Antisense oligonucleotides containing conformational constrained 2′,4′-(N-Methoxy)aminomethylene and 2′4′- aminooxymethylene and 2′-O,′-C-aminomethylene bridged nucleoside analogues show improved potency in animal models

Article abstract of DOI:10.1021/jm9013295

To identify chemistries and strategies to improve the potency of MOE second generation ASOs, we have evaluated gapmer antisense oligonucleotides containing BNAs having N-O bonds. These modifications include AT-MeO-amino BNA, N-Me-aminooxy BNA, 2′,4′-BNA

Full text of DOI:10.1021/jm9013295

1636 J. Med. Chem. 2010, 53, 1636–1650
DOI: 10.1021/jm9013295
Antisense Oligonucleotides Containing Conformationally Constrained
20,40-(N-Methoxy)aminomethylene and 20,40-Aminooxymethylene and
20-O,40-C-Aminomethylene Bridged Nucleoside Analogues Show Improved
Potency in Animal Models
Thazha P. Prakash,* Andrew Siwkowski, Charles R. Allerson, Michael T. Migawa, Sam Lee, Hans J. Gaus, Chris Black,
Punit P. Seth, Eric E. Swayze, and Balkrishen Bhat†
Department of Medicinal Chemistry and Antisense Core Research, Isis Pharmaceuticals Inc., 1896 Rutherford Road, Carlsbad, California 92008.
Current address: Regulus Therapeutics, 1896 Rutherford Road, Carlsbad, California 92008.
†
Received September 7, 2009
To identify chemistries and strategies to improve the potency of MOE second generation ASOs, we have
evaluated gapmer antisense oligonucleotides containing BNAs having N-O bonds. These modifica-
tions include N-MeO-amino BNA, N-Me-aminooxy BNA, 20,40-BNANC[NMe], and 20,40-BNANC
bridged nucleoside analogues. These modifications provided increased thermal stability and improved
in vitro activity compared to the corresponding ASO containing the MOE modification. Additionally,
ASOs containing N-MeO-amino BNA, N-Me-aminooxy BNA, and 20,40-BNANC[NMe] modifications
showed improved in vivo activity (>5-fold) compared to MOE ASO. Importantly, toxicity parameters,
such as AST, ALT, liver, kidney, and body weights, were found to be normal for N-MeO-amino BNA,
N-Me-aminooxy BNA, and 20,40-BNANC[NMe] ASO treated animals. The data generated in these
experiments suggest that N-MeO-amino BNA, N-Me-aminooxy BNA, and 20,40-BNANC[NMe] are
useful modifications for applications in both antisense and other oligonucleotide based drug discovery
efforts.
Introduction
bone substitution which work predominantly through an
RNase H dependent mechanism. The substitution of a sulfur
for oxygen in the backbone ester increases stability to nucleo-
lytic degradation and improves pharmacokinetics via increas-
ing plasma protein binding and tissue uptake.3,4
ASOsa can modulate gene expression by binding to a
specific mRNA through Watson-Crick base pairing. Upon
binding, the oligonucleotide can modulate RNA processing,
inhibit translation, or promote degradation. Mechanisms of
degradation include recruitment of RNase H, which cleaves
the RNA strand of a DNA-RNA duplexes, and activation of
the RNAi pathway utilizing siRNA or shRNA.1 Currently
there is one approved antisense product2 and multiple drugs
employing various chemical designs in active development.
The first generation of ASO therapeutics was 20-DNA oligo-
mers uniformly modified with the phosphorothioate back-
To improve upon the first generation ASO drugs, many
different modifications to the core nucleoside monomer unit
of the ASO have been evaluated for their effects on affinity
for complementary RNA, nuclease resistance, and ASO
potency.5-8 Most of the modifications that enhance affinity
and nuclease resistance, in particular, the 20-substituted nu-
cleosides, also limit the abilityof the ASO tosupport RNase H
mediated cleavage of the targeted RNA.9 Optimization of
ASO design has led to the development of chimeric “gapmer”
designs (Figure 1A) in which a central DNA region of 7-14
nucleotides is flanked on the 50- and 30-ends by two to six
20-modifications.10 The most advanced of these second gen-
eration antisense designs are MOE gapmer oligonucleotides.11
MOE modified ASOs show increased affinity to a comple-
mentary RNA and are highly resistant toward degradation by
nucleases.12 These improvements resulted in a substantial
(>20-fold) increase in oligonucleotide potency in cell culture,
relative to first generation ASOs.13,14 MOE ASOs have been
shown to possess both excellent pharmacokinetic properties15-17
and robust pharmacological activity in animals18,19,19-23 and in
human clinical trials.24 To date, MOE ASOs have an excellent
safety record in human clinical trials.24-26
*To whom correspondence should be addressed. Phone: 760-603-
2590. Fax: 760-603-3891. E-mail: tprakash@isisph.com.
a Abbreviations: EtOAc, ethyl acetate; DMAP, 4-di(methyl-
amino)pyridine; DMSO, dimethyl sulfoxide; DMF, N,N-dimethylform-
amide; DMTCl, 4,40-dimethoxytrityl chloride; Nap, 2-(methyl)-
naphthalene; rt, room temperature; ASO, antisense oligonucleotide;
ALT, alanine aminotransferase; AST, aspartate aminotransferase;
PS-DNA, DNA phosphorothioates; PTEN, phosphatase and tensin
homologue; PBS, phosphate buffered saline; DBU, 1,8-diazabicyclo-
[5.4.0]undec-7-ene; DMT, 4,40-dimethoxytrityl ; MOE, 20-O-(2-meth-
oxyethyl); BNA, 20,40-bridged nucleic acid; LNA, locked nucleic acid;
N-Me-aminooxy BNA, 20-N-(methyl)-40-C-aminooxymethylene 20,40-
bridged nucleic acid; N-Me-aminooxy 20,40-bridged nucleic acid, 20-
N-(methyl)-40-C-aminooxymethylene 20,40-bridged nucleic acid; 20,40-
BNANC [NMe], 20-O,40-C-(N-methyl) aminomethylene 20,40-bridged
nucleic acid; 20,40-BNANC, 20-O,40-C-aminomethylene 20,40-bridged nu-
cleic acid; RNAi, RNA interference; siRNA, short RNA duplexes;
shRNA, short hairpin RNA; Ms, methanesulfonyl; TBDPS, tert-butyl-
diphenylsilyl; TBDMS, tert-butyldimethylsilyl; Ura, uracil; bzCyt, N4-
benzoylcytosine.
The improvement in potency of MOE ASOs has, in part,
been attributed to the increased affinity for target mRNA
r
pubs.acs.org/jmc
Published on Web 01/28/2010
2010 American Chemical Society

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4 1637
N-Me-aminooxy BNA (Figure 1) bridged nucleic acid struc-
tures. These nucleosides incorporate elements of both
20-O-DMAOE RNA and LNA, and we envisaged that intro-
ducing aminooxy functionality in the BNA scaffold could
alter the hydration properties of nucleicacids. We rationalized
that, similar to the MOE modification,12 the altered hydration
and increased steric bulk may improve the toxicity profile of
ASOs containing these modifications. In this study we have
prepared and evaluated the in vitro and in vivo activity
of ASOs containing several “aminooxy” BNA modifications
and compared their activities to LNA and MOE benchmarks.
Results and Discussion
First, we developed efficient routes for the synthesis of
N-MeO-aminomethylene and N-Me-aminooxymethylene
bridged nucleosides and their 30-phosphoramidites (struc-
tures shown in blocks 1 and 3). The 20-O-40-C-aminomethyl-
ene bridged nucleoside 30-phoshoramidites (block 2) were
synthesized according to reported procedures.35 We also
synthesized gapmer ASOs containing N-MeO-aminomethyl-
ene, N-Me-aminooxymethylene, and 20-O-40-C-aminomethyl-
ene bridged nucleoside residues. The hybridization properties
of these ASOs with complementary RNA and in vitro and in
vivo activities were investigated.
Figure 1. (A) Antisense oligonucleotides with gapmer design having
20-modified “wings” at the 30- and 50-end flanking a central 20-deoxy
gap region for RNase H activity. (B) Chemical structures of MOE
RNA, 20-O-DMAOE RNA, and 20,40-linkage bridged nucleic acids.
conferred by the MOE modification. While MOE provides a
substantial improvement in affinity, bicyclic nucleoside modi-
fications such as 20,40-methylene bridged nucleic acids27,28 com-
monly called LNA29,30 have been shown to provide a further
increase in affinity. The improved binding affinity of these
conformationally constrained oligonucleotides has been attri-
buted to conformational preorganization and improved stack-
ing.29 The LNA containing chimeric ASOs have recently been
shown to inhibit growth in human tumor xenograft models31
and are entering early human clinical trials for oncology
indications. In a comparative study of gapmer ASOs containing
LNA and MOE modifications in the wings, it was demonstrated
that LNA substitution improved the potency of some of the
ASOs in animals.32 However, this potency was unfortunately
accompanied by an increase in the risk of hepatotoxicity.32 This
led us to explore structural analogues around the bicyclic
nucleoside scaffold, which resulted in several modifications that
showed a promising profile in early animal studies.33,34
Recently Rahman et al. reported that 20-O-40-C-amino-
methylene bridged (Figure 1, 20,40-BNANC[NMe] and 20,40-
BNANC) containing oligonucleotides have similar binding
affinity for RNA and improved exonuclease stability com-
pared to LNA.35 However, there was no report of in vitro and
in vivo activity of ASOs containing 20,40-BNANC[NMe] and
20,40-BNANC modifications. This class of BNA modification
was particularly intriguing to us, as we have previously
reported that ASOs containing 20-O-DMAOE (Figure 1)
and MOE modifications exhibited similar in vitro and in vivo
activity and toxicity profiles.36 As a part of our on going effort
to identify BNA analogues with improved antisense proper-
ties, weprepared certain analogues reported by Rahman et al.,
as well as the related N-MeO-amino BNA (Figure 1) and
Chemistry
1. Synthesis of N-MeO-amino BNA U and C Amidites 1 and
2. Synthesis of N-MeO-amino BNA U phosphoramidite
1 started from a known nucleoside (4, Scheme 1), which
was synthesized from diacetone glucofuranose (3) in eight
steps.37 Compound 4 was treated with methanesulfonyl

1638 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4
Prakash et al.
Scheme 1a
Scheme 2a
a (i) N-Methoxyamine, DMF, N,N-diisopropylethylamine, 60 °C,
84%; (ii) 2,3-dichloro-5,6-dicyano-p-benzoquinone, CH2Cl2, H2O, rt,
85.5%; (iii) triethylamine trihydrofluoride, triethylamine, THF, 85%;
(iv) DMTCl, pyridine, 99%; (v) 2-cyanoethyl-N,N,N0N0-tetraisopropyl-
phosphorodiamidite, 1H-tetrazole, N-methylimidazole, DMF, 89%.
from the more electronegative 60-O-methanesulfonyl or
20-O-trifluoromethanesulfonyl group to theN-methoxyamino
functionality. A similar upfield shift for C-60 (61.4 ppm) and
C-20 (68.4 ppm) of compound 8 in the 13C spectra was also
observed confirming the structural connectivity of this con-
strained nucleoside. The appearance of resonances corres-
ponding to the methyl moiety of N-MeO group also pro-
vided additional evidence for the formation of the bicyclic
nucleoside 8.
Compound 8 was then treated with 2,3-dichloro-5,6-dicya-
no-1,4-benzoquinone to remove the Nap group from the
30-position to yield compound 9 (86%). Subsequent treatment
with triethylamine trihydrofluoride and triethylamine in THF
gave fully deprotected constrained nucleoside 10 (85% yield).
The 50-position of compound 10was thenselectivelyprotected
with DMT group to yield compound 11. Phosphitylation of
compound 11 at the 30-position with 2-cyanoethyl N,N,N0,N0-
tetraisopropylphosphorodiamidite in the presence of 1H-tetra-
zole and 1-methylimidazole in DMF afforded the correspond-
ing phosphoramidite 1 in 89% yield.
a (i) methanesulfonyl chloride, pyridine, rt, 93%; (ii) (a) CH3CN,
DBU; (b) 0.4 M NaOH H2O/dioxane, rt, 85%; (iii) (CF3SO2)2O,
DMAP, CH2Cl2, -15 to -10 °C, 59.5%.
chloride in pyridine to afford bis-methanesulfonyl derivative
5 (93%), which was cyclized with DBU in acetonitrile to
yield the 2,20-anhydrouridine derivative. Opening of the
2,20-anhydro ring on treatment with 0.4 M aqueous NaOH
in dioxane for 45 min to 1 h gave arabino uridine derivative 6
in good yield (85%). It is noted that prolonged treatment
with 0.4 M aqueous NaOH in dioxane resulted in cleavage of
the TBDPS group. Reaction of 6 with triflic anhydride and
DMAP in CH2Cl2 at -15 to -10 °C provided the desired
nucleoside 7 in 60% yield.
An intermediate, such as 7, could potentially lead to
double substitution at C-20 and C-60 positions. We reasoned
that treatment of nucleoside 7 with a highly reactive meth-
oxyamine should first give nucleophilic substitution at the
20-position to provide the methoxyamino derivative. This
methoxyamino substituted nucleoside should initiate an
intramolecular ring closing reaction and displace the leaving
group at the 60-position to provide the desired N-MeO-
aminomethylene bridged nucleoside analogue. As expected,
heating compound 7 with N-methoxyamine in the presence
of N,N-diisopropylethylamine at 60 °C afforded N-methoxy-
aminomethylene bridged uridine derivative 8 (Scheme 2) in
84% isolated yield. The side reaction resulting from nucleo-
philic substitution of N-methoxyamine at both C-20 and C-60
positions was not detected. This clearly suggests that once
nucleophilic substitution occurs at either the C-20 or C-60
position with N-methoxyamine, spontaneous intramolecular
ring closure occurs. High resolution mass spectral analysis
The synthesis of the N-MeO-aminomethylene bridged bi-
cyclic cytidine phosphoramidite 2 is illustrated in Scheme 3.
Compound 11 on treatment with tert-butyldimethylsilyl
chloride and imidazole in anhydrous DMF at room tem-
perature yielded 30-O-TBDMS derivative 12 (85% yield).
The bicyclic uridine derivative (12) was converted into
cytidine derivative (13, 95% yield) according to literature
procedure.38 The exocyclic amino group of bicyclic cytidine
nucleoside (13) was protected with the benzoyl group on
treatment with benzoic anhydride in anhydrous DMF,
affording 14 (99% yield).39 Compound 14 treated with
triethylamine trihydrofluoride and triethylamine in THF to
remove TBDMS group from 30-position yielded 15. Finally,
phosphitylation of compound 15 at the 30-position gave the
phosphoramidite 2 (84%) in good overall yield.
and H and 13C NMR experiments were used to prove the
2. Synthesis of 20,40-BNANC and 20,40-BNANC[NMe] U and
1
structural identity of the cyclized nucleoside. We observed a
significant upfield shift of the 60-proton (2.94 ppm and 3.47)
and 20-proton (4.17 ppm) in the fused nucleoside 8 relative
to nucleoside 7 (4.40 and 4.56 ppm 60-proton and 5.50 ppm
20-proton). This upfield shift is probably due to a change
C Amidites 16-19. The 20,40-BNANC and 20,40-BNANC
-
[NMe] uridine and cytidine phosphoramidites (16-19) were
synthesized according to the reported procedures.35
3. Synthesis of N-Me-aminooxy BNA U and C Phosphor-
amidites 20 and 21. The N-Me-aminooxymethylene bridged

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4 1639
Scheme 4a
Scheme 3a
a (i) Trifluoromethanesulfonic anhydride, DMAP, pyridine, 88%;
(ii) (a) N-hydroxyphthalimide, N,N-diisopropylethylamine, DMF,
80 °C; (b) N-methylhydrazine, CH2Cl2, -10 to 0 °C; (c) CH3OH, form-
aldehyde (37 wt % solution in water), 46.1%; (iii) (a) Amberlite IR-120,
dioxane, H2O, rt; (b) acetic anhydride, pyridine, rt, 75%.
Scheme 5a
a (i) tert-Butyldimethylsilyl chloride, imidazole, DMF, rt, 85.4%; (ii)
(a) triethylamine, 1,2,4-tetrazole, CH3CN, POCl3; (b) NH4OH-
dioxane, 95%; (iii) benzoic anhydride, DMF, rt, 99%; (iv) triethylamine
trihydrofluoride, triethylamine, THF, rt, 91%; (v) 2-cyanoethyl-N,N,
N0N0-tetraisopropylphosphorodiamidite, 1H-tetrazole, N-methylimida-
zole, DMF, rt, 84%.
uridine phosphoramidite (20) was synthesized as described in
Schemes 4-6. The 60-methyleneaminooxy arabinonucleo-
side (29, Scheme 5), with a facile living group at the
20-position, served as a key intermediate. Reduction of the
60-methyleneaminooxy group at 60-position of nucleoside 29
provides a very powerful nucleophile which should attack
the 20-position, provided the leaving group trajectory is
positioned correctly.
The synthesis started from a known sugar 22 (Scheme 8).37
Compound 22 was treated with NaH and 2-(bromomethyl)-
naphthalene to yield 3,5-O-bis(Nap) derivative 23a (64%)
as a major product (Scheme 8). The other regioisomer 23b
was also formed as a minor product (7%). The two isomers
were separated by silica gel column chromatography. The
3,5-O-bis(Nap) sugar 23a was converted to 6-O-trifluoro-
methanesulfonyl derivative 24 (Scheme 4, 88% yield). Sugar
24 was first subjected to a nucleophilic substitution reaction
with N-hydroxyphthalimide and N,N-diisopropylethyla-
mine in N,N-dimethylacetamide at 90 °C to afford the
6-phthalimido derivative. The 6-phthalimido derivative
was stirred with N-methylhydrazene in CH2Cl2 at -10 to
0 °C to afford the 6-aminooxy sugar.40 The byproduct,
2-methyl-1-oxophthalozine, was readily separated by fil-
tration, and excess N-methylhydrazene was removed by
evaporation. The 6-aminooxy sugar, on treatment with
formaldehyde in methanol, afforded methyleneaminooxy
derivative 25. Attempted acetolysis of sugar 25 using acetic
anhydride, acetic acid, and a catalytic amount of concen-
trated sulfuric acid resulted in the formation of an unidenti-
fied mixture of products. However, deprotection of the
isopropyledine with strong acidic resin in a mixture of water
and 1,4-dioxane proceeded smoothly to afford the 1,2-dihy-
droxysugar, which was subsequently treated with acetic
a (i) (a) Uracil, trimethylsilyl trifluoromethanesulfonate, bis(trimethyl-
silyl)acetamide, CH3CN; (b) NH3, CH3OH, rt, 86%; (ii) (a) methane-
sulfonyl chloride, CH2Cl2, triethylamine, rt; (b) DBU, CH3CN; (c)
NaOH, dioxane, 58.9%; (iii) methanesulfonyl chloride, CH2Cl2, triethyl-
amine, rt, 86%.
anhydride in pyridine to afford 1,2-O-bis-acetyl derivative
26 (75% yield) as an anomeric mixture.
41
€
Acetylated sugar 26was subjected to a modified Vorbruggen
reaction using in situ silylated uridine mediated by trimethylsilyl
trifluoromethanesulfonate to yield the desired 2-O-acetyl-β-D-
ribofuranosyluridine derivative. The removal of the acetyl group
was achieved by treatment with methanolic ammonia at room
temperature to yield 27 (86% yield). Inversion of configuration
of the 20-hydroxyl group was accomplished in a three-step
process. First, 27 was mesylated and then subsequently con-
verted to the 2,20-anhydro derivative on treatment with DBU in

1640 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4
Prakash et al.
Scheme 6a
Scheme 8a
a (i) 2-(Bromomethyl)naphthalene, NaH, DMF.
(59% yield). Finally, compound 28, on treatment with methane-
sulfonyl chloride and triethylamine in CH2Cl2, yielded com-
pound 29 (86%).
The key ring closure reaction was accomplished in a two-
step process. First, the 60-N-methyleneaminooxy derivative
29 was reduced with NaBH3CN in 1 M PPTS in MeOH.40
The 60-N-methylaminooxy derivative on heating at 80 °C
in N,N-dimethyl acetamide and N,N-diisopropylethylamine
underwent an intramolecular nucleophilic substitution
at 20-position, giving the desired bicyclic nucleoside 30
(Scheme 6) in good yield. The structure of the target nucleo-
side 30 was confirmed by NMR and mass spectrometry. The
two Nap groups were removed on treatment with 2,3-di-
chloro-5,6-dicyano-1,4-benzoquinone in CH2Cl2 and water
to afford N-Me-aminooxymethylene bridged uridine 31.
The 50-hydroxyl group of nucleoside 31 was then selectively
protected with the DMT group to yield 32 (79%), which was
subsequently phosphitylated at the 30-position to afford
phosphoramidite 20.
a (i) (a) Pyridinium p-tolunesulfonate, CH3OH, NaBH3CN, rt; (b)
N,N-diisopropylethylamine, N,N-dimethylacetamide, 80 °C, 84%;
(ii) 2,3-dichloro-5,6-dicyano-p-benzoquinone, CH2Cl2, H2O, rt, 86%;
(iii) DMTCl, pyridine, 79%; (iv) 2-cyanoethyl-N,N,N0,N0-tetraisopro-
pylphosphorodiamidite, 1H-tetrazole, N-methylimidazole, DMF, 79%.
The synthesis of the N-Me-aminooxymethylene bridged
cytidine phosphoramidite 21 is illustrated in Scheme 7. The
bicyclic nucleoside 32, on treatment with triethylsilyl chlo-
ride and imidazole in DMF at ambient temperature, yielded
30-O-triethylsilyl derivative 33. Compound 33 was converted
to the 4-(1,2,4-triazo-1-yl) derivative with 1,2,4-triazole,
POCl3, and Et3N.38 Subsequent treatment with aqueous
NH3 in dioxane at ambient temperature for 6 h gave the
cytidine analogue 34 in 95% yield. The exocyclic amino
group of 34 was protected with a benzoyl group on treatment
with benzoic anhydride in anhydrous DMF, affording com-
pound 35.39 The triethylsilyl group was removed with
triethylamine trihydrofluoride and triethylamine in THF at
ambient temperature to yield 36. Finally, phosphitylation of
compound 36 at the 30-position gave the required phosphor-
amidite 21 (87% yield).
Scheme 7a
Antisense Oligonucleotides
To evaluate the effect of N-MeO-amino BNA, 20,40-BNANC
,
20,40-BNANC[NMe], and N-Me-aminooxy BNA modifications
in antisense constructs, gapmer ASOs 41-44 (Table 1) target-
ing mouse PTEN mRNA expression42 were designed. These
sequences were derived from a previously identified 14-mer
sequence.34 For comparison, previously characterized34,43
MOE gapmer ASOs 37 and 39 and LNA gapmers 40 and 45
were also evaluated (Table 1). Additionally, we also synthesized
MOE modified control ASO 38 (Table 1).
1. Synthesis of PTEN Gapmer ASO Containing N-MeO-
amino BNA, 20,40-BNANC, 20,40-BNANC[NMe], and N-Me-
aminooxy BNA. The MOE ASOs 37-39 and LNA ASOs 40
and 45 were synthesized according to literature proce-
dure.22,34 The ASOs 41-44 (Table 1) were synthesized on a
solid phase DNA synthesizer using phosphoramidites 1, 2,
16-21. The standard phosphoramidites were used for the
incorporation of dA, T, dG, and dC nucleotides. A 0.1 M
a (i) TESCl, imidazole, DMF, rt, 84%; (ii) (a) triethylamine, 1,2,4-
tetrazole, CH3CN, POCl3; (b) NH4OH-dioxane, 95%; (iii) benzoic
anhydride, DMF, rt, 84%; (iv) triethylamine trihydrofluoride, triethyl-
amine, THF, rt, 92%; (v) 2-cyanoethyl-N,N,N0,N0-tetraisopropylphos-
phorodiamidite, 1H-tetrazole, N-methylimidazole, DMF, rt, 87%.
acetonitrile. Opening of the 2,20-anhydro derivative with aqu-
eous NaOH in 1,4-dioxane gave arabino nucleoside derivative 28

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4 1641
Table 1. ASOs Containing LNA, MOE, N-MeO-amino BNA, 20,40-BNANC, 20,40-BNANC[NMe], and N-Me-aminooxy BNA Nucleotide Residuesa
compd
sequence (50-30)
chemistry
target
d(mCeTeGe CeTeA GmCmCTmCTGG ATeTeTe GeAe)30
d(mCemCeTeTemCemCmCTG A AGGTT mCemCe TemCemCe)
d(CeUeTAGCACTGGCCeUe)
20-O-MOE
PTEN
Control
PTEN
PTEN
PTEN
PTEN
PTEN
PTEN
PTEN
PTEN
m
37
38
39
40
41
42
43
44
45
46
20-O-MOE
20-O-MOE
LNA
d(mCLTLTAGCACTGGCmCLTL)
d(CB1UB1TAGCACTGGCCB1UB1)30
d(CB2UB2TAGCACTGGCCB2UB2)30
d(CB3UB3TAGCACTGGCCB3UB3)30
d(CB4UB4TAGCACTGGCCB4UB4)30
d(CLULTAGCACTGGCCLUL)
N-MeO-amino BNA
20,40-BNANC
20,40-BNANC[NMe]
N-Me-aminooxy BNA
LNA
d(CTTAGCACTGGCCT)
DNA
a All internucleosidic linkages are phosphorothioate. mCL = LNA 5-methylcytidine. TL = LNA thymidine. CL = LNA cytidine. UL = LNA uridine.
Ce = 20-O-MOE-cytidine. Ue = 20-O-MOE-uridine. Ae = 20-O-MOE-adenosine. Ge = 20-O-MOE-guanosine. mCe = 20-O-MOE-5-methylcytidine.
mC = 20-deoxy-5-methylcytidine. CB1 = N-MeO-amino BNA cytidine. UB1 = N-MeO-amino BNA uridine. CB2 = 20,40-BNANC cytidine. UB2 = 20,40-
BNANC uridine. CB3 = 20,40-BNANC[NMe] cytidine. UB3 = 20,40-BNANC[NMe] uridine. CB4 = N-Me-aminooxy BNA cytidine. UB4 = N-Me-amino-
oxy BNA uridine.
Table 2. Tm, IC50, and ED50 of LNA, MOE, N-MeO-amino BNA,
20,40-BNANC, 20,40-BNANC[NMe], and N-Me-aminooxy BNA Contain-
solution of the phosphoramidites in anhydrous acetonitrile
was used for the synthesis of ASOs. A solution of phenyl-
ing ASOsa
acetyl disulfide in 3-picoline and acetonitrile (1:1 v/v)44 was
used as sulfurizing reagent. “UnyLinker” solid support45,46
was used for the synthesis of ASOs. It has been reported that
during the deprotection, oligonucleotide phosphodiseters
were released 1.2-1.7 times more quickly than the corres-
ponding phosphorothioates from “UnyLinker” solid sup-
port.45 Therefore, we used a phosphodiester linkage between
“UnyLinker” solid support and the growing ASO to facili-
tate faster release of ASOs during deprotection.
In order to remove the cyanoethyl group from the phos-
phorothioate linkages, solid support bearing oligonucleo-
tides were treated with 50% triethylamine in acetonitrile for
45 min.47 Subsequently, solid supports were suspended
in aqueous ammonia (28-30 wt %) and heated at 55 °C
for 14 h to release the ASOs from the solid support and to
remove all protecting groups from the exocyclic amino
groups of the bases. The ASOs were then purified by HPLC
on a strong anion exchange column and desalted using
HPLC on a reverse phase column. The ASOs were charac-
terized by HPLC coupled mass spectrometry (Supporting
Information).
compd
chemistry
20-O-MOE
20-O-MOE
LNA
Tm (°C) IC50 (nM) ED50 (mg/kg)
37
39
40
41
42
43
44
45
46
67.9
51.3
60.6
57.7
57.7
58.6
55.4
58.0
48.5
1.0
34.7
1.3
10
>45
3
N-MeO-amino
20,40-BNANC
20,40-BNANC[NMe]
N-Me-aminooxy
LNA
3.1
3.2
8
>37
6
2.5
3.4
11
DNA
a For Tm conditions, see Experimental Section.
target mRNA. These data also suggested that hydrophilic
substitutions (OMe or O) in the minor groove (as in N-MeO
amino BNA 41 or 20,40-BNANC 42) and hydrophobic sub-
stitution in the edge of the minor groove (Me in 20,40-
BNANC[NMe] 43) have no effect on the thermal stability
of the BNA ASO/RNA duplex. In contrast, N-Me-amino-
oxy BNA ASO 44 Tm (Table 2, 55.4 °C) was approximately
2.6 °C lower than for 20,40-BNANC ASO 42. These data
suggest that hydrophobic substitutions, such a methyl
group, in the minor groove have a destabilizing effect on
the BNA ASO/RNA duplex. Similar observation was made
recently with carb-LNA analogues.48 Water surrounding the
nucleic acids plays an important role in minimizing phos-
phate-phosphate electrostatic repulsion.49 The lower Tm
of BNA ASO 44 with methyl substitution in the minor
groove may be attributed to the decreased number of water
molecules expected to be present around the hydrophobic
methyl group compared to the hydrophilic OMe group or
oxygen.
The LNA ASO 40 showed a higher Tm (60.6 °C) but has
5-methyl LNA thymidine and 5-methyl LNA cytidine resi-
dues. It has been reported that 5-methyl substitution on the
pyrimidine residues provide around 0.5 to 0.8 °C per residue
enhancement in Tm relative to DNA.50 The observed higher
Tm value of 40 relative to 45 could be attributed to methyl-
ated cytidine LNA residues in 40 (Table 2). As expected
20-mer ASO 37 with 10 20-O-MOE modified nucleotides
exhibited higher Tm (Table 2, 67.9 °C) than 14-mer BNA
ASOs.
2. Thermal Denaturation Studies of N-MeO-amino BNA,
20,40-BNANC, 20,40-BNANC[NMe], and N-Me-aminooxy BNA
Modified ASOs RNA Duplexes. First, we investigated the
effect of N-MeO-amino BNA, 20,40-BNANC, 20,40-BNANC
-
[NMe], and N-Me-aminooxy BNA modifications on binding
affinity of gapmer ASOs to target RNA. We therefore
determined the Tm of duplexes formed between ASOs
41-44 (Table 2) and 14-mer complementary RNA. For
comparative analysis, the Tm of 20-O-MOE modified ASOs
37 and 39 and LNA modified ASOs 40 (with 5-methyl C
and T), 45 (with U and C), and DNA 46 (Table 2) were also
determined. All BNA ASOs showed significantly higher Tm
values relative to DNA phosphorothioates 46 (Table 2,
48.5 °C). The Tm values of the BNA modified ASOs were 4
to 7.3 °C higher than corresponding 14-mer MOE ASO 39
(Table 2, 51.3 °C). Comparison of the Tm values of ASOs
containing BNA analogues and LNA suggested that the
nature and position of the substituent have significant
influence on the Tm values. N-MeO-amino BNA, 20,40-
BNANC, and 20,40-BNANC[NMe] ASOs (Table 2, 41-43,
57.7-58.6 °C) showed similar Tm values. These Tm values
were close to Tm of LNA ASO (Table 2, 45, 58.0 °C).
In Vitro Studies
These data suggested that BNA ASOs 41-43 and LNA
ASO 45 were expected to have similar binding affinity to
All the PTEN ASOs containing bicyclic nucleic acids
(40-44, Table 2) reduced the expression of PTEN mRNA

1642 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4
Prakash et al.
Figure 2. PTEN mRNA reduction in liver and ALT levels after 3-week multiple administration study. Mice (6-week-old male Balb/c) were
injected (ip) twice a week for 3 weeks: 0.7, 2.3, 7.2, 23.0 mg kg-1 MOE ASO 37; 0.5, 1.5, 4.5, 14.6 mg kg-1 LNA ASO 40; 0.5, 1.5, 4.6, 14.8 mg
kg-1 N-MeO-amino ASO 41 and N-Me-aminooxy ASO 44. The animals were sacrificed 72 h after administration of the last dose, and ALT
levels and liver mRNA were quantified. All errors are (SD.
in a concentration-dependent manner when transfected into
bEND.3 cells (Supporting Information). The IC50 values
ranged from 1.3 to 3.4 nM (Table 2) for the BNA containing
ASOs, and the observed potency was significantly higher than
the corresponding MOE gapmer, ASO 39 (IC50 = 34.7 nM,
Table 2). The Tm of the BNA ASOs in this study was
significantly higher than that of the corresponding 14-mer
MOE Tm. This roughly correlated with in vitro potency, as
BNA ASOs 40-44 showed significantly improved potency
relative to the lower Tm MOE ASO 39 (Table 2). The in vitro
potency of 14-mer BNA ASOs was slightly lower than 20-mer
MOE gapmer ASO 37 (IC50 = 1.0 nM, Table 2), which also
has a higher Tm due to increased length and MOE content.
Figure 3. PTEN mRNA reduction in liver and ALT levels after
3-week multiple administration of 0.5, 1.5, 4.6, 14.8 mg kg-1
20,40-BNANC[NMe] ASO 43. The animals (6-week-old Balb/c mice)
were sacrificed 72 h after administration of the last dose, and ALT
levels and liver mRNA were quantified. All errors are (SD.
The control ASOs 38 with MOE modifications did not reduce
PTEN expression (Supporting Information). These data sug-
gest that the intrinsic activity of short antisense oligonucleo-
tides are improved on incorporation of conformationaly
constrained bicyclic nucleotide residues relative to length
matched MOE modified residues. This could in part be attri-
buted to improved binding affinity of BNA ASOs to target
mRNA.
N-MeO-amino BNA ASOs 41 (ED50 = 8 mg kg-1, Table 2)
and 20,40-BNANC[NMe] ASO 43 (ED50 = 6 mg kg-1, Table 2)
showed similar potency. In contrast, the N-Me-aminooxy
BNA ASO 44 was slightly less potent (ED50 = 11 mg kg-1
,
Table 2). The corresponding 14-mer MOE ASO was signifi-
cantly less active (ED50 >45 mg kg-1, Table 2). The LNA
ASO 40 was most active (ED50 = 3 mg kg-1, Table 2) in this
study. The potencies of the 14-mer LNA ASO 40, the N-MeO-
amino BNA ASO 41, and the 20,40-BNANC[NMe] ASO 43
were all improved relative to the reference 20-mer MOE ASO
37 (ED50 = 10 mg kg-1, Table 2). However, the 14-mer
N-Me-aminooxy BNA ASO 44 demonstrated reduced in vivo
potency relativeto20-mer MOEASO37(Table2). Thesedata
clearly suggest that the nature and position of substitution on
Animal Studies
Next we evaluated the activity of MOE, N-MeO-amino
BNA, 20,40-BNANC, 20,40-BNANC[NMe], N-Me-aminooxy
BNA, and LNA ASOs in animal models. The ASOs contain-
ing N-MeO-amino BNA 41, 20,40-BNANC[NMe] 43, and
N-Me-aminooxy BNA 44 reduced PTEN mRNA expression
in a dose-dependent manner (Figures 2 and 3), whereas the
20,40-BNANC ASO 42 did not reduce the mRNA expression
even at the highest dose tested (Supporting Information). The

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4 1643
the BNA scaffold influence the in vivo activity of BNA
modified ASOs, despite showing similar activity in cell cul-
ture.
corresponding MOE ASO but reduced compared to LNA
ASO. The in vitro activities of N-MeO-amino BNA, N-Me-
aminooxy BNA, 20,40-BNANC, and 20,40-BNANC[NMe] con-
taining ASOs were very similar and were significantly higher
than those of the corresponding MOE ASOs. This is likely a
result of the improved binding affinity for RNA targets due to
the conformational constraint of the bicyclic nucleoside and is
not unexpected. The in vivo results showed a separation of
both potency and toxicities of the BNA containing ASOs.
It was interesting that the 20,40-BNANC[NMe] ASO 43
worked well in vivo while the corresponding 20,40-BNANC
ASO 42 was inactive, despite both ASOs having similar
potencies in cell culture (Table 2). In order to determine if
this was a pharmacokinetic difference, we measured tissue
concentration of ASO 42 in the liver of animals treated with
the highest dose. To our surprise we could not detect any drug
or metabolites in the tissues of animals treated with ASO 42.
In contrast, active ASOs such as the LNA 40 showed the
expected levels of drug in liver tissue (∼30 μg g-1 at the high
dose). ASO 42 has reactive oxyamino functionality, and it is
conceivable that it reacts with plasma protein components
which prevent it from being delivered to tissues. The mono-
substituted oxyamino functionality could also be rapidly
metabolized and degraded in tissues. In any case, it is clear
that pharmacokinetic differences explain the loss of activity
for oxyamino ASO 42.
N-MeO-amino BNA, N-Me-aminooxy BNA, and 20,40-BNANC
-
[NMe] containing ASOs showed significantly improved acti-
vity compared to the corresponding 14-mer MOE ASO but
were 2- to 4-fold reduced compared to the LNA 14-mer. The
20,40-BNANC ASO was inactive because of a lack of accumu-
lation in liver, presumably because of rapid metabolism and/
or elimination. The in vivo activities of 14-mer (2-10-2
design) N-MeO-amino BNA, N-Me-aminooxy BNA, and
20,40-BNANC[NMe] containing ASOs were similar or slightly
improved relative to that of a 20-mer 5-10-5 MOE gapmer.
Our study demonstrates that nucleoside modifications con-
taining “aminooxy” functionality such as N-MeO-amino
BNA, N-Me-aminooxy BNA, and 20,40-BNANC[NMe] are
potentially useful modifications for RNase H based antisense
therapeutics. While they appear slightly less potent than LNA
and recently reported carbon containing analogues,34,51 they
also appear to reduce the transaminase increases seen with the
LNA ASO having the same sequence. Since the potency was
also reduced, whether this translates into an increase in
therapeutic index for the “aminooxy” containing ASOs is
unknown and will have to be determined via extensive evalua-
tion in multiple sequences and species.
In order to assess the toxicity of the ASOs, plasma transa-
minase levels of animals treated with MOE ASO 37, LNA
ASO 40, N-MeO-amino 41, 20,40-BNANC[NMe] ASO 43, and
N-Me-aminooxy ASO 44 were examined. The ALT levels
were within the normal range for all animals (Figures 2 and 3)
except LNA ASO 40 treated animals, which showed a modest
elevation at the high dose group, consistent with our previous
reports (ALT, Figure 2B). The liver, kidney, and body weights
of the animals treated with MOE ASO 37, N-MeO-amino
BNA ASO 41, 20,40-BNANC[NMe] ASO 43, N-Me-aminooxy
ASO44, and 20-O-MOEASO werenormalatthe dosesusedin
this study. However, the spleen weights of the animals treated
with N-MeO-amino BNA 41 and 20,40-BNANC[NMe] ASO 43
ASO were higher than saline treated animals, indicating
a proinflamatory effect. The LNA ASO 40 increased liver
weight and reduced body weight gain, and this was consistent
with the modest ALT elevations we observed at the high dose
and indicates an onset of liver toxicity.
Experimental Section
General Procedures. Solvents used were of anhydrous grade
and were stored under nitrogen at all times. The 20-deoxynucleo-
side phosphoramidites and reagents for oligonucleotide synthe-
sis were procured form Glen Research Inc., VA. All other
starting materials and reagents were purchased from Aldrich
Chemical Co. and were used without further purification. Thin-
layer chromatography was performed on precoated plates (silica
gel 60 F254, EM Science, NJ) and visualized with UV light
and spraying with a solution of p-anisaldehyde (6 mL), H2SO4
(8.3 mL), and CH3COOH (2.5 mL) in C2H5OH (227 mL)
Conclusions
Efficient methods for the synthesis of N-MeO-amino-
methylene and N-Me-aminooxymethylene bridged uridine
and cytidine nucleosides and their 30-phosphoramidites were
developed. The synthesis of N-MeO-aminomethylene bridged
nucleoside includes a one pot nucleophilic substitution and
intramolecular cyclization in very good yield. A convenient
route to prepare 40-(methyleneaminooxy)methyl nucleosides
was also developed. A one pot intramolecular ring closure
reaction involving reductive amination and nucleophilic sub-
stitution afforded the N-Me-aminooxymethylene bridged
nucleoside. For comparative evaluation we synthesized
1
followed by charring. H NMR spectra were referenced using
internal standard (CH3)4Si and 31P NMR spectra using external
standard 85% H3PO4. Mass spectra were recorded by College of
Chemistry, University of California, Berkeley, CA. The purities
of all the compounds tested in biological assay were assessed by
HPLC and capillary gel electrophorisis and were g95%.
50-O-(DMT)-20-N,40-C-[(N-methoxy)aminomethylene]uridine-
30-[(2-cyanoethyl)-N,N-diisopropyl]phosphoramidite 1. A mix-
ture of compound 11 (1.31 g, 2.22 mmol) and 1H-tetrazole
(0.14 g, 2.00 mmol) was dried over P2O5 overnight under
reduced pressure. To the solution of the mixture in anhydrous
DMF (5.44 mL), 2-cyanoethyl-N,N,N0N0-tetraisopropylphos-
phorodiamidite (1.03 mL, 3.25 mmol) and 1-methylimidazole
(0.052 mL, 0.65 mmol) were added. The reaction mixture was
stirred at room temperature for 6 h under argon atmosphere.
The reaction mixture was poured into EtOAc (50 mL), and the
organic layer was washed with aqueous NaHCO3 (5% by wt,
100 mL), brine (60 mL), dried (Na2SO4), and evaporated.
The residue was purified by silica gel column chromatography
(1:1 EtOAc/hexane) to yield compound 1 (1.57 g, 89% yield) as
a white foam. 31P NMR (121 MHz, CDCl3) δ 148.57, 148.00;
HRMS (FAB) calcd for C41H51N5O9Pþ 788.3424, found
788.3428.
20-O,40-C-aminomethylene (20,40-BNANC and 20,40-BNANC
-
[NMe]) bridged nucleosides and corresponding phosphor-
amidites according to recently reported literature procedures.35
The synthesis of ASOs containing N-MeO-aminomethylene
and N-Me-aminooxymethylene bridged nucleotides was
achieved using traditional solid phase DNA synthesis proce-
dures.
N-MeO-amino BNA, 20,40-BNANC, and 20,40-BNANC
-
[NMe] containing ASOs (14-mer 2-10-2 gapmer) showed
high affinity to target RNA, significantly higher than the
corresponding MOE ASO but similar to the LNA ASO. The
Tm of N-Me-aminooxy BNA ASO was higher than the

1644 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4
Prakash et al.
N4-Benzoyl-50-O-(DMT)-20-N,40-C-[(N-methoxy)aminomethyl-
ene)cytidine-30-[(2-cyanoethyl)-N,N-diisopropyl]phosphoramidite 2.
Compound 2 (1.17 g, 84% yield) was synthesized from compound
15 (1.08 g, 1.57 mmol), 1H-tetrazole (0.1 g, 1.4 mmol), DMF (4.3
mL), 2-cyanoethyl-N,N,N0N0-tetraisopropylphosphorodiamidite
(0.75 mL, 2.35 mmol), and 1-methylimidazole (0.032 mL, 0.47
mmol) according to the procedure used for the synthesis of
compound 1. 31P NMR (121 MHz, CDCl3) δ 149.91, 149.00;
HRMS (TOF MS ES) calcd for C48H56N6O6Pþ 891.3846, found
891.3832.
2-O-(Methanesulfonyl)-4-C-(O-methanesulfonyl)hydroxymethyl-
3-O-(Nap)-5-O-(TBDPS)-β-D-ribofuranosyluracil 5. Compound
4 (14 g, 21.46 mmol) was dried over P2O5 under reduced
pressure. Methanesulfonyl chloride (7.51 mL, 96.68 mmol)
was added to a cold (0 °C) solution of compound 4 in anhydrous
pyridine (118 mL). After being stirred at room temperature for
3 h, the reaction mixture was poured into EtOAc and the organic
layer was sequentially washed with saturated aqueous NaHCO3
(400 mL), brine (400 mL), dried (Na2SO4), and concentrated
under reduced pressure. The residue obtained was purified using
flash silica gel column chromatography and eluted with 5%
CH3OH in CH2Cl2 to provide compound 5 (16.21 g, 93% yield).
1H NMR (300 MHz, CDCl3) δ 8.33 (s, 1 H), 7.86-7.79 (m, 4 H),
7.58-7.28 (m, 14 H), 6.13 (d, J = 3.6 Hz, 1 H), 5.38 (m, 1H), 5.31
(d, J = 8.1 Hz, 1 H), 4.96 (d, J = 11.5 Hz, 1 H), 4.65 (d, J = 11.3
Hz, 1 H), 4.57-4.53 (m, 2 H), 4.23 (d, J = 11.5 Hz, 1 H), 3.98
(d, J = 11.3 Hz, 1 H), 3.77 (d, J = 11.3 Hz, 1 H), 3.18 (s, 3H),
2.84 (s, 3 H), 1.05 (s, 9H); 13C NMR (75 MHz, CDCl3) δ 162.6,
150.1, 142.3, 135.8, 135.7, 135.5, 134.5, 133.8, 133.5, 132.6,
131.8, 130.6, 130.5, 129.9, 128.8, 128.2, 128.1, 127.9, 127.8,
127.2, 126.7, 126.5, 126.1, 103.2, 89.5, 87.0, 78.7, 76.1, 74.3,
68.8, 64.6, 39.1, 37.7, 27.7, 19.5; MS (ES) m/z 806.9 [M - H]-;
HRMS (ES-FT Orbit-Trap) calcd for C39H44N2O11S2SiNaþ
831.2048, found 831.2041.
mixture was diluted with ice cold CH2Cl2 (200 mL). The
resulting solution was washed with ice-cold saturated aqueous
NaHCO3 (200 mL) and brine (200 mL). The organic phase was
dried over anhydrous Na2SO4, filtered, and evaporated to a
pale-yellow oil. Purification by silica gel column chromato-
graphy (1:1 hexanes/EtOAc) yielded compound 7 (8.26 g, 60%)
1
as a white foam. H NMR (300 MHz, CDCl3) δ 8.19 (s, 1H),
7.85-7.78 (m, 4H), 7.56-7.21 (m, 14 H), 6.36 (d, J = 3.6 Hz,
1 H), 5.57 (m, 1 H), 5.50 (br s, 1 H), 4.98 (d, J = 11.9 Hz, 1 H),
4.70-4.56 (m, 3 H), 4.40 (d, J = 11.1 Hz, 1 H), 3.81 (d, J = 10.6
Hz, 1 H), 3.66 (d, J = 11.1 Hz, 1 H), 2.87 (s, 3H), 0.89 (s, 9 H);
13C NMR (75 MHz, CDCl3) δ 162.4, 149.5, 145.0, 135.6, 135.3,
133.4, 133.2, 132.8, 132.7, 131.7, 130.2, 130.1, 128.9, 128.1,
128.0, 127.8, 127.6, 126.6, 125.4, 124.6, 120.3, 116.1, 102.4,
86.0, 85.4, 83.7, 82.1, 73.7, 67.2, 62.8, 37.9, 26.6, 19.0; 19F NMR
(282 MHz, CDCl3) δ -74.22; MS (ES) m/z 863.0 [M þ H]þ;
HRMS (TOF MS ES) calcd for C39H41F3N2O11S2SiNaþ
885.1771, found 885.1769.
30-O-(Nap)-50-O-(TBDPS)-20-N,40-C-[(N-methoxy)aminomethyl-
ene]uridine 8. To a solution of compound 7 (7.86 g, 9.12 mmol)
in anhydrous DMF (12 mL) in a pressure bottle was added
N,N-diisopropylethylamine (15.66 mL, 89.90 mmol) and
N-methoxyamine (4.23 g, 90 mmol). The reaction mixture was
heated at 60 °C for 18 h. The reaction mixture was poured into
EtOAc (300 mL) and washed sequentially with aqueous NaH-
CO3 (5 wt %, 2 ꢀ 300 mL) and brine (300 mL). The organic
phase was dried over anhydrous Na2SO4, filtered, and evapo-
rated. The residue obtained was purified by silica gel column
chromatography (1:1 hexanes/EtOAc) to yield compound 8
(5.09 g, 84% yield) as a white foam. 1H NMR (300 MHz,
DMSO-d6) δ 11.39 (s, 1 H), 7.93-7.81 (m, 4 H), 7.73-7.32
(m, 14 H), 5.98 (br s, 1 H), 5.15 (d, J = 8.1 Hz, 1 H), 4.86-4.69
(m, 2 H), 4.31 (s, 1H), 4.17 (s, 1 H), 3.96-3.86 (m, 2 H), 3.53 (s, 3
H), 3.47 (d, J = 11.9 Hz, 1 H), 2.94 (br s, 1 H), 0.95 (s, 9 H); 13
C
4-C-(O-Methanesulfonyl)hydroxymethyl-3-O-(Nap)-5-O-
(TBDPS)-β-D-arabinofuranosyluracil 6. To a solution of com-
pound 5 (16 g, 19.74 mmol) in anhydrous CH3CN (135 mL) was
added DBU (5.46 mL, 39.48 mmol). After being stirred at room
temperature for 3 h, the mixture was diluted with EtOAc (300
mL), washed with 1% (v/v) aqueous acetic acid (1 ꢀ 400 mL)
and brine (2 ꢀ 400 mL), dried over anhydrous Na2SO4, filtered,
and evaporated to foam. The foam was redissolved in
1,4-dioxane (216 mL), and 2 M aqueous NaOH (54 mL) was
added. After 45 min, the mixture was neutralized with acetic
acid, diluted with EtOAc (400 mL), washed with saturated
aqueous NaHCO3 (1 ꢀ 300 mL) and brine (300 mL), dried over
anhydrous Na2SO4, filtered, and evaporated. Purification by
silica gel column chromatography (5% CH3OH in CH2Cl2)
NMR (75 MHz, CD3OD) δ 166.2, 151.7, 141.4, 136.7, 136.5,
135.8, 134.6, 134.1, 133.9, 133.5, 133.2, 131.2, 131.1, 130.0,
129.5, 129.4, 129.0, 128.9, 128.8, 128.0, 127.5, 127.4, 127.3,
127.2, 126.9, 101.8, 89.5, 84.1, 77.3, 73.2, 68.4, 61.4, 60.8, 27.5,
20.2; MS (ES) m/z 664.2 [M þ H]þ; HRMS (TOF MS ES) calcd
for C38H41N3O6SiNaþ 686.2662, found 686.2657.
50-O-(TBDPS)-20-N,40-C-[(N-methoxy)aminomethylene]uri-
dine 9. To a solution of compound 8 (4.98 g, 7.5 mmol)
in CH2Cl2 (77 mL), water (0.3 mL, 16.54 mmol) and 2,3-
dichloro-5,6-dicyano-1,4-benzoquinone (9.76 g, 43 mmol) were
added. The dark-brown solution was stirred at room tempera-
ture for 18 h. The reaction mixture was diluted with EtOAc
(200 mL) and washed sequentially with aqueous NaHCO3
(5 wt %, 2 ꢀ 200 mL) and brine (200 mL). The organic phase
was dried (Na2SO4), filtered, and evaporated. The residue
obtained was purified by silica gel column chromatography
and eluted with 5% CH3OH in CH2Cl2 containing 1% triethy-
lamine to yield 9 (3.36 g, 86% yield) as a white foam. 1H NMR
(300 MHz, DMSO-d6) δ 11.37 (s, 1 H), 7.79 (d, J = 8.9 Hz, 1 H),
7.70-7.42 (m, 10 H), 5.95 (br s, 1 H), 5.61 (d, J = 3.8 Hz, 1 H),
5.29 (d, J = 8.1 Hz, 1 H), 4.09 (br s, 1 H), 3.89 (br s, 2 H), 3.85
(s, 1 H), 3.49 (s, 3 H), 3.43 (d, J = 11.7 Hz, 1 H), 2.83 (br s, 1 H),
1.03 (s, 9 H); 13C NMR (75 MHz, CD3OD) δ 166.4, 151.8, 141.8,
137.0, 136.7, 134.4, 133.9, 131.3, 129.2, 101.8, 89.9, 83.5, 71.7,
68.5, 61.3, 61.2, 54.9, 27.5, 20.3; MS (ES) m/z 524.1 [M þ H]þ;
HRMS (TOF MS ES) calcd for C27H33N3O6SiNaþ 546.2036,
found 546.2029.
20-N,40-C-[(N-Methoxy)aminomethylene]uridine 10. To a stir-
red solution of compound 9 (3.30 g, 6.31 mmol) in THF (63 mL),
triethylamine (2.18 mL, 15.66 mmol) and triethylamine trihy-
drofluoride (5.10 mL, 31.31 mmol) were added. The resulting
reaction mixture was stirred at room temperature for 18 h.
Solvent was removed under reduced pressure to get an oil, and
this oily residue was purified by silica gel column chromato-
graphy and eluted with 5% MeOH in CH2Cl2 containing 1% tri-
ethylamine to yield 10 (1.53 g, 85%) as a white solid. 1H NMR
1
yielded compound 6 (12.25 g, 85% yield) as a white foam. H
NMR (300 MHz, DMSO-d6) δ 11.33 (s, 1 H), 7.91 (br s, 4 H),
7.59-7.34 (m, 14 H), 6.22 (d, J = 4.9 Hz, 1 H), 6.02 (d, J = 4.7
Hz, 1 H), 5.16 (d, J = 8.1 Hz, 1 H), 4.97 (d, J = 12.2 Hz, 1 H),
4.79 (d, J = 12.2 Hz, 1 H), 4.58-4.50 (m, 2 H), 4.40 (d, J = 10.4
Hz, 1 H), 4.34 (br s, 1 H) 3.84 (m, 2 H), 3.16 (s, 3 H), 0.85 (s, 9 H);
13C NMR (75 MHz, CDCl3) δ 166.2, 150.5, 143.2, 135.8,134.5,
133.4, 132.7, 132.6, 130.1, 130.0, 128.7, 128.2, 128.0, 127.9,
127.5, 126.4, 126.4, 126.2, 100.5, 86.9, 86.1, 83.8, 73.2, 72.2,
68.3, 62.3, 37.3, 26.8, 19.2; MS (ES) m/z 731.2 [M þ H]þ; HRMS
(ES-FT Orbit-Trap) calcd for C38H42N2O9SSiNaþ 753.2267,
found 753.2272.
4-C-(O-Methanesulfonyl)hydroxymethyl-3-O-(Nap)-5-O-
(TBDPS)-2-O-trifluoromethanesulfonyl)-β-D-arabinofuranosyl-
uracil 7. Compound 6 (11.76 g, 16.11 mmol) was mixed with
DMAP (11.79 g, 96.62 mmol) and dried over P2O5 under
reduced pressure overnight. The dried mixture was dissolved
in anhydrous CH2Cl2 (94 mL). The reaction mixture was cooled
to -15 °C (dry ice/ethanol bath). To the chilled solution was
added a solution of trifluoromethanesulfonic anhydride (6.59
mL, 32.22 mmol) in anhydrous CH2Cl2 (70 mL). After being
stirred for 1.5 h at -15 to -10 °C under argon atmosphere, the

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4 1645
(300 MHz, DMSO-d6) δ 11.32 (s, 1 H), 7.82 (d, J = 7.9 Hz, 1 H),
5.89 (br s, 1 H), 5.62 (d, J = 8.3 Hz, 1 H), 5.45 (d, J = 4.35 Hz,
1 H), 5.09 (t, J = 5.5 Hz, 1 H), 3.93 (br s, 1 H), 3.79 (s, 1 H),
3.70-3.57 (m, 2 H), 3.48 (s, 3 H), 3.41 (d, J = 11.7 Hz, 1 H), 2.78
(br s, 1 H); 13C NMR (75 MHz, CD3OD) δ 166.6, 151.9, 141.9,
101.9, 90.1, 83.4, 71.7, 68.6, 61.2, 58.8; MS (ES) m/þz 286 [M þ
H]þ; HRMS (TOF MS ES) calcd for C11H16N3O6 286.1039,
found 286.1046.
mixture was stirred in a pressure bottle for 6 h at room
temperature. The solvent was removed under reduced pressure,
and the resulting residue was purified by flash silica gel column
chromatography and eluted with 5% CH3OH in CH2Cl2 con-
taining 1% triethylamine to yield 13 (1.32 g, 95%) as a white
foam. 1H NMR (300 MHz, CDCl3) δ 8.21 (d, J = 7.4 Hz, 1 H),
7.51-7.31 (m, 9 H), 6.92-6.88 (m, 4 H), 6.18 (br s, 1 H), 5.63
(d, J = 7.38 Hz, 1 H), 4.33 (s, 1 H), 4.11 (s, 1 H), 3.86 (s, 6 H),
3.63 (s, 3 H), 3.52 (d, J = 10.6 Hz, 1 H), 3.43 (d, J = 11.4 Hz, 1
H), 3.52 (d, J = 10.6 Hz, 1 H), 3.27 (d, J = 10.5 Hz, 1 H), 3.04
(br s, 1 H), 0.81 (s, 9 H), 0.09 (s, 3 H), 0.06 (s, 3 H); 13C NMR
(75 MHz, CDCl3) δ 165.9, 158.7, 155.5, 144.5, 141.7, 135.6,
135.5, 130.2, 130.1, 128.2, 127.9, 127.0, 113.2, 93.6, 87.7, 86.4,
71.5, 67.1, 66.4, 60.9, 59.0, 55.3, 25.5, 17.9, -4.6, -5.1; MS (ES)
m/z 698.9 [M - H]-; HRMS (TOF ES MS) calcd for C38H49N4-
O7Siþ 701.3356, found 701.3356.
50-O-(DMT)-20-N,40-C-[(N-methoxy)aminomethylene]uridine
11. Compound 10 (1.48 g, 5.19 mmol) was mixed with DMTCl
(2.50 g, 7.38 mmol) and dried over P2O5 under reduced pressure
overnight. The dried mixture was dissolved in anhydrous pyr-
idine (14 mL), and the resulting solution was stirred at room
temperature for 8 h under argon atmosphere. The reaction
mixture was poured into CH2Cl2 (150 mL) and washed sequen-
tially with aqueous NaHCO3 (5 wt %, 150 mL) and brine
(150 mL). The organic phase was dried over anhydrous Na2SO4,
filtered, and evaporated. The residue obtained was purified by
silica gel column chromatography and eluted with 0-5%
MeOH in CH2Cl2 containing 1% triethylamine to yield com-
N4-Benzoyl-50-O-(DMT)-30-O-(TBDMS)-20-N,40-C-[(N-meth-
oxy)aminomethylene]cytidine 14. Compound 13 (1.34 g, 1.91
mmol) was dissolved in anhydrous DMF (5 mL), and benzoic
anhydride (0.65 g, 2.88 mmol) was added. After being stirred for
18 h at room temperature, the reaction mixture was diluted with
EtOAc (100 mL). The resulting organic phase was washed with
saturated aqueous NaHCO3 (2 ꢀ 100 mL) and brine (100 mL).
The EtOAc layer was dried over anhydrous Na2SO4, filtered,
and concentrated under reduced pressure. The residue obtained
was purified by flash silica gel column chromatography and
eluted with 80% EtOAc in hexane to yield 14 (1.52 g, 99%) as a
1
pound 11 (3.02 g, 99% yield) as a white foam. H NMR (300
MHz, DMSO-d6) δ 11.38 (s, 1 H), 7.81 (d, J = 8.1 Hz, 1 H),
7.41-7.25 (m, 9 H), 6.91 (d, J = 8.5 Hz, 4 H), 5.94 (br s, 1 H),
5.59 (d, J = 4.0 Hz, 1 H), 5.41 (d, J = 7.7 Hz, 1 H), 4.15 (br s,
1 H), 3.84 (s, 1 H), 3.75 (s, 6 H), 3.48 (s, 3 H), 3.40-3.29 (m, 2 H),
3.21 (d, J = 10.7 Hz, 1 H), 2.87 (br s, 1 H); 13C NMR (75 MHz,
CD3OD) δ 166.5, 160.4, 151.7, 150.2, 146.3, 141.9, 137.1, 136.8,
131.5, 129.5, 129.0, 128.2, 114.4, 101.9, 88.9, 88.1, 83.6, 72.2,
68.4, 61.2, 60.5, 55.9; HRMS (TOF MS ES) calcd for C32H32-
N3O8- 586.2189, found 586.2190.
50-O-(DMT)-30-O-(TBDMS)-20-N,40-C-[(N-methoxy)amino-
methylene]uridine 12. To a solution of compound 11 (1.4 g,
2.38 mmol) and imidazole (1.62 g, 23.8 mmol) in anhydrous
DMF (5.3 mL), tert-butyldimethylsilyl chloride (1.79 g, 11.90
mmol) was added. The reaction mixture was stirred at room
temperature for 24 h under argon atmosphere. The reaction was
quenched with aqueous NaHCO3 (60 mL), and extraction was
performed with EtOAc (2 ꢀ 50 mL). The combined organic
phase was washed with brine (100 mL) and dried over anhy-
drous Na2SO4. After evaporation, the residue was purified by
silica gel column chromatography and eluted with 80% EtOAc
in hexane to yield 12 (1.43 g, 85%) as a white foam. 1H NMR
(300 MHz, DMSO-d6) δ 11.39 (s, 1 H), 7.89 (d, J = 8.1 Hz, 1 H),
7.39-7.251 (m, 9 H), 6.91 (d, J = 8.9 Hz, 4 H), 5.92 (br s, 1 H),
5.44 (d, J = 8.3 Hz, 1 H) 4.27 (s, 1H), 3.86 (s, 1 H), 3.74 (s, 6 H),
3.45 (s, 3 H), 3.32-3.29 (m, 2 H), 3.22 (d, J = 11.7 Hz, 1 H), 2.92
(br s, 1 H) 0.71 (s, 9 H), 0.03 (s, 3 H), -0.06 (s, 3 H); 13C NMR
(75 MHz, CDCl3) δ 163.7, 159.0, 149.9, 144.6, 140.4, 135.6,
135.5, 130.3, 128.3, 128.2, 127.3, 113.5, 101.7, 88.3, 86.8, 83.4,
71.7, 67.0, 61.0, 60.6, 58.9, 55.5, 25.7, 18.1, -4.6, -5.0; MS (ES)
m/z 698.8 [M - H]-.
1
white foam. H NMR (300 MHz, DMSO-d6) δ 11.33 (s, 1H),
8.43 (d, J = 7.5 Hz, 1 H), 8.02 (d, J = 7.7 Hz, 2 H), 7.65-7.24
(m, 13 H), 6.92 (d, J = 8.7 Hz, 4 H), 6.02 (br s, 1 H), 4.31 (s, 1 H),
3.98 (s, 1 H), 3.76 (s, 6 H), 3.50 (s, 3 H), 3.39-3.25 (m, 3 H), 2.96
(br s, 1 H), 0.70 (s, 9 H), -0.01 (s, 3 H), -0.09 (s, 3 H); 13C NMR
(75 MHz, CD3CN) δ 168.4, 164.0, 160.0, 155.4, 146.0, 145.6,
136.8, 136.6, 134.6, 134.0, 131.2, 130.7, 129.7, 129.6, 129.2,
129.0, 128.2, 114.3, 97.0, 88.9, 87.4, 84.6, 72.6, 67.2, 61.7, 61.3,
60.1, 56.0, 26.1, 18.6, -4.3, -4.7; MS (ES) m/z 802.9 [M - H]-;
HRMS (ES-Orbit-Trap) calcd for C45H53N4O8Siþ 805.3627,
found 805.3620.
N4-Benzoyl-50-O-(DMT)-20-N,40-C-[(N-methoxy)aminomethyl-
ene]cytidine 15. In a 100 mL round-bottom flask, triethylamine
trihydrofluoride (1.52 mL, 9.33 mmol) was dissolved in anhydrous
THF (18.7 mL). Triethylamine (0.65 mL, 4.67 mmol) was added to
this solution, and the mixture was quickly poured onto compound
14 (1.5 g, 1.87 mmol). The resulting mixture was stirred at room
temperature for 48 h. The reaction mixture was poured into EtOAc
(50 mL). The organic phase was washed sequentially with water
(50 mL), 5% aqueous NaHCO3 (50 mL), and brine (50 mL). The
EtOAc layer was dried (Na2SO4) and concentrated under reduced
pressure. The residue obtained was purified by silica gel column
chromatography and eluted with 50% EtOAc in hexane to afford
15 (1.17 g, 91%) as a white foam. 1H NMR (300 MHz, DMSO-d6)
δ 11.32 (s, 1 H), 8.36 (d, J = 7.4 Hz, 1 H), 8.02 (d, J = 8.1 Hz, 2 H),
7.66-7.25 (m, 13 H), 6.93 (d, J = 8.9 Hz, 4 H), 6.05 (br s, 1H), 5.61
(d, J = 3.8 Hz, 1 H), 4.20 (d, J = 3.6 Hz, 1 H), 3.96 (s, 1 H), 3.77
(s, 6H), 3.53 (s, 3 H), 3.43-3.23 (m, 3 H), 2.90 (br s, 1 H); 13C
NMR (75 MHz, CD3CN) δ 168.0, 163.7, 159.6, 155.3, 145.8,
145.5, 136.8, 136.5, 134.3, 133.7, 130.9, 130.8, 129.5, 129.0, 128.9,
128.8, 127.9, 114.0, 96.7, 88.4, 87.2, 84.0, 71.8, 67.1, 61.1, 60.8, 60.0,
55.8; MS (ES) m/z 691.2 [M þ H]þ; HRMS (TOF ES MS) calcd
for C39H38N4O8Naþ 713.2587, found 713.2573.
50-O-(DMT)-20-N,40-C-(N-methyl)aminooxymethyleneuri-
dine-30-[(2-cyanoethyl)-N,N-diisopropyl]phosphoramidite 20. Com-
pound 20 (0.85 g, 79% yield) was synthesized from compound
32 (0.8 g, 1.36 mmol), 1H-tetrazole (0.09 g, 1.29 mmol), DMF
(4.00 mL), 2-cyanoethyl-N,N,N0N0-tetraisopropylphosphorodi-
amidite (0.67 mL, 2.12 mmol), and 1-methylimidazole (0.033
mL, 0.40 mmol) according to procedure used for the synthesis of
compound 1. 31P NMR (121 MHz, CDCl3) δ 149.42, 149.18;
HRMS (TOF MS ES) calcd for C41H49N5O9P- 786.3268, found
786.3283.
50-O-(DMT)-30-O-(TBDMS)-20-N,40-C-[(N-methoxy)amino-
methylene]cytidine 13. A suspension of 1,2,4-triazole (4.65 g,
67.27 mmol) in anhydrous CH3CN (25.4 mL) was cooled in an
ice bath for 5-10 min under an argon atmosphere. To this cold
suspension, POCl3 (1.47 mL, 60 mmol) was added slowly over
10 min and stirring continued for an additional 5 min. Triethyl-
amine (11.00 mL, 79.20 mmol) was added slowly over 10 min,
keeping the bath temperature around 0-2 °C. The reaction
mixture was stirred at 0-2 °C for an additional 30 min.
Compound 12 (1.39 g, 1.98 mmol) in anhydrous CH3CN
(12.7 mL) was added in one portion and stirred for 10 min,
and the reaction mixture was removed from the ice bath and
stirred at room temperature for 4 h under an argon atmosphere.
The mixture was concentrated to one-third of its volume, diluted
with EtOAc (100 mL), and washed with water (2 ꢀ 100 mL) and
brine (100 mL). The organic phase was dried over anhydrous
Na2SO4, filtered, and concentrated under reduced pressure. The
resulting residue was dissolved in a solution of aqueous NH3
(12.7 mL, 28-30 wt %) and dioxane (30.5 mL). The reaction

1646 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4
Prakash et al.
N4-Benzoyl-50-O-(DMT)-20-N,40-C-(N-methyl)aminooxymethyl-
ene)cytidine-30-[(2-cyanoethyl)-N,N-diisopropyl]phosphorami-
dite 21. Compound 21 (0.76 g, 87% yield) was synthesized
from compound 36 (0.68 g, 0.99 mmol), 1H-tetrazole (0.06 g,
0.88 mmol), DMF (2.90 mL), 2-cyanoethyl-N,N,N0N0-tetra-
isopropylphosphorodiamidite (0.49 mL, 1.53 mmol), and
1-methylimidazole (0.023 mL, 0.29 mmol) according to pro-
cedure used for the synthesis of compound 1. 31P NMR (121
MHz, CDCl3) δ 149.58, 149.06; HRMS (TOF MS ES) calcd
for C48H56N6O9Pþ 891.3846, found 891.3836.
was diluted with EtOAc (400 mL) and washed with aqueous
NaHCO3 (3 ꢀ 600 mL) and brine (400 mL) and dried (Na2SO4)
and concentrated under reduced pressure. The residue obtained
was purified by by silica gel column chromatography (30-40%
EtOAc in hexane), and the product obtained (23.84 g, 36.78
mmol) was dissolved in CH2Cl2 (272 mL). The reaction mixture
was chilled to -10 °C, and N-methylhydrazine (2.60 mL, 48.84
mmol) was added. The reaction mixture was stirred at -10 to
0 °C for 2 h. The precipitate formed was filtered, and the
precipitate was washed with ice cold CH2Cl2. The combined
filtrate and the washing were concentrated, and the residue
obtained was dissolved in CH3OH (272 mL). To this, formalde-
hyde (37 wt % in H2O, 3.24 mL, 39.94 mmol) was added, and the
mixture was stirred at room temperature for 4 h. Solvent was
removed under reduced pressure and the residue dissolved in
EtOAc (250 mL) and washed with water (150 mL) and brine
(150 mL). The organic phase was dried (Na2SO4) and concen-
trated under reduced pressure. The residue obtained was puri-
fied by silica gel column chromatography and eluted with
30-40% EtOAc in hexane to yield 25 (11.48 g, 46.1%). 1H
NMR (300 MHz, CDCl3) δ 7.90-7.27 (m, 14 H), 7.05 (d, J =
8.1 Hz, 1 H), 6.39 (d, J = 8.1 Hz, 1 H), 5.78 (d, J = 3.6 Hz, 1 H),
4.91 (d, J = 12.2 Hz, 1 H), 4.83-4.60 (m, 4 H), 4.59-4.50 (m,
1 H), 4.44 (d, J = 12.1 Hz, 1 H), 4.37 (d, J = 5.1 Hz, 1 H),
3.75-3.62 (m, 1 H), 3.61-3.52 (m, 1 H), 1.66 (s, 3 H), 1.35 (s,
3 H); 13C NMR (75 MHz, CDCl3) δ 137.0, 135.5, 135.2, 133.1,
132.8, 128.1, 128.0, 127.8, 127.6, 126.6, 126.2, 125.9, 125.7,
125.6, 113.7, 104.2, 86.4, 79.5, 78.2, 74.5, 73.7, 72.6, 71.5, 26.8,
26.4; MS (ES) m/z 550.2 [M þ Na]þ; HRMS (ES-Orbit-Trap)
calcd for C32H33NO6Naþ 550.2194, found 550.2200.
1,2-Di-O-acetyl-3,5-O-bis(Nap)-4-C-(methyleneaminooxy-
methyl)-r-D-ribofuranose 26. To a solution of compound 25
(10.85 g, 20.59 mmol) in 1,4-dioxane (71 mL), water (63.5 mL)
and strong acidic resin (Amberlite IR-120, 25.1 g) were added.
The reaction mixture was heated at 80 °C for 3 days. Resin was
filtered and washed with EtOAc (4 ꢀ 50 mL). The the filtrate
and washing were combined and concentrated to dryness under
reduced pressure to get yellowish oil. The oil was coevaporated
with pyridine (2 ꢀ 50 mL), and the residue was dissolved in
anhydrous pyridine (54 mL). To this acetic anhydride (7.79 mL,
82.36 mmol) was added, and the mixture was stirred at room
temperature for 3 h under argon atmosphere. Solvent was
removed under reduced pressure, and the residue was dissolved
in EtOAc (100 mL) and washed with aqueous NaHCO3 (100
mL) and brine (100 mL) and dried (Na2SO4) and concentrated
under reduced pressure. The residue obtained was purified by
silica gel column chromatography and eluted with 30% EtOAc
in hexane to yield 26 (8.85 g, 75%). 1H NMR (300 MHz, CDCl3,
mixture of isomers) δ 8.18-7.27 (m, 14 H), 7.12-6.84 (m, 1 H),
6.62-6.27 (m, 1 H), 6.21 (s, 1 H), 5.54-5.24 (m, 1 H), 4.99-4.37
(m, 7 H), 3.84-3.40 (m, 2 H), 2.31-1.95 (m, 3 H), 1.93-1.74
(m, 3 H); 13C NMR (75 MHz, CDCl3, mixture of isomers) δ
169.9, 169.7, 169.0, 137.2, 135.5, 135.0, 133.1, 133.0, 132.9,
128.2, 128.1, 128.0, 127.8, 127.8, 127.6, 126.5, 126.3, 126.3,
126.2, 126.1, 125.9, 125.9, 125.7, 125.6, 125.5, 125.5, 125.5,
113.8, 97.7, 94.6, 88.0, 86.1, 78.6, 74.6, 73.5, 73.5, 73.5, 70.9,
21.3, 20.8, 20.8, 20.6; MS (ES) m/z 594.2 [M þ Na]þ; HRMS
(ES-Orbit-Trap) calcd for C33H33NO8Naþ 594.2098, found
594.2095.
3,5-O-Bis(Nap)-1,2-isopropylidene-4-C-hydroxymethyl-r-D-ribo-
furanose 23a. NaH (60% dispersion in mineral oil, 7.94 g, 198.16
mmol) was added to nitrogen flushed round-bottom flask and
washed with hexanes (2 ꢀ 50 mL) to remove the mineral oil.
After the hexanes were decanted, DMF (490 mL) was added and
the mixture was cooled in an ice bath. 3-O-(Nap)-1,2-isopropyl-
idene-4-C-hydroxymethyl-R-D-ribofuranose 22 (44.6 g, 123.90
mmol) was added to the reaction mixture, and the mixture
was stirred for 30 min. 2-(Bromomethyl)naphthalene (30.08 g,
136.08 mmol) was slowly added to the reaction mixture, and the
stirring was continued at room temperature for another 6 h. The
reaction mixture was cooled in an ice bath, and CH3OH (20 mL)
was added. The reaction mixture was poured into ice cold water
(1.5 L). The resulting aqueous phase was extracted with EtOAc
(2 ꢀ 400 mL), and the organic layers were combined, washed
with brine (1 L), and concentrated under reduced pressure.
The residue was purified by silica gel column chromatography
to yield 23a (39.32 g, 64%) as white solid. A minor amount (4.12
1
g, 6.65%) of compound 23b was also isolated. H NMR (300
MHz, CDCl3) δ 8.14-7.08 (m, 14 H), 5.78 (d, J = 3.6 Hz, 1 H),
4.91 (d, J = 11.9 Hz, 1 H), 4.77-4.44 (m, 4 H), 4.31 (d, J = 5.3
Hz, 1 H), 4.06-3.76 (m, 2 H), 3.72-3.42 (m, 2 H), 2.42 (t, J =
6.8 Hz, 1 H), 1.67 (m, 3 H), 1.34 (s, 3 H); 13C NMR (75 MHz,
CDCl3) 135.4, 134.8, 133.2, 133.0, 128.4, 128.1, 127.9, 127.7,
126.9, 126.5, 126.3, 126.2, 126.1, 125.9, 125.7, 113.6, 104.4, 86.4,
78.8, 78.5, 73.7, 72.8, 71.6, 63.2, 26.8, 26.1; MS (ES) m/z 523
[M þ Na]þ; HRMS (ES-Orbit-Trap) calcd for C31H32O6Naþ
523.2091, found 523.2086.
3,5-O-Bis(Nap)-1,2-isopropylidene-4-C-(trifluoromethanesul-
fonyloxymethyl-r-D-ribofuranose 24. A mixture of compound
23a (30.40 g, 60.72 mmol) and DMAP (7.40 g, 60.72 mmol) was
dried over P2O5 under reduced pressure. The mixture was
dissolved in anhydrous pyridine (152 mL) and chilled to
-5 °C. To this trifluoromethanesulfonic anhydride (20.44 mL,
121.44 mmol) was added dropwise in 20 min. After being stirred
at -5 to 0 °C for 15 min under argon atmosphere, the reaction
mixture was allowed to warm to room temperature. Stirring
continued for 3 h under argon atmosphere. The reaction mixture
was diluted with EtOAc (300 mL) and poured into an iced cold
aqueous NaHCO3 (300 mL). The organic phase was separated,
washed with brine (300 mL), dried (Na2SO4), and concentrated
under reduced pressure. The residue obtained was purified by
silica gel column chromatography (1:1 hexanes/EtOAc) to
1
afford compound 24 (33.64 g, 88.00%). H NMR (300 MHz,
CDCl3) δ 8.03-7.27 (m, 14 H), 5.72 (d, J = 3.4 Hz, 1 H), 5.04
(d, J = 10.5 Hz, 1 H), 4.97-4.82 (m, 2 H), 4.79-4.48 (m, 4 H),
4.25 (d, J = 4.9 Hz, 1 H), 3.69-3.40 (m, 2 H), 1.67 (s, 3 H), 1.34
(s, 3 H); 13C NMR (75 MHz, CDCl3) δ 134.9, 134.4, 133.2,
133.2, 133.1, 133.1, 133.0, 128.4, 128.2, 127.9, 127.9, 127.7,
127.7, 127.7, 127.1, 126.6, 126.3, 126.2, 126.2, 126.2, 126.0,
125.7, 125.6, 120.8, 116.5, 113.9, 104.3, 84.0, 79.2, 78.6, 76.2,
73.9, 72.8, 70.5, 26.5, 25.9; 19F NMR (282 MHz, CDCl3) δ
-74.28; MS (ES) m/z 655.1 [M þ Na]þ.
3,5-O-Bis(Nap)-4-C-(methyleneaminooxymethyl)-β-D-ribofur-
anosyluracil 27. To a stirred solution of anomeric mixture of
26 (11.75 g, 20.57 mmol) and uracil (5.19 g, 46.31 mmol) in
anhydrous acetonitrile (125 mL) was added N,O-bis(trimethyl-
silyl)acetamide (37.8 mL, 154.54 mmol). After heating at 67 °C
for 2 h under an argon atmosphere, the reaction mixture was
cooled in an ice bath. To this, trimethylsilyl trifluoromethane-
sulfonate (8.54 mL, 47.24 mmol) was added dropwise. The
reaction mixture was heated at 65 °C for 2 h under an argon
atmosphere. The reaction was quenched with an ice cold aqu-
eous NaHCO3 (saturated, 200 mL). The mixture was extracted
3,5-O-Bis(Nap)-1,2-isopropylidene-4-C-(methyleneaminooxy-
methyl)-r-D-ribofuranose 25. Compound 24 (29.80 g, 47.15
mmol) was dissolved in anhydrous N,N-dimethylacetamide
(88 mL). To this, N-hydroxyphthalimide (60.77 g, 377.18 mmol)
and N,N-diisopropylethylamine (65.70 mL, 377.18 mmol) were
added. The dark-colored suspension thus obtained was heated
at 90 °C for 18 h under argon atmosphere. The reaction mixture

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4 1647
with EtOAc (2 ꢀ 100 mL). The organic phase was washed with
brine (200 mL) and dried (Na2SO4) and concentrated under
reduces pressure. The residue obtained was dissolved in metha-
nolic NH3 (7 M, 150 mL) and stirred at room temperature for
18 h. Solvent was removed under reduced pressure and the
residue obtained was purified by silica gel column chromato-
graphy and eluted with 5% CH3OH in CH2Cl2 to yield 27 (10.33
(Na2SO4) and concentrated under reduces pressure. The residue
obtained was purified by silica gel column chromatography and
eluted with 70% EtOAc in hexane to yield 29 (5.84 g, 86%). 1H
NMR (300 MHz, DMSO-d6) δ 11.38 (brs, 1 H), 8.01-7.76 (m, 9
H), 7.65-7.42 (m, 6 H), 7.16 (d, J = 6.0 Hz, 1 H), 6.67 (d, J = 6.0
Hz, 1 H), 6.29 (d, J = 6.0 Hz, 1H), 5.51 (t, J = 6.3 Hz, 1 H), 5.27
(d, J = 6.2 Hz, 1 H), 4.86 (dd, J = 12.0 Hz, 24.1 Hz, 2 H),
4.71-4.40 (m, 4 H), 4.25 (d, J = 12.0 Hz,1 H), 3.77-3.61 (m,
2 H), 3.20 (s, 3H); 13C NMR (75 MHz, CDCl3) δ 162.8, 150.1,
140.9, 138.2, 134.4, 134.2, 133.2, 133.1, 133.0, 128.4, 128.3, 128.0,
127.8, 127.7, 127.7, 127.7, 127.4, 126.8, 126.4, 126.3, 125.9, 125.6,
102.0, 84.7, 82.3, 81.5, 80.4, 73.6, 73.4, 73.3, 68.7, 38.2; MS (ES)
m/z 660.0 [M þ H]þ; HRMS (TOF MS ES) calcd for
C34H33N3O9SNaþ 682.1830, found 682.1822.
20-N,40-C-[(N-Methyl)aminooxymethylene]-30,50-bis-O-(Nap)-
uridine 30. Compound 29 (5.74 g, 8.71 mmol) was dissolved in a
solution of 1 M pyridinium p-tolunesulfonate in anhydrous
CH3OH (87 mL). The reaction mixture was cooled to 10 °C in
an ice bath, and NaBH3CN (1.09 g, 17.42 mmol) was added.
After being stirred for 15 min at 10 °C, the reaction mixture was
allowed to come to room temperature and stirred for an addi-
tional 2 h. The reaction mixture was concentrated to get an oil,
diluted with EtOAc (150 mL), washed with water (150 mL),
aqueous NaHCO3 (5%, 100 mL), and brine (100 mL). The
organic phase was dried over anhydrous Na2SO4 and concen-
trated under reduced pressure. The residue obtained was dis-
solved in DMF (57.4 mL), and N,N-diisopropylethylamine
(57.4 mL) was added. The reaction mixture was heated at
80 °C for 18 h. The reaction mixture was cooled and diluted
with EtOAc (300 mL). The solution was washed with aqueous
NaHCO3 (saturated, 300 mL) and brine (300 mL). The organic
phase was dried (Na2SO4) and concentrated under reduced
pressure. The residue obtained was purified by silica gel column
chromatography and eluted with 50% EtOAc in hexane to yield
30 (4.13 g, 84%) as a white foam. 1H NMR (300 MHz, DMSO-
d6) δ 11.33 (s, 1 H), 7.91-7.75 (m, 9 H), 7.56-7.43 (m, 6 H), 6.18
(s, 1 H), 5.22 (d, J = 8.1 Hz, 1 H), 4.82-4.62 (m, 4 H), 4.12 (d,
J = 11.1 Hz, 1 H), 4.03 (m, 1 H), 3.79-3.64 (m, 3 H), 3.47 (d,
J = 10.9 Hz, 1 H), 2.70 (s, 3 H); 13C NMR (75 MHz, CDCl3) δ
163.6, 150.0, 139.8, 134.8, 134.7, 133.3, 133.2, 128.6, 128.5,
128.0, 127.9, 127.1, 126.7, 126.6, 126.5, 126.4, 125.9, 125.5,
101.7, 83.0, 82.8, 73.9, 72.5, 70.8, 68.4, 67.7, 66.6, 43.7; MS
(ES) m/z 566.2 [M þ H]þ; HRMS (TOF MS ES) calcd for
C33H31N3O6Naþ 588.2111, found 588.2127.
1
g, 86%) as a white foam. H NMR (300 MHz, DMSO-d6) δ
11.33 (s, 1 H), 8.01-7.76 (m, 8 H), 7.70 (d, J = 8.1 Hz, 1 H),
7.60-7.37 (m, 6 H), 7.05 (d, J = 7.4 Hz, 1 H), 6.59 (d, J = 7.4
Hz, 1 H), 5.92 (d, J = 6.6 Hz, 1 H), 5.68 (d, J = 5.9 Hz, 1 H), 5.34
(d, J = 8.1 Hz, 1 H), 5.07-4.96 (m, 1 H), 4.80-4.61 (m, 3 H),
4.47-4.26 (m, 3 H), 4.25-4.18 (m, 1 H), 3.78-3.65 (m, 2 H); 13
C
NMR (75 MHz, CDCl3) δ 163.0, 150.6, 140.4, 137.9, 134.4,
133.1, 133.0, 128.4, 128.1, 127.9, 127.8, 127.7, 127.3, 127.1,
126.9, 126.5, 126.3, 126.2, 125.8, 125.6, 102.4, 90.0, 87.1, 78.6,
74.8, 74.5, 74.2, 73.9, 71.9 ; MS (ES) m/z 582.1 [M þ H]þ; HRMS
(ES-Orbit-Trap) calcd for C33H31N3O7Naþ 604.2054, found
604.2047.
3,5-O-Bis(Nap)-4-C-(methyleneaminooxymethyl)-β-D-arabino-
furanosyl)uracil 28. Compound 27 (10.20 g, 17.56 mmol) was
dissolved in anhydrous CH2Cl2 (175 mL), and triethylamine
(29.35 mL, 210.57 mmol) was added. The reaction mixture was
chilled in an ice bath and methanesulfonyl chloride (2.73 mL,
35.07 mmoL) was added dropwise. The mixture was stirred for
10 min under an argon atmosphere. The reaction mixture was
allowed to come to room temperature. After being stirred for 3 h
under an argon atmosphere, reaction mixture was poured into
an ice cold aqueous NaHCO3 (saturated, 150 mL). The organic
phase was separated and washed with brine (150 mL) and dried
(Na2SO4) and concentrated under reduces pressure. The residue
obtained was purified by silica gel column chromatography and
eluted with 50-70% EtOAc in hexane to yield methanesulfonyl
derivative (8.10 g, 70%). To a solution of methanesulfonyl
derivative (8.10 g, 12.29 mmol) in anhydrous CH3CN (97.50
mL) was added DBU (4.16 mL, 27.80 mmol). After being stirred
at room temperature for 3 h, the mixture was diluted with
EtOAc (200 mL), washed with 1 M aqueous HCl (200 mL),
water (200 mL), aqueous NaHCO3 (200 mL), and brine (200
mL), dried over anhydrous Na2SO4, filtered, and evaporated to
a foam. The foam was redissolved in 1,4-dioxane (270 mL), and
2 M aqueous NaOH (68 mL) was added. After 45 min, the
mixture was diluted with EtOAc (200 mL), washed with 1 M
aqueous HCl (200 mL), water (200 mL), saturated aqueous
NaHCO3 (200 mL), and brine (200 mL), dried over anhydrous
Na2SO4, filtered, and evaporated. Purification by silica gel
column chromatography (70% EtOAc in hexane) yielded 28
(6.01 g, 59%) as a white foam. 1H NMR (300 MHz, DMSO-d6)
δ 11.24 (s, 1 H), 8.02- 7.72 (m, 8 H), 7.68 (s, 1 H), 7.62-7.43 (m, 7
H), 7.32 (m, 1 H), 7.11 (d, J = 7.3 Hz, 1 H), 6.63 (d, J = 7.3 Hz,
1 H), 6.11 (d, J = 6.0 Hz, 1 H), 5.90 (d, J = 5.3 Hz, 1 H), 5.17 (m,
1 H), 4.92-4.75 (m, 2 H), 4.67-4.47 (m, 3 H), 4.44-4.32 (m,
1 H), 4.28-4.17 (m, 2 H), 3.75- 3.59 (m, 2 H); 13C NMR (75
MHz, CDCl3) δ 164.0, 150.7, 142.1, 137.7, 134.9, 134.2, 133.2,
133.1, 128.4, 128.2, 128.0, 127.8, 127.7, 126.9, 126.8, 126.4,
126.2, 126.2, 126.0, 125.7, 125.6, 100.8, 85.6, 85.0, 83.0, 74.9,
73.8, 73.7, 72.7, 70.2; MS (ES) m/z 582.2 [M þ H]þ; HRMS
(ES-Orbit-Trap) calcd for C33H31N3O7Naþ 604.2054, found
604.2050.
20-N,40-C-[(N-Methyl)aminooxymethylene]uridine 31. To a
solution of compound 30 (4.11 g, 7.27 mmol) in CH2Cl2 (73
mL), 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (9.37 g, 41.27
mmol) and H2O (0.29 mL, 16.16 mmol) were added. The
reaction mixture was stirred at room temperature for 18 h.
Solvent was removed under reduced pressure. The residue
obtained was dissolved in 10% CH3OH in CH2Cl2 (20 mL)
and purified by silica gel column chromatography and eluted
with 5-10% CH3OH in CH2Cl2 containing 2% triethylamine to
yield 31 (1.78 g, 86%). 1H NMR (300 MHz, CD3OD) δ 8.01 (d,
J = 8.1 Hz, 1 H), 6.16 (s, 1 H), 5.62 (d, J = 8.1 Hz, 1 H), 4.16 (d,
J = 11.3 Hz, 1H), 4.09 (d, J = 4.8 Hz, 1 H), 3.68 (d, J = 5.8 Hz,
1 H), 3.47-3.41 (m, 2 H), 3.15-3.12 (m, 1 H), 2.78 (s, 3 H). 13
C
NMR (75 MHz, MeOD) 167.8, 153.2, 142.8, 103.1, 85.8, 84.7,
72.2, 70.7, 66.7, 60.9, 44.8; MS (ES) m/z 286þ.1 [M þ H]þ; HRMS
(TOF MS ES) calcd for C11H16N3O6 286.1039, found
286.1034.
3,5-O-Bis(Nap)-4-C-(methyleneaminooxymethyl-20-O-methane-
sulfonyl-β-D-arabinofuranosyluracil 29. Compound 28 (5.99 g,
10.33 mmol) was dissolved in anhydrous CH2Cl2 (55 mL), and
triethylamine (18.27 mL, 31.06 mmol) was added. The reac-
tion mixture was cooled to 0 °C, and methanesulfonyl chloride
(1.70 mL, 21.76 mmol) was added dropwise and warmed to
room temperature and stirred for 3 h under an argon atmo-
sphere. The reaction mixture was diluted with CH2Cl2 (50 mL),
cooled to 0°C, and quenched with saturated aqueous NaHCO3
(10 mL). The reaction mixture was washed with saturated
aqueous NaHCO3 (100 mL) and brine (100 mL) and dried
50-O-(DMT)-20-N,40-C-[(N-methyl)aminooxymethylene]uri-
dine 32. Compound 32 (2.82 g, 79% yield) was synthesized from
compound 31 (1.72 g, 6.03 mmol), DMTCl (2.99 g, 8.83 mmol),
and anhydrous pyridine (17 mL) according to the procedure
used for the synthesis of compound 11 except that the residue
obtained after workup was purified by silica gel column chro-
matography and eluted with 70% EtOAc and 2% triethylamine
in hexane to yield a white foam. 1H NMR (300 MHz, DMSO-d6)
δ 11.36 (s, 1 H), 7.87 (d, J = 8.1 Hz, 1 H), 7.53-7.06 (m, 9 H),

1648 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4
Prakash et al.
6.91 (d, J = 8.5 Hz, 4 H), 6.16 (s, 1 H), 5.26 (d, J = 7.6 Hz, 2 H),
4.17 (m, 1 H), 3.96 (d, J = 11.5 Hz, 1 H), 3.75 (s, 6 H), 3.49-3.34
144.1, 135.6, 135.2, 133.1, 130.1, 130.3, 130.2, 129.2, 128.4,
128.3, 127.8, 127.4, 113.6, 96.8, 87.1, 83.5, 69.6, 68.9, 65.2,
60.4, 55.5, 43.7; HRMS (TOF MS ES) calcd for C39H39N4O8
(m, 2H), 3.27-3.05 (dd, J = 11, 26.4 Hz, 2 H), 2.67 (s, 3 H); 13
C
þ
NMR (75 MHz, CDCl3) δ 163.8, 159.2, 159.1, 150.4, 144.8,
139.9, 135.4, 135.2, 130.3, 130.2, 128.0, 127.3, 113.5, 102.6, 87.1,
83.4, 82.4, 70.1, 68.9, 65.4, 60.1, 55.5, 43.5; MS (ES) m/z 586.2
[M - H]-; HRMS (TOF MS ES) calcd for C32H33N3O8Naþ
610.2166, found 610.2162.
691.2768, found 691.2755.
Synthesis of ASOs Containing 20,40-N-Methoxyaminomethyl-
ene and 20-O-40-C-Aminomethylene and 20,40-Aminooxymethyl-
ene Linked Bicyclic Nucleic Acids. The synthesis of ASOs
(41-44, Table 1) on a 40 μmol scale was performed on
50-O-(DMT)-30-O-(triethylsilyl)-20-N,40-C-[(N-methyl)amino-
oxymethylene]uridine 33. Compound 33 (1.18 g, 84% yield) was
synthesized from compound 32 (1.18 g, 2.01 mmol), imidazole
(1.37 g, 20.08 mmol), DMF (5.00 mL), and chlorotriethyl silane
(1.69 mL, 10.04 mmol) according to the procedure used for the
an AKTA oligopiolot 10 automated DNA/RNA synthesizer
¨
(GE Healthcare Bioscience, NJ) using a 1.2 mL column and
UnyLinker solid support (loading 160 μmol g-1). The standard
phosphoramidites were used for incorporation of dA, T, dG,
and dC residues. A 0.1 M solution of the phosphoramidites 1, 2,
16-21 in anhydrous CH3CN was used for the synthesis. For the
coupling step, the phosphoramidites 1, 2, 16-21 were delivered
4-fold excess over the solid support and phosphoramidites
condensation were carried out for 10 min. The oxidation step
was carried out with tert-butyl hydroperoxide (20% in CH3CN
containing 6% water, 12 min contact time).52 A 0.2 M phenyl-
acetyl disulfide solution in 3-picoline/CH3CN (1:1, v/v) was
used as a sulfur-transfer reagent with 3 min of contact time.
Dichloroacetic acid (6%) in toluene was used for removing 4,40-
dimethoxytrityl group. A 0.7 M solution of 4,5-dicyanoimida-
zole in anhydrous CH3CN was used as an activator. All other
steps in the protocol supplied by manufacturer were used. At the
end of the synthesis, solid support bearing the oligonucleotides
was treated with 50% triethylamine in acetonitrile for 45 min to
remove the cyanoethyl group from the phosphorothioate lin-
kages. Subsequently, the solid-support bound ASOs were sus-
pended in aqueous ammonia (28-30 wt %, 40 mL) and heated at
55 °C for 14 h. The solid supports were filtered and washed with
water. The combined filtrate and the washing were concentrated,
and the residues obtained were purified by HPLC on a strong
anion exchange column (GE Healthcare Bioscience, Source 30Q,
30 μm, 2.54 cm ꢀ 8 cm, A is 100 mM ammonium acetate in 30%
aqueous CH3CN, B is 1.5 M NaBr in A, 0-60% of B in 60 min,
flow rate of 14 mL min-1). The ASOs were desalted by HPLC on
a reverse phase column to yield ASOs 41-44 in an isolated yield
of 25-30% based on the loading of the solid support. ASOs were
characterized by ion-pair-HPLC-MS analysis with Agilent
1100 MSD system (Supporting Information).
Cell Culture Assay. Oligonucleotides were transfected into
bEnd.3 cells (ATCC, Manassas, VA) to determine IC50. bEnd.3
cells were grown in T-75 flasks incubated at 37 °C in the presence
of 10% CO2 in a complete growth medium of Dulbecco’s
modified Eagle’s medium supplemented with 10% fetal bovine
serum (DMEM and FBS, respectively, Invitrogen, Carlsbad
CA) until 70-80% confluent. Once this confluency was
reached, the cells were either subcultured or plated at 1 ꢀ 104
cells per well into 96-well plates for transfection the following
day. On the day of transfection 3 μg mL-1 of Lipofectin
(Invitrogen, Carlsbad CA) was thoroughly mixed into Opti-
MEM (Invitrogen, Carlsbad CA) and incubated at 37 °C for
30-50 min. Immediately prior to transfection, concentrated
oligonucleotide solutions were added to the lipid/media mixture
and serially diluted 1:2 into eight treatment concentrations for
each oligonucleotide (40 nM to 312.5 pM). The plated bEnd.3
cells were removed from the incubator and washed once with 1ꢀ
phosphate buffered saline PBS (Invitrogen, Carlsbad, CA).
Then the transfection mixtures were added to individual wells
of the 96-well plate. The plates were incubated at 37 °C for 4 h in
the presence of 5% CO2. Then the transfection mixtures were
removed and the cells were refed with complete media. After
24 h of incubation, the cells were washed once with 1ꢀ PBS and
lysed, and total mRNA was isolated using Qiagen 96-well
RNeasy plates (RNeasy 96, Qiagen, Germantown, MD). The
isolated RNA was analyzed for PTEN and cyclophilin A RNA
expression levels using qRT-PCR as described.53 PTEN RNA
expression levels for each well were normalized to those of
cyclophillin A and expressed as a percentage of the levels
1
synthesis of compound 12. H NMR (300 MHz, DMSO-d6) δ
11.38 (s, 1 H), 7.99 (d, J = 8.1 Hz, 1 H), 7.49-7.08 (m, 9 H), 6.90
(dd, J = 1.6, 8.8 Hz, 4 H), 6.20 (s, 1 H), 5.30 (d, J = 8.1 Hz, 1 H),
4.28 (d, J = 4.7 Hz, 1 H), 3.87 (d, J = 11.1 Hz, 1 H), 3.74 (s, 6 H),
3.46 (d, J = 4.7 Hz, 1 H), 3.36 (d, J = 11.0 Hz, 1 H), 3.15 (dd,
J = 10.8, 32.7 Hz, 2 H), 2.64 (s, 3 H), 0.97-0.68 (m, 9 H),
0.63-0.33 (m, 6 H); 13C NMR (75 MHz, CDCl3) δ163.8, 158.8,
149.9, 144.1, 140.0, 135.1, 134.9, 130.1, 129.1, 128.1, 127.9,
127.8, 127.2, 113.5, 113.4, 101.7, 86.8, 83.2, 82.9, 69.7, 67.9,
65.8, 59.7, 55.2, 43.2, 6.9, 5.1; MS (ES) m/z 702.3 [M þ H]þ.
50-O-(DMT)-30-O-(triethylsilyl)-20-N,40-C-[(N-methyl)amino-
oxymethylene]cytidine 34. Compound 34 (1.06 g, 95% yield) was
synthesized from compound 33 (1.12 g, 1.60 mmol) in anhy-
drous CH3CN (10.5 mL) according to the procedure used for the
synthesis of compound 13. 1,2,4-Triazole (3.76 g, 54.4 mmol),
CH3CN (21.00 mL), POCl3 (1.18 mL, 12.69 mmol), triethyl-
amine (8.89.mL, 63.77 mmol), aqueous NH3 (12.7 mL, 28-30
wt %), and dioxane (30.5 mL) were added. 1H NMR (300 MHz,
DMSO-d6) δ 8.09 (d, J = 7.3 Hz, 1 H), 7.52-7.05 (m, 9 H), 6.90
(dd, J = 1.5, 8.7 Hz, 4 H), 6.17 (s, 1 H), 5.59 (d, J = 7.5 Hz, 1 H),
4.28 (d, J = 4.5 Hz, 1 H), 3.85 (d, J = 11.1 Hz, 1 H), 3.75 (s, 6H),
3.35-3.28 (m, 3 H), 3.01 (d, J = 10.8 Hz, 1 H), 2.67 (s, 3 H),
0.90-0.64 (m, 9 H), 0.59-0.32 (m, 6 H); 13C NMR (75 MHz,
CDCl3) δ 166.2, 158.9, 155.8, 144.5, 141.8, 135.6, 135.5, 130.4,
128.5, 128.1, 127.3, 113.4, 94.0, 86.9, 83.7, 83.0, 69.4, 68.2, 66.0,
60.3, 55.5, 43.6, 6.9, 5.1; MS (ES) m/z 701.3 [M þ H]þ; HRMS
(TOF ES MS) calcd for C38H49N4O7SiNaþ 723.3184, found
723.3179.
N4-Benzoyl-50-O-(DMT)-30-O-(triethylsilyl)-20-N,40-C-[(N-
methyl)aminooxymethylene]cytidine 35. Compound 35 (0.98 g,
84% yield) was synthesized from compound 34 (1.02 g, 1.46
mmol), anhydrous DMF (6.60 mL), and benzoic anhydride
(0.56 g, 2.49 mmol) according to the procedure used for the
1
synthesis of compound 14. H NMR (300 MHz, DMSO-d6) δ
11.35 (br s, 1 H), 8.58 (d, J = 7.5 Hz, 1 H), 8.02 (d, J = 7.1 Hz, 2
H), 7.66-7.25 (m, 13 H), 6.93 (d, J = 8.9 Hz, 4 H), 6.21 (s, 1 H),
4.35 (d, J = 4.7 Hz, 1 H), 3.92 (d, J = 11.2 Hz, 1 H), 3.78 (s, 6 H),
3.46 (d, J = 4.7 Hz, 1 H), 3.39 (d, J = 11.0 Hz, 1 H), 3.29 (m,
1H), 3.14 (m, 1 H), 2.73 (s, 3 H), 0.84-0.76 (m, 9), 0.59-0.41
(m, 6H); 13C NMR (75 MHz, CD3Cl3) δ 163.0, 159.0, 145.4,
144.1, 135.6, 135.4, 133.3, 130.4, 130.3, 129.1, 128.5, 128.2,
128.0, 127.5, 113.5, 96.6, 87.1, 84.2, 83.5, 69.2, 68.1, 65.8,
60.2, 55.5, 43.6, 6.9, 5.1; MS (ES) m/z 805.3 [M þ H]þ; HRMS
(ES-FT Orbit-Trap) calcd for C45H53N4O8Siþ 805.3627, found
805.3622.
N4-Benzoyl-50-O-(DMT)-20-N,40-C-[(N-methyl)aminooxy-
methylene]cytidine 36. Compound 36 (0.74 g, 92% yield) was
synthesized from compound 35 (0.94 g, 1.16 mmol), triethyl-
amine trihydrofluoride (1.15 mL, 7.09 mmol), anhydrous THF
(13.7 mL), and triethylamine (0.49 mL, 3.55 mmol) according to
the procedure used for the synthesis of compound 15. 1H NMR
(300 MHz, DMSO-d6) δ 11.31 (s, 1 H), 8.46 (d, J = 7.5 Hz, 1 H),
8.01 (d, J = 7.3 Hz, 2 H), 7.71-7.20 (m, 13 H), 6.93 (d, J = 8.9
Hz, 4 H), 6.22 (s, 1 H), 5.29 (d, J = 7.3 Hz, 1 H), 4.29-4.18 (m, 1
H), 4.08-3.93 (m, 1H), 3.77 (s, 6 H), 3.43-3.38 (m, 2 H),
3.35-3.29 (m, 1 H), 3.19-3.07 (m, 1 H), 2.75 (s, 3 H); 13C
NMR (75 MHz, CDCl3) δ 171.1, 162.5, 158.7, 155.0, 144.9,

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4 1649
References
observed in untreated control wells (% UTC). Each treatment
was performed in triplicate on separate 96-well plates. IC50
values were determined using GraphPad Prism software by
fitting the data to a sigmoidal dose-response curve (variable
slopes) using a defined top of 100% and bottom of 0%.
Animal Treatment. Male BALB/c mice (6-8 weeks old,
Charles River, Wilmington, MA) were housed four to a cage
under conditions meeting National Institutes of Health regula-
tions and AAALAC accreditation.54 For the multiple adminis-
tration studies ASOs 37, 39-41, 43, and 44 were administered in
PBS by intraperitoneal (ip) injection according to the indicated
dose levels twice a week for 3 weeks. For the single administra-
tion studies the ASOs 40, 42, 43 were administered in PBS
by injection according to the indicated dose levels once. The
animals were maintained at a constant temperature of 23 °C and
were fed standard lab diet. Animal weight was recorded prior
to each dosing throughout the live phase of the study. Mice
were anesthetized and sacrificed 3 days after administration of
final dose. Plasma was isolated from whole blood obtained via
cardiac puncture. ALT and AST levels were determined using
an Olympus AU400e bioanalyzer. Liver and spleen weights were
determined. Effect of compound on organ weights, normalized
to body weight, was expressed relative to those of the saline
treated group.
RNA Analysis. Tissues were homogenized in 4 M guanidine
isothiocyanate, 25 mM EDTA, 50 mM Tris-HCl, pH 6, contain-
ing 1 M β-mercaptoethanol immediately following sacrifice and
homogenization. RNA was extracted using RNeasy columns
(Qiagen) according to the manufacturer’s protocol. RNA was
eluted from the columns with water. RNA samples were ana-
lyzed by fluorescence-based quantitative RT-PCR using an
Applied Biosystems 7700 sequence detector. Levels of target
RNAs as well as those of cyclophilin A, a housekeeping
gene, were determined. Target RNA levels were normalized to
cyclophilin levels for each RNA sample. Primers used for
determination of PTEN RNA level are as follows: FP 50
ATGACAATCATGTTGCAGCAATTC 30, RP 50 CGATG-
CAATAAATATGCACAAATCA 30, and PR 50 6FAM-CTG-
TAAAGCTGGAA AGGGACGGACTGGT-TAMRA 30.
ASO Extraction and HPLC-ES/MS Metabolite Identifica-
tion. Organs were frozen in liquid nitrogen immediately follow-
ing the removal and stored at -80 °C until ASO extraction.
Tissues were weighed, and ASO was extracted as described
previously.32 Tissue samples were homogenized and subjected
to solid phase extraction using phenyl bonded SPE column
(Isolute). Concentrations of ASO in tissue were determined by
ion pair HPLC coupled mass spectrometry.55
(1) Crooke, S. T., Ed. Antisense Drug Technology: Principles, Strate-
gies, and Applications, 2nd ed.; CRC Press: Boca Raton, FL, 2007;
799 pp.
(2) Group, V. S. Randomized dose-comparison studies of intravenous
fomiversen for treatment of cytomegalovirus retinitis that has
reactivated or is persistently active despite other therapies in
patients with AIDS. Am. J. Ophthalmol. 2002, 133, 475–483.
(3) Eckstein, F. Phosphorothioate oligodeoxynucleotides: what is
their origin and what is unique about them? Antisense Nucleic Acid
Drug Dev. 2000, 10, 117–121.
(4) Geary, R. S.; Yu, R. Z.; Levin, A. A. Pharmacokinetics of
phosphorothioate antisense oligodeoxynucleotides. Curr. Opin.
Invest. Drugs 2001, 2, 562–573.
(5) Manoharan, M. 20-Carbohydrate modifications in antisense oligo-
nucleotide therapy: importance of conformation, configuration
and conjugation. Biochim. Biophys. Acta 1999, 1489, 117–130.
(6) Freier, S. M.; Altmann, K. H. The ups and downs of nucleic
acid duplex stability: structure-stability studies on chemically-
modified DNA:RNA duplexes. Nucleic Acids Res. 1997, 25, 4429–
4443.
(7) Swayze, E. E.; Bhat, B. The Medicinal Chemistry of Oligonucleo-
tides. In Antisense Drug Technology: Principles, Strategies, and
Applications, 2nd ed.; Crooke, S. T., Ed.; CRC Press: Boca Raton, FL,
2008; pp 143-182.
(8) Kurreck, J. Antisense technologies. Improvement through novel
chemical modifications. Eur. J. Biochem. 2003, 270, 1628–1644.
(9) Lima, W. F.; Nichols, J. G.; Wu, H.; Prakash, T. P.; Migawa,
M. T.; Wyrzykiewicz, T. K.; Bhat, B.; Crooke, S. T. Structural
requirements at the catalytic site of the heteroduplex substrate
for human RNase H1 catalysis. J. Biol. Chem. 2004, 279, 36317–
36326.
(10) Monia, B. P.; Lesnik, E. A.; Gonzalez, C.; Lima, W. F.; McGee, D.;
Guinosso, C. J.; Kawasaki, A. M.; Cook, P. D.; Freier, S. M.
Evaluation of 20-modified oligonucleotides containing 20-deoxy
gaps as antisense inhibitors of gene expression. J. Biol. Chem.
1993, 268, 14514–14522.
(11) Martin, P. Ein neuer zugang zu 2-O-alkylribonucleosiden und
eigenschaften deren oligonucleotide. Helv. Chim. Acta 1995, 78,
486–504.
(12) Teplova, M.; Minasov, G.; Tereshko, V.; Inamati, G. B.; Cook,
P. D.; Manoharan, M.; Egli, M. Crystal structure and improved
antisense properties of 20-O-(2-methoxyethyl)-RNA. Nat. Struct.
Biol. 1999, 6, 535–539.
(13) McKay, R.; Miraglia, L.; Cummins, L.; Owens, S.; Sasmor, H.;
Dean, N. Characterization of a potent and specific class of anti-
sense oligonucleotide inhibitor of human protein kinase C-alpha
expression. J. Biol. Chem. 1999, 274, 1715–1722.
(14) Altmann, K. H.; Martin, P.; Dean, N. M.; Monia, B. P. Second
generation antisense oligonucleotides—inhibition of pkc-alpha
and c-raf kinase expression by chimeric oligonucleotides incorpor-
ating 60-substituted carbocyclic nucleosides and 20-O-ethylene
glycol substituted ribonucleosides. Nucleosides Nucleotides 1997,
16, 917–926.
Tm Analysis. The thermal stability of the duplexes formed
by oligonucleotides with the MOE and bicyclic nucleic acid
modified gapmer ASOs 37-45, DNA 46 (Table 2), and com-
plementary RNA was studied by measuring the UV absor-
bance versus temperature curves as described previously.56
Each sample contained 100 mM Naþ, 10 mM phosphate,
0.1 mM EDTA, 4 μM oligonucleotides, and 4 μM complemen-
tary length matched RNA. Each Tm reported was an average of
two experiments.
(15) Geary, R. S.; Watanabe, T. A.; Truong, L.; Freier, S.; Lesnik,
E. A.; Sioufi, N. B.; Sasmor, H.; Manoharaon, M.; Levin, A. A.
Pharmacokinetic properties of 20-O-(2-methoxyethyl)-modified
oligonucleotide analogs in rats. J. Pharmacol. Exp. Ther. 2001,
296, 890–897.
(16) Yu, R. Z.; Geary, R. S.; Monteith, D. K.; Matson, J.; Truong, L.;
Fitchett, J.; Levin, A. A. Tissue disposition of 20-O-(2-methoxy)
ethyl modified antisense oligonucleotides in monkeys. J. Pharm.
Sci. 2004, 93, 48–59.
(17) Geary, R. S.; Yu, R. Z.; Watanabe, T.; Henry, S. P.; Hardee, G. E.;
Chappell, A.; Matson, J.; Sasmor, H.; Cummins, L.; Levin, A. A.
Pharmacokinetics of a tumor necrosis factor-alpha phosphoro-
thioate 20-O-(2-methoxyethyl) modified antisense oligonucleotide:
comparison across species. Drug Metab. Dispos. 2003, 31, 1419–
1428.
Acknowledgment. The authors thank Guillermo Vasquez
for synthesizing the starting materials.
(18) Zhang, H.; Cook, J.; Nickel, J.; Yu, R.; Stecker, K.; Myers, K.;
Dean, N. M. Reduction of liver Fas expression by an antisense
oligonucleotide protects mice from fulminant hepatitis. Nat. Bio-
technol. 2000, 18, 862–867.
(19) Yu, R. Z.; Zhang, H.; Geary, R. S.; Graham, M.; Masarjian, L.;
Lemonidis, K.; Crooke, R.; Dean, N. M.; Levin, A. A. Pharmaco-
kinetics and pharmacodynamics of an antisense phosphorothioate
oligonucleotide targeting Fas mRNA in mice. J. Pharmacol. Exp.
Ther. 2001, 296, 388–395.
Supporting Information Available: Mass spectral data of
oligonucleotides 37, 39, 40-44; figures of PTEN mRNA reduc-
tion in bend cells after transfection of ASOs 37-44; figure of
PTEN mRNA reduction in liver and ALT level after single
administration of ASOs 40, 42, 43; 31P NMR and HRMS of
compounds 1, 2, 20, 21; 1H and 13C NMR spectra and HRMS
results of compounds 5-7, 10, 11, 15, 23a, 25, 27, 28, 30-32, 36;
19F NMR of compound 7; LC-MS profiles of ASOs 41-44.
This material is available free of charge via the Internet at
http://pubs.acs.org.
(20) Liang, Y.; Osborne, M. C.; Monia, B. P.; Bhanot, S.; Watts, L. M.;
She, P.; Decarlo, S. O.; Chen, X.; Demarest, K. Antisense oligo-
nucleotides targeted against glucocorticoid receptor reduce hepatic

1650 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 4
Prakash et al.
glucose production and ameliorate hyperglycemia in diabetic mice.
Metabolism 2005, 54, 848–855.
(38) Divakar, K. J.; Reese, C. B. 4-(1,2,4-Triazol-1-yl)- and 4-(3-nitro-
1,2,4-triazol-1-yl)-1-(b-D-2,3,5-tri-O-acetylarabinofuranosyl)pyri-
midin-2(1H)-ones. Valuable intermediates in the synthesis of
derivatives of 1-(b-D-arabinofuranosyl)cytosine (ara-C). J. Chem.
Soc., Perkin Trans. 1 1982, 1171–1176.
(39) Bhat, V.; Ugarkar, B. G.; Sayeed, V. A.; Grimm, K.; Kosora, N.;
Domenico, P. A.; Stocker, E. A simple and convenient method for
the selective N-acylations of cytosine nucleosides. Nucleosides
Nucleotides 1989, 8, 179–183.
(40) Prakash, T. P.; Kawasaki, A. M.; Fraser, A. S.; Vasquez, G.;
Manoharan, M. Synthesis of 20-O-[2-[(N,N-dimethylamino)-
oxy]ethyl] modified nucleosides and oligonucleotides. J. Org.
Chem. 2002, 67, 357–369.
(41) Vorbrueggen, H.; Bennua, B. Nucleoside syntheses. XXV. A new
simplified nucleoside synthesis. Chem. Ber. 1981, 114, 1279–1286.
(42) Butler, M.; McKay, R. A.; Popoff, I. J.; Gaarde, W. A.; Witchell,
D.; Murray, S. F.; Dean, N. M.; Bhanot, S.; Monia, B. P. Specific
inhibition of PTEN expression reverses hyperglycemia in diabetic
mice. Diabetes 2002, 51, 1028–1034.
(21) Zinker, B. A.; Rondinone, C. M.; Trevillyan, J. M.; Gum, R. J.;
Clampit, J. E.; Waring, J. F.; Xie, N.; Wilcox, D.; Jacobson, P.;
Frost, L.; Kroeger, P. E.; Reilly, R. M.; Koterski, S.; Opgenorth,
T. J.; Ulrich, R. G.; Crosby, S.; Butler, M.; Murray, S. F.; McKay,
R. A.; Bhanot, S.; Monia, B. P.; Jirousek, M. R. PTP1B antisense
oligonucleotide lowers PTP1B protein, normalizes blood glucose,
and improves insulin sensitivity in diabetic mice. Proc. Natl. Acad.
Sci. U.S.A. 2002, 99, 11357–11362.
(22) Butler, M.; McKay, R. A.; Popoff, I. J.; Gaarde, W. A.; Witchell,
D.; Murray, S. F.; Dean, N. M.; Bhanot, S.; Monia, B. P. Specific
inhibition of PTEN expression reverses hyperglycemia in diabetic
mice. Diabetes 2002, 51, 1028–1034.
(23) Crooke, R. M.; Graham, M. J.; Lemonidis, K. M.; Whipple, C. P.;
Koo, S.; Perera, R. J. An apolipoprotein B antisense oligonucleo-
tide lowers LDL cholesterol in hyperlipidemic mice without caus-
ing hepatic steatosis. J. Lipid Res. 2005, 46, 872–884.
(24) Kastelein, J. J.; Wedel, M. K.; Baker, B. F.; Su, J.; Bradley, J. D.;
Yu, R. Z.; Chuang, E.; Graham, M. J.; Crooke, R. M. Potent
reduction of apolipoprotein B and LDL cholesterol by short-term
administration of an antisense inhibitor of apolipoprotein B.
Circulation 2006, 114, 1729–1735.
(43) Butler, M; M., R.; Popoff, I. J.; Gaarde, W. A.; Witchell, D;
Murray, S. F.; Dean, N. M.; Bhanot, S; Monia, B. P. Specific
inhibition of PTEN expression reverses hyperglycemia in diabetic
mice. Diabetes 2002, 51, 1028–1034.
(25) Chi, K. N.; Eisenhauer, E.; Fazli, L.; Jones, E. C.; Goldenberg,
S. L.; Powers, J.; Tu, D.; Gleave, M. E. A phase I pharmacokinetic
and pharmacodynamic study of OGX-011, a 20-methoxyethyl
antisense oligonucleotide to clusterin, in patients with localized
prostate cancer. J. Natl. Cancer Inst. 2005, 97, 1287–1296.
(26) Sewell, K. L.; Geary, R. S.; Baker, B. F.; Glover, J. M.; Mant,
T. G.; Yu, R. Z.; Tami, J. A.; Dorr, F. A. Phase I trial of ISIS
104838, a 20-methoxyethyl modified antisense oligonucleotide tar-
geting tumor necrosis factor-alpha. J. Pharmacol. Exp. Ther. 2002,
303, 1334–1343.
(27) Obika, S.; Nanbu, D.; Hari, Y.; Andoh, J.; Morio, K.; Doi, T.;
Imanishi, T. Synthesis of 20-O,40-C-methyleneuridine and -cyti-
dine. Novel bicyclic nucleosides having a fixed C30-endo sugar
puckering. Tetrahedron Lett. 1997, 38, 8735–8738.
(44) Cheruvallath, Z. S.; Carty, R. L.; Moore, M. N.; Capaldi, D. C.;
Krotz, A. H.; Wheeler, P. D.; Turney, B. J.; Craig, S. R.; Gaus, H.
J.; Scozzari, A. N.; Cole, D. L.; Ravikumar, V. T. Synthesis of
antisense oligonucleotides: replacement of 3H-1,2-benzodithiol-
3-one 1,1-dioxide (Beaucage reagent) with phenylacetyl disulfide
(PADS) as efficient sulfurization reagent: from bench to bulk
manufacture of active pharmaceutical ingredient. Org. Process
Res. Dev. 2000, 4, 199–204.
(45) Guzaev, A. P.; Manoharan, M. A conformationally preorganized
universal solid support for efficient oligonucleotide synthesis.
J. Am. Chem. Soc. 2003, 125, 2380–2381.
(46) Wang, Z.; Olsen, P.; Ravikumar, V. T. A novel universal linker for
efficient synthesis of phosphorothioate oligonucleotides. Nucleo-
sides, Nucleotides Nucleic Acids 2007, 26, 259–269.
(28) Obika, S.; Nanbu, D.; Hari, Y.; Andoh, J.; Morio, K.; Doi, T.;
Imanishi, T. Stability and structural features of the duplexes
containing nucleoside analogs with a fixed N-type conformation,
20-O,40-C-methyleneribonucleosides. Tetrahedron Lett. 1998, 39,
5401–5404.
(47) Wang, Z.; Siwkowski, A.; Lima, W. F.; Olsen, P.; Ravikumar, V. T.
Antisense oligonucleotides: efficient synthesis of 20-O-methoxy-
ethyl phosphorothioate oligonucleotides using 4,5-dicyanoimida-
zole. Are these oligonucleotides comparable to those synthesized
using 1H-tetrazole as coupling activator? Bioorg. Med. Chem. 2006,
14, 5049–5060.
(48) Zhou, C.; Liu, Y.; Andaloussi, M.; Badgujar, N.; Plashkevych, O.;
Chattopadhyaya, J. Fine tuning of electrostatics around the inter-
nucleotidic phosphate through incorporation of modified 20,40-
carbocyclic-LNAs and -ENAs leads to significant modulation of
antisense properties. J. Org. Chem. 2009, 74, 118–134.
(49) Saenger, W. Principles of Nucleic Acid Structure; Springer-Verlag:
New York, 1984.
(50) Freier, S. M.; Altmann, K.-H. The ups and downs of nucleic
acid duplex stability: structure-stability studies on chemically-
modified DNA:RNA duplexes. Nucleic Acids Res. 1997, 25, 4429–
4443.
(29) Wengel, J. Synthesis of 30-C- and 40-C-branched oligodeoxynucleo-
tides and the development of locked nucleic acid (LNA). Acc.
Chem. Res. 1999, 32, 301–310.
(30) Koshkin, A. A.; Nielsen, P.; Meldgaard, M.; Rajwanshi, V. K.;
Singh, S. K.; Wengel, J. LNA (locked nucleic acid): an RNA mimic
forming exceedingly stable LNA:LNA duplexes. J. Am. Chem. Soc.
1998, 120, 13252–13253.
(31) Fluiter, K.; Frieden, M.; Vreijling, J.; Rosenbohm, C.; De Wissel,
M. B.; Christensen, S. M.; Koch, T.; Orum, H.; Baas, F. On the in
vitro and in vivo properties of four locked nucleic acid nucleotides
incorporated into an anti-H-Ras antisense oligonucleotide. Chem-
BioChem 2005, 6, 1104–1109.
(32) Swayze, E. E.; Siwkowski, A. M.; Wancewicz, E. W.; Migawa,
M. T.; Wyrzykiewicz, T. K.; Hung, G.; Monia, B. P.; Bennett, C. F.
Antisense oligonucleotides containing locked nucleic acid improve
potency but cause significant hepatotoxicity in animals. Nucleic
Acids Res. 2007, 35, 687–700.
(33) Seth, P. P.; Siwkowski, A.; Allerson, C. R.; Vasquez, G.; Lee, S.;
Prakash, T. P.; Kinberger, G.; Migawa, M. T.; Gaus, H.; Bhat, B.;
Swayze, E. E. Design, synthesis and evaluation of constrained
methoxyethyl (cMOE) and constrained ethyl (cEt) nucleoside
analogs. Nucleic Acids Symp. Ser. 2008, 553–554.
(34) Seth, P. P.; Siwkowski, A.; Allerson, C. R.; Vasquez, G.; Lee, S.;
Prakash, T. P.; Wancewicz, E. V.; Witchell, D.; Swayze, E. E. Short
antisense oligonucleotides with novel 20-40 conformationaly re-
stricted nucleoside analogues show improved potency without
increased toxicity in animals. J. Med. Chem. 2009, 52, 10–13.
(35) AbdurRahman, S. M.; Seki, S.; Obika, S.; Yoshikawa, H.;
Miyashita, K.; Imanishi, T. Design, synthesis, and properties of
20,40-BNANC: a bridged nucleic acid analogue. J. Am. Chem. Soc.
2008, 130, 4886–4896.
(36) Prakash, T. P.; Johnston, J. F.; Graham, M. J.; Condon, T. P.;
Manoharan, M. 20-O-[2-[(N,N-Dimethylamino)oxy]ethyl]-modi-
fied oligonucleotides inhibit expression of mRNA in vitro and in
vivo. Nucleic Acids Res. 2004, 32, 828–833.
(51) Koizumi, M.; Takagi-Sato, M.; Okuyama, R.; Araki, K.; Sun, W.;
Nakai, D.; Tsutsumi, S.; Kawai, K. Direct comparison of in vivo
antisense activity of ENA oligonucleotides targeting PTP1B
mRNA with that of 20-O-(2-methoxy)ethyl-modified oligonucleo-
tides. Oligonucleotides 2006, 16, 253–262.
(52) Alul, R. H.; Singman, C. N.; Zhang, G. R.; Letsinger, R. L. Oxalyl-
CPG: a labile support for synthesis of sensitive oligonucleotide
derivatives. Nucleic Acids Res. 1991, 19, 1527–1532.
(53) Geary, R. S.; Wancewicz, E.; Matson, J.; Pearce, M.; Siwkowski,
A.; Swayze, E.; Bennett, F. Effect of dose and plasma concentra-
tion on liver uptake and pharmacologic activity of a 20-methoxy-
ethyl modified chimeric antisense oligonucleotide targeting PTEN.
Biochem. Pharmacol. 2009, 78, 284–291.
(54) Committee on Care and Use of Laboratory Animals. Guide for the
Care and Use of Laboratory Animals; DHHS Publication No. 85-23,
26; National Institutes of Health: Bethesda, MD, 1985.
(55) Yu, R. Z.; Kim, T. W.; Hong, A.; Watanabe, T. A.; Gaus, H. J.;
Geary, R. S. Cross-species pharmacokinetic comparison from
mouse to man of a second-generation antisense oligonucleotide,
ISIS 301012, targeting human apolipoprotein B-100. J. Pharmacol.
Exp. Ther. 2007, 35, 460–468.
(56) Lesnik, E. A.; Freier, S. M. What affects the effect of 20-alkoxy
modifications? 1. Stabilization effect of 20-methoxy substitutions in
uniformly modified DNA oligonucleotides. Biochemistry 1998, 37,
6991–6997.
(37) Seth, P. P.; Swayze, E. E. 6-Modified Bicyclic Nucleic Acid
Analogs. U.S. Patent 7399845, 2008; Isis Pharmaceuticals, Inc.