Development of novel aminoglycoside (NB54) with reduced toxicity and enhanced suppression of disease-causing premature stop mutations

Article abstract of DOI:10.1021/jm801640k

Nonsense mutations promote premature translational termination and represent the underlying cause of a large number of human genetic diseases. The aminoglycoside antibiotic gentamicin has the ability to allow the mammalian ribosome to read past a false-st

Full text of DOI:10.1021/jm801640k

2836
J. Med. Chem. 2009, 52, 2836–2845
Development of Novel Aminoglycoside (NB54) with Reduced Toxicity and Enhanced
Suppression of Disease-Causing Premature Stop Mutations
Igor Nudelman,‡,† Annie Rebibo-Sabbah,‡,§ Marina Cherniavsky,† Valery Belakhov,† Mariana Hainrichson,† Fuquan Chen,|
Jochen Schacht,| Daniel S. Pilch, Tamar Ben-Yosef,§ and Timor Baasov*,†
The Edith and Joseph Fischer Enzyme Inhibitors Laboratory, Schulich Faculty of Chemistry, TechnionsIsrael Institute of Technology,
Haifa 32000, Israel, Department of Genetics and The Rappaport Family Institute for Research in the Medical Sciences, Faculty of Medicine,
TechnionsIsrael Institute of Technology, Haifa 31096, Israel, Kresge Hearing Research Institute, UniVersity of Michigan, Ann Arbor,
Michigan, Department of Pharmacology, UniVersity of Medicine and Density of New Jersey, Robert Wood Johnson Medical School,
675 Hoes Lane, Piscataway, New Jersey 08854-5635
ReceiVed December 24, 2008
Nonsense mutations promote premature translational termination and represent the underlying cause of a
large number of human genetic diseases. The aminoglycoside antibiotic gentamicin has the ability to allow
the mammalian ribosome to read past a false-stop signal and generate full-length functional proteins. However,
severe toxic side effects along with the reduced suppression efficiency at subtoxic doses limit the use of
gentamicin for suppression therapy. We describe here the first systematic development of the novel
aminoglycoside 2 (NB54) exhibiting superior in vitro readthrough efficiency to that of gentamicin in seven
different DNA fragments derived from mutant genes carrying nonsense mutations representing the genetic
diseases Usher syndrome, cystic fibrosis, Duchenne muscular dystrophy, and Hurler syndrome. Comparative
acute lethal toxicity in mice, cell toxicity, and the assessment of hair cell toxicity in cochlear explants
further indicated that 2 exhibits far lower toxicity than that of gentamicin.
Introduction
not of normal termination codons, so that the expression of the
full-length, functional protein is restored to some extent. Some
aminoglycoside antibiotics exhibit such a unique ability; they
can promote readthrough of disease-causing premature stop
codons in mammalian cells and partially restore the expression
of functional proteins.3-7 The aminoglycoside gentamicin can
partially restore the expression of functional proteins in mouse
models of DMD8 and CF9 carrying nonsense mutations in the
dystrophin and cystic fibrosis transmembrane conductance
regulator (CFTR) genes, respectively. Furthermore, treatment
with gentamicin of patients harboring nonsense mutations in
CFTR or Dystrophin genes promoted partial production of the
respective missing proteins.10-12 These observations, in con-
junction with the recent indication that the enhancement of
CFTR protein synthesis from <1% to as little as 5% of normal
levels may greatly reduce the severity or eliminate the principal
manifestations of CF disease,6,13 point to the potential of this
approach for the treatment of a large group of inherited diseases
caused by nonsense mutations.
Many human genetic diseases, including cystic fibrosis (CF)a,
Duchenne muscular dystrophy (DMD), Usher syndrome (USH),
Hurler syndrome (HS), and numerous types of cancer, are caused
by nonsense mutations, single point alterations in DNA that give
rise to in-frame UAA, UAG, or UGA codons in mRNA coding
regions, leading to premature termination of translation and
eventually to truncated, nonfunctional proteins.1 According to
the Human Gene Mutation Database, nonsense mutations
represent about 12% of all mutations reported,2 and for many
of those diseases, there is presently no effective treatment.
Although gene therapy seems like a potential possible solution
for genetic disorders, there are still many critical difficulties to
be solved before this technique can be used in humans.
One alternative way to treat these diseases is to selectively
promote translational readthrough of premature stop codons, but
* To whom correspondence should be addressed. Phone: (972) 48292590.
Fax: (972) 48295703. E-mail: chtimor@tx.technion.ac.il.
†
The Edith and Joseph Fischer Enzyme Inhibitors Laboratory, Schulich
However, severe side-effects of gentamicin including renal,
auditory, and vestibular toxicities,1,7 along with the reduced
readthrough efficiency at subtoxic doses in a mouse model14
and in clinical trials,6 have limited its clinical use for this
purpose. To date, nearly all suppression experiments for the
potential use of aminoglycosides in the treatment of genetic
diseases have been performed with commercially available
drugs5 whose high toxicity and/or low potency limit or may
even preclude their use in suppression therapy in humans.
Almost no efforts have been made to optimize their activity as
stop codon readthrough inducers. Nevertheless, the proof-of-
concept experiments with gentamicin strongly indicated that
systematic search for new structures with improved termination
suppression activity and lower toxicity is required to extrapolate
the approach to the point where it can actually help patients.1,7
Faculty of Chemistry, TechnionsIsrael Institute of Technology.
‡
I. Nudelman and A. Rebibo-Sabbah contributed equally to this work.
Department of Genetics and The Rappaport Family Institute for
§
Research in the Medical Sciences, Faculty of Medicine, TechnionsIsrael
Institute of Technology.
|
Kresge Hearing Research Institute, University of Michigan.
Department of Pharmacology, University of Medicine and Density of
New Jersey, Robert Wood Johnson Medical School.
a Abbreviations: CF, cystic fibrosis; DMD, Duchenne muscular dystro-
phy; USH, type 1 Usher syndrome; HS, Hurler syndrome; CFTR, cystic
fibrosis transmembrane conductance regulator; PCDH15, protocadherin 15;
USH1, Usher syndrome; AHB, (S)-4-amino-2-hydroxybutanoyl; Boc2O, Di-
tert-butyl dicarbonate; TFA, trifluoroacetic acid; HOBT, hydroxybenzot-
riazole; DCC, N,N′-dicyclohexylcarbodiimide; BtrH, butirosin 1-N-
acyltransferase; BtrG, butirosin 1-N-γ-L-glutamyl cyclotransferase; HEK-
293, human embryonic kidney cell line; COS-7, monkey kidney cell line;
MDCK, canine kidney cell line; LC50, half-maximal lethal concentration;
LD50, half-maximal lethal dose; OHC, outer hair cells; IHC, inner hair cells;
Tm, melting temperatures; MIC, minimal inhibitory concentrations; PBS,
phosphate buffered saline; EPPS, 4-(2-hydroxyethyl)-1-piperazinepropane-
sulfonic acid.
To address the need for such compounds, we recently
developed compound 1 (also named NB30, Figure 1),15 a new
10.1021/jm801640k CCC: $40.75
2009 American Chemical Society
Published on Web 03/23/2009

NoVel Aminoglycoside (NB54)
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9 2837
may represent a more superior choice than gentamicin in
suppression therapy.
Chemistry
Design and Synthesis of the New Lead Structure
Compound 2. To further improve both the premature stop codon
suppression activity and toxicity of 1, we sought to explore the
effect of selective installation of the (S)-4-amino-2-hydroxybu-
tanoyl (AHB) group at N-1 position to yield compound 2
because of the following reasons. First, it has been shown that
the selective introduction of an AHB group at N-1 position of
several aminoglycosides is effective in lowering the acute lethal
toxicity (LD50) of the resulting derivative relative to that of the
parent molecule.17,18 For example, LD50 values in mg/kg of
ribostamycin ) 260 vs butirosin (N-1-AHB-ribostamycin) )
520; neamine LD50 ) 125 vs N-1-AHB-neamine LD50 ) 260;
dibekacin LD50 ) 71 vs arbekacin (N-1-AHB-dibekacin) LD50
) 118. Although aminoglycosides are limited in clinical use
primarily because of their oto- and nephrotoxic potential and
these toxic effects are not necessarily reflected in their acute
lethal toxicity, it has generally been recognized that aminogly-
cosides with weaker acute toxicity are prone to have less toxic
potential on the renal, auditory, and/or vestibular functions.17,19
Second, the N-1-AHB group has also significant impact on the
stop-codon-readthrough potency of an aminoglycoside. For
example, recent studies have indicated that clinical doses of
amikacin provide highly effective suppression of the human
CFTR-G542X nonsense mutation in a transgenic CF mouse.14
In contrast to amikacin, kanamycin A that differs from amikacin
by only the absence of an AHB substitution at N-1 position
does not show measurable readthrough activity5 (see also Figure
S1 of Supporting Information showing comparative in vitro
readthrough activities of amikacin and kanamycin A). Third,
numerous structural and biochemical studies have revealed the
impact of the flexible AHB side chain on the improved
antibacterial performance of aminoglycosides. For example,
X-ray analyses of the bacterial A site in a complex with
amikacin20 and some other N-1-AHB-modified aminoglyco-
sides21 have demonstrated that the AHB group can increase
binding affinity of aminoglycosides to the A site through making
additional direct contacts. We have previously shown that 1
binds to the human cytoplasmic A site sequence (Ka ) 4.7 ×
Figure 1. Chemical structures of a series of 2-deoxystreptamine-
derived (ring II) aminoglycosides, including gentamicin, paromomycin,
1, and 2 that were investigated in this study.
pseudotrisaccharide derivative of the clinical aminoglycoside
paromomycin. Compound 1 has significantly reduced cytotox-
icity in comparison to gentamicin and paromomycin.16 More-
over, we have recently demonstrated that 1 promotes dose-
dependent suppression of nonsense mutations of the PCDH15
gene, one of the underlying causes of type 1 Usher syndrome
(USH1).16 However, the suppression potency of 1 was signifi-
cantly lower relative to that of gentamicin and paromomycin.
In attempts to further improve the suppression efficiency and
reduce the toxicity of 1, in the present work, we report on the
design, synthesis, and comparative evaluation of the second-
generation lead structure compound 2 (also named NB54, Figure
1). We show that compound 2 has significantly reduced cell,
cochlear, and acute toxicities and has substantially higher stop-
codon readthrough potency in both in vitro and ex vivo studies
than those of gentamicin. The data indicate that compound 2
Scheme 1. Chemical Transformation of Paromamine 3 into 2

2838 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9
Nudelman et al.
103 M-1) with about 100-fold weaker affinity than its parent
paromomycin (Ka ) 3.9 × 105 M-1
)
22 and exhibits about three
times weaker suppression potency than paromomycin.15 On the
basis of these cumulative data, we anticipated that the attachment
of an AHB group at N-1 position of 1 could improve the binding
affinity of the resulting derivative to the human cytoplasmic A
site and probably improve its readthrough activity and reduce
its toxicity.
The synthesis of compound 2 was accomplished in nine
chemical steps from the readily available paromamine 3 as
shown in Scheme 1. Regioselective differentiation of the three
amino groups of paromamine 3 was achieved by employing
metal-mediated chelation methodology.23 Thus, treatment of 3
with Zn(OAc)2 and Boc2O afforded the selectively N-1-Boc-
protected paromamine (40% isolated yield), which after azida-
tion (TfN3) gave the diazido derivative 4. Treatment with TFA
to remove the Boc group and the reaction of the resulting N-1
amine with (S)-2-hydroxy-4-azidobutyric acid (HOBT, DCC,
Et3N) was followed by treatment with methylamine to afford
the selectively N-1-acylated product 5 in 93% yield for three
steps. Regioselective acetylation of 5 with Ac2O at low
temperature gave the product 6 in 75% isolated yield. Glyco-
sylation of 6 with the trichloroacetimidiate donor 724 under the
Lewis acid conditions furnished the desired pseudotrisaccharide
8 in 76% isolated yield, exclusively as a ꢀ-anomer at the newly
generated glycosidic linkage. Two sequential deprotection steps
on 8: treatment with methylamine to remove all the ester
protections, and the Staudinger reaction to convert azides to
the corresponding amines, afforded 2 in 78% isolated yield (for
two steps).
This synthetic scheme was used to generate multigram
quantities of compound 2 for various biological studies reported
here. To further advance the synthesis of 2, we have recently
developed a combined chemical-enzymatic strategy for selec-
tive installation of the N-1-AHB group on various unprotected
aminoglycosides by using recombinant BtrH and BtrG enzymes
of butirosin biosynthesis in combination with a synthetic acyl
donor.25 Using this methodology, we quantitatively converted
compound 1 to 2 in several milligrams scale by performing two
enzymatic steps sequentially without purification of the inter-
mediate products. Further investigation to scale-up the produc-
tion of 2 by this methodology is currently underway.
Figure 2. In vitro stop codon suppression levels induced by compound
2 (b), gentamicin (9), paromomycin (0), and compound 1 (O) in a
series of nonsense mutation context constructs representing various
genetic diseases (shown in parenthesis): (A) p2luc, (B) R3381X (DMD),
(C) R3X (USH1), (D) R245X (USH1), (E) G542X (CF), (F) W1282X
(CF), (G) Q70X (HS), (H) W402X (HS). DNA fragments were cloned
between BamHI and SacI restriction sites of the p2luc vector, and the
obtained constructs were transcribed and translated using TNT quick
coupled transcription/translation system. The amount of the translated
products was evaluated using the dual luciferase reporter assay system,
and the suppression level was calculated as described previously.27 The
results are averages of at least three independent experiments.
genes of the p2luc vector.26,27 The resulting eight nonsense
mutation-carrying plasmids, including p2luc and seven disease-
specific constructs, were transcribed and translated using the
TNT Reticulocyte Lysate Quick Coupled Transcription/Transla-
tion System in the presence of varying concentrations of
compounds 1 and 2, gentamicin and paromomycin, and the stop
codon suppression efficiency was calculated as previously
reported27 (Figure 2).
From the observed data, it can be seen that all the tested
aminoglycosides induced readthrough, although the efficacy was
substantially different between the different constructs and the
compounds tested. Of the four aminoglycosides tested, com-
pound 2 induced the highest level of readthrough, followed by
gentamicin, paromomycin, and 1. In general, UGA C tetracodon
sequence showed the best translational readthrough in the
presence of all four aminoglycosides tested, with UGA G and
Results
Compound
2 Induces more Effective Suppression of
PCDH15, CFTR, Dystrophin, and IDUA Nonsense Mutations
than Gentamicin, Paromomycin, and Compound 1 in Vitro.
Previous studies have shown that aminoglycosides suppress
various stop codons with dramatically different efficiencies
(UGA > UAG > UAA) and that the effectiveness of suppression
is further dependent upon the identity of the first nucleotide
immediately downstream from the stop codon (C > U > A g
G) and the local sequence context around the stop codon.5,26
Therefore, our pilot study to evaluate the readthrough efficiency
of compound 2 was performed on a variety of constructs
containing different sequence contexts around premature stop
codons derived from the PCDH15, CFTR, dystrophin, and IDUA
genes that underlie USH1, CF, DMD, and HS, respectively. We
chose several prevalent nonsense mutations that are specific to
these diseases; R3X and R245X for USH1, G542X and
W1282X for CF, R3381X for DMD, and Q70X and W402X
for HS. DNA fragments containing the nonsense mutation or
the corresponding wild type codon, in their natural context, were
cloned in frame between the Renilla and the Firefly luciferase

NoVel Aminoglycoside (NB54)
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9 2839
experimental conditions ex vivo (data not shown). Because of
their relatively low cell toxicity, compounds 1 and 2 can
however be used at higher dosages than gentamicin and
paromomycin. Therefore, the maximal suppression levels of
compounds 1 and 2 were obtained at significantly higher
concentrations than those of gentamicin and paromomycin.
Nevertheless, with a maximal suppression level of 5.25%,
compound 2 is 1.9-fold more effective than compound 1 (2.75%
suppression), 3.2-fold more effective than paromomycin (1.62%
suppression), and 2.8-fold more effective than gentamicin
(1.86% suppression).
Compounds 1 and 2 Exhibit Significantly Reduced
Acute and Cell Toxicities Than Those of Gentamicin and
Paromomycin. Cell toxicity of compound 2 was tested in three
kidney-derived cell lines: HEK-293 (human embryonic kidney),
COS-7, and MDCK (canine kidney). The measured LC50 values
of 2 in comparison to those previously reported by us for
gentamicin, paromomycin, and compound 1, under identical
conditions,16 are given in Table 1. The LC50 values obtained
for compound 2 were 2-12-fold higher than LC50 values of
the clinically used aminoglycosides gentamicin and paromo-
mycin in all three cell lines tested.
Figure 3. Ex vivo suppression of the PCDH15-R3X nonsense mutation
by 1, 2, paromomycin, and gentamicin. The p2luc plasmid harboring
the R3X nonsense mutation (containing four upstream and six
downstream PCDH15-flanking codons) inserted in frame between the
renilla luciferase and firefly luciferase genes was transfected into COS-7
cells, and addition of tested compounds was performed after 5 h.
Luciferase activity was determined using the dual luciferase reporter
assay system (Promega). Stop codon readthrough was calculated as
described previously.27 The results are averages of at least three
independent experiments.
It is notable that the acute lethal toxicity value (LD50) reported
for an aminoglycoside often differs considerably between
different laboratories.17 Such discrepancy between different
reports could be explained by several factors including the strain,
sex, and age of the animals, the volume and rate of injection,
and the pH of the aminoglycoside antibiotic solution adminis-
tered to the animals.17 To avoid such uncertainties, the compara-
tive acute intravenous toxicity values of 1, 2, gentamicin, and
paromomycin were determined in mice under the same experi-
mental conditions and the observed data are shown in Table 1.
The observed data indicate that of the four aminoglycosides
tested, compound 2 is the least toxic compound. With the LD50
value of 500 mg/kg, 2 is approximately 8-fold less toxic than
gentamicin (LD50 ) 60 mg/kg), 6-fold less toxic than paromo-
mycin (LD50 ) 80 mg/kg), and 2-fold less toxic than compound
1 (LD50 ) 240 mg/kg). In addition to compound 2, compound
1 also demonstrated substantially reduced acute toxicity relative
to the clinical aminoglycosides gentamicin and paromomycin.
Surprisingly, the observed 2-fold difference in LD50 values
between compounds 1 and 2 is similar to that observed between
ribostamycin and butirosin (LD50 values of 260 and 520 mg/
kg, respectively),17 suggesting that the presence of the N-1-
AHB group could be responsible for the acute toxicity attenu-
ation of compound 2 relative to that of compound 1. These data
are consistent with the earlier reported structure-toxicity
relationship of various aminoglycosides,17 demonstrating that
the decrease of a total charge and/or installation of N1-AHB
side chain strongly impact the acute toxicity attenuation of an
aminoglycoside. Furthermore, because the acute toxicity data
of aminoglycosides were found to be well correlated to their
neuromuscular blocking effects,28 we suggest that the reduction
in the total positive charge of 2 and 1 (+4) versus that of
gentamicin and paromomycin (+5) is linked to the acute toxicity
attenuation due to the subsequent reduced effects on neuro-
muscular blocking. This suggestion is supported by earlier
studies, which demonstrated that the total charge of an ami-
noglycoside correlates with the blocking potency29,30 and that
coadministration of Ca2+ antagonizes both acute toxicity and
neuromuscular blocking effects induced by aminoglycosides.31
UGA A tetracodons showing lower levels of readthrough.
Likewise, the UAG C tetracodon (Q70X) readthrough was less
efficient than those of the parallel UGA C tetracodons (R3X
and p2luc). Inhibition of translation was monitored as the ratio
of Renilla luciferase activity with and without the presence of
aminoglycosides. In all the eight constructs tested, the highest
concentration of gentamicin and compound 2 resulted in
approximately 50% reduction in overall translation, whereas the
effects of paromomycin and compound 1 on translation were
significantly milder, resulting in approximately 40% and 30%
reduction in overall translation, respectively.
Compound 2 Induces Highly Effective Suppression of
the PCDH15-R3X Nonsense Mutation in a Mammalian
Cell Line. The dual luciferase reporter plasmid system that we
used for the in vitro study described above was also employed
to measure the effect of aminoglycosides on stop codon
readthrough in tissue culture cells ex vivo. The ability of this
dual luciferase reporter system to control for differences in
mRNA levels between normal and nonsense-containing se-
quences provides a distinct advantage compared with single
reporter or direct protein analysis.26,27 A comparative study was
performed on the construct harboring the PCDH15-R3X non-
sense mutation of USH1 in a monkey kidney cell line (COS-7)
incubated with varying concentrations of 1, 2, gentamicin, and
paromomycin (Figure 3). To ensure over 80% cell viability for
each of the tested compounds, the maximal dosage for each
compound was estimated from its respective half-maximal lethal
concentration value (LC50 values) in COS-7 cells (Table 1). The
following maximal dosages of aminoglycosides were used:
gentamicin 0.25 mg/mL (0.38 mM), paromomycin 0.5 mg/mL
(0.70 mM), compound 1 1 mg/mL (1.78 mM), and compound
2 1 mg/mL (1.53 mM).
The observed efficiency on a weight basis of aminoglycoside-
induced readthrough of PCDH15-R3X nonsense mutation was
in the order compound 2 > gentamicin g paromomycin >
compound 1, a very similar trend to that observed for the
suppression of the same stop mutation in vitro (Figure 3 and
Figure 2C). Virtually the same order of readthrough efficiency
was also observed for the PCDH15-R245X nonsense mutation
suppression by this set of aminoglycosides under the same
Because both compounds 1 and 2 have the same total positive
charge but differ only by the presence of an AHB side chain, it
is likely that due to the presence of a flexible AHB moiety the

2840 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9
Nudelman et al.
Table 1. Comparative Cell Toxicity, Acute Intravenous Toxicity, Antibacterial Activity, and Prokaryotic Translation Inhibition Data of Gentamicin,
Paromomycin, 1, and 2a
cell toxicity LC50 (mM)b
acute toxicity
LD50 (mg/kg)c
prokaryotic system
antibacterial
translation
aminoglycoside
HEK-293
COS-7
MDCK
activity, MIC (µM)d
inhibition, IC50 (nM)e
gentamicin
paromomycin
compd 1
1.1 ( 0.1
1.2 ( 0.2
7.4 ( 1.4
2.8 ( 0.7
0.75 ( 0.1
1.4 ( 0.2
10.8 ( 2.8
9.3 ( 1.0
0.78 ( 0.1
1.5 ( 0.1
11.5 ( 1.9
3.3 ( 0.3
60
80
240
500
6
22
790
588
20 ( 6
56 ( 6
415 ( 80
159 ( 13
compd 2
a In all biological tests, all tested aminoglycosides were in their sulfate salt forms. The concentrations reported refer to that of the free amine form of each
aminoglycoside. b Aminoglycosides-induced cell toxicity was calculated as a ratio between the number of living cells in cultures grown in the presence of
the tested compound versus cultures grown without compound. The half-maximal lethal concentration (LC50) values were obtained from fitting
concentration-response curves to the data of at least two independent experiments by using GraFit 5 software. HEK-293, human embryonic kidney cells;
COS-7, monkey kidney cells; MDCK, canine kidney cells. c LD50 refers to a median lethal dose. d The MIC values were determined against Escherichia coli
R477-100 strain by using the double-microdilution method, with 384 µg/mL as starting concentration of each tested compound. All the experiments were
performed in duplicate, and analogous results were obtained in three different experiments. e Prokaryotic translation inhibition was quantified in coupled
transcription/translation assays as previously described by us.22 The luminescence was measured immediately after the addition of 50 µL luciferase assay
reagent (Promega), and light emission was recorded with Victor3 plate reader (Perkin-Elmer). The half-maximal concentration (IC50) values were obtained
from fitting concentration response curves to the data of at least two independent experiments by using GraFit 5 software.
interaction of compound 2 with steps that control acetylcholine
release at the level of presynaptic structures is less efficient than
that of compound 1. Indeed, numerous earlier studies demon-
strated that aminoglycosides with the same total charge but with
different structures interfere differently with the steps of calcium-
mediated acetylcholine release at the level of presynaptic
structures and that this interaction is the main cause of the
neuromuscular blockage induced by aminoglycosides and their
subsequent toxicity.28,32,33
correspondingly enhanced affinity of 2 for the eukaryotic
ribosome. As a first step to assess the veracity of this hypothesis,
we compared the impacts of 2 and 1 on the thermal stability of
an RNA hairpin construct that models the human cytoplasmic
rRNA A-site.36 Figure 5 shows the UV melting profiles of the
human cytoplasmic rRNA A-site model oligonucleotide in the
absence and presence of 1 and 2 (at a [drug]/[RNA] ratio of 5).
These UV melting profiles were analyzed as described in the
Experimental Section to derive melting temperatures (Tm),
defined as the temperature at which half-the RNA molecules
are single-stranded and the other half are in duplex form. Note
that compound 2 binding enhances the thermal stability of the
host RNA to a greater extent than compound 1 (∆Tm ) 9.7 and
4.5 °C for compounds 2 and 1, respectively). In general, the
relative extents to which ligands enhance the thermal stability
of a host nucleic acid correlate with the relative affinities of
the ligands for the nucleic acid.37 Thus, our UV melting results
are consistent with 2 binding the human cytoplasmic rRNA
A-site with a greater affinity than 1. It is likely that this enhanced
affinity contributes, at least in part, to the observed enhanced
stop codon readthrough activity of compound 2 relative to
compound 1.
Compounds 1 and 2 Exhibit Significantly Lower Ototoxic
Potential than Gentamicin. The major irreversible side effect of
aminoglycosides is ototoxicity (loss of hearing or balance), with
an incidence of auditory or vestibular disturbances around
8-20% for a short course of therapy34 but higher in long-term
treatment, as would be needed in suppression therapy. The
cellular basis of ototoxicity is the permanent destruction of hair
cells in the inner ear.35 Organ cultures of the early postnatal
mouse are frequently used in research on ototoxic agents and
their mechanisms. The pattern of toxicity is similar to the in
vivo action of aminoglycosides: preferential loss of outer hair
cells in a base-to-apex fashion that is characteristic of ami-
noglycoside damage to the cochlea in both human and experi-
mental animals.35 The advantage of the preparation over the in
vivo condition, however, is an accelerated time course of hair
cell loss, making explants an excellent model to screen for
ototoxicity.
For the assessment of ototoxicity potential, compounds 1, 2,
and gentamicin were tested with cochlear explants (Figure
4A-E). Staining for F-actin revealed the organized outline of
the array of three rows of outer hair cells and one row of inner
hair cells in segments from the basal part of the cochlea. In the
presence of 0.1 mM compound 1 (Figure 4A) or 0.1 mM
compound 2 (Figure 4C), the structure of the epithelium
remained normal and was indistinguishable from controls. At
drug concentrations of 1 mM (Figure 4B,D), only few areas of
outer hair cell loss (arrows) were seen and inner hair cells were
normal. In contrast, hair cell loss was almost complete in
the presence of 0.2 mM gentamicin (Figure 4E). Virtually the
same conclusions can be drawn from an examination of the
middle part and apical parts of the cochlea (Figure S2 of
Supporting Information), demonstrating that both 1 and 2 have
significantly lower ototoxic potential than that of gentamicin.
Compound 2 Inhibits Prokaryotic Protein Translation
with Significantly Lower Potency and Exhibits Markedly
Reduced Bactericidal Activity than those of Gentamicin
and Paromomycin. Recently we have shown that compound
1 is about 10-fold weaker inhibitor of prokaryotic translation
than gentamicin and paromomycin22 and exhibits almost no
bactericidal activity against both Gram-negative and Gram-
positive bacteria.15 To assess whether compound 2 retains
similar properties, we conducted comparative translation inhibi-
tion of 1, 2, gentamicin, and paromomycin in a prokaryotic
system by using an in vitro luciferase assay (Table 1). The
measured half-maximal inhibitory concentration (IC50) values
show that the efficacy with which both 1 and 2 inhibit the
prokaryotic ribosome is significantly lower than that of gen-
tamicin and paromomycin. These data are in accordance with
the observed antibacterial data of this set of compounds (Table
1). Thus, while both gentamicin and paromomycin exhibit
excellent antibacterial activities against Escherichia coli
(R477-100) with the minimal inhibitory concentrations (MIC)
of 6 and 22 µM, respectively, both 2 and 1 lack significant
antibacterial activity (MIC values of 588 and 790 µM, respec-
Compound 2 Enhances the Thermal Stability of a
Human Cytoplasmic rRNA A-Site Model Oligonucleotide
to a Greater Extent Than Compound 1. The improved
readthrough activity of 2 over that of 1 might reflect a

NoVel Aminoglycoside (NB54)
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9 2841
Figure 5. UV melting profiles for a human cytoplasmic rRNA A-site
model oligonucleotide in the absence (filled circles) and presence of
compound 1 (open circles) and compound 2 (filled triangles) at a [drug]/
[RNA] ratio of 5. For clarity of presentation, the melting curves were
normalized by subtraction of the upper and lower baselines to yield
plots of fraction single strand (R) versus temperature.38 Solution
conditions were 10 mM EPPS (pH 7.0) and 10 mM NaCl.
paromomycin. This finding places compound 2 on the top
among all the natural and/or synthetic aminoglycosides reported
to date for the potential use in translational therapy.
The most compelling evidence for the superior readthrough
efficiency of compound 2 over that of compound 1, gentamicin,
and paromomycin was demonstrated in vitro on seven different
DNA fragments derived from the mutant PCDH15, CFTR,
Dystrophin, and IDUA genes carrying nonsense mutations and
representing the underlying causes for the genetic diseases
USH1, CF, DMD, and HS, respectively (Figure 2). Similar
advantage of 2 was also demonstrated ex vivo in cultured cell
lines (Figure 3). The presence of the flexible N-1-AHB group
in compound 2 most likely contributes to its elevated readthrough
efficiency compared to that of its parent compound 1. This is
consistent with previous reports showing that amikacin (N-1-
AHB-kanamycin A) suppresses premature stop codons more
efficiently than kanamycin A.5,14 Here we show that compound
2 binds the human cytoplasmic rRNA A-site sequence with a
greater affinity than compound 1 (Figure 5), suggesting that the
enhanced readthrough activity of 2 relative to 1 is due, at least
in part, to a correspondingly enhanced affinity for the rRNA
A-site. The impact of N-1-AHB group on the elevated
readthrough activity of 2 was coupled with a lower toxicity
profile of 2 (Table 1). Comparative acute lethal toxicity in mice,
cell toxicity in three different kidney-derived cell lines, and the
assessment of hair cell toxicity in cochlear explants (Figure 4)
clearly indicated that compound 2 is one of the least toxic
aminoglycoside derivatives reported to date.
Even though many avenues of research have been pursued
during the past few decades in an attempt to alleviate the
aminoglycoside-induced toxicity to mammals,1,7 few have been
implemented into standard clinical use other than changes in
administration schedule. Currently, only a limited number of
aminoglycosides, including gentamicin, amikacin, and tobra-
mycin, are in clinical use as antibiotics for internal administra-
tion in humans. Among these, tobramycin does not have
suppression activity, and gentamicin is the only one tested in
clinical trials.10-12 Some recent studies in cultured cells and in
animal models have shown that due to its relatively low toxicity,
amikacin14 may represent an alternative to gentamicin for
translational therapy. However, no clinical trials with amikacin
have yet been reported, probably because of its significantly
lower readthrough potency (over 10-fold lower) as compared
Figure 4. Drug-induced hair cell loss in cochlear explants. Explants
of the mouse organ of Corti were incubated with drugs and stained for
actin as described in Experimental Section. Sections of the basal part
are shown. (A) 0.1 mM compound 1, (B) 1 mM compound 1, (C) 0.1
mM compound 2, (D) 1 mM compound 2, and (E) 0.2 mM gentamicin.
A and C show essentially normal morphology, arrows in B and D point
to small areas of missing outer hair cells, and cell loss is almost
complete in E. “OHC” indicates outer, “IHC” inner hair cells. Size bar
indicates the increment of 40 µm.
tively). Similar correlation between prokaryotic antitranslational
activity and MIC values in E. coli has previously been
reported.39
Discussion
A major concern that arises with the potential use of
aminoglycosides for “translational therapy” is their toxicity to
the organism, preventing their repeated long-term administration
required for the treatment of genetic diseases.7 The results of
this study show that compound 2, the newly developed
aminoglycoside, exhibits several-fold greater suppression
activity and far lower toxicity than those of gentamicin and

2842 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9
Nudelman et al.
to that of gentamicin5,14 (see Figure 2 and Figure S1 of
Supporting Information). Furthermore, even though amikacin
is less toxic than gentamicin and tobramycin,17 its acute
intravenous toxicity in mice is significantly higher (LD50 ) 300
mg/kg)17 than that of compound 2 (LD50 ) 500 mg/kg, Table
1).
mL) and DMF (150 mL), and the mixture was stirred for 12 h at
room temperature. A solution of di-tert-butyldicarbonate (9.81 g,
45 mmol) in DMF (20 mL) was added to the reaction mixture over
a time period of 30 min, and the mixture was stirred for an
additional 24 h. The reaction progress was monitored by TLC
[CH2Cl2/MeOH/H2O/MeNH2 (33% solution in EtOH), 10:15:6:15].
The reaction mixture was diluted with MeOH (250 mL) and loaded
onto 50 mm × 300 mm ion-exchange column (Amberlite CG50,
H+ form). The column was first washed extensively (about 10
column volumes) with a mixture MeOH/H2O (60:40), followed by
elution with the mixture of MeOH/H2O/NH4OH(25% solution in
water) (80:15:5) to afford the desired N-1-Boc derivative of
In summary, the newly developed aminoglycoside compound
2 exhibits both appreciably higher suppression efficiency and
lower toxicity than those of gentamicin. This achievement has
several important implications. First, these results prove the
principle that the mammalian ribosome can be effectively
targeted by an aminoglycoside-based structure for improving
suppression efficiency and reducing toxicity.7,15,22 Second, the
observed inability of 1 and 2 to show significant antibacterial
activity along with their decreased prokaryotic ribosome speci-
ficity are striking and remain to be further investigated. Of
greatest concern is whether these data are linked or not to the
observed reduced cell- and ototoxicity potential of 1 and 2. This
notion is supported by the fact that the mammalian mitochon-
drial protein synthesis machinery is very similar to the prokary-
otic machinery40 and that the aminoglycoside-induced ototox-
icity may, at least in part, be connected to drug-mediated
dysfunction of the mitochondrial ribosome.41,42 Third, the
observed relatively low toxicity and high degree of potency of
compound 2 in targeting all seven different nonsense constructs
underlying USH1, CF, DMD, and HS support the feasibility of
testing this novel aminoglycoside in treating these diseases in
animal and human subjects. Finally, this study provides a new
direction for the development of novel aminoglycoside-based
structures by means of optimizing drug-induced suppression
efficacy and toxicity; further progress in this direction may offer
promise for the treatment of many genetic diseases caused by
nonsense mutations.
1
paromamine in 40% yield (5.03 g). H NMR (500 MHz, D2O):
“Ring I” δH 2.70 (dd, 1H, J1 ) 3.5, J2 ) 7.0 Hz, H-2), 3.26 (dd,
1H, J1 ) J2 ) 9.5 Hz, H-4), 3.43 (dd, 1H, J1 ) J2 ) 9.5 Hz, H-3),
3.62 (dd, 1H, J1 ) 4.0, J2 ) 12.5 Hz, H-6′), 3.69 (dt, 1H, J1 ) 2.0,
J2 ) 10.0 Hz, H-5), 3.72 (dd, 1H, J1 ) 4.0, J2 ) 12.5 Hz, H-6),
5.14 (d, 1H, J ) 4.0 Hz, H-1); “Ring II” δH 1.18 (ddd, 1H, J1 )
J2 ) J3 ) 12.5 Hz, H-2ax), 2.51 (dt, 1H, J1 ) 4.5, J2 ) 12.5 Hz,
H-2eq), 2.73-2.78 (m, 1H, H-3), 3.15 (dd, 1H, J1 ) J2 ) 9.5 Hz,
H-4), 3.16 (dd, 1H, J1 ) J2 ) 10.0 Hz, H-6), 3.29-3.37 (m, 1H,
H-1), 3.58 (dd, 1H, J1 ) J2 ) 10.0 Hz, H-5). The additional peaks
in the spectrum were identified as follows: δH 1.30 (s, 9H, Boc).
13C NMR (125 MHz, D2O) “Ring I” δC 56.9 (C-2), 62.4 (C-6),
71.6 (C-4), 74.7 (C-5), 77.7 (C-3), 102.6 (C-1); “Ring II” δC 36.3
(C-2), 50.9 (C-3), 52.0 (C-1), 75.3 (C-5), 76.4 (C-6), 88.6 (C-4).
The additional peaks in the spectrum were identified as follows:
δC 29.4 (Boc, 3C), 159.6 (Boc, CO). MALDI-TOF MS calcd for
C17H33N3O9Na ([M + Na]+ m/e 446.2; measured m/e 446.5).
The product from the above step (44.3 g, 0.1 mol) was converted
to the corresponding 3,2′-diazido derivative by following the
published procedure,43 using Tf2O (110 mL, 0.66 mol) and NaN3
(100 g, 1.53 mol). The reaction progress was monitored by TLC
(EtOAc/MeOH 95:5), which indicated completion after 8 h. The
crude product was purified by flash chromatography (EtOAc/MeOH
1
95:5) to yield the title compound 4 (42.5 g, 90% yield). H NMR
(500 MHz, MeOD): “Ring I” δH 2.88-2.93 (m, 1H, H-2), 3.23
(dd, 1H, J1 ) J2 ) 9.0 Hz, H-4), 3.49 (d, 2H, J1 ) 3.5 Hz, H-6,
H-6′), 3.59-3.63 (m, 2H, H-3, H-5), 5.54 (d, 1H, J ) 3.5 Hz, H-1);
“Ring II” δH 1.08-1.16 (m, 1H, H-2ax), 1.96 (dt, 1H, J1 ) 4.0, J2
) 12.5 Hz, H-2eq), 2.88-2.93 (m, 1H, H-6), 3.09-3.16 (m, 1H,
H-1), 3.12-3.18 (m, 1H, H-3), 3.18 (dd, 1H, J1 ) J2 ) 9.5 Hz,
H-4), 3.23 (dd, 1H, J1 ) J2 ) 9.0 Hz, H-5). The additional peaks
in the spectrum were identified as follows: δH 1.13 (s, 9H, Boc).
13C NMR (125 MHz, MeOD) “Ring I” δC 63.8 (C-6), 66.5 (C-2),
73.1 (C-4), 74.5 (C-3), 75.6 (C-5), 101.2 (C-1); “Ring II” δC 36.2
(C-2), 53.5 (C-1), 62.9 (C-3), 77.6 (C-6), 79.1 (C-5), 83.1 (C-4).
The additional peaks in the spectrum were identified as follow: δC
31.1 (Boc, 3C), 160.0 (Boc, CO). MALDI-TOF MS calcd for
C17H29N7O9 K ([M + K]+) m/e 514.2; measured m/e 514.4).
2′,3-Diazido-1-N-[(S)-4-azido-2-hydroxy-butanoyl]paro-
mamine (5). Compound 4 (3.0 g, 6.31 mmol) was dissolved in a
mixture of trifluoroacetic acid (12 mL) and dichloromethane (30
mL). The reaction progress was monitored by TLC (CH2Cl2/MeOH
4:1), which indicated completion after 1 h. The reaction mixture
was concentrated to dryness under reduced pressure. The resulting
crude was dissolved in a mixture of Et3N (10 mL) and DMF (10
mL) and cooled to -20 °C. In a separate flask, (S)-2-hyroxy-4-
azidobutyric acid (3.94 g, 31.55 mmol) was dissolved in anhydrous
DMF (30 mL) and cooled to 0 °C. To the cold solution, DCC (7.10
g, 34.46 mmol) and HOBT (4.72 g, 34.96 mmol) were added and
the resulted mixture was stirred at 0 °C for about 1 h. This mixture
was carefully added by syringe to the cold solution of the amine at
-20 °C. The reaction was stirred at -20 °C for 1 h and then allowed
to warm to room temperature for an additional 1 h. Thereafter, the
mixture was treated with a solution of MeNH2 (33% solution in
EtOH, 30 mL), and the reaction progress was monitored by TLC
(CH2Cl2/MeOH 7:3). After completion of the reaction (about 8 h),
the mixture was concentrated and purified by flash chromatography
(MeOH/CH2Cl2 1:9) to provide the titled compound 5 (3.0 g, 93%
yield). 1H NMR (500 MHz, MeOD): “Ring I” δH 3.12 (dd, 1H, J1
Experimental Section
General. Paromomycin, amikacin, kanamycin A, and gentamicin
were purchased from Sigma. All other chemicals and biochemicals,
unless otherwise stated, were obtained from commercial sources.
In all biological tests, all the tested aminoglycosides were in their
sulfate salt forms [Mw (g/mol) of the sulfate salts were as follow:
paromomycin, 713.7; gentamicin, 653.2; amikacin, 781.8; kana-
mycin A, 680.6; compound 1, 563.0; compound 2, 652.8]. Purity
of compounds 1 and 2 was determined by using HPLC-ESI-MS
analysis, which indicated 98.69% and 95.55% purity, respectively
(see Supporting Information).
General Methods. NMR spectra (including 1H, 13C, DEPT, 2D-
COSY, 1D TOCSY, HMQC, HMBC) were routinely recorded on
a Bruker Avance 500 spectrometer, and chemical shifts reported
(in ppm) are relative to internal Me4Si (δ ) 0.0) with CDCl3 as
the solvent and to HOD (δ )4.63) with D2O as the solvent. 13C
NMR spectra were recorded on a Bruker Avance 500 spectrometer
at 125.8 MHz, and the chemical shifts reported (in ppm) relative
to the residual solvent signal for CDCl3 (δ ) 77.00) or to external
sodium 2,2-dimethyl-2-silapentane sulfonate (δ ) 0.0) for D2O as
the solvent. Mass spectra analysis were obtained either on a Bruker
Daltonix Apex 3 mass spectrometer under electron spray ionization
(ESI) or by a TSQ-70B mass spectrometer (Finnigan Mat).
Reactions were monitored by TLC on Silica Gel 60 F254 (0.25 mm,
Merck), and spots were visualized by charring with a yellow
solution containing (NH4)6Mo7O24 · 4H2O (120 g) and (NH4)2-
Ce(NO3)6 (5 g) in 10% H2SO4 (800 mL). Flash column chroma-
tography was performed on Silica Gel 60 (70-230 mesh). All
reactions were carried out under an argon atmosphere with
anhydrous solvents unless otherwise noted.
2′,3-Diazido-1-N-[(tert-butoxy)carbonyl]paromamine (4). Zn(OAc)2
(14.75 g, 66 mmol) was added to a stirred solution of paromamine
(compound 3 in its free base form, 9.69 g, 30 mmol) in H2O (30

NoVel Aminoglycoside (NB54)
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9 2843
) 4.0, J2 ) 10.0 Hz, H-2), 3.45 (dd, 1H, J1 ) 9.5, J2 ) 10.5 Hz,
H-4), 3.76-3.83 (m, 2H, H-6, H-6′), 3.92 (dd, 1H, J1 ) 9.0, J2 )
10.5 Hz, H-3), 3.97-4.00 (m, 1H, H-5), 5.65 (d, 1H, J ) 3.5 Hz,
H-1); “Ring II” δH 1.55 (ddd, 1H, J1 ) J2 ) J3 ) 12.5 Hz, H-2ax),
2.18 (dt, 1H, J1 ) 4.0, J2 ) 13.0 Hz, H-2eq), 3.36 (dd, 1H, J1 )
J2 ) 9.0 Hz, H-6), 3.42-3.48 (m, 1H, H-3), 3.50 (dd, 1H, J1 ) J2
) 9.0 Hz, H-4), 3.54 (dd, 1H, J1 ) J2 ) 9.0 Hz, H-5), 3.77-3.83
(m, 1H, H-1). The additional peaks in the spectrum were identified
as follows: 1.82-1.88 (m, 1H, H-9), 2.01-2.07 (m, 1H, H-9), 3.46
(dd, 2H, J1 ) 6.5 J2 )7.5, H-10), 4.16 (dd, 1H, J1 ) 4.0, J2 ) 8.5,
H-8). 13C NMR (125 MHz, MeOD) “Ring I” δC 61.0 (C-6), 63.6
(C-2), 70.6 (C-4), 71.3 (C-3), 72.8 (C-5), 98.3 (C-1); “Ring II” δC
32.3 (C-2), 49.1 (C-1), 60.2 (C-3), 74.6 (C-6), 77.4 (C-5), 79.7
(C-4). The additional peaks in the spectrum were identified as
follows: 33.6 (C9), 47.4 (C10), 69.0 (C8), 175.7 (C7). MALDI-
TOF MS calcd for C16H26N10O9 K ([M + K]+) m/e 541.2; measured
m/e 541.1).
(d, 1H, J ) 4.0 Hz, H-1); “Ring II” δH 1.47 (ddd, 1H, J1 ) J2 )
J3 ) 12.5 Hz, H-2ax), 2.50 (dt, 1H, J1 ) 4.0, J2 ) 13.0 Hz, H-2eq),
3.56-3.58 (m, 1H, H-3), 3.72 (dd, 1H, J1 ) 8.5, J2 ) 9.5 Hz,
H-4), 3.99 (dd, 1H, J1 ) 8.5, J2 ) 9.5 Hz, H-5), 4.01-4.08 (m,
1H, H-1), 4.91 (dd, 1H, J1 ) 9.5, J2 ) 10.5 Hz, H-6), 6.64 (d, 1H,
J ) 8.5 Hz, NH); “Ring III” δH 3.57 (dd, 1H, J1 ) 6.0, J2 ) 13.0
Hz, H-5′), 3.64 (dd, 1H, J1 ) 3.0, J2 ) 13.0 Hz, H-5), 4.50-4.55
(m, 1H, H-4), 5.49 (dd, 1H, J1 ) 5.0, J2 ) 7.0 Hz, H-3), 5.62 (dd,
1H, J1 ) 1.0, J2 ) 5.0 Hz, H-2), 5.68 (d, 1H, J ) 1.0 Hz, H-1).
The additional peaks in the spectrum were identified as follows:
2.00-2.15 (m, 2H, H-9), 2.04 (s, 3H, Ac), 2.09 (s, 6H, 2Ac), 2.20
(s, 3H, Ac), 2.23 (s, 3H, Ac), 3.35 (t, 2H, J ) 7.0, H-10), 5.16 (dd,
1H, J1 ) 5.0, J2 ) 7.0, H-8), 7.33 (t, 2H, J ) 8.0, Bz), 7.43 (t, 2H,
J ) 8.0, Bz), 7.51-7.54 (m, 1H, Bz), 7.56-7.60 (m, 1H, Bz), 7.85
(dd, 2H, J ) 1.0, 7.5, Bz), 7.94 (dd, 2H, J ) 1.0, 7.5, Bz). 13C
NMR (125 MHz, CDCl3) “Ring I” δC 61.6 (C-2), 61.8 (C-6), 68.1
(C-5), 68.2 (C-4), 70.7 (C-3), 96.8 (C-1); “Ring II” δC 32.1 (C-2),
48.4 (C-1), 58.5 (C-3), 73.5 (C-6), 77.9 (C-4), 80.0 (C-5); “Ring
III” δC 52.7 (C-2), 71.5 (C-3), 74.7 (C-2), 80.1 (C-4), 107.4 (C-
1). The additional peaks in the spectrum were identified as follows:
20.6-20.9 (Ac, 5C), 30.5 (C-9), 47.1 (C-10), 70.9 (C8), 128.4 (Bz,
2C), 128.5 (Bz, 2C), 129.6 (Bz, 2C), 129.7 (Bz, 2C), 133.6 (Bz,
1C), 133.7 (Bz, 1C), 165.2 (Bz, CO), 165.2 (Bz, CO), 168.9 (C-8,
CO), 169.7 (Ac, CO), 169.7 (C-7, CO), 169.9 (Ac, CO), 170.6 (Ac,
3′,4′,6′,6-Tetra-O-acetyl-2′,3-diazido-1-N-[(S)-4-azido-2-O-acetyl-
butanoyl]paromamine (6). Compound 5 (3.0 g, 5.85 mmol) was
dissolved in dry pyridine (10 mL), cooled at -12 °C, and then
acetic anhydride (5.4 equiv, 3.0 mL, 31.80 mmol) was added. The
reaction temperature was kept at -12 °C, and the reaction progress
was monitored by TLC (EtOAc/hexane 7:3), which indicated
completion after 8 h. The reaction mixture was diluted with EtOAc
(100 mL) and extracted with aqueous solution of HCl (2%),
saturated aqueous NaHCO3, and brine. The combined organic layer
was dried over MgSO4 and concentrated. The crude product was
purified by flash chromatography (EtOAc/hexane 2:3) to afford 6
CO), 172.3 (Ac, CO). MALDI-TOF MS calcd for C45H51N13O19
K
([M + K]+) m/e 1116.3; measured m/e 1116.3.
5-O-(5-Amino-5-deoxy-ꢀ-D-ribofuranosyl)-1-N-[(S)-4-amino-2-
hydroxy-butanoyl]paromamine (2). Compound 8 (1.55 g, 1.44
mmol) was treated with a solution of MeNH2 (33% solution in
EtOH, 50 mL) and the reaction progress was monitored by TLC
(EtOAc/MeOH 85:15), which indicated completion after 8 h. The
reaction mixture was evaporated to dryness and the residue was
dissolved in a mixture of THF (5 mL) and aqueous NaOH (1 mM,
5.0 mL). The mixture was stirred at room temperature for 10 min,
after which PMe3 (1 M solution in THF, 11.52 mL, 11.52 mmol)
was added. The reaction progress was monitored by TLC [CH2Cl2/
MeOH/H2O/MeNH2 (33% solution in EtOH) 10:15:6:15], which
indicated completion after 1 h. The product was purified by flash
chromatography on a short column of silica gel. The column was
washed with the following solvents: THF (800 mL), CH2Cl2 (800
mL), EtOH (200 mL), and MeOH (400 mL). The product was then
eluted with a mixture of 20% MeNH2 (33% solution in EtOH) in
80% MeOH. Fractions containing the product were combined and
evaporated to dryness. The residue was redissolved in a small
volume of water and evaporated again (2-3 repeats) to afford the
free amine form of 2. The analytically pure product was obtained
by passing the above product through a short column of Amberlite
1
(3.15 g, 75% yield). H NMR (500 MHz, CDCl3): “Ring I” δH
3.70 (dd, 1H, J1 ) 3.0, J2 ) 11.0 Hz, H-2), 4.10 (dd, 1H, J1 ) 2.0,
J2 ) 12.5 Hz, H-6), 4.31 (dd, 1H, J1 ) 4.5, J2 ) 12.5 Hz, H-6′),
4.36-4.39 (m, 1H, H-5), 5.05 (dd, 1H, J1 ) 10.0, J2 ) 10.0 Hz,
H-4), 5.28 (d, 1H, J ) 3.5 Hz, H-1) 5.50 (dd, 1H, J1 ) 10.0, J2 )
10.0 Hz, H-3); “Ring II” δH 1.48 (ddd, 1H, J1 ) J2 ) J3 ) 12.5
Hz, H-2ax), 2.50 (dt, 1H, J1 ) 4.0, J2 ) 13.0 Hz, H-2eq), 3.34-3.39
(m, 1H, H-4), 3.38-3.43 (m, 1H, H-3), 3.74-3.78 (m, 1H, H-5),
3.99-4.04 (m, 1H, H-1), 4.82 (dd, 1H, J1 ) J2 ) 10.0 Hz, H-6),
6.63 (d, 1H, J ) 7.5 Hz, NH). The additional peaks in the spectrum
were identified as follows: 2.05-2.09 (m, 2H, H-9), 2.05 (s, 3H,
Ac), 2.08 (s, 3H, Ac), 2.09 (s, 3H, Ac), 2.15 (s, 3H, Ac), 2.19 (s,
3H, Ac), 3.35-3.38 (m, 2H, H-10), 5.14 (dd, 1H, J1 ) 5.5, J2 )
6.5, H-8). 13C NMR (125 MHz, CDCl3) “Ring I” δC 61.8 (C-6),
61.8 (C-2), 68.1 (C-4), 68.4 (C-5), 71.4 (C-3), 99.1 (C-1); “Ring
II” δC 32.5 (C-2), 48.2 (C-1), 58.2 (C-3), 73.8 (C-5), 74.0 (C-6),
84.3 (C-4). The additional peaks in the spectrum were identified
as follows: 20.6-20.9 (Ac, 5C), 30.5 (C-9), 47.1 (C-10), 70.8 (C8),
169.1 (C-8, CO), 169.8 (Ac, CO), 169.8 (C-7, CO), 170.0 (Ac,
CO), 170.6 (Ac, CO), 172.4 (Ac, CO). MALDI-TOF MS calcd for
C26H36N10O14 K ([M + K]+) m/e 751.2; measured m/e 751.1).
5-O-(5-Azido-2,3-O-dibenzoyl-5-deoxy-ꢀ-D-ribofuranosyl)-3′,4′,6′,6-
tetra-O-acetyl-2′,3-diazido-1-N-[(S)-4-azido-2-O-acetyl-butanoyl]pa-
romamine (8). Anhydrous CH2Cl2 (10 mL) was added to a
powdered, flame-dried 4 Å molecular sieves (3.0 g), followed by
the addition of the acceptor (compound 6, 1.75 g, 2.46 mmol) and
the donor (compound 7, 5-deoxy-5-azido-2,3-di-O-benzoyl-1-O-
trichloroacetimido-D-ribofuranose)15 (3.3 g, 6.27 mmol) dissolved
in CH3CN (10 mL). The mixture was stirred for 10 min at room
temperature and was then cooled to -20 °C. A catalytic amount
of BF3-Et2O (100 µL) was added, and the mixture was stirred at
-15 °C. The reaction progress was monitored by TLC (EtOAc/
hexane 3:2), which indicated the completion after 30 min. The
reaction was diluted with CH2Cl2 and filtered through celite. After
thorough washing of the celite with CH2Cl2, the washes were
combined and extracted with saturated aqueous NaHCO3, brine,
dried over MgSO4, and concentrated. The crude product was
purified by flash chromatography (EtOAc/hexane 2:3) to afford
+
CG50 (NH4 form). The column was first washed with a mixture
of MeOH/H2O (3:2), then the product was eluted with a mixture
of MeOH/H2O/NH4OH (80:10:10) to afford compound 2 (628 mg,
78% yield).
For the storage and biological tests, 2 was converted to its sulfate
salt form: the free base was dissolved in water, the pH was adjusted
1
to 6.5 with H2SO4 (0.1 N) and lyophilized. H NMR (500 MHz,
D2O, pD 3.5) “Ring I” δH 3.52 (dd, 1H, J1 ) 4.0, J2 ) 11.0 Hz,
H-2), 3.53-3.57 (m, 1H, H-4), 3.81-3.85 (m, 1H, H-5), 3.81-3.85
(m, 1H, H-6), 3.93-3.98 (m, 1H, H-6′), 4.04 (dd, 1H, J1 ) 9.0, J2
) 10.0 Hz, H-3), 5.87 (d, 1H, J ) 4.0 Hz, H-1); “Ring II” δH
1.80 (ddd, 1H, J1 ) J2 ) J3 ) 12.5 Hz, H-2ax), 2.24 (dt, 1H, J1 )
4.0, J2 ) 12.5 Hz, H-2eq), 3.54-3.58 (m, 1H, H-3), 3.73 (dd, 1H,
J1 ) J2 ) 9.5 Hz, H-6), 3.92-3.98 (m, 1H, H-1), 3.99 (dd, 1H, J1
) J2 ) 9.0 Hz, H-5), 4.11 (dd, 1H, J1 ) J2 ) 9.5 Hz, H-4); “Ring
III” δH 3.29 (dd, 1H, J1 ) 7.0, J2 ) 13.5 Hz, H-5), 3.42 (dd, 1H,
J1 ) 4.0, J2 ) 13.5 Hz, H-5′), 4.12-4.15 (m, 1H, H-4), 4.23-4.25
(m, 1H, H-3), 4.26-4.29 (m, 1H, H-2), 5.40 (s, 1H, H-1). The
additional peaks in the spectrum were identified as follows:
1.98-2.06 (m, 1H, H-9), 2.15-2.22 (m, 1H, H-9), 3.14-3.23 (m,
2H, H-10), 4.34 (dd, 1H, J1) 4.0, J2 ) 8.5, H-8). 13C NMR (125
MHz, D2O) “Ring I” δC 55.4 (C-2), 61.9 (C-6), 70.8 (C-3), 70.8
(C-4), 75.8 (C-5), 95.7 (C-1); “Ring II” δC 31.4 (C-2), 50.4 (C-3),
51.4 (C-1), 74.6 (C-6), 78.1 (C-4), 85.1 (C-5); “Ring III” δC 43.4
1
compound 8 (2.01 g, 76% yield). H NMR (500 MHz, CDCl3):
“Ring I” δH 3.53 (dd, 1H, J1 ) 4.0, J2 ) 11.0 Hz, H-2), 4.15 (dd,
1H, J1 ) 2.0, J2 ) 12.5 Hz, H-6), 4.26 (dd, 1H, J1 ) 4.0, J2 )
12.5 Hz, H-6′), 4.50-4.55 (m, 1H, H-5), 5.07 (dd, 1H, J1 ) 9.5, J2
) 10.0 Hz, H-4), 5.43 (dd, 1H, J1 ) 9.5, J2 ) 10.0 Hz, H-3), 5.83

2844 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9
Nudelman et al.
(C-5), 72.7 (C-3), 76.5 (C-3), 79.9 (C-4), 110.5 (C-1). The additional
peaks in the spectrum were identified as follows: 32.6 (C9), 38.4
(C10), 71.3 (C8), 177.4 (C7). MALDI-TOF MS calculated for
C21H41N5O12 K ([M + K]+) m/e 594.3; measured m/e 594.3.
Dual Luciferase Readthrough Assays. DNA fragments derived
from PCDH15, CFTR, Dystrophin, and IDUA cDNAs, including
the tested nonsense mutation or the corresponding wt codon and
four to six upstream and downstream flanking codons, were
created by annealing following pairs of complementary oligo-
nucleotides. p.R3Xmut/wt: 5′-GATCCCAGAAGATGTTTT/
CGACAGTTTTATCTCTGGACAGAGCT-3′ and 5′-CTGTCA-
GAGATAAAACTGTCA/GAAACATCTTCTG-3′; p.R245Xmut/
wt: 5′-GATCCAAAATCTGAATGAGAGGT/CGAACCACC-
ACCACCACCCTCGAGCT-3′ and 5′-CGAGGGTGGTGGTG-
GTTGTTCG/ACCTCTCATTCAGATTTTG-3′; p.G542Xmut/wt:
5′-TCGACCAATATAGTTCTTT/GGAGAAGGTGGAATC-
GAGCT-3′ and 5′- CGATTCCACCTTCTCA/GAAGAAC-
TATATTGG-3′; p.W1282Xmut/wt: 5′- TCGACAACTTTGCAA-
CAGTGA/GAGGAAAGCCTTTGAGCT-3′ and 5′- CAAAGGC-
TTTCCTT/CCACTGTTGCAAAGTTG-3′; p.R3381Xmut/wt: 5′-
TCGACAAAAAACAAATTTTGA/CACCAAAAGGTAT-
GAGCT-3′and5′-CATACCTTTTGGTT/GCAAAATTTGTTTTTTG-
3′; p.Q70Xmut/wt: 5′-TCGACCCTCAGCTGGGACT/CAG-
CAGCTCAACCTCGAGCT-3′ and 5′-CGAGGTTGAGCTGCTA/
GGTCCCAGCTGAGG-3′;p.W402Xmut/wt:5′-TCGACTGAGGAG-
CAGCTCTGA/GGCCGAAGTGTCGGAGCT-3′ and 5′- CCGA-
CACTTCGGCT/CCAGAGCTGCTCCTCAG-3′.
Fragments were inserted in frame into the polylinker of the p2luc
plasmid between either BamHI and SacI (p.R3X and p.R245X) or
SalI and SacI (all the rest) restriction sites. For the in vitro
readthrough assays, the obtained plasmids, with addition of the
tested aminoglycosides, were transcribed and translated using the
TNT reticulocyte lysate quick coupled transcription/translation
system (Promega). Luciferase activity was determined after 90 min
of incubation at 30 °C, using the Dual luciferase reporter assay
system. For the ex vivo readthrough assays, the construct harboring
the R3X mutation was transfected to COS-7 cells with Lipo-
fectamine 2000 (Invitrogen) and addition of the tested compounds
was performed 5 h post transfection. Stop codon readthrough was
calculated as previously described.27
Alexa 488-phalloidin (Molecular Probes). After several rinses in
PBS, the specimens were mounted on a slide with fluoromount-G
(SouthernBiotech).
UV Melting Studies. The human cytoplasmic rRNA A-site model
oligonucleotide 5′-GGCGUCGCUACUUCGGUAAAAGUCGCC-
3′ was obtained in its PAGE-purified sodium salt form from
Dharmacon, Inc. (Chicago, IL). The concentrations of all RNA
solutions were determined spectrophotometrically as previously
described.36 All experimental RNA solutions were preheated at 85
°C for 5 min and slowly cooled to room temperature prior to their
use. Temperature-dependent absorption experiments were conducted
on an AVIV model 14DS spectrophotometer (Aviv Biomedical,
Lakewood, NJ) equipped with a thermoelectrically controlled cell
holder. Quartz cells with a 1 cm path length were used for all of
the absorbance studies. Temperature-dependent absorption profiles
(Figure 5) were acquired at 274 nm with a 5 s averaging time. The
temperature was raised in 0.5 °C increments, and the samples were
allowed to equilibrate for 1.5 min at each temperature setting. In
these UV melting studies, the RNA solutions were 2 µM in strand
and drug concentrations ranged from 0 to 10 µM. Buffer solutions
contained 10 mM EPPS (pH 7.0) and 10 mM NaCl.
Acknowledgment. We thank John F. Atkins (University of
Utah) for providing the p2luc plasmid and Larisa Panz for the
purity determination of compounds 1 and 2. This work supported
by research grants from the US-Israel Binational Science
Foundation (grant no. 2006/301) to T.B. and D.S.P., Horowitz
Fund (grant no. 2010826) to T.B. and T.B.Y., RO1 DC03685
and P30 05188 from the National Institutes of Health to J.S.,
and the Foundation du Judaisme Francais to A.R.S. V.B.
acknowledges the financial Support by the Center of Absorption
in Science, the Ministry of Immigration Absorption, and the
Ministry of Science and Technology, Israel (Kamea Program).
Supporting Information Available: Comparative in vitro
readthrough activity data of amikacin and kanamycin A, ototoxicity
data in cochlear explants of the middle and apex parts, and purity
determination of compounds 1 and 2. This material is available
free of charge via the Internet at http://pubs.acs.org.
Toxicity Assays. Cytotoxicity of compound 2 was determined
as previously reported by us for gentamicin, paromomycin, and
compound 1.16 Male BALB/C mice at 22 days of age (18-20 g)
purchased from Harlan Laboratories Limited (Jerusalem, Israel)
were used to evaluate the LD50 of the aminoglycosides. Mice were
maintained on a 12 h light/dark cycle at 20-22 °C, with relative
humidity of 50-55%, and were given food and water ad libitum.
The aminoglycosides tested were administered in single intravenous
(iv) doses, and each concentration was applied to eight animals.
The aminoglycosides were dissolved in PBS, and 150 µL of final
solution (pH ) 7) were injected into the tail vein. Changes in the
appearance and behavior and mortality in mice were monitored for
4 days after the administration. The LD50 values were determined
according to the Reed and Muench method.44
For evaluation of ototoxicity, a preparation of the organ of Corti
and spiral ganglion neurons was obtained by dissection of the
cochlea from postnatal day 3 mice. The tissue was positioned as a
flat surface preparation on a collagen-coated incubation dish in 1
mL of serum-free BME plus serum-free supplement (Sigma), 1%
bovine serum albumin, 2 mM glutamine, 5 mg/mL glucose, and
10 U/mL penicillin and incubated for 4-5 h (37 °C, 5% CO2).
Then an additional 1 mL of the culture medium was added, and
incubation continued for 24 h. The next day, the serum-free medium
was exchanged for a new medium containing a specific concentra-
tion of drug and incubated for desired time points. For hair cell
counts, organ cultures were fixed overnight in 4% paraformaldehyde
at 4 °C and then permeabilized for 30 min with 3% Triton X-100
in PBS. The specimens were washed three times with PBS and
blocked with 10% goat serum for 30 min at room temperature,
followed by incubation at room temperature for 40 min for
fluorescent visualization of F-actin with rhodamine-phalloidin or
References
(1) Keeling, K. M.; Bedwell, D. M. Pharmacological suppression of
premature stop mutations that cause genetic diseases. Curr. Pharma-
cogenomics 2005, 3, 259–269.
(2) Mort, M.; Ivanov, D.; Cooper, D. N.; Chuzhanova, N. A. A meta-
analysis of nonsense mutations causing human genetic disease. Hum.
Mutat. 2008, 29, 1037–1047.
(3) Burke, J. F.; Mogg, A. E. Suppression of a nonsense mutation in
mammalian cells in vivo by the aminoglycoside antibiotics G-418 and
paromomycin. Nucleic Acids Res. 1985, 13, 6265–6272.
(4) Kaufman, R. J. Correction of genetic disease by making sense from
nonsense. J. Clin. InVest. 1999, 104, 367–368.
(5) Manuvakhova, M.; Keeling, K.; Bedwell, D. M. Aminoglycoside
antibiotics mediate context-dependent suppression of termination
codons in a mammalian translation system. RNA 2000, 6, 1044–1055.
(6) Kerem, E. Pharmacologic therapy for stop mutations: how much CFTR
activity is enough? Curr. Opin. Pulm. Med. 2004, 10, 547–552.
(7) Hainrichson, M.; Nudelman, I.; Baasov, T. Designer aminoglycosides:
the race to develop improved antibiotics and compounds for the
treatment of human genetic diseases. Org. Biomol. Chem. 2008, 6,
227–239.
(8) Barton-Davis, E. R.; Cordier, L.; Shoturma, D. I.; Leland, S. E.;
Sweeney, H. L. Aminoglycoside antibiotics restore dystrophin function
to skeletal muscles of mdx mice. J. Clin. InVest. 1999, 104, 375–381.
(9) Du, M.; Jones, J. R.; Lanier, J.; Keeling, K. M.; Lindsey, J. R.;
Tousson, A.; Bebok, Z.; Whitsett, J. A.; Dey, C. R.; Colledge, W. H.;
Evans, M. J.; Sorscher, E. J.; Bedwell, D. M. Aminoglycoside
suppression of a premature stop mutation in a Cftr-/-mouse carrying
a human CFTR-G542X transgene. J. Mol. Med. 2002, 80, 595–604.
(10) Wilschanski, M.; Yahav, Y.; Yaacov, Y.; Blau, H.; Bentur, L.; Rivlin,
J.; Aviram, M.; Bdolah-Abram, T.; Bebok, Z.; Shushi, L.; Kerem, B.;
Kerem, E. Gentamicin-induced correction of CFTR function in patients
with cystic fibrosis and CFTR stop mutations. N. Engl. J. Med 2003,
349, 1433–1441.

NoVel Aminoglycoside (NB54)
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9 2845
(11) Politano, L.; Nigro, G.; Nigro, V.; Piluso, G.; Papparella, S.; Paciello,
O.; Comi, L. I. Gentamicin administration in Duchenne patients with
premature stop codon. Preliminary results. Acta Myol. 2003, 22, 15–
21.
(12) Wagner, K. R.; Hamed, S.; Hadley, D. W.; Gropman, A. L.; Burstein,
A. H.; Escolar, D. M.; Hoffman, E. P.; Fischbeck, K. H. Gentamicin
treatment of Duchenne and Becker muscular dystrophy due to nonsense
mutations. Ann. Neurol. 2001, 49, 706–711.
(13) Ramalho, A. S.; Beck, S.; Meyer, M.; Penque, D.; Cutting, G. R.;
Amaral, M. D. Five percent of normal cystic fibrosis transmembrane
conductance regulator mRNA ameliorates the severity of pulmonary
disease in cystic fibrosis. Am. J. Respir. Cell Mol. Biol. 2002, 27,
619–627.
(14) Du, M.; Keeling, K. M.; Fan, L.; Liu, X.; Kovacs, T.; Sorscher,
E.; Bedwell, D. M. Clinical doses of amikacin provide more
effective suppression of the human CFTR-G542X stop mutation
than gentamicin in a transgenic CF mouse model. J. Mol. Med. 2006,
84, 573–582.
(26) Howard, M. T.; Shirts, B. H.; Petros, L. M.; Flanigan, K. M.;
Gesteland, R. F.; Atkins, J. F. Sequence specificity of aminoglycoside-
induced stop condon readthrough: potential implications for treatment
of Duchenne muscular dystrophy. Ann. Neurol. 2000, 48, 164–169.
(27) Grentzmann, G.; Ingram, J. A.; Kelly, P. J.; Gesteland, R. F.; Atkins,
J. F. A dual-luciferase reporter system for studying recoding signals.
RNA 1998, 4, 479–486.
(28) Albiero, L.; Bamonte, F.; Ongini, E.; Parravicini, L. Comparison of
neuromuscular effects and acute toxicity of some aminoglycoside
antibiotics. Arch. Int. Pharmacodyn. Ther. 1978, 233, 343–350.
(29) Rothlin, C. V.; Katz, E.; Verbitsky, M.; Vetter, D. E.; Heinemann,
S. F.; Elgoyhen, A. B. Block of the alpha9 nicotinic receptor by
ototoxic aminoglycosides. Neuropharmacology 2000, 39, 2525–2532.
(30) Talbot, P. A. Potentiation of aminoglycoside-induced neuromuscular
blockade by protons in vitro and in vivo. J. Pharmacol. Exp. Ther.
1987, 241, 686–694.
(31) Paradelis, A. G.; Triantaphyllidis, C.; Markomichelakis, J. M.; Logaras,
G. The neuromuscular blocking activity of aminodeoxykanamycin as
compared with that of other aminoglycoside antibiotics. Arzneim.-
Forsch. 1977, 27, 141–143.
(32) Amici, M.; Eusebi, F.; Miledi, R. Effects of the antibiotic gentamicin
on nicotinic acetylcholine receptors. Neuropharmacology 2005, 49,
627–637.
(15) Nudelman, I.; Rebibo-Sabbah, A.; Shallom-Shezifi, D.; Hainrichson,
M.; Stahl, I.; Ben-Yosef, T.; Baasov, T. Redesign of aminoglyco-
sides for treatment of human genetic diseases caused by premature
stop mutations. Bioorg. Med. Chem. Lett. 2006, 16, 6310–6315.
(16) Rebibo-Sabbah, A.; Nudelman, I.; Ahmed, Z. M.; Baasov, T.; Ben-
Yosef, T. In vitro and ex vivo suppression by aminoglycosides of
PCDH15 nonsense mutations underlying type 1 Usher syndrome. Hum.
Genet. 2007, 122, 373–381.
(17) Fujisawa, K.; Hoshiya, T.; Kawaguchi, H. Aminoglycoside antibiotics.
VII. Acute toxicity of aminoglycoside antibiotics. J. Antibiot. 1974,
27, 677–681.
(18) Kondo, S.; Hotta, K. Semisynthetic aminoglycoside antibiotics:
Development and enzymatic modifications. J. Infect. Chemother. 1999,
5, 1–9.
(19) Reiffens., J.; Holmes, S. W.; Hottendo, G.; Bierwage., M. Ototoxicity
Studies with Bb-K8sNew Semisynthetic Aminoglycoside Antibiotic.
J. Antibiot. 1973, 26, 94–100.
(20) Kondo, J.; Francois, B.; Russell, R. J.; Murray, J. B.; Westhof, E.
Crystal structure of the bacterial ribosomal decoding site complexed
with amikacin containing the gamma-amino-alpha-hydroxybutyryl
(haba) group. Biochimie 2006, 88, 1027–1031.
(21) Russell, R. J.; Murray, J. B.; Lentzen, G.; Haddad, J.; Mobashery, S.
The complex of a designer antibiotic with a model aminoacyl site of
the 30S ribosomal subunit revealed by X-ray crystallography. J. Am.
Chem. Soc. 2003, 125, 3410–3411.
(22) Kondo, J.; Hainrichson, M.; Nudelman, I.; Shallom-Shezifi, D.;
Barbieri, C. M.; Pilch, D. S.; Westhof, E.; Baasov, T. Differential
Selectivity of Natural and Synthetic Aminoglycosides towards the
Eukaryotic and Prokaryotic Decoding A Sites. ChemBioChem 2007,
8, 1700–1709.
(23) Kirst, H. A.; Truedell, B. A.; Toth, J. E. Control of Site-Specific
Substitution of Aminoglycosides by Transition-Metal Cations. Tetra-
hedron Lett. 1981, 22, 295–298.
(33) Vital Brazil, O.; Prado-Franceschi, J. The neuromuscular blocking
action of gentamicin. Arch. Int. Pharmacodyn. Ther. 1969, 179, 65–
77.
(34) Sha, S. H.; Qiu, J. H.; Schacht, J. Aspirin to prevent gentamicin-
induced hearing loss. N. Engl. J. Med 2006, 354, 1856–1857.
(35) Forge, A.; Schacht, J. Aminoglycoside antibiotics. Audiol. Neurootol.
2000, 5, 3–22.
(36) Kaul, M.; Barbieri, C. M.; Pilch, D. S. Defining the basis for the
specificity of aminoglycoside-rRNA recognition: a comparative study
of drug binding to the A sites of Escherichia coli and human rRNA.
J. Mol. Biol. 2005, 346, 119–134.
(37) Crothers, D. M. Statistical Thermodynamics of Nucleic Acid Melting
Transitions with Coupled Binding Equilibria. Biopolymers 1971, 10,
2147–2160.
(38) Marky, L. A.; Breslauer, K. J. Calculating Thermodynamic Data for
Transitions of Any Molecularity from Equilibrium Melting Curves.
Biopolymers 1987, 26, 1601–1620.
(39) Greenberg, W. A.; Priestley, E. S.; Sears, P. S.; Alper, P. B.;
Rosenbohm, C.; Hendrix, M.; Hung, S. C.; Wong, C. H. Design and
synthesis of new aminoglycoside antibiotics containing neamine as
an optimal core structure: correlation of antibiotic activity with in vitro
inhibition of translation. J. Am. Chem. Soc. 1999, 121, 6527–6541.
(40) Kondo, J.; Westhof, E. The bacterial and mitochondrial ribosomal
A-site molecular switches possess different conformational substates.
Nucleic Acids Res. 2008, 36, 2654–2666.
(41) Bottger, E. C.; Springer, B.; Prammananan, T.; Kidan, Y.; Sander, P.
Structural basis for selectivity and toxicity of ribosomal antibiotics.
EMBO Rep. 2001, 2, 318–323.
(42) Hobbie, S. N.; Bruell, C. M.; Akshay, S.; Kalapala, S. K.; Shcherbakov,
D.; Bottger, E. C. Mitochondrial deafness alleles confer misreading
of the genetic code. Proc. Natl. Acad. Sci. U.S.A. 2008, 105, 3244–
3249.
(24) Fridman, M.; Belakhov, V.; Lee, L. V.; Liang, F. S.; Wong, C. H.;
Baasov, T. Dual effect of synthetic aminoglycosides: antibacterial
activity against Bacillus anthracis and inhibition of anthrax lethal
factor. Angew. Chem., Int. Ed. 2005, 44, 447–452.
(25) Nudelman, I.; Chen, L.; Llewellyn, N. M.; Sahraoui, E. H.; Chernia-
vsky, M.; Spencer, J. B.; Baasov, T. Combined chemical-enzymatic
assembly of aminoglycoside derivatives with N-1-AHB side chain.
AdV. Synth. Catal. 2008, 350, 1682–1688.
(43) Alper, P. B.; Hendrix, M.; Sears, P. S.; Wong, C. H. Probing the
specificity of aminoglycoside-ribosomal RNA interactions with
designed synthetic analogs. J. Am. Chem. Soc. 1998, 120, 1965–1978.
(44) Reed, L. J.; Muench, H. A simple method for estimating fifty percent
endpoints. Am. J. Hyg. 1938, 27, 493–496.
JM801640K