of
thioredoxin reductase enzyme. Figure (b) shows the docked 3D-conformations of most active compounds (Compound 3k – Green; Compound 3l – Cyan and com-
pound 3s – yellow). Red dotted (—) line is indicating h-bond interactions with surrounded amino acids of binding site. Finally, figure (c) provides the 2D docked
information of active compounds. Green and violet circled amino acids display their polar and non-polar interactions nature. (For interpretation of the references to
color in this figure legend, the reader is referred to the Web version of this article.)
Table 3
Effect on hematological parameters after 7 days of acute exposure (oral administration) of 3k, 3l and 3s (Results were expressed as mean ± S.E.M. of 6 animals
per group.).
7days post exposure
Compound
Control
3k
3l
3s
Analyzed parameters
500
μg/kg b.wt.
1000
μg/kg b.wt.
500
μg/kg b.wt.
1000
μg/kg b.wt.
500
μ
g/kg b.wt.
1000 μg/kg b.wt.
RBC (106/mm3)
WBC (103/mm3)
Hemoglobin (gm/dl)
Platelets (104 cells/mm3)
Neutrophils (%)
Lymphocytes (%)
Eosinophils (%)
4.65 ± 1.32
10.89 ± 1.36
13.41 ± 1.12
4.49 ± 1.23
25.28 ± 2.36
38.27 ± 1.81
1.71 ± 0.25
3.33 ± 1.15
00 ± 0
4.7 ± 1.15
4.75 ± 1.61
10.89 ± 2.1
13.39 ± 1.11
4.52 ± 1.23
25.64 ± 2.21
38.78 ± 1.25
1.66 ± 0.36
3.21 ± 1.21
00 ± 0
4.69 ± 1.38
11.02 ± 1.97
13.35 ± 1.27
4.54 ± 1.2
26.25 ± 2.13
37.88 ± 1.54
1.62 ± 0.35
3.11 ± 1.2
00 ± 0
4.71 ± 1.23
11.01 ± 2.1
13.5 ± 1.05
4.48 ± 1.3
26.47 ± 2.5
37.65 ± 1.29
1.61 ± 0.82
3.15 ± 1.15
00 ± 0
4.68 ± 1.28
11.12 ± 1.89
13.44 ± 1.05
4.51 ± 1.29
25.87 ± 1.20
38.02 ± 1.45
1.60 ± 0.85
3.13 ± 1.08
00 ± 0
4.641 ± 1.17
11.2 ± 2.1
11.28 ± 2.22
13.45 ± 1.06
4.56 ± 1.32
25.51 ± 2.26
38.95 ± 1.64
1.58 ± 0.64
3.11 ± 1.12
00 ± 0
13.23 ± 1.24
4.55 ± 1.48
25.67 ± 2.41
38.22 ± 1.56
1.68 ± 0.25
3.18 ± 1.22
00 ± 0
Monocytes (%)
Basophils (%)
Apoptosis induction in the 3l treated adult parasites was obvious
from the obtained molecular biology data. RT-PCR profiling of different
apoptosis execution and DNA degradation genes in adult S. cervi clearly
showed significant upregulation. Marked increase in the expressions of
proapoptotic EGL-1, CED-4 and CED-3 and downregulation of anti-
apoptotic CED-9 specifically pointed out the commencement of
apoptosis in the treated parasites. Moreover, Cps-6 (C. elegans homo-
logue of mammalian endonuclease G released from mitochondria) Crn-
1, (C. elegans homologue of human flap endonuclease-1 (FEN-1)) and
Nuc-1 functionally known as intermediates of DNA degradation pathway
[20–22] got upregulated upon 3l treatment. Moreover, the Hoechst
stained Mf showed significant chromatin condensation. Additionally,
the flowcytometric data of the Hoechst stained Mf was also congruent
with the obtained microscopic images. Apart from it, Annexin-V FITC/PI
based flowcytometric data also advocates apoptosis (early) induction.
Destabilization of the mitochondrial membrane potential as observed in
the JC-1 stained based FACS analysis strikes the involvement of mito-
chondrial arm into the death phenomenon.
Perceptible alterations in the intermediates of the intrinsic and
extrinsic pathway of apoptosis further reinforce apoptosis upon
357

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
Table 4
Effect on serological parameters after 7 days of acute exposure (oral administration) of 3k, 3l and 3s (Results were expressed as mean ± S.E.M. of 6 animals per
group.).
7days post exposure
Compound
Control
3k
3l
3s
Analyzed parameters
500
μ
g/kg b. wt
1000
μg/kg b. wt
500
μg/kg b. wt
1000
μ
g/kg b. wt
500
μg/kg b. wt
1000 μg/kg b. wt
Total protein (gm/dL)
Albumin (gm/dL)
6.78 ± 1.32
3.58 ± 1.2
6.81 ± 1.52
6.85 ± 1.32
6.75 ± 1.51
6.79 ± 1.38
6.89 ± 1.29
7.17 ± 1.34
3.65 ± 1.32
3.75 ± 1.1
3.598 ± 1.01
0.357 ± 0.012
0.131 ± 0.012
0.24 ± 0.003
113.97 ± 3.16
32.34 ± 2.13
77.93 ± 2.12
3.64 ± 1.23
3.768 ± 1.19
0.38 ± 0.058
0.138 ± 0.0187
0.247 ± 0.04
116.39 ± 2.36
32.38 ± 2.154
77.89 ± 2.36
3.821 ± 1.168
0.394 ± 0.012
0.148 ± 0.0019
0.264 ± 0.027
118.37 ± 3.57
32.76 ± 2.34
77.98 ± 2.33
Serum bilirubin (mg/dL)
Serum bilirubin (Con) (mg/dL)
Serum bilirubin (Uncon) (mg/dL)
Alkaline phosphates (U/L)
ALT (U/L)
0.35 ± 0.05
0.124 ± 0.01
0.236 ± 0.008
114.25 ± 5.35
31.5 ± 2.57
79.25 ± 2.54
0.36 ± 0.045
0.127 ± 0.012
0.24 ± 0.003
114.46 ± 3.25
31.24 ± 2.36
78.88 ± 2.14
0.375 ± 0.047
0.148 ± 0.01
0.278 ± 0.033
115.57 ± 2.47
31.65 ± 2.18
78.87 ± 2.14
0.42 ± 0.022
0.14 ± 0.0012
0.267 ± 0.0035
115.08 ± 2.63
33.11 ± 2.568
78.11 ± 2.48
AST (U/L)
Fig. 9. Detailed molecular mode of action of 3l. Upon treatment with the compound, destabilization of the lipid bilayer takes place which increased the MDA level
through lipid perxidation. On the other hand, disruption of the membrane structure generates oxidative stress through production of reactive oxygen species.
Perturbation in the internal redox homeostasis upon treatment caused loss of mitochondrial membrane potential which in turn augmented caspase mediated death of
the filarial pathogens. Additionally, activation of the classical CED-pathway of nematode apoptosis also fuelled the death phenomenon.
treatment. Moreover, the visible enhancements in the oxidative stress
markers also project the stress inducing ability of the selected com-
pound. On the other hand, results of the molecular docking studies also
claim that 3l bears a handsome ability to bind with the nematode CED-3
and TrxR. These two proteins play important role in nematode life. The
enzyme TrxR critically maintains the redox homeostasis as well as
several other physiological functions [62]. On the other side, the protein
CED-3 is directly associated with nematode apoptosis and considered as
the executioner caspase. Therefore, the ability of this compound to bind
and alter the functions (results from western blots and PCR) signify the
real beauty of this synthesized novel chemical compound.
Furthermore, the favorable binding energy of the compounds with
the antioxidant enzyme TrxR as revealed from the SAR study advocates
the suitability of the compounds for therapeutic intervention. As already
discussed elsewhere [62] the importance of this TrxR enzyme in para-
sites therefore selective targeting of it may probably be effective for
treatment. Although SAR study promotes compound 3s as most active
but the compound 3l is more favored because of its low IC50 value in
358

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
terms of adulticidal potential.
DST PURSE Program (SR/PURSE 2/42/G) for the support of chemicals
and scanning electron microscopic facility.
This high pro-oxidative environment was found to signal apoptosis in
S. cervi which was evident from both DNA and protein levels. Studies
have revealed that, ROS was the underlying mechanism behind the
effectiveness of 3l. Application of NAC was found to normalize the
oxidative stress and apoptosis induction potential of the compounds.
This vital observation has suggested that 3l caused apoptotic death in
S. cervi fundamentally beckoned from ROS. Therefore, the death of the
parasite following apoptosis induction is basically ROS dependent. From
the obtained results question may arise why necroptosis or ferroptosis
was not considered as the mechanism behind the effectiveness of these
compounds. Specifically, there remain sharp distinctions between
apoptosis and other two death pathways as evidenced from this study.
Necroptosis can be estimated flowcytometrically through Annexin-V
FITC/PI wherein, cells will be in the quadrant that is positive for both
Annexin-V and PI [65] but in our study we found cells which are
Annexin-V positive but PI negative which specifically denotes apoptosis.
Moreover, in necroptosis Cas-8 is inactivated [66] but here in our study
Cas-8 was upregulated significantly. Therefore, we can eliminate the
chance of necroptosis induction upon treatment. Although the increased
MDA level (lipid ROS) was matching with the ferroptotic event but the
Nrf2 and the Keap-1 expression which was supposed to be inactivated
during ferroptosis [67] was not at par with this pathway. Therefore, the
present study predominantly promotes apoptotic event behind the death
of the parasites.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.freeradbiomed.2021.04.026.
References
[1] D.O. Famakinde, Mosquitoes and the lymphatic filarial parasites: research trends
and budding roadmaps to future disease eradication, Trav. Med. Infect. Dis. 3
(2018) 4, https://doi.org/10.3390/tropicalmed3010004.
[2] J. Cano, M.P. Rebollo, N. Golding, et al., The global distribution and transmission
limits of lymphatic filariasis: past and present, Parasites Vectors 7 (2014) 466,
https://doi.org/10.1186/s13071-014-0466-x.
[3] The World Health Organization (WHO). https://www.who.int/news-room/fact-sh
eets/detail/lymphatic-filariasis. (Accessed 19 February 2021).
[4] S. Chakraborty, M. Gurusamy, D.C. Zawieja, M. Muthuchamy, Lymphatic filariasis:
perspectives on lymphatic remodeling and contractile dysfunction in filarial
disease pathogenesis, Microcirculation 20 (2013) 349–364, https://doi.org/
10.1111/micc.12031.
[5] S. Mukherjee, N. Joardar, S.P. Sinha Babu, Current trends in targeted chemo- and
immunotherapy against bancroftian filariasis: biochemical, molecular and
pharmacological perspectives, in: A. Yadav, V. Tandon, S.L. Hoti (Eds.), Advances
in Medico-Veterinary Parasitology: an Indian Perspective, Panima Publishing
Corporation, New Delhi, 2018, pp. 397–414.
[6] S. Mukherjee N. Joardar, S.P. Sinha Babu, Redox regulatory circuits as targets for
therapeutic intervention of bancroftian filariasis: biochemical, molecular, and
pharmacological perspectives, in: S. Chakraborti, T. Chakraborti,
D. Chattopadhyay, C. Shaha (Eds.), Oxidative Stress in Microbial Diseases,
Springer, Singapore, 2019, pp. 185–208, https://doi.org/10.1007/978-981-13-
8763-0_10.
Finally, the non-toxic nature of the selected candidates is an added
advantage for projecting them as novel antifilarial therapeutics. To date,
antifilarial efficacy of piperine derivatives has not been reported,
therefore, this study is a maiden report on the antifilarial efficacy and
safety of novel bioactive piperine derivatives.
[7] S.A.A. Rizvi, A.M. Saleh, Applications of nanoparticle systems in drug delivery
technology, Saudi Pharmaceut. J. 26 (2018) 64–70, https://doi.org/10.1016/j.
jsps.2017.10.012.
[8] S. Onoue, S. Yamada, H.K. Chan, Nanodrugs: pharmacokinetics and safety, Int. J.
Nanomed. 9 (2014) 1025–1037, https://doi.org/10.2147/IJN.S38378.
[9] Y.H. Choi, H.K. Han, Nanomedicines: current status and future perspectives in
aspect of drug delivery and pharmacokinetics, J. Pharm. Invest. 48 (2018) 43–60,
https://doi.org/10.1007/s40005-017-0370-4.
5. Conclusion
In this study, a series of piperine derivatives (3a-3u) were taken into
consideration for evaluating the therapeutic potential against filarial
parasite. Three compounds viz. 3k, 3l and 3s were found to exhibit
promising efficacies, among others. Our study has revealed that 3l
caused oxidative stress mediated apoptosis in the exposed parasite
without harming the host. Collectively our findings suggest that piperine
derivative 3l has comparable filaricidal potential. A plausible mecha-
nism of action has been depicted in this study and it can be considered
for further development and advancement of antifilarial
chemotherapeutics.
[10] N. Joardar, N. Mukherjee, S.P. Sinha Babu, Nanopharmaceuticals to target
antifilarials: administration of old age drugs in a novel way, in: F.
Rocha Inamuddin, F.P. Severino (Eds.), Applications of Nanobiotechnology for
Neglected Tropical Diseases, Academic Press, 2021, ISBN 9780128211007.
[11] A. Tiwari, K.R. Mahadik, S.Y. Gabhe Piperine, A comprehensive review of methods
of isolation, purification, and biological properties, Med, Drug Disc 7 (2020)
100027, https://doi.org/10.1016/j.medidd.2020.100027.
[12] H. Tang, W. Chen, M.Z. Dou, R. Chen, Y. Hu, W. Chen, H. Chen, Antimicrobial
effect of black pepper petroleum ether extract for the morphology of Listeria
monocytogenes and Salmonella typhimurium, J. Food Sci. Technol. 54 (2017)
2067–2076, https://doi.org/10.1007/s13197-017-2644-2.
[13] P.V. Karsha, O.B. Lakshmi, Antibacterial activity of black pepper (Piper nigrum
Linn.) with special reference to its mode of action on bacteria, Indian J. Nat Prod
Resour. 1 (2010) 213–215.
Author contribution
[14] A. Thiengsusuk, P. Muhamad, W. Chaijaroenkul, K.N. Bangchang, Antimalarial
activity of piperine, J. Trop. Med. (2018) 9486905, https://doi.org/10.1155/
2018/9486905.
NJ, SPS, AKM, KJ conceived the study; PS and AKM designed and
performed the chemical synthesis of the piperine derivatives; NJ
designed and performed all the biological experiments; SH did the flow
cytometry based biological experiments and analyses; UD performed the
structure activity relationship study, NJ, SPS, KJ and AKM wrote and
reviewed the final draft of the manuscript; SPS, KJ, and AKM supervised
the entire study.
[15] M. Samuel, S.V. Oliver, M. Coetzee, B.D. Basil, The larvicidal effects of black
pepper (Piper nigrum L.) and piperine against insecticide resistant and susceptible
strains of Anopheles malaria vector mosquitoes, Parasites Vectors 9 (2016), https://
doi.org/10.1186/s13071-016-1521-6.
[16] S. Mukherjee, N. Joardar, S. Mondal, A. Schiefer, A. Hoerauf, K. Pfarr, S.P. Sinha
Babu, Quinolone-fused cyclic sulfonamide as a novel benign antifilarial agent, Sci.
Rep. 8 (2018) 12073, https://doi.org/10.1038/s41598-018-30610-7.
[17] A.S. Ray, N. Joardar, S. Mukherjee, C.H. Rahaman, S.P. Sinha Babu, Polyphenol
enriched ethanolic extract of Cajanus scarabaeoides (L.) Thouars exerts potential
antifilarial activity by inducing oxidative stress and programmed cell death, PloS
One 13 (2018), e0208201, https://doi.org/10.1371/journal.pone.0208201.
[18] A. Gucchait, N. Joardar, P.K. Parida, P. Roy, N. Mukherjee, A. Dutta,
R. Yesuvadian, S.P. Sinha Babu, K. Jana, A.K. Misra, Development of novel anti-
filarial agents using carbamo(dithioperoxo)thioate derivatives, Eur. J. Med. Chem.
143 (2018) 598–610, https://doi.org/10.1016/j.ejmech.2017.11.047.
[19] N. Yan, J. Chai, E.S. Lee, L. Gu, Q. Liu, J. He, J.W. Wu, D. Kokel, H. Li, Q. Hao,
D. Xue, Y. Shi, Structure of the CED-4-CED-9 complex provides insights into
programmed cell death in Caenorhabditis elegans, Nature 437 (2005) 831–837,
https://doi.org/10.1038/nature04002.
Declaration of competing interest
None.
Acknowledgement
This study was funded by Department of Science and Technology
(DST), India (SR/SO/AS-006/2014). NJ and PS sincerely acknowledges
the Council for Scientific and Industrial Research (CSIR), Govt. of India
for providing the Senior Research Fellowship. NJ and SPS sincerely
thank the Head, Department of Zoology, Visva-Bharati, Santiniketan for
providing the departmental research facilities; sincere thanks are due to
[20] G. Lettre, M.O. Hengartner, Developmental apoptosis in C. elegans: a complex
CEDnario, Nat. Rev. Mol. Cell Biol. 7 (2006) 97–108, https://doi.org/10.1038/
nrm1836.
[21] J.Z. Parrish, C. Yang, B. Shen, D. Xue, CRN-1, a Caenorhabditis elegans FEN-1
homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation,
EMBO J. 22 (2003) 3451–3460, https://doi.org/10.1093/emboj/cdg320.
359

N. Joardar et al.
Free Radical Biology and Medicine 169 (2021) 343–360
[22] N. Mukherjee, N. Joardar, S.P. Sinha Babu, Antifilarial activity of azadirachtin
fuelled through reactive oxygen species induced apoptosis: a thorough molecular
study on Setaria cervi, J. Helminthol. 93 (2018) 519–528, https://doi.org/
10.1017/S0022149X18000615.
receptor flexibility, J. Comput. Chem. 30 (2009) 2785–2791, https://doi.org/
10.1002/jcc.21256.
[45] P. Roy, A. Sengupta, N. Joardar, A. Bhattacharyya, N.C. Saha, A.K. Misra, S.
P. Sinha Babu, Influence of autophagy, apoptosis and their interplay in filaricidal
activity of C-cinnamoyl glycosides, Parasitology 146 (2019) 1451–1461, https://
doi.org/10.1017/S0031182019000660.
[23] G.J. Kontoghiorghes, C.N. Kontoghiorghe, Prospects for the introduction of
targeted antioxidant drugs for the prevention and treatment of diseases related to
free radical pathology, Expet Opin. Invest. Drugs 7 (2019) 593–603, https://doi.
org/10.1080/13543784.2019.1631284.
[46] E.J. Kim, M.Y. Lee, Y.J. Jeon, Silymarin inhibits morphological changes in LPS-
stimulated macrophages by blocking NF-κB pathway, KOREAN J. PHYSIOL.
PHARMACOL. 19 (2015) 211–218, https://doi.org/10.4196/kjpp.2015.19.3.211.
[47] I. Philipova, V. Valcheva, R. Mihaylova, M. Mateeva, I. Doytchinova, G. Stavrakov,
Synthetic piperine amide analogs with antimycobacterial activity, Chem. Biol.
Drug Des. 91 (2018) 763–768, https://doi.org/10.1111/cbdd.13140.
[48] M. Subramani, S.K. Rajendran, Mild, metal-free and protection-free transamidation
of N-Acyl-2-piperidones to amino acids, amino alcohols and aliphatic amines and
esterification of N-Acyl-2-piperidones, Eur. J. Org Chem. (2019) 3677–3686,
https://doi.org/10.1002/ejoc.201900517.
[24] J.C. Comley, M.J. Rees, C.H. Turner, D.C. Jenkins, Colorimetric quantitation of
filarial viability, Int. J. Parasitol. 19 (1989) 77–83, https://doi.org/10.1016/0020-
7519(89)90024-6.
[25] N. Mukherjee, S. Mukherjee, P. Saini, P. Roy, S.P. Sinha Babu, Antifilarial effects of
polyphenol rich ethanolic extract from the leaves of Azadirachta indica through
molecular and biochemical approaches describing reactive oxygen species (ROS)
mediated apoptosis of Setaria cervi, Exp. Parasitol. 136 (2014) 41–58, https://doi.
org/10.1016/j.exppara.2013.11.006.
[26] N. Joardar, S. Mukherjee, S.P. Sinha Babu, Thioredoxin reductase from the bovine
filarial parasite Setaria cervi: studies on its localization and optimization of the
extraction, Int. J. Biol. Macromol. 107 (2018) 2375–2384, https://doi.org/
10.1016/j.ijbiomac.2017.10.114.
[49] A. Schoffmann, L. Wimmer, D. Goldmann, S. Khom, J. Hintersteiner, I. Baburin, et
al., Efficient modulation of γ-Aminobutyric acid type a receptors by piperine
derivatives, J. Med. Chem. 57 (2014) 5602–5619, https://doi.org/10.1021/
jm5002277.
[27] S. Ratanatham, O. Sirivanichkul, E.S. Upatham, P. Sobhon, V. Viyanant,
C. Ketavan, Scanning electron microscopic study of microfilaria and the third stage
larva of Wuchereria bancrofti, Southeast Asian J. Trop. Med. Publ. Health 4 (1997)
820–825.
[50] S. Gertler, H. Haller, New compounds. N-substituted piperonylamides, J. Am.
Chem. Soc. 64 (1942) 1741, https://doi.org/10.1021/ja01259a600.
[51] K.R. Amperayani, K.N. Kumar, U.D. Parimi, Synthesis and in vitro and in silico
antimicrobial studies of novel piperine-pyridine analogs, Res. Chem. Intermed. 44
(2018) 3549–3564, https://doi.org/10.1007/s11164-018-3324-1.
[52] V.F. Paula, L.C.A. Barbosa, A.J. Demuner, D.P. Veloso, M.C. Picanço, Synthesis and
insecticidal activity of new amide derivates of piperine, Pest Manag Sci 56 (2000)
168–174, https://doi.org/10.1002/(SICI)1526-4998(200002)56:2<168::AID-
PS110>3.0.CO;2-H.
˜
[28] Y.J. Garcia, A.J. Rodríguez-Malaver, N. Penaloza, Lipid peroxidation measurement
by thiobarbituric acid assay in rat cerebellar slices, J. Neurosci. Methods 144
(2005) 127–135, https://doi.org/10.1016/j.jneumeth.2004.10.018.
[29] H.S. Choi, J.W. Kim, Y.N. Cha, C. Kim, A quantitative nitroblue tetrazolium assay
for determining intracellular superoxide anion production in phagocytic cells,
J. Immunoassay Immunochem. 27 (2006) 31–44, https://doi.org/10.1080/
15321810500403722.
[53] P.L. Sangwan, J.L. Koul, S. Koul, M.V. Reddy, N. Thota, I.A. Khan, A. Kumar, N.
P. Kalia, G.N. Qazi, Piperine analogs as potent Staphylococcus aureus NorA efflux
pump inhibitors, Bioorg. Med. Chem. 16 (2008) 9847–9857, https://doi.org/
10.1016/j.bmc.2008.09.042.
[30] A.H. Sardar, S. Kumar, A. Kumar, B. Purkait, S. Das, A. Sen, et al., Proteome
changes associated with Leishmania donovani promastigote adaptation to oxidative
and nitrosative stresses, J. Proteomics 81 (2013) 185–199, https://doi.org/
10.1016/j.jprot.2013.01.011.
[54] E. Neff, C.C. Evans, P.D. Jimenez Castro, R.M. Kaplan, G. Dharmarajan, Drug
resistance in filarial parasites does not affect mosquito vectorial capacity,
Pathogens 10 (2020) 2, https://doi.org/10.3390/pathogens10010002.
[55] J.D. Hayes, A.T. Dinkova-Kostova, K.D. Tew, Oxidative stress in cancer, Canc. Cell
38 (2020) 167–197, https://doi.org/10.1016/j.ccell.2020.06.001.
[56] H. Sies, D.P. Jones, Reactive oxygen species (ROS) as pleiotropic physiological
signalling agents, Nat. Rev. Mol. Cell Biol. 21 (2020) 363–383, https://doi.org/
10.1038/s41580-020-0230-3.
[31] S.B. Su, Y. Motoo, J.L. Iovanna, P. Berthezene, M.J. Xie, H. Mouri, K. Ohtsubo,
F. Matsubara, N. Sawabu, Overexpression of p8 is inversely correlated with
apoptosis in pancreatic cancer, Clin. Canc. Res. 7 (2001) 1320–1324.
[32] A. Nayak, P. Gayen, P. Saini, S. Maitra, S.P. Sinha Babu, Albendazole induces
apoptosis in adults and microfilariae of Setaria cervi, Exp. Parasitol. 128 (2011)
236e242.
[33] C. Riccardi, I. Nicoletti, Analysis of apoptosis by propidium iodide staining and
flow cytometry, Nat. Protoc. 1 (2006) 1458–1461, https://doi.org/10.1038/
nprot.2006.238.
[57] H. Sies, C. Berndt, D.P. Jones, Oxidative stress, Annu. Rev. Biochem. 86 (2017)
715–748, https://doi.org/10.1146/annurev-biochem-061516-045037.
¨
[58] A. Seiler, M. Schneider, H. Forster, S. Roth, E.K. Wirth, C. Culmsee, N. Plesnila,
[34] N. Mukherjee, P.K. Parida, A. Santra, T. Ghosh, A. Dutta, K. Jana, A.K. Misra, S.
P. Sinha Babu, Oxidative stress plays major role in mediating apoptosis in filarial
nematode Setaria cervi in the presence of trans-stilbene derivatives, Free Radic.
Biol. Med. 93 (2016) 130–144, https://doi.org/10.1016/j.
E. Kremmer, O. Rådmark, W. Wurst, G.W. Bornkamm, U. Schweizer, M. Conrad,
Glutathione peroxidase 4 senses and translates oxidative stress into 12/15-lipoxy-
genase dependent- and AIF-mediated cell death, Cell Metabol. 8 (2008) 237–248,
https://doi.org/10.1016/j.cmet.2008.07.005.
freeradbiomed.2016.01.027.
[59] T. Fukai, M. Ushio-Fukai, Superoxide dismutases: role in redox signaling, vascular
function, and diseases, Antioxidants Redox Signal. 15 (2011) 1583–1606, https://
doi.org/10.1089/ars.2011.3999.
[35] The UniProt Consortium, UniProt: a worldwide hub of protein knowledge, Nucleic
Acids Res. 47 (2019) D506–D515, https://doi.org/10.1093/nar/gky1049.
[36] A. Marchler-Bauer, M.K. Derbyshire, N.R. Gonzales, S. Lu, F. Chitsaz, et al., CDD:
NCBI’s conserved domain database, Nucleic Acids Res. 43 (2015) D222–D226,
https://doi.org/10.1093/nar/gku1221.
[60] M. Schieber, N.S. Chandel, ROS function in redox signaling and oxidative stress,
Current Biol CB 24 (2014) R453–R462, https://doi.org/10.1016/j.
cub.2014.03.034.
´
[37] P.W. Rose, A. Prlic, A. Altunkaya, C. Bi, A.R. Bradley, C.H. Christie, et al., The
[61] J. Loscalzo, Membrane redox state and apoptosis: death by peroxide, Cell Metabol.
8 (2008) 182–183, https://doi.org/10.1016/j.cmet.2008.08.004.
[62] N. Joardar, S.P. Sinha Babu, A review on the druggability of a thiol-based
enzymatic antioxidant thioredoxin reductase for treating filariasis and other
parasitic infections, Int. J. Biol. Macromol. 142 (2020) 125–141, https://doi.org/
10.1016/j.ijbiomac.2019.09.083.
RCSB protein data bank: integrative view of protein, gene and 3D structural
information, Nucleic Acids Res. 45 (2017) D271–D281, https://doi.org/10.1093/
nar/gkw1000.
[38] W. Huang, T. Jiang, W. Choi, S. Qi, Y. Pang, Q. Hu, et al., Mechanistic insights into
CED-4-mediated activation of CED-3, Genes Dev. 27 (2013) 2039–2048, https://
doi.org/10.1101/gad.224428.113.
[63] A. Rahal, A. Kumar, V. Singh, B. Yadav, R. Tiwari, S. Chakraborty, K. Dhama,
Oxidative stress, prooxidants, and antioxidants: the interplay, BioMed Res. Int.
2014 (2014) 761264, https://doi.org/10.1155/2014/761264.
[39] https://www.mn-am.com/online_demos/corina_demo_interactive, 215.12.2020.
[40] S. Forli, R. Huey, M.E. Pique, M.F. Sanner, D.S. Goodsell, A.J. Olson,
Computational protein–ligand docking and virtual drug screening with the
AutoDock suite, Nat. Protoc. 11 (2016) 905–919, https://doi.org/10.1038/
nprot.2016.051.
[64] S. Tiwari, M. Wadhawan, N. Singh, S. Rathaur, Effect of CDNB on filarial
thioredoxin reductase, A proteomic and biochemical approach, J Proteomics 113
(2015) 435–446, https://doi.org/10.1016/j.jprot.2014.10.007.
`
[41] Discovery Studio 2017 R2 BIOVIA, Dassault Systemes, San Diego, http://accelrys.
[65] U. Natarajan, T. Venkatesan, V. Radhakrishnan, S. Samuel, A. Rathinavelu,
Differential mechanisms of cell death induced by HDAC inhibitor SAHA and MDM2
inhibitor RG7388 in MCF-7 cells, Cells 8 (2018), https://doi.org/10.3390/
cells8010008, 8.
com/products/collaborative-science/bioviadiscoverystudio/visualization.html.
[42] G.M. Morris, R. Huey, W. Lindstrom, M.F. Sanner, R.K. Belew, D.S. Goodsell, A.
J. Olson AutoDock4, AutoDockTools4, Automated docking with selective receptor
flexibility, J. Comput. Chem. 30 (2009) 2785–2789.
[66] Y.K. Dhuriya, D. Sharma, Necroptosis: a regulated inflammatory mode of cell
death, J. Neuroinflammation 15 (2018) 199, https://doi.org/10.1186/s12974-
018-1235-0.
[43] U. Debnath, S. Verma, S. Jain, S.B. Katti, Y.S. Prabhakar, Pyridones as NNRTIs
against HIV-1 mutants:3D-QSAR and protein informatics, J. Comput. Aided Mol.
Des. 27 (2013) 637–654.
[67] X. Sun, Z. Ou, R. Chen, X. Niu, D. Chen, R. Kang, D. Tang, Activation of the p62-
Keap1-NRF2 pathway protects against ferroptosis in hepatocellular carcinoma
cells, Hepatology 63 (2016), https://doi.org/10.1002/hep.28251, 173-84.
[44] G.M. Morris, R. Huey, W. Lindstrom, M.F. Sanner, R.K. Belew, D.S. Goodsell, A.
J. Olson, AutoDock4 and AutoDockTools4: automated docking with selective
360