Versatile synthesis and rational design of caged morpholinos

Published on Web 08/26/2009

Versatile Synthesis and Rational Design

of Caged Morpholinos

Xiaohu Ouyang,^†Ilya A. Shestopalov,^†Surajit Sinha,^†,|Genhua Zheng,^‡

Cameron L. W. Pitt,^†Wen-Hong Li,^‡Andrew J. Olson,^§and James K. Chen*^,†

Department of Chemical and Systems Biology and Institute for Neuro-InnoVation and

Translational Neuroscience, Stanford UniVersity School of Medicine, Stanford,

California 94305, and Department of Cell Biology, UniVersity of Texas-Southwestern Medical

Center, Dallas, Texas 75390

Received December 19, 2008; E-mail: jameschen@stanford.edu

Abstract: Embryogenesis is regulated by genetic programs that are dynamically executed in a stereotypic

manner, and deciphering these molecular mechanisms requires the ability to control embryonic gene function

with similar spatial and temporal precision. Chemical technologies can enable such genetic manipulations,

as exempliﬁed by the use of caged morpholino (cMO) oligonucleotides to inactivate genes in zebraﬁsh

and other optically transparent organisms with spatiotemporal control. Here we report optimized methods

for the design and synthesis of hairpin cMOs incorporating a dimethoxynitrobenzyl (DMNB)-based

bifunctional linker that permits cMO assembly in only three steps from commercially available reagents.

Using this simpliﬁed procedure, we have systematically prepared cMOs with differing structural conﬁgurations

and investigated how the in vitro thermodynamic properties of these reagents correlate with their in vivo

activities. Through these studies, we have established general principles for cMO design and successful-

ly applied them to several developmental genes. Our optimized synthetic and design methodologies have

also enabled us to prepare a next-generation cMO that contains a bromohydroxyquinoline (BHQ)-based

linker for two-photon uncaging. Collectively, these advances establish the generality of cMO technologies

and will facilitate the application of these chemical probes in vivo for functional genomic studies.

utero.²However, methods for regulating endogenous gene

function in zebraﬁsh are underdeveloped relative to those for

Introduction

Embryonic development relies upon the precise control of

genetic programs to create complex tissues and organs. Mu-

tagenesis screens and the sequencing of multiple genomes have

revealed an extensive list of patterning genes, many of which

are expressed in a tissue-speciﬁc manner within the developing

embryo. One of the remaining challenges in developmental

biology is to understand how these genes act in space and time

to modulate cell proliferation, migration, and differentiation in

a stereotypic manner. Toward that goal, several genetic ap-

proaches for conditional gene regulation have been developed,

such as the FLP/FRT, Cre/Lox, and Tet-ON/Tet-OFF systems,

and these technologies have provided key insights into the

molecular mechanisms that underlie tissue patterning and

function.¹

other model organisms; targeted gene knockouts by homologous

recombination and inducible RNA interference technologies

have not yet been achieved.³In lieu of these approaches,

synthetic oligonucleotides such as morpholinos (MOs) and

negatively charged peptide nucleic acids (ncPNAs) have been

employed as antisense reagents in zebraﬁsh embryos (Figure

1).^4,5MO nucleoside analogues display DNA bases from a

morpholine ring system and are connected by a phosphorodia-

midate backbone, while ncPNA monomers are composed of

alternating trans-4-hydroxy-L-proline/phosphonate polyamides,

each functionalized with a DNA base. Because of these non-

natural structures, both MOs and ncPNAs are resistant to

nucleases and persist for up to 4 days in zebraﬁsh embryos.

Thus, when MO or ncPNA oligomers are injected into zebraﬁsh

prior to the eight-cell stage, they become uniformly distributed

throughout the embryo and constitutively block either RNA

splicing or translation, depending on the targeted sequence. In

the case of MOs, oligomers containing 25 bases are typically

used, while ncPNA oligomers are limited to 18 bases. Unlike

Chemical technologies are also required for surmounting this

challenge, especially in biological systems for which reverse-

genetic methods are limited. For example, the zebraﬁsh is ideally

suited for visualizing vertebrate ontogeny, since its embryos

and larvae are optically transparent and develop rapidly ex

^†Department of Chemical and Systems Biology, Stanford University

School of Medicine.

^‡University of Texas-Southwestern Medical Center.

^§Institute for Neuro-Innovation and Translational Neuroscience, Stanford

University School of Medicine.

(2) Grunwald, D. J.; Eisen, J. S. Nat. ReV. Genet. 2002, 3, 717–724.

(3) Skromne, I.; Prince, V. E. DeV. Dyn. 2008, 237, 861–882.

(4) Nasevicius, A.; Ekker, S. C. Nat. Genet. 2000, 26, 216–220.

(5) Urtishak, K. A.; Choob, M.; Tian, X.; Sternheim, N.; Talbot, W. S.;

Wickstrom, E.; Farber, S. A. DeV. Dyn. 2003, 228, 405–413.

^|Present address: Department of Organic Chemistry, Indian Association

for the Cultivation of Science, 2A and 2B Raja S.C. Mullick Road, Jadavpur,

Kolkata 700032, India.

(1) Shestopalov, I. A.; Chen, J. K. Chem. Soc. ReV. 2008, 37, 1294–1307.

9

10.1021/ja809933h CCC: $40.75  2009 American Chemical Society

J. AM. CHEM. SOC. 2009, 131, 13255–13269 13255

A R T I C L E S

Ouyang et al.

and RNA function in vitro,^8-11and this general approach differs

from complementary oligonucleotide-caging technologies that

target individual nucleoside bases,^12,13the phosphate back-

bone,^14-16or oligonucleotide termini.¹⁷

As a proof of principle, we ﬁrst used this methodology to

conditionally silence a T-box transcription factor called no tail-a

(ntla), which is required for the differentiation of axial

mesodermal cells into a transient, chordate-speciﬁc organ called

the notochord.^18,19Embryos lacking ntla function exhibit clear

morphological phenotypes in a cell-autonomous manner, pro-

viding an ideal system for evaluating the efﬁcacy of cMOs in

vivo. In particular, ntla mutants or morphants (as MO-injected

embryos are commonly called) lack a notochord, are posteriorly

truncated, and exhibit U-shaped rather than V-shaped somites.

The latter defect is collateral to notochord ablation, since the

notochord secretes morphogens to pattern the ﬂanking myo-

tome.²⁰Mutants or morphants lacking ntla function also exhibit

an ectopic medial ﬂoor plate, a ventral region of the developing

spinal cord, and it is believed that ntla acts as a transcriptional

switch between notochord and medial ﬂoor plate cell fates.^18,21

By varying the developmental stage at which we activated the

ntla cMO, we found that this transcription factor is required

not only for speciﬁcation of the mesoderm toward notochord

cell fates but also for the maturation of notochord progenitors

into a highly vacuolated tissue.⁷We also demonstrated our

ability to silence ntla expression in a subset of mesodermal cells

by activating the ntla cMO in a spatially restricted manner,

selectively redirecting these populations to differentiate into

medial ﬂoor plate cells. A similar caging approach has been

applied to ncPNAs targeting the chordin (chd) and dharma (dha)

genes, although the use of these photoactivatable ncPNA

hairpins to spatially control gene expression has not been

reported to date.²²

Figure 1. Structures of DNA, MO, and ncPNA oligonucleotides.

Figure 2. Schematic representation of the hairpin cMO strategy.

RNA interference technologies, MOs and ncPNAs do not

promote RNA degradation.⁶

While MOs and ncPNAs have been used to interrogate gene

function in zebraﬁsh and other model organisms, the utility of

these reagents is restricted by their constitutive activity. Gene

expression is inhibited immediately after introduction of the

antisense oligomers, and because they are typically injected into

early-stage embryos, this blockade persists in most, if not all,

cell lineages. Conventional MOs and ncPNAs therefore are less

effective for studying genes that are required for embryonic

survival and/or have pleiotropic functions at different develop-

mental stages or in distinct tissues. To overcome this limitation,

we recently developed caged morpholinos (cMOs) that can be

activated by light, taking advantage of the transparency of

zebraﬁsh embryos and larvae.⁷This was achieved by tethering

a complementary MO-derived inhibitor to the 25-base targeting

sequence through a dimethoxynitrobenzyl (DMNB)-based pho-

tocleavable linker, resulting in a hairpin structure (Figure 2).

The intramolecular duplex suppresses binding of the targeting

sequence to its complementary RNA, and the stem-loop

conﬁguration is signiﬁcantly less active in vivo. After linker

cleavage with 360-nm light, the inhibitor dissociates from the

25-base MO, allowing the antisense reagent to prevent splicing

or translation of its RNA target. Similar caging strategies have

previously been described for regulating DNA duplex formation

While our results established the general principle of using

caged oligonucleotides to conditionally regulate in vivo gene

expression, there are limitations associated with these initial

investigations. First, our previous studies required preparation

of the inhibitory oligomer and its appendant DMNB linker

through solid-phase chemistries, since conventional MOs ame-

nable to terminal hydroxyl modiﬁcations were not commercially

available at that time. These procedures are laborious and time-

consuming, hindering the synthesis and evaluation of other

cMOs. Second, guidelines for the design of other hairpin cMOs

were not evident from our ﬁndings, as only one inhibitory

(12) Mayer, G.; Krock, L.; Mikat, V.; Engeser, M.; Heckel, A. ChemBio-

Chem 2005, 6, 1966–1970.

(13) Young, D. D.; Lusic, H.; Lively, M. O.; Yoder, J. A.; Deiters, A.

ChemBioChem 2008, 9, 2937–2940.

(14) Ando, H.; Furuta, T.; Tsien, R. Y.; Okamoto, H. Nat. Genet. 2001,

28, 317–325.

(15) Shah, S.; Rangarajan, S.; Friedman, S. H. Angew. Chem., Int. Ed. 2005,

44, 1328–1332.

(16) Monroe, W. T.; McQuain, M. M.; Chang, M. S.; Alexander, J. S.;

Haselton, F. R. J. Biol. Chem. 1999, 274, 20895–20900.

(17) Nguyen, Q. N.; Chavli, R. V.; Marques, J. T.; Conrad, P. G., Jr.; Wang,

D.; He, W.; Belisle, B. E.; Zhang, A.; Pastor, L. M.; Witney, F. R.;

Morris, M.; Heitz, F.; Divita, G.; Williams, B. R.; McMaster, G. K.

Biochim. Biophys. Acta 2006, 1758, 394–403.

(6) Summerton, J. Biochim. Biophys. Acta 1999, 1489, 141–158.

(7) Shestopalov, I. A.; Sinha, S.; Chen, J. K. Nat. Chem. Biol. 2007, 3,

650–651.

(18) Halpern, M. E.; Ho, R. K.; Walker, C.; Kimmel, C. B. Cell 1993, 75,

99–111.

(8) Ordoukhanian, P.; Taylor, J. S. J. Am. Chem. Soc. 1995, 117, 9570–

9571.

(19) Schulte-Merker, S.; van Eeden, F. J.; Halpern, M. E.; Kimmel, C. B.;

Nusslein-Volhard, C. DeVelopment 1994, 120, 1009–1015.

(20) Stemple, D. L. DeVelopment 2005, 132, 2503–2512.

(21) Amacher, S. L.; Draper, B. W.; Summers, B. R.; Kimmel, C. B.

DeVelopment 2002, 129, 3311–3323.

(9) Richards, J. L.; Tang, X.; Turetsky, A.; Dmochowski, I. J. Bioorg.

Med. Chem. Lett. 2008, 18, 6255–6258.

(10) Tang, X.; Dmochowski, I. J. Mol. Biosyst. 2007, 3, 100–110.

(11) Tang, X.; Swaminathan, J.; Gewirtz, A. M.; Dmochowski, I. J. Nucleic

Acids Res. 2008, 36, 559–569.

(22) Tang, X.; Maegawa, S.; Weinberg, E. S.; Dmochowski, I. J. J. Am.

Chem. Soc. 2007, 129, 11000–11001.

9

13256 J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009

Versatile Synthesis and Rational Design of Caged Morpholinos

A R T I C L E S

Chart 1. Chemical Structures of Linker-Conjugated Inhibitor 1

sequence and structural conﬁguration was tested. Nor could

general rules for caged oligonucleotide design be derived from

the ncPNA study, which limited its analysis to single chd- and

dha-targeting reagents with divergent structures and dosages.²²

Finally, the reliance of both classes of caged oligonucleotides

on nitrobenzyl-based chromophores restricts their use to single-

photon irradiation with UV light, which can induce DNA lesions

and has limited spatial resolution. Photoactivatable MOs and

ncPNAs that are compatible with two-photon excitation could

be activated with less coincident damage, deeper tissue penetra-

tion, and greater spatial precision.²³

Obtained through Solid-Phase Chemistry and Bifunctional Linker

2a for Solution-Phase Chemistry

We report herein our resolution of these issues through the

development of new hairpin cMOs. We have designed and

synthesized a DMNB-based bifunctional linker that can be used

to conjugate the targeting MO and its complementary inhibitor

in only three steps, starting with appropriately functionalized

MO oligomers that are now commercially available. We have

utilized this optimized synthetic route to prepare a series of ntla-

targeting cMOs with differing structural conﬁgurations, thereby

allowing us to systematically analyze how the in vivo efﬁcacy

of these reagents correlates with their biophysical properties.

Through these studies, we have demonstrated that cMO activity

in vivo can be modeled in simpliﬁed thermodynamic terms, and

we have established guidelines for the preparation of other

cMOs. These design criteria have enabled us to prepare

photoactivatable reagents targeting the zebraﬁsh genes heart of

glass (heg),²⁴ﬂoating head (ﬂh),²⁵and endothelial-speciﬁc

Variant gene 2 (etV2).²⁶We have further demonstrated the

versatility of this approach by replacing the DMNB chro-

mophore with a bromohydroxyquinoline (BHQ) group, which

has a signiﬁcantly greater cross section for two-photon

excitation.^27,28These studies represent the ﬁrst comprehensive

analysis of the structure and in vivo function of hairpin-caged

oligonucleotides, providing a foundation upon which future

chemical technologies for conditional gene regulation can be

based.

Scheme 1. Synthesis of Bifunctional Linkers 2a and 2b^a

^aReagents and conditions: (a) methyl adipoyl chloride, DIPEA, CH₂Cl₂,

86%; (b) 1,1′-carbonyldiimidazole, DMF, 88%; (c) 6-amino-N-(prop-2-

ynyl)hexanamide, DIPEA, CH₂Cl₂, 64%; (d) 2 M NaOH(aq), THF, MeOH,

93%; (e) disuccinimidyl carbonate, pyridine, acetonitrile, 75%. Yields are

those obtained for the DMNB derivatives.

Results and Discussion

Development of a DMNB-Based Bifunctional Linker for

Hairpin cMO Synthesis. Since our current cMO design involves

the conjugation of a targeting MO to a complementary inhibitor,

modiﬁcations of the hydroxyl- and amine-functionalized termini

of each oligomer (designated as the 5′ and 3′ ends, respectively)

are necessary. At the time of our initial studies, MOs function-

alized with 3′ primary amines were commercially available, but

5′-amine oligomers were not. We therefore prepared an inhibi-

tory oligonucleotide conjugated at its 5′ end to a photocleavable

linker (1; Chart 1) using solid-phase chemistry. This required

the synthesis of all four MO bases, a linker-modiﬁed MO

monomer, and multiple rounds of solid-phase coupling (Scheme

S1 in the Supporting Information).⁷Addition of the linker-

functionalized inhibitor to the targeting MO was then achieved

through a Cu(I)-catalyzed Huisgen 1,3-dipolar cycloaddition

(“click” chemistry²⁹). Although this approach is ultimately

effective, its utilization of time-consuming and labor-intensive

procedures hinders the application of hairpin cMOs to other

developmental genes.

To streamline the synthesis of cMOs, we developed a new

strategy that takes advantage of the recent commercial avail-

ability of 5′-amine MOs. Our goal was to prepare a bifunctional

linker that contains the DMNB chromophore, an N-hydroxy-

succinimide ester for amine conjugation, and a terminal alkyne

for azide cycloaddition through “click” chemistry. With ap-

propriately functionalized targeting and inhibitory MOs, the

cMO could then be assembled in three steps. We ﬁrst synthe-

sized the bifunctional, photocleavable cross-linker 2a (Chart 1

and Scheme 1). The DMNB amino alcohol 3a⁷was selectively

acylated with methyl adipoyl chloride to give amide 4a, which

was then activated by 1,1′-carbonyldiimidazole and coupled with

6-amino-N-(prop-2-ynyl)hexanamide³⁰to provide the propargyl

(23) Furuta, T.; Wang, S. S.; Dantzker, J. L.; Dore, T. M.; Bybee, W. J.;

Callaway, E. M.; Denk, W.; Tsien, R. Y. Proc. Natl. Acad. Sci. U.S.A.

1999, 96, 1193–1200.

(24) Mably, J. D.; Mohideen, M. A.; Burns, C. G.; Chen, J. N.; Fishman,

M. C. Curr. Biol. 2003, 13, 2138–2147.

(25) Talbot, W. S.; Trevarrow, B.; Halpern, M. E.; Melby, A. E.; Farr, G.;

Postlethwait, J. H.; Jowett, T.; Kimmel, C. B.; Kimelman, D. Nature

1995, 378, 150–157.

(26) Sumanas, S.; Lin, S. PLoS Biol. 2006, 4, e10.

(27) Fedoryak, O. D.; Dore, T. M. Org. Lett. 2002, 4, 3419–3422.

(28) Zhu, Y.; Pavlos, C. M.; Toscano, J. P.; Dore, T. M. J. Am. Chem.

Soc. 2006, 128, 4267–4276.

(29) Rostovtsev, V. V.; Green, L. G.; Fokin, V. V.; Sharpless, K. B. Angew.

Chem., Int. Ed. 2002, 41, 2596–2599.

(30) Bonnet, D.; Ilien, B.; Galzi, J. L.; Riche, S.; Antheaune, C.; Hibert,

M. Bioconjugate Chem. 2006, 17, 1618–1623.

9

J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009 13257

A R T I C L E S

Ouyang et al.

Scheme 2. Simpliﬁed Strategy for cMO Synthesis^a

^aReagents and conditions: (a) 2,5-dioxopyrrolidin-1-yl 3-azidopropanoate, 0.1 M sodium borate (pH 8.5)/3:1 (v/v) DMSO, 98%; (b) bifunctional DMNB

linker 2a or 2b, 0.1 M sodium borate (pH 8.5)/DMSO 6:1 (v/v), 70-90%; (c) sodium ascorbate, TBTA, CuI, 0.1 M potassium phosphate (pH 8.0), DMSO,

10-25% after HPLC. The ntla cMOs 8a-h, 8a′, and 8e′ were prepared through this synthetic route, using the ntla-targeting MO (5′-GACTTGAGGCA-

GACATATTTCCGAT-5′) and inhibitory MOs having various lengths and sequences (Table 1).

intermediate 5a. Saponiﬁcation of 5a and re-esteriﬁcation of

the corresponding acid with disuccinimidyl carbonate then

yielded linker 2a, which is orthogonally reactive with azides

and amines.

To prepare a ntla cMO through this synthetic approach, a

targeting MO (5′-GACTTGAGGCAGACATATTTCCGAT-3′)

was functionalized with 3-azidopropionic acid succinimidyl ester

to yield the azide derivative 6 (Scheme 2). Linker 2a was then

reacted with the commercially available 5′-amine- and 3′-

ﬂuorescein-functionalized MO (5′-TATGTCTGCC-3′) in 0.1 M

sodium borate buffer (pH 8.5) to generate linker-derivatized

inhibitory oligomer 7a, and the two MO oligomers were coupled

through “click” chemistry in 0.1 M potassium phosphate buffer

(pH 8) containing sodium ascorbate, CuI, and tris[(1-benzyl-

1H-1,2,3-triazol-4-yl)methyl]amine (TBTA). Puriﬁcation of the

ﬁnal product by ion-exchange HPLC using NaClO₄as the eluent

then yielded the ntla cMO 8a.

To evaluate the in vivo efﬁcacy of this reagent, we next

injected 8a into wild-type zebraﬁsh embryos at the one-cell stage

and globally irradiated approximately half of the embryos with

360-nm light (13 mW/cm²) for 10 s at 3 h post fertilization

(hpf). The remaining embryos were cultured in the dark as

negative controls, and the resulting phenotypes at 1 day post

fertilization (dpf) were then scored. As we have described

previously, ntla loss-of-function phenotypes can be categorized

into four classes according to their severity: class I ) a fully

penetrant ntla mutant phenotype characterized by no notochord,

U-shaped somites, and a lack of posterior structures; class II )

no notochord, U-shaped somites, and some posterior somites;

class III ) incompletely vacuolated notochord, V-shaped

somites, and a shortened anterior-posterior axis; and class IV

) wild-type phenotype (Figure 3A).⁷These phenotypes can be

recapitulated by injecting early-stage embryos with varying

Figure 3. Conventional and caged MOs targeting the ntla gene and

classiﬁcation of ntla mutant phenotypes. (A) Classiﬁcation of ntla mutant

doses of the conventional ntla MO, and classes I-IV correspond

respectively to doses of g115, 57, 28, and e14 fmol/embryo

(Figure 3B). Since the class I phenotype can be achieved with

ntla MO levels g115 fmol/embryo, we utilized 8a at this

minimum dose in this experiment. To our surprise, 8a induced

class-II and class-III phenotypes in the absence of irradiation

phenotypes according to morphological cues. Somitic (s), medial ﬂoor plate

(mfp), notochord (nc), and yolk extension (ye) tissues are labeled. Scale

bars: left panels, 200 µm; right panels, 50 µm. Bright-ﬁeld (left) and

differential interference contrast (right) images of 1 dpf embryos are shown.

(B) Distribution of phenotypes according to the dose (per embryo) of a

conventional ntla MO. (C) Distribution of phenotypes for ntla cMO 8a at

a dose of 115 fmol/embryo with and without photoactivation.

9

13258 J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009

Versatile Synthesis and Rational Design of Caged Morpholinos

A R T I C L E S

Figure 4. Activity proﬁles of ntla cMOs with different structures. The leftmost panels show schematic representations of “staggered” (top) and “blunt”

(bottom) cMO conﬁgurations (n ) number of bases), and the other panels are distributions of phenotypes for each cMO conﬁguration 8a-h (see Table 1

and Figure 3) at a dose of 230 fmol/embryo.

Table 1. Oligomer sequences

(Figure 3C), while our original ntla cMO exhibited little activity

prior to uncaging.⁷Since the targeting and inhibitory MOs used

in this reagent are identical to those in our previous study, this

difference in caging efﬁciency must reﬂect changes in the linker

structure.

oligomer

sequence

cMO

ntla MO^a

GACTTGAGGCAGACATATTTCCGAT

8a-h, 8a′,

8e′ 22a-b

heg MO^a

GTAATCGTACTTGCAGCAGGTGACA 9a-c

ﬂh MO^a

GGGAATCTGCATGGCGTCTGTTTAG

CACTGAGTCCTTATTTCACTATATC

GCTTGAGGTCTCTGATAGCCTGCAT

TATGTCTGCC

10

11

12

etV2 MO^a

Gene-Silencing Activities and Biophysical Properties of

Hairpin ntla cMOs. Reasoning that the hairpin cMO efﬁcacy

depends on the interplay between inhibitor length, stem-loop

conﬁguration, and linker formats, we used linker 2a to prepare

ntla cMOs with differing structures (8a-h; Figure 4 and Table

1). In particular, we varied the length of the inhibitory MO (10,

12, 14, and 16 bases) and evaluated both “blunt” and “staggered”

stem-loops. Each ntla cMO was synthesized, puriﬁed by ion-

exchange HPLC, injected into one-cell-stage zebraﬁsh embryos,

and photoactivated as before, except that a dose of 230 fmol/

embryo was evaluated in each case. This higher cMO concen-

tration was used for these studies to maximize our ability to

identify caged conﬁgurations with minimum basal activity.

The resulting phenotypes conﬁrmed that hairpin cMO activity

varies signiﬁcantly with inhibitor length and stem-loop struc-

ture. Within a stem-loop conﬁguration, increasing the number

of bases in the inhibitory oligomer decreased the cMO activity

under both basal and photoactivated conditions. The “blunt”

and “staggered” stem-loop conﬁgurations also exhibited distinct

activity proﬁles. The “staggered” system failed to achieve an

adequate activity differential between the caged and uncaged

forms under any of the conditions we tested. As described above,

cMO 8a still exhibited gene-silencing activity in its caged form,

even though it successfully induced class-I phenotypes upon

photoactivation. The other “staggered” cMOs (8b-d) had lower

basal activities, but their uncaged forms failed to yield strong

ntla mutant phenotypes. In contrast, the “blunt” stem-loop

design provided greater caging efﬁciency, and two cMOs, 8e

and 8f, exhibited dynamic ranges appropriate for conditional

gene silencing: these two reagents did not induce mutant

phenotypes in their caged forms, and photoactivation of the

cMOs yielded fully penetrant phenotypes in most embryos.

Since our linker-1-based ntla cMO utilized the same inhibitory

oligomer as the “staggered” reagent 8a,⁷these results underscore

the importance of matching linker and stem-loop structures

for optimum cMO activity.

spt MO^a

ntla 10-mer

“Staggered”^b

ntla 12-mer

“Staggered”^b

ntla 14-mer

“Staggered”^b

ntla 16-mer

“Staggered”^b

ntla 10-mer

“Blunt”^b

8a, 8a′

TATGTCTGCCTC

TATGTCTGCCTCAA

TATGTCTGCCTCAAGT

GCCTCAAGTC

8b

8c

8d

8e, 8e′

8f

ntla 12-mer

CTGCCTCAAGTC

GTCTGCCTCAAGTC

ATGTCTGCCTCAAGTC

CAAGTACGATTAC

GCTGCAAGTAC

GTACGATTAC

“Blunt”^b

ntla 14-mer

“Blunt”^b

8g

ntla 16-mer

8h

9a

“Blunt”^b

heg 13-mer

“Blunt”^b

heg 11-mer

“Staggered”^b

heg 10-mer

“Blunt”^b

9b

9c

ﬂh 10-mer

GCAGATTCCC

10

“Blunt”^b

etV2 10-mer

“Blunt”^b

GGACTCAGTG

11

spt 10-mer

GACCTCAAGC

12

“Blunt”^b

ntla RNA^c

ﬂh RNA^c

ATCGGAAATATGTCTGCCTCAAGTC

CTAAACAGACGCCATGCAGATTCCC

TGTCACCTGCTGCAAGTACGATTAC

GATATAGTGAAATAAGGACTCAGTG

ATGCAGGCTATCAGAGACCTCAAGC

-

heg RNA^c

etV2 RNA^c

spt RNA^c

^aMO oligomers for translational inhibition of targeted mRNA.

^bInhibitory MO oligomers for modulating cMO activity. ^cRNA

oligomers for thermal denaturation studies.

various stem-loop structures. Thermal denaturation curves for

the ntla MO/RNA duplex and ntla MO/inhibitor heterodimers

were acquired by mixing the ntla-targeting MO with the

complementary oligomers in a 1:1 ratio and measuring their

temperature-dependent changes in hypochromicity at 260 nm

(Figure 5 and Tables 1-3). For these studies, we used the

commercially available amine-functionalized ntla-targeting and

To better understand how cMO structure dictates in vivo

activity, we characterized the biophysical properties of each

reagent. We ﬁrst determined the binding energies for the ntla

MO/RNA duplex, each ntla MO/inhibitor heterodimer, and

9

J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009 13259

A R T I C L E S

Ouyang et al.

Table 4. Thermodynamic Parameters of Noncleavable ntla MO

Hairpins

T_m(°C)^{a c}

∆G_hairpin(kcal/mol)^{b c}

,

oligomer

8a′

8e′

72.6 ( 2.0

77.8 ( 0.9

-4.9 ( 0.6

-6.9 ( 0.5

^aMelting temperature of the noncleavable MO hairpin. ^bBinding free

energy of the hairpin at 28 °C. ^cT_mand ∆G_hairpinvalues were

determined from sigmoidal ﬁts of the thermal denaturation curves using

the hairpin algorithm in MeltWin 3.0b software.

Figure 5. Representative thermal denaturation curves for MO duplexes

corresponding to ntla cMOs 8a-h (ntla-targeting and inhibitory MOs, 0.5

µM each) and noncleavable hairpins 8a′ and 8e′.

inhibitor hairpins (8a′ and 8e′) (Scheme 2) using the bifunctional

but nonphotolabile cross-linker 2b, which was prepared from

3-(methylamino)propan-1-ol (3b) in analogy to the DMNB-

based reagent 2a (Scheme 2). Derivation of the ∆G values from

these thermal denaturation curves using a hairpin-binding

model³¹revealed that the intramolecular binding free energies

of 8a′ and 8e′ were -4.9 and -6.9 kcal/mol, respectively (Table

4).

Table 2. Thermodynamic Parameters of MO/Inhibitor Dimers

T_m(°C)^{b e}

,

oligomer^a

observed

predicted^c

∆G (kcal/mol)^{d e}

,

8a

8b

8c

8d

8e

8f

8g

8h

9a

9b

9c

10

11

12

36.3 ( 0.4

49.2 ( 1.3

52.5 ( 1.5

54.5 ( 0.9

45.7 ( 0.6

49.0 ( 0.8

56.1 ( 0.6

59.0 ( 0.7

41.4 ( 1.6

41.7 ( 2.3

32.2 ( 1.1

43.7 ( 1.1

40.5 ( 1.1

42.9 ( 1.2

38

46

49

57

42

49

57

61

44

34

42

-10.7( 0.2

-13.3( 0.3

-14.1( 0.2

-14.7( 0.1

-12.3( 0.3

-13.5( 0.3

-15.5( 0.2

-16.2( 0.4

-11.4( 0.2

-11.4( 0.5

-9.7( 0.1

Taken together, these in vitro binding energies provide

qualitative insights into how cMOs perform in vivo. Intermo-

lecular ntla MO/inhibitor interactions with ∆G values lower than

-12 kcal/mol are required for low basal activities, and “blunt”

hairpins exhibit higher caging efﬁciencies than their “staggered”

counterparts because of their greater stabilization of the in-

tramolecular MO/inhibitor duplex (Table 2 and Figure 4).

Surprisingly, the ∆G values for the “blunt” and “staggered” ntla

MO/inhibitor duplexes correlate with the inhibitor length and

sequence in a similar manner, yet the activities of their

corresponding ntla cMOs upon photoactivation diverge. For

example, the intermolecular ntla MO/inhibitor duplexes derived

from “blunt” ntla cMOs 8e and 8f have ∆G values of -12.3

and -13.5 kcal/mol, respectively, and activated forms of these

cMOs produce strong ntla mutant phenotypes. The other two

“blunt” ntla cMOs (8g and 8h) have ∆G values of -15.5 and

-16.2 kcal/mol, respectively, and both induce only partial loss-

of-function phenotypes upon linker photolysis. An in vitro ntla

MO/inhibitor ∆G value between -12 and -14 kcal/mol

therefore represents the optimal balance of basal and induced

activities for the “blunt” ntla cMOs. However, the “staggered”

ntla MOs (8a and 8b) fail to induce full ntla mutant phenotypes

after uncaging, even though their corresponding ntla MO/

inhibitor duplexes have ∆G values of -10.7 and -13.3 kcal/

mol.

-12.5( 0.5

-11.7( 0.3

-11.9( 0.2

^aDimers of MO and inhibitory MO oligomers with 3′ and 5′ amine

modiﬁcations, respectively. ^bMelting temperature of the MO/inhibitor

dimer. ^cPredicted melting temperature according to eq 10, which is

based upon the T_mand ∆G values for 8a-h. ^dBinding free energy of

the dimer at 28 °C. ^eT_mand ∆G values were determined from

sigmoidal ﬁts of the thermal denaturation curves using the non-

self-complementary algorithm in MeltWin 3.0b software.

Table 3. Thermodynamic Parameters of MO/RNA Dimers

oligomer^a

T_m(°C)

∆G (kcal/mol)^b

ntla

heg

ﬂh

etV2

spt

77.7 ( 0.8

83.4 ( 0.9

83.4 ( 0.8

73.9 ( 1.0

85.2 ( 1.2

-28.1 ( 2.4

-28.4 ( 2.2

-27.5 ( 2.1

-25.1 ( 2.8

-30.0 ( 3.2

^aDimers of 25-mer MO and RNA oligomers. ^bBinding free energy

of the MO/RNA dimer at 28 °C.

The molecular basis for these differing activities is unclear.

Our original solid-phase-chemistry-derived ntla MO⁷and the

“staggered” cMO 8a have identical targeting and inhibitory MO

sequences, suggesting that linker elements may contribute to

cMO activity after uncaging. In addition, the photolysis products

of ntla cMOs 8a and 8e are functionalized with linker substit-

uents that are not present in the oligomers used in our binding

energy measurements; the targeting MO liberated upon cMO

activation is 3′-functionalized with a 1,2,3-triazole and an

aliphatic amine, while the inhibitory oligomer is 5′-functional-

ized with an aliphatic chain and the DMNB-derived chro-

mophore. We therefore irradiated 8a and 8e with 360-nm light

and obtained thermal denaturation curves for the resulting ntla

MO/inhibitor heterodimers. Analysis of the photolysis products

by HPLC conﬁrmed that the two hairpin oligonucleotides are

uncaged with comparable efﬁcacies (∼75% conversion), and

the ∆G values for the resulting linker-functionalized ntla MO/

inhibitor complexes are similar to those observed for their

amine-functionalized counterparts (Figure S1 and Table S1 in

the Supporting Information). Since we were unable to discern

inhibitory MO oligomers prior to their modiﬁcation for cMO

synthesis. The thermal denaturation curves were ﬁt to a two-

state oligomer binding model³¹to provide the corresponding

∆G values at 28 °C, the standard temperature for culturing

zebraﬁsh embryos. These analyses indicated that the binding

free energy for ntla MO and its complementary 25-base RNA

is -28.1 kcal/mol, while binding free energies for the various

ntla MO/inhibitor duplexes range from -10.7 to -16.2 kcal/

mol. The ∆G values for intermolecular ntla MO/inhibitor

complexes correlated with the length and sequence content of

the inhibitory MOs, independent of the region of complemen-

tarity (corresponding to “blunt” vs “staggered” hairpins). To

assess binding energies for ntla MO/inhibitor interactions within

an intramolecular stem-loop, we next conducted hypochro-

micity measurements of “blunt” and “staggered” ntla MO

hairpins. Since the 260-nm absorbance measurements would

photolyze the ntla cMOs (8a-h), we synthesized two ntla MO/

(31) Marky, L. A.; Breslauer, K. J. Biopolymers 1987, 26, 1601–1620.

9

13260 J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009

Versatile Synthesis and Rational Design of Caged Morpholinos

A R T I C L E S

Figure 6. Schematic representation of cMO/RNA, MO/inhibitor (INH), and MO/RNA equilibria.

any thermodynamic differences between the intermolecular MO/

inhibitor duplexes corresponding to 8a and 8e, we next

interrogated whether RNA strand exchange rates might account

for their divergent activities in vivo. We incubated each ntla

MO/inhibitor duplex with complementary 25-base RNA for

different lengths of time and resolved the resulting MO/RNA

duplexes by polyacrylamide gel electrophoresis (Figure S2 in

the Supporting Information). The RNA exchange rates for the

“staggered” and “blunt” MO/inhibitor duplexes were indistin-

guishable in this assay; MO/RNA hybridization was complete

in both cases within the time frame of RNA addition. Thus, the

activity differences between 8a and 8e cannot be explained by

in vitro MO/inhibitor thermodynamics or kinetics alone, and

the two cMOs might exhibit divergent photolysis, inhibitor

dissociation, or RNA exchange rates in vivo.

Modeling of cMO Activity in Vivo. While the correlation

between MO/inhibitor interaction strength and cMO activity

provides qualitative guidelines for reagent design, a quantitative

thermodynamic analysis is necessary to predict cMO efﬁcacy

with greater precision (Figure 6). Prior to photolysis, cMOs

adopt “open” and “closed” states according to the equilibrium

constant K_hairpin(eq 1):

50 nL embryonic volume at 5 hpf), and using our ntla cMO 8e

data to establish ∆G values of -28.1, -12.3, and -6.9 kcal/

mol for the MO/RNA duplex, intermolecular MO/inhibitor

duplex, and intramolecular MO/inhibitor hairpin, respectively,

led to the prediction that essentially all of the ntla RNA is MO-

complexed before and after cMO photolysis. This conclusion

clearly deviates from the phenotypes we observed with ntla cMO

8e-injected embryos.

Since these predictions do not take into account the complex-

ity of MO and RNA interactions in live organisms, we sought

to empirically derive the activity proﬁles of MOs in vivo. We

ﬁrst investigated whether the relationship between ntla RNA

activity and total ntla MO concentration can still be described

as a two-state equilibrium, even though the apparent equilibrium

MO·RNA

constant for in vivo MO/RNA interactions (K

, analogous

app

to K^M_d^O·RNAin Figure 6) would include contributions from

oligonucleotide-binding proteins, RNA secondary structure, and

other embryonic factors. We injected the targeting MO into one-

cell-stage zebraﬁsh at doses of 0, 14, 28, 57, and 115 fmol/

embryo (approximate ﬁnal concentrations of 0, 0.28, 0.56, 1.1,

and 2.3 µM, respectively), lysed the embryos at 10 hpf, and

then detected the Ntla protein by quantitative immunoblotting

(Figure 7A). The ntla MO reduced the Ntla protein levels in a

dose-dependent manner that can be modeled as two-state

thermodynamic interaction, with the fraction of wild-type RNA

[cMO_open

]

K_hairpin

)

(1)

[cMO_closed

]

Act

activity remaining in MO-injected embryos (RNA /RNA

)

MO

WT

With the assumption that the total concentration of cMO prior

to uncaging ([cMO]_t) signiﬁcantly exceeds that of its RNA target

([RNA]_t), the basal level of RNA bound by the nonphotolyzed

cMO, given by ([cMO_open·RNA]/[RNA]_t), can be described as

a function of [cMO]_t, K_hairpin, and the dissociation constant for

the MO/RNA duplex (K^M_d^O·RNA) (eq 2):

described as a function of total MO concentration ([MO]_t) and

MO·RNA

K

app

(Figure 7B and eq 5):

Act

MO

MO·RNA

RNA

K

app

)

(5)

Act

WT

MO·RNA

RNA

K

+ [MO]_t

app

MO·RNA

[cMO_open· RNA]

Through this analysis, an apparent free-energy value (∆G

)

app

)

of -8.7 kcal/mol for embryonic ntla MO/RNA interactions was

[RNA]_t

obtained.

[cMO]_tK_hairpin

MO · RNA

It is important to note that this ∆G

value does not

app

(2)

[cMO]_tK_hairpin+ K_hairpinK_d^MO·RNA+ K_d^MO·RNA

reﬂect the actual binding constant for the ntla MO/RNA duplex

in zebraﬁsh embryos but instead is an aggregate descriptor of

MO/RNA afﬁnity, RNA accessibility, MO/protein interactions,

Upon photoactivation, the fraction of RNA complexed with the

released targeting MO is a function of [cMO]_t, K^M_d^O·RNA, and

and the inﬂuence of other embryonic factors on MO efﬁcacy.

the dissociation constant for the MO/inhibitor complex (K^M_d^O·INH

)

MO·RNA

Indeed, the 19.4 kcal/mol difference between ∆G

and

app

(eqs 3 and 4):

the corresponding in vitro ∆G value underscores how signiﬁcant

these other variables can be. Our empirical data, however,

suggest that this thermodynamic description can have predictive

value, even though it does not explicitly consider MO and RNA

interactions with other cellular components or possible kinetic

contributions to in vivo function. Thus, MO-induced gene

silencing can be modeled in these simpliﬁed thermodynamic

terms.

-K^M_d^O·INH

+

K^{MO·INH 2}+ 4K^M_d^O·INH[cMO]_t

(

√

)

d

[MO] )

2

(3)

(4)

[MO · RNA]

[RNA]_t

[MO]

K^M_d^O·RNA+ [MO]

)

To determine whether cMO activity can also be modeled in

simple thermodynamic terms, we next analyzed MO/inhibitor

interactions in vivo. We injected zebraﬁsh embryos with the

Setting [cMO]_tto a value of 4.6 µM, which approximates the

embryonic concentration of the ntla cMO (230 fmol/embryo,

9

J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009 13261

A R T I C L E S

Ouyang et al.

ntla MO (115 fmol/embryo; ∼2.3 µM) and various doses of

the 14-base inhibitor corresponding to ntla cMO 8g (0, 150,

450, and 1350 fmol/embryo; ∼0, 3, 9, and 27 µM, respectively).

The resulting Ntla protein levels at 10 hpf were then quantiﬁed

as before (Figure 7C). The inhibitory oligomer repressed the

ntla MO activity in a concentration-dependent manner that can

be modeled as a three-state, competitive equilibrium involving

MO, inhibitor, and RNA interactions (Figure 7D). The fraction

of wild-type RNA activity associated with each MO and

Act

inhibitor dose, RNA

/RNA , can be expressed as a

MO,INH

WT

function of the apparent equilibrium constant for MO/inhibitor

MO·INH

interactions (K

; analogous to K^M_d^O·INHin Figure 6), the

app

total concentration of the inhibitory oligomer ([INH]_t), and

[MO]_t(eqs 6 and 7):

Act

MO,INH

MO·RNA

RNA

K

app

)

(6)

Act

WT

MO·RNA

RNA

K

+ [MO]

app

[MO] ≈

-(K

MO·INH

app

- [MO]_t+ [INH]_t) +

K^MO·INH- [MO] + [INH] + 4K_a^M_p^O_p^·INH[MO]_t

2

(

√

)

app

t

(7)

2

MO·INH

Through this analysis, we derived an apparent ∆G

value

app

of -7.3 kcal/mol for 8g MO/inhibitor interactions. As with the

MO·RNA

∆G

value we determined for MO-dependent ntla silenc-

app

ing, this apparent free-energy value does not reﬂect the actual

binding constant for the ntla MO/inhibitor duplex in vivo but

instead integrates other interactions between these synthetic

oligonucleotides and cellular components. Since the 8.2 kcal/

MO·INH

mol difference between ∆G

and the corresponding in vitro

app

∆G value is signiﬁcantly smaller than the 19.4 kcal/mol

difference we observed for MO/RNA interactions (see Table 3

and Figure 7B), cellular factors appear to impact RNA activity

to a greater extent than MO function.

To assess the validity of modeling in vivo MO, RNA, and

inhibitor interactions in these simpliﬁed terms, we investigated

MO·RNA

MO·INH

whether the apparent ∆G

and ∆G

values can be

app

Figure 7. ntla MO/RNA and ntla MO/inhibitor interactions in vivo. (A)

Ntla protein knockdown in zebraﬁsh embryos injected at the one-cell stage

with various ntla MO doses. Ntla and ꢀ-actin levels at 10 hpf were detected

by immunoblotting and quantiﬁed. (B) These data can be modeled as a

used to predict how cMO gene-silencing activity will be

inﬂuenced by changes in inhibitor structure. As discussed above,

the fraction of total RNA activity inhibited by a complementary

MO and the mitigating inﬂuence of an inhibitory oligomer can

be described by eqs 5-7. In the case of a cMO, [MO]_tand

[INH]_twill be equal after photoactivation, and the fraction of

wild-type RNA activity remaining in the presence of photoac-

two-state equilibrium (solid line), yielding an apparent free energy value

MO·RNA

(∆G

) -8.7 kcal/mol) that describes MO/RNA interactions in live

app

embryos. (C) Ntla protein knockdown in embryos injected at the one-cell

stage with ntla MO (115 fmol/embryo) and various doses of the 14-base

inhibitory oligomer corresponding to ntla cMO 8g. Ntla and ꢀ-actin levels

at 10 hpf were detected by immunoblotting and quantiﬁed as above. (D)

Act

tivated cMO (RNA /RNA ) is therefore a function of

cMO

WT

Modeling of the 8g data in (C) as a three-state, competitive equilibrium

MO·RNA

MO·INH

K

, K

, and [cMO]_t(eqs 8 and 9):

app

MO·INH

(solid line) yields an apparent free-energy value (∆G

) -7.3 kcal/

app

mol) that describes 8g MO/inhibitor interactions in vivo. The graphical data

are means of triplicate samples with error bars representing the standard

deviations.

Act

cMO

MO·RNA

RNA

K

app

)

(8)

(9)

Act

WT

MO·RNA

RNA

K

+ [MO]

app

interactions associated with ntla cMOs 8e, 8f, 8g, and 8h can

be estimated as 1100, 140, 50, and 1.6 µM, respectively. Using

these parameters in the model described by eqs 8 and 9 leads

to the prediction that ntla cMOs 8e and 8f will be similar in

efﬁcacy to the conventional ntla MO, achieving at least a 90%

knockdown of Ntla protein expression levels (red lines in Figure

8A,B). In contrast, ntla cMOs 8g and 8h are predicted to exhibit

weaker efﬁcacies at the same embryonic dose, since the

inhibitory oligomer interacts more strongly with the targeting

MO (red lines in Figure 8C,D).

MO·INH

-K

+

K^{MO·INH 2}+ 4K^M_ap^O_p^·INH[cMO]_t

(

)

√

app

[MO] )

2

In the case of our ntla cMO experiments shown in Figure 4,

MO · RNA

K

and [cMO]_tcan be approximated as 0.48 µM

) -8.7 kcal/mol) and 4.6 µM, respectively. If it is

assumed that “blunt” MO/inhibitor interactions generally exhibit

a 8.2 kcal/mol difference between ∆G

sponding in vitro ∆G, the K

app

MO·RNA

(∆G

app

MO·INH

and the corre-

app

MO·INH

values for MO/inhibitor

app

9

13262 J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009

Versatile Synthesis and Rational Design of Caged Morpholinos

A R T I C L E S

Figure 8. Modeling of in vivo cMO activity. Photoactivated cMOs and MOs inhibit their RNA targets with different efﬁcacies, which diverge as the

MO/RNA interaction strength decreases. This divergent activity proﬁle is exacerbated when the MO/inhibitor interaction strength increases. RNA activity

curves for MOs and photoactivated cMOs associated with in vivo MO/RNA interaction energies of (red) -8.7 and (blue) -7.3 kcal/mol are shown for

intermolecular MO/inhibitor interaction energies estimated for the “blunt” ntla cMOs (A) 8e, (B) 8f, (C) 8g, and (D) 8h, assuming complete uncaging upon

irradiation. Actual photoactivation yields in vivo are likely 50-75% (see text). Photoactivated cMO and conventional MO activity proﬁles are drawn as solid

and dashed colored lines, respectively. The embryonic ntla cMO concentration used in our structure-activity studies (see Figure 4) is indicated in each panel

by the vertical black line.

Our observations in vivo match these predictions. Photoac-

tivated 8e and 8f yielded the strongest mutant phenotypes of

the ntla cMO conﬁgurations we tested. Moreover, the predicted

efﬁcacies of 8g and 8h are consistent with their photoinduced

phenotypes and the relationship between ntla RNA activity and

phenotypic class (compare Figures 3B, 4, 7A,B, and 8C,D),

especially considering that UV light penetrance and therefore

cMO uncaging efﬁciencies in vivo will be attenuated to some

degree. On the basis of our in vitro uncaging results (see Figure

S1 in the Supporting Information) and the observed phenotypes

for irradiated ntla cMO-injected embryos, we estimate that our

whole-organism irradiation procedure achieves cMO photoac-

binding proteins. Rather, the binding free energies for the intra-

and intermolecular MO/inhibitor duplexes dictate the fraction

of targeting MO that is free to anneal to its RNA target, thereby

establishing the basal and photoinduced activities of a given

MO·INH

cMO. Our ﬁndings suggest that cMOs should have ∆G

app

values of approximately -5 kcal/mol or greater for their

corresponding intermolecular MO/inhibitor duplexes, as this

interaction strength in vivo would allow efﬁcient gene-silencing

upon cMO photoactivation for a broad range of targeting MO

potencies. Maximizing the cMO activity in this manner,

however, is counterbalanced by the need to maintain the

“closed” cMO hairpin state prior to photoactivation. In fact,

MO·INH

tivation yields of 50-75%. Our model also predicts that cMO

the ∆G

value of -4.1 kcal/mol predicted for ntla cMO

app

MO·RNA

efﬁcacy will be increasingly compromised as ∆G

in-

8e may represent the optimum thermodynamic parameter for

cMO efﬁcacy. Further attenuation of the MO/inhibitor interac-

tion will eventually yield undesirable levels of basal activity,

and a small fraction of embryos injected with the ntla cMO 8e

exhibited weak mutant phenotypes without irradiation (see

Figure 4).

app

creases (compare the blue and red lines in Figure 8, which

represent a 10-fold change in MO/RNA interaction strength),

since the concentration of photoactivated cMO required to

achieve a given level of RNA silencing increases in a manner

disproportionate to that of a conventional MO. This latter issue

is of particular importance because the MO doses required to

induce mutant phenotypes vary signiﬁcantly between genes,

reﬂecting different RNA activity thresholds for wild-type

physiology and variable RNA sequence accessibilities. In

addition, MO doses greater than 1000 fmol/embryo (∼20 µM)

are generally avoided to minimize cytotoxicity.

In contrast, the MO/inhibitor interaction strength associated

with optimum cMO efﬁcacy should not vary signiﬁcantly

between genes. The 25-base targeting MOs are typically

designed to avoid secondary structures, and they are not known

to interact in a sequence-speciﬁc manner with DNA- or RNA-

Guidelines for Hairpin cMO Design. Taken together, our

results demonstrate that cMO activity can be modeled as a

competitive three-state equilibrium, even though this approach

does not explicitly consider how MO activity and RNA

accessibility are inﬂuenced by cellular proteins, RNA structure,

and other embryonic factors. Moreover, this analysis does not

require the determination of actual MO/RNA or MO/inhibitor

binding afﬁnities in whole embryos. We therefore sought to

establish simple guidelines for the preparation of cMOs targeting

other genes and to empirically test their validity. Such design

criteria would signiﬁcantly advance the use of cMOs in chemical

9

J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009 13263

A R T I C L E S

Ouyang et al.

Figure 9. Evaluation of heg, ﬂh, and spt cMO activities in vivo. (A) Embryos injected with a conventional heg MO recapitulate heg mutant phenotypes,

including enlarged heart chambers, no blood circulation, and cardiac edema. (B, C) Embryos injected with heg cMO 9a exhibit heg mutant phenotypes upon

photoactivation. (D) Embryos injected with a conventional ﬂh MO recapitulate ﬂh mutant phenotypes, including notochord ablation and somite fusion

through the trunk midline. (E, F) Embryos injected with ﬂh cMO 10 exhibit ﬂh mutant phenotypes upon photoactivation. (G) Embryos injected with a

conventional spt MO recapitulate spt mutant phenotypes, including a loss of trunk somitic tissue and mislocalized mesodermal progenitors in the posterior

(“spadetail” morphology). (H, I) Embryos injected with spt cMO 12 exhibit partial spt mutant phenotypes upon photoactivation. Nonspeciﬁc toxicity is also

observed (data not shown). Developmental stages: (A-C) 4 dpf; (D-F, G-I) 1 dpf. Scale bars: (A-C) 400 µm; (D-F, G-I) 200 µm.

and developmental biology research, especially considering the

ﬁnancial and time investments associated with these studies.

The disparate efﬁcacies of the two stem-loop structures indicate

that “blunt” cMO hairpins are preferable to “staggered”

conﬁgurations, and within our series of “blunt” ntla cMOs 8e-h,

in vitro MO/inhibitor ∆G values between -12 and -14 kcal/

mol yield an optimum balance between caged and uncaged

activities. Our modeling of cMO activity in vivo further suggests

that the higher MO/inhibitor ∆G value associated with ntla cMO

8e should be preferred, since it would maximize the inducible

gene-silencing activity over a broader range of targeting MO

efﬁcacies. This binding energy corresponds to a duplex melting

temperature of ∼45 °C (see Figure 5 and Table 2).

required for concentric growth of the heart.²⁴Embryos lacking

heg function exhibit abnormally large heart chambers with walls

that are only one cell thick and therefore incapable of sustaining

blood circulation. These defects are apparent by 2 dpf and can

be recapitulated with the heg-targeting MO (5′-GTAATCG-

TACTTGCAGCAGGTGACA-3′) at doses of 230 fmol/embryo

(∼4.6 µM) or higher (79%, n ) 48). By 4 dpf, heg mutants

and morphants exhibit severe cardiac edema (Figure 9A). To

generate a heg cMO (9a), we conjugated the targeting MO to

an inhibitory oligomer 5′-CAAGTACGATTAC-3′ using linker

2a (Tables 1-3). We then injected wild-type zebraﬁsh embryos

with 9a at the one-cell stage (460 fmol/embryo; ∼9.2 µM) and

either irradiated the embryos with 360-nm light at 2 hpf or

cultured them in the dark. By 4 dpf, the irradiated embryos had

no blood circulation and exhibited cardiac edema (86%, n )

21), while the nonirradiated zebraﬁsh had normal cardiac

patterning and function (98%, n ) 44) (Figure 9B,C and Figure

S3 in the Supporting Information). To further test the predictive

value of our cMO design criteria, we evaluated two additional

heg cMOs: one contained a “staggered” inhibitor (9b; inhibitor

sequence 5′-GCTGCAAGTAC-3) with an intermolecular MO/

inhibitor ∆G value comparable to that for 9a, and the other

contained a shorter “blunt” inhibitor (9c; inhibitor sequence 5′-

GTACGATTAC-3′) with a weaker MO/inhibitor interaction

strength (Tables 1 and 2). In comparison to 9a, these alternative

heg cMOs were less effective in vivo. The majority of zebraﬁsh

embryos injected with an equivalent dose of either 9b or 9c

exhibited heg mutant phenotypes in the absence of irradiation

(9b: 66%, n ) 53; 9c: 62%, n ) 45), indicating that these

structural conﬁgurations do not adequately cage the MO activity

(Figure S3). Thus, the design parameters established through

our ntla cMO structure-activity relationship studies are trans-

ferable to other genes.

To facilitate the design of thermodynamically equivalent

cMOs against other genes, we ﬁrst determined the relationship

between MO duplex sequence and thermal stability. By multiple-

regression analysis of the ntla MO/inhibitor pairs listed in Table

2, we determined that the melting temperature of MO duplexes

(T^M_m^O, in °C) is correlated with sequence content according to

eq 10 and can be empirically related to its in vitro ∆G value

(in kcal/mol at 28 °C) by eq 11:

T^M_m^O) 1.9(n_A+ n_T) + 5.7(n_G+ n_C)

∆G ) -0.25T^M_m^O- 1.4

(10)

(11)

In eq 10, each n_j(j ) A, T, G, C) is the number of times the

corresponding base appears in the MO sequence. Using this

equation, one can identify an appropriate inhibitor for a given

targeting MO, which ideally would generate a “blunt” hairpin

and have a predicted duplex melting temperature between 40

and 45 °C. This empirically derived algorithm should be most

accurate with MO duplexes similar in length to those in this

study, since it does not take into account the contribution of

nearest-neighbor effects.

We next tested the validity of our design criteria by targeting

four other zebraﬁsh genes: heg, ﬂh, etV2, and spadetail/tbx16

(spt). The transmembrane protein heg is expressed in the

endocardium during embryogenesis, mediating a signal that is

The ﬂh homeobox transcription factor is coexpressed with

ntla in the zebraﬁsh mesoderm, and loss of ﬂh expression also

causes ablation of the notochord.^25,32However, mesodermal

(32) Melby, A. E.; Kimelman, D.; Kimmel, C. B. DeV. Dyn. 1997, 209,

156–165.

9

13264 J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009

Versatile Synthesis and Rational Design of Caged Morpholinos

A R T I C L E S

progenitors normally fated to become the notochord do not

transform into medial ﬂoor plate cells in ﬂh mutants; rather,

these populations differentiate into ectopic muscle to create fused

somites. Since no ﬂh-targeting MO had yet been described, we

ﬁrst identiﬁed a ﬂh-blocking oligonucleotide (5′-GGGAATCT-

GCATGGCGTCTGTTTAG-3′) and demonstrated its efﬁcacy

in zebraﬁsh embryos (Figure 9D). This antisense reagent is a

potent inhibitor of ﬂh function, and a dose of 60 fmol/embryo

(∼1.2 µM) is sufﬁcient to cause replacement of the notochord

with axial muscle cells in 1 dpf zebraﬁsh (89%, n ) 19). On

the basis of our cMO design criteria, we synthesized a hairpin

ﬂh cMO (10) using linker 2a and a 5′-GCAGATTCCC-3′

oligomer as the MO inhibitor (Tables 1-3). Wild-type zebraﬁsh

were injected at the one-cell stage with 10 at a dose of 100

fmol/embryo (∼2 µM) and either globally irradiated with 360-

nm light for 10 s at 2 hpf or cultured in the dark. As expected,

the majority of nonirradiated ﬂh cMO-injected embryos devel-

oped normally (89%, n ) 28), while the irradiated embryos

lacked a notochord and had fused somites (100%, n ) 11),

matching the mutant phenotype (Figure 9E,F).

The etV2 transcription factor is expressed in the lateral

mesoderm during early somitogenesis and then in vascular

endothelial cells of the axial, head, and intersomitic vessels.²⁶

It is believed that these early etV2-expressing cells are endot-

helial precursors, and etV2 mutants or embryos injected with

an etV2-blocking MO (5′-CACTGAGTCCTTATTTCAC-

TATATC-3′) exhibit disrupted blood-vessel formation and lack

circulation.²⁶MO doses of 115 fmol/embryo (∼2.3 µM) or

higher are sufﬁcient to induce a fully penetrant mutant phenotype

(data not shown). We therefore synthesized a hairpin etV2 cMO

(11) containing a 5′-GGACTCAGTG-3′ inhibitory oligomer and

injected it into wild-type zebraﬁsh at the one-cell stage (230

fmol/embryo; ∼4.6 µM) (Tables 1-3). Embryos then irradiated

with 360 nm light for 10 s at 3 hpf had limited or no blood

circulation by 2.5 dpf (100%, n ) 12; see Supplementary Movie

1 in the Supporting Information), but most of the etV2 cMO-

injected embryos cultured in the dark exhibited normal blood

ﬂow (87%, n ) 15; see Supplementary Movie 2 in the

Supporting Information).

Finally, we designed and synthesized a cMO targeting spt,

which is another mesodermal T-box transcription factor.^21,33The

ntla and spt genes are expressed in overlapping domains during

early embryogenesis and then become restricted to the axial

and paraxial mesoderm, respectively. Cells with ntla function

become the notochord, while the spt-expressing cells contribute

to the skeletal muscle in the ﬂanking somites. A loss of spt

function therefore causes a severe deﬁcit in trunk somitic

mesoderm as well as a gross mislocalization of the correspond-

ing progenitor cells to posterior regions (hence the “spadetail”

name). These phenotypes can be recapitulated with a spt-

targeting MO 12 (5′-GCTTGAGGTCTCTGATAGCCTGCAT-

3′)³⁴at doses of 345 fmol/embryo (∼6.9 µM) or higher (61%,

n ) 23) (Figure 9G). As with the other cMOs described above,

we prepared the corresponding spt cMO hairpin using linker

2a and the inhibitory oligomer 5′-GACCTCAAGC-3′ (Tables

1-3). Wild-type embryos at the one-cell stage were injected

with 12, and a subset was globally irradiated with 360 nm light

for 10 s at 2 hpf. The majority of embryos cultured in the dark

developed normally (87%, n ) 24). Zebraﬁsh injected with a

dose of 700 fmol/embryo (∼14 µM) exhibited a loss of trunk

mesoderm but not posteriorly mislocalized progenitor cells upon

cMO photoactivation (31%, n ) 16) and also showed nonspe-

ciﬁc developmental defects due to general MO toxicity (62%,

n ) 16) (Figure 9H,I). These phenotypes indicate that the

photoactivated spt cMO 12 is not able to fully recapitulate the

activity of the conventional MO and that this reagent also

exhibits greater nonspeciﬁc toxicity. Thus, although our design

criteria were successful for cMOs targeting ntla, heg, ﬂh, and

etV2, there can be unforeseen MO or inhibitor interactions with

embryonic factors that reduce cMO efﬁcacy in certain situations.

In the case of the spt cMO, one possibility is that a 700 fmol/

embryo dose of the 35-base reagent approaches the toxicity level

of a 1000 fmol/embryo dose of the conventional 25-base MO.

Development of

a BHQ-Based cMO for Two-Photon

Activation. To conclude our studies, we investigated the ability

of our hairpin cMO design to incorporate other photocleavable

groups. While nitrobenzyl-based chromophores such as the

DMNB group in our ntla, ﬂh, heg, etV2, and spt cMOs have

been widely used in biological applications, the UV light

required for their photolysis is potentially damaging and difﬁcult

to restrict in three-dimensional space. Two-photon excitation

typically uses wavelengths greater than 700 nm and affords

greater spatial resolution, but the DMNB group and most other

caging moieties have small two-photon cross sections and are

therefore inefﬁciently cleaved under these conditions. Two

notable exceptions are the bromohydroxycoumarin (BHC)²³and

bromohydroxyquinoline (BHQ)²⁷groups. Since the low ﬂuo-

rescence of BHQ chromophores makes them particularly useful

for biological applications, we designed a BHQ-based bifunc-

tional cross-linker (13, Scheme 3) for the preparation of cMOs.

As with our DMNB-based linker 2a, this two-photon-sensitive

linker incorporates an N-hydroxysuccinimide ester and a

terminal alkyne to enable orthogonal coupling to appropriately

modiﬁed MO oligomers.

To synthesize linker 13, we ﬁrst prepared BHQ derivative

14 as previously described²⁷and then protected its phenolic

hydroxyl group with a benzenesulfonyl moiety to give 15. The

2-methyl group of 15 was then oxidized with selenium dioxide,

and the resulting aldehyde 16 was allylated to give alcohol 17.

Oxidative cleavage of 17 yielded aldehyde 18,³⁵which was

reductively aminated with aqueous methylamine in the presence

of NaBH(OAc)₃to give the amino alcohol intermediate 19. In

analogy to Scheme 1, compound 19 was acylated to form the

amide 20, and 1,1′-carbonyldiimidazole-mediated coupling of

this product with 6-amino-N-(prop-2-ynyl)hexanamide afforded

carbamate 21. Phenol deprotection and ester saponiﬁcation of

21 were simultaneously accomplished with 0.2 M NaOH to give

an acid intermediate, which was re-esteriﬁed with N-hydroxy-

succinimide in the presence of 1-ethyl-3-(3′-dimethylamino-

propyl)carbodiimide to give the two-photon-sensitive linker 13.

The bifunctional linker was then used to assemble ﬂuorescein-

conjugated and nonﬂuorescent ntla cMOs (22a and 22b,

respectively; Chart 2) using the corresponding inhibitory oli-

gomers (23a and 23b), which are analogous to that in the

optimum DMNB-containing ntla cMO 8e (Figure 4 and Table

1). Since the BHQ group has not been used previously with

carbamates and other BHQ-caged compounds have not been

tested in cultured cells or live organisms, we ﬁrst determined

whether the BHQ carbamate is stable in vivo and can be

(33) Grifﬁn, K. J.; Amacher, S. L.; Kimmel, C. B.; Kimelman, D.

DeVelopment 1998, 125, 3379–3388.

(34) Bisgrove, B. W.; Snarr, B. S.; Emrazian, A.; Yost, H. J. DeV. Biol.

2005, 287, 274–288.

(35) Yu, W.; Mei, Y.; Kang, Y.; Hua, Z.; Jin, Z. Org. Lett. 2004, 6, 3217–

3219.

9

J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009 13265

A R T I C L E S

Ouyang et al.

Scheme 3. Synthesis of Bifunctional BHQ Linker 13^a

^aReagents and conditions: (a) benzenesulfonyl chloride, DIPEA, CH₂Cl₂, 97%; (b) SeO₂, dioxane, 80 °C, 91%; (c) In powder, allyl bromide, NH₄Cl(aq),

THF, 96%; (d) K₂OsO₄·2H₂O, lutidine, dioxane, H₂O, then NaIO₄, 75%; (e) methylamine(aq), NaBH(OAc)₃, MeOH, H₂O, 81%; (f) methyl adipoyl chloride,

DIPEA, CH₂Cl₂, 59%; (g) carbonyldiimidazole, DMF then 6-amino-N-(prop-2-ynyl)hexanamide, DIPEA, DMF, 81%; (h) 0.2 M NaOH(aq), THF, MeOH,

82%; (i) N-hydroxysuccinimide, EDCI, DMF, 48%.

Chart 2. Schematic Representation of BHQ-Based ntla cMOs 22a and 22b and Their Corresponding Precursors 23a and 23b

efﬁciently photolyzed. We injected ntla cMO 22a into wild-

type zebraﬁsh embryos at the one-cell stage (230 fmol/embryo)

and irradiated a subset of them with 360-nm light for 10 s at 3

hpf. The embryos were then cultured for another day and scored

according to the four phenotypic classes described above. As

we hoped, the BHQ-based ntla cMO exhibited activity es-

sentially identical to that of the DMNB-based reagent 8e;

embryos injected with this reagent developed normally when

cultured in the dark but displayed a ntla phenotype upon

irradiation (Figure S4 in the Supporting Information).

We then examined whether the BHQ-based ntla cMO 22b

could be activated in targeted regions of the zebraﬁsh embryo

using two-photon excitation. These experiments followed studies

conducted previously in our laboratory, in which we uncaged a

DMNB-based ntla cMO in a subset of mesodermal progenitor

cells, selectively inducing them to differentiate into medial ﬂoor

plate cells rather than the notochord.⁷To identify the irradiated

cells in this earlier investigation, we coinjected the zebraﬁsh

embryos with mRNA encoding Kaede ﬂuorescent protein, which

undergoes a green-to-red photoconversion upon one-photon

excitation. Because Kaede is inefﬁciently converted by two-

photon excitation, we utilized a caged coumarin ﬂuorophore

conjugated to dextran (dextran-HCC-NPE) as a cell-autono-

mous photoactivatable tracer (Figure S5 in the Supporting

Information). This new class of caged coumarins is highly

sensitive to two-photon irradiation,^36,37and dextran-HCC-NPE

has demonstrated efﬁcacy in vivo.³⁸We injected dextran-HCC-

NPE into one-cell-stage embryos with either the BHQ-based

(36) Dakin, K.; Li, W. H. Nat. Methods 2006, 3, 959.

(37) Zhao, Y.; Zheng, Q.; Dakin, K.; Xu, K.; Martinez, M. L.; Li, W. H.

J. Am. Chem. Soc. 2004, 126, 4653–4663.

9

13266 J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009

Versatile Synthesis and Rational Design of Caged Morpholinos

A R T I C L E S

opmental biology community will require efﬁcient synthetic

procedures and general principles for cMO design. To advance

these goals, we have devised a bifunctional linker for the

synthesis of hairpin cMOs that enables these probes to be

prepared in three steps from commercially available reagents.

This optimized synthetic procedure has enabled us to prepare

several ntla-targeting cMOs of differing conﬁgurations, and we

have used these structural variants to determine how the

thermodynamic properties of cMOs correlate with their in vivo

functions. Our studies reveal that hairpin cMO function is highly

dependent on the sequence and location of the complementary

inhibitor as well as the linker structure.

We further observed that MO/MO and MO/RNA binding free

energies in vitro differ dramatically from the apparent free

energies of their functional interactions in vivo, undoubtedly

reﬂecting the inﬂuence of oligonucleotide-binding proteins, RNA

secondary structure, and other embryonic factors. Although the

apparent free-energy values obtained through our in vivo studies

cannot accurately describe the true MO and RNA binding

afﬁnities in zebraﬁsh embryos, our ﬁndings demonstrate that

these thermodynamic descriptors can be used to predict MO

efﬁcacy. Thus, cMO activity in vivo can be modeled as a

competitive three-state equilibrium, and the complex interactions

between MOs and embryonic factors can be treated as an

aggregate phenomenon. Our ﬁndings establish a metric for cMO

design, which we have successfully applied to cMOs that target

the ﬂh, heg, and etV2 genes, and these empirically derived

principles will help guide future applications of cMOs in

functional genomic studies. Our insights should also be ap-

plicable to other caged hairpin reagents, including those based

upon ncPNAs and 2′-O-methyl RNAs.²²Although these oligo-

nucleotide analogues interact with complementary oligomers

with distinct in vitro and in vivo free energy values, their design

and biological application are subject to the same principles

outlined in this study. As illustrated by the partial phenotypes

we observed with our spt cMO, however, the activity of caged

hairpin oligonucleotides can be attenuated in vivo through

mechanisms that are not yet understood. We anticipate that our

guidelines for cMO design will become more reﬁned as this

chemical technology is more broadly utilized in embryological

research.

Figure 10. Two-photon uncaging of the BHQ-based ntla cMO in vivo.

(A) Schematic representation of embryos injected with the dextran-HCC-

NPE photoactivatable tracer and then two-photon-irradiated within the

posterior axial mesoderm at the 10 hpf stage (red square, dorsal view). By

1 dpf, these irradiated cells normally differentiate into vacuolated notochord

cells (red rectangle, lateral view) toward the end of the yolk extension. (B)

IR gradient contrast image of the posterior axial mesoderm with the targeted

irradiation area indicated by the dashed red box (dorsal view). (C)

Fluorescent image of the same region prior to irradiation (excitation, 820

nm; emission, 525/70 nm). (D) Fluorescent image post-irradiation (same

conditions as in C). (E) Embryos injected with the dextran-HCC-NPE and

oligomer 23b contained a cluster of blue-ﬂuorescent notochord (nc) cells

by 1 dpf (lateral view; excitation, 436/20 nm; emission, 480/40 nm). (F)

Embryos injected with dextran-HCC-NPE and ntla cMO 22b exhibited

medial ﬂoor plate (mfp) cells with blue ﬂuorescence and few ﬂuorescently

labeled notochord cells (same conditions as in E). Scale bars: 50 µm.

Finally, the modularity of our hairpin cMOs provides an

opportunity for future improvements to this technology, as

illustrated by our development of a BHQ-based cMO that is

compatible with two-photon excitation. For example, linkers

that minimize the entropic loss associated with stem-loop

formation could increase the energetic difference between inter-

and intramolecular MO/inhibitor duplexes, thereby improving

the dynamic range of basal and photoinduced activities. Alterna-

tive approaches might involve incorporating the photocleavable

bond within the inhibitory oligomer or caging the MO with two

short complementary oligomers rather than one long inhibitor.

Investigating these possibilities through organic synthesis will

expand the utility of cMO technologies and help shed new light

on the molecular mechanisms of embryonic development.

ntla cMO 22b or the BHQ-conjugated inhibitory oligomer 23b.

An 80 µm × 60 µm × 50 µm region of the posterior, axial

mesoderm at the end of gastrulation was then subjected to two-

photon irradiation for 2 min (Figure 10A-D). These cells

normally differentiate into vacuolated notochord cells by 1 dpf,

and the embryos injected with the coumarin tracer and BHQ-

functionalized ntla MO inhibitor 23b contained a cluster of blue-

ﬂuorescent notochord cells toward the end of the yolk extension

(Figure 10A,E). In contrast, embryos injected with both the

photoactivatable tracer and ntla cMO 22b exhibited medial ﬂoor

plate cells with blue ﬂuorescence and few, if any, ﬂuorescently

labeled notochord cells (Figure 10F). These observations conﬁrm

the sensitivity of the BHQ-based reagent to two-photon pho-

tolysis and illustrate the versatility of the hairpin cMO archi-

tecture.

Experimental Section

Conclusion

General Synthetic Procedures. All of the reactions were carried

out in ﬂame-dried glassware under an argon atmosphere using

commercial reagents without further puriﬁcation, unless otherwise

indicated. Reactions were magnetically stirred and monitored by

thin-layer chromatography (TLC) using glass-backed silica gel

60_F254(Merck, 250 µm thickness). Yields refer to chromatographi-

Photoactivatable MOs are valuable probes of embryonic

patterning mechanisms, and their implementation by the devel-

(38) Guo, Y. M.; Chen, S.; Shetty, P.; Zheng, G.; Lin, R.; Li, W. H. Nat.

Methods 2008, 8, 835–841.

9

J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009 13267

A R T I C L E S

Ouyang et al.

cally and spectroscopically pure compounds, unless otherwise

MO Microinjections. Various MO, MO/inhibitor duplex, and

cMO solutions containing 0.1% (w/v) phenol red were prepared

and microinjected at 1 or 2 nL/embryo. For example, to inject 115

fmol of MO, 2 nL of a 57.5 µM solution containing 0.1% (w/v)

phenol red was injected into each zebraﬁsh embryo at the one-cell

stage. All embryo injections were done according to standard

procedures, and the embryos were subsequently cultured in E3

medium at 28.5 °C. For two-photon experiments, solutions contain-

ing 1.25 mM dextran-HCC-NPE and 0.1% (w/v) phenol red with

or without 57.5 µM cMO 22b were injected at 2 nL/embryo.

Photolysis of cMOs in Vitro. Photolysis reactions were per-

formed by dissolving 1 nmol of cMO hairpin in water (2 µL) and

irradiating for 1 min using a Leica DM4500B compound micro-

scope equipped with an A4 ﬁlter cube (ex: 360 nm, 40 nm bandpass)

and a 20× water-immersion objective (0.50 NA, 13 mW/cm²

intensity at 360 nm). Longer irradiation times did not improve

reaction yields. The solutions were then adjusted to pH 11.5 with

0.02 M NaOH and analyzed by HPLC using a DNAPac PA-200

ion-exchange column (Dionex, 4 mm × 250 mm). Aqueous running

buffers were (A) 0.02 M NaOH, 1% ACN and (B) 0.375 M NaClO₄

in 0.02 M NaOH and 1% ACN. The HPLC gradient was 7 to 50%

B in 27 min at 1.2 mL/min.

stated. SiO₂chromatography was carried out with EM Science silica

1

gel (60 Å, 70-230 mesh) as a stationary phase. H NMR and ¹³

C

NMR spectra were acquired on Varian 300, 400, and 500 MHz

spectrometers and standardized to the NMR solvent peak. Elec-

trospray mass spectrometry (ESI-MS) was performed using a

Micromass ZQ single-quadrupole liquid chromatograph-mass

spectrometer (LC-MS) and a Micromass Q-TOF hybrid quadrupole

LC-MS. Detailed synthetic procedures and structural characteriza-

tion data are provided in the Supporting Information.

Representative Procedure for MO Inhibitor Synthesis (7e).

An MO oligomer (5′-GCCTCAAGTC-3′) with 5′-amine and 3′-

ﬂuorescein modiﬁcations was purchased from Gene-Tools, LLC

and used without further puriﬁcation. This oligomer (100 nmol)

was dissolved in borate buffer [0.1 M Na₂B₄O₇(pH 8.5), 100 µL]

and combined with linker 2a (0.76 mg, 1.5 µmol) in DMSO (15

µL). The reaction was shaken overnight in the dark and then

lyophilized to dryness. The resulting yellow gum was dissolved in

water (0.5 mL), washed three times with CHCl₃(0.5 mL), and

diluted to 1.5 mL with water. The yellow solution was loaded onto

Toyopearl Super-Q resin (400 µL), washed three times with wash

solution [aqueous 2.5 mM Na₂B₄O₇(pH 8.5), 50% acetonitrile

(ACN)] and two times with water. Fluoresceinated oligomers were

eluted from the resin with 600 µL of aqueous 5% HOAc/50% ACN,

washed three times with CHCl₃(0.6 mL), and neutralized with 10%

NH₄OH(aq) (0.3 mL). Solvent was removed in vacuo, and the

remaining NH₄OAc was removed by repeated aqueous solubiliza-

tion and lyophilization, affording 7e as a yellow solid (70 nmol,

70%). MS-ESI for 7e [M + H]⁺(m/z): calcd for C₁₈₄H₂₆₄N₆₉O₆₁P₁₀,

4728; found, 4728.

Photoactivation of cMOs in Vivo. Zebraﬁsh embryos between

the 64- and 256-cell stages were arrayed in an agarose microin-

jection template. Mercury lamp light was focused onto the

individual embryos for 10 s using a Leica DM4500B compound

microscope equipped with an A4 ﬁltercube and a 20× water-

immersion objective. Embryos were oriented with the animal pole

facing the light source. Following photoactivation, embryos were

cultured in E3 medium at 28.5 °C.

Two-Photon Irradiation of cMOs. Two-photon cMO photo-

activation in zebraﬁsh embryos was performed on an upright two-

photon confocal microscope (Ultima XY, Prairie Technologies, Inc.,

Middleton, WI) equipped with two Ti:sapphire lasers (Mai Tai HP,

Spectra Physics, Mountain View, CA) and a 40× (0.8 NA) water-

immersion objective (LUMPlanFl/IR, Olympus America, Center

Valley, PA). The 820-nm illumination from the ﬁrst laser (10 mW

at the back focal plane of the objective) was used to collect two

initial images for each embryo: an epiﬂuorescence image (bandpass:

525 nm center, 70 nm fwhm) and an IR gradient contrast image

(820-nm illumination).⁴⁰Using the gradient contrast image, an 80

µm × 60 µm × 50 µm region of interest (ROI) was selected for

photoactivation. The ROI was then illuminated for 2 min at 750

nm (65 mW at the back focal plane of the objective) with the second

laser. Following photoactivation, the embryo was reimaged with

820-nm illumination. Following two-photon irradiation, embryos

were cultured in E3 medium at 28.5 °C.

Bright-Field and Fluorescence Microscopy. Chorions were

manually removed from 1 dpf embryos, which were immobilized

in E3 medium containing 0.7% (w/v) low-melt agarose and 0.05%

(w/v) tricaine. Bright-ﬁeld images were obtained at 5× with a Leica

MZFLIII ﬂuorescence stereoscope equipped with a Leica DC300F

digital camera. Differential interference contrast images and time-

lapse movies were obtained with a Leica DM4500B ﬂuorescence

microscope equipped with a 10× (0.25 NA) objective and a

QImaging Retiga-SRV digital camera. Fluorescence images were

also obtained with this equipment and a CFP ﬁlterset (excitation,

436/20 nm; emission, 480/40 nm).

Representative Procedure for cMO Synthesis (8e). The

inhibitory oligomer 7e (50 nmol) and azide-functionalized ntla MO⁷

6 (50 nmol) were dissolved in phosphate buffer [KH₂PO₄(pH 8.0),

230 µL]. To this mixture was added sodium ascorbate (99.0 µg,

500 nmol) in 25 µL of water followed by TBTA (265 µg, 500

nmol) and CuI (95.2 µg, 500 nmol) in 50 µL of DMSO. The

reaction mixture was brieﬂy sonicated and then stirred overnight

at room temperature in the dark. Precipitate was removed from the

reaction mixture by centrifugation, and the supernatant was split

and desalted over two Zeba Desalt size-exclusion columns (Pierce)

according to the manufacturer’s instructions. The desired product

was puriﬁed from the reaction mixture by adjusting the solution

pH to 11.5 with 1 M NaOH(aq) and loading it onto a DNAPac

PA-100 ion-exchange HPLC column (Dionex, 9 mm × 250 mm).

Aqueous running buffers were (A) 0.02 M NaOH, 1% ACN and

(B) 0.375 M NaClO₄in 0.02 M NaOH and 1% ACN. A stepwise

gradient was used to separate the product and starting materials,

with speciﬁc conditions determined by column capacity. A repre-

sentative puriﬁcation gradient was the following: 7 to 19% B in 5

min, 19 to 22% B in 10 min, 22 to 50% B in 1 min, and 50% B for

9 min (ﬂow rate 4 mL/min). Elution fractions were collected with

the UV-vis ﬂow-cell lamp turned off to prevent photolysis.

Fractions (1 mL) were collected every 15 s and buffered with 1 M

NH₄OAc(aq) (pH 5.0) (40 µL). The fractions containing ﬂuores-

ceinated product were combined and desalted over a Zeba size-

exclusion column. The eluent volume was reduced in vacuo to 50

µL, and the cMOs were precipitated with acetone (400 µL). After

centrifugation, the supernatant was discarded, and the cMO pellet

was washed with ACN (100 µL) and brieﬂy lyophilized, affording

8e as a yellow solid (7 nmol, 14%). MS-ESI for 8e [M + H]⁺

(m/z): calcd for C₄₈₈H₇₃₇N₂₁₉O₁₆₄P₃₅, 13379; found, 13380.

Zebraﬁsh Aquaculture and Husbandry. Adult zebraﬁsh (wild-

type AB strain) were acquired from the Zebraﬁsh International

Resource Center. Embryos used in these studies were obtained by

natural matings and cultured in E3 embryo medium at 28.5 °C

according to standard procedures.³⁹

Determination of MO Duplex Binding Energies. For inter-

molecular MO duplexes, the complementary oligomers (0.5 µM,

1:1 molar ratio) in buffer [100 mM KCl, 20 mM HEPES, 10 mM

MgCl₂, 0.1 mM EDTA (pH 7.0), 1 mL] were denatured at 95 °C

for 5 min. Thermal denaturation curves were obtained by monitoring

temperature-dependent changes in the absorbance of 260-nm light

using a Varian Cary 300 spectrophotometer (annealing at 0.5 °C/

min). The hypochromicity curves were ﬁtted to a sigmoidal

function, and thermodynamic parameters were calculated using the

(39) Zebraﬁsh: A Practical Approach; Nusslein-Volhard, C., Dahm, R.,

(40) Dodt, H.; Eder, M.; Frick, A.; Zieglgansberger, W. Science 1999, 286,

Eds.; Oxford University Press: New York, 2002; Vol. 261.

110–113.

9

13268 J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009

Versatile Synthesis and Rational Design of Caged Morpholinos

A R T I C L E S

non-self-complementary algorithm in MeltWin 3.0b software.

Binding free energies were calculated at 28 °C. For intermolecular

MO/RNA duplexes, the complementary MO and RNA oligomers

were used in a 2:1 molar ratio to minimize hypochromicity changes

due to RNA self-annealing. For intramolecular duplexes, thermo-

dynamic parameters were calculated using the hairpin algorithm

in MeltWin 3.0b software.

denatured at 95 °C for 2 min and annealed by cooling to 28 °C

over 15 min. The complementary, 3′-ﬂuoresceinated 25-base RNA

(3 µM in the above buffer, 2 µL) was then added to the annealed

MO duplex solution to achieve a ﬁnal RNA concentration of 0.2

µM. The mixture of oligomers was incubated at 28 °C for either 1

or 10 min and then chilled to 4 °C on ice. The “0 min” sample was

prepared by adding the RNA to the annealed MO duplex solution

at 4 °C, and the MO/RNA duplex was prepared by heat denaturation

and annealing, as was done for the MO/inhibitor duplexes. All of

the samples were then immediately mixed with chilled loading dye

[6× stock: 60% glycerol, 0.1 M Tris-HCl, 90 mM boric acid, 1

mM EDTA, 0.9 mM xylene cyanol (pH 8.4)] and resolved on a

15% Tris-borate-EDTA acrylamide gel at 200 V for 20 min at 4

°C. After electrophoresis, the acrylamide gel was analyzed with a

GE Typhoon imager (488 nm excitation, 580 nm emission).

Western Blot Analysis. At bud stage (10 hpf), wild-type and

MO-injected embryos were dechorinated with Pronase (1 mg/mL)

for 10 min at 28 °C. The embryos were transferred to microcen-

trifuge tubes and homogenized with a pipet in TM1 buffer [180

µL/sample; 100 mM NaCl, 5 mM KCl, 5 mM HEPES (pH 7.0),

1% (w/v) PEG-20000] containing protease inhibitors [1 mM PMSF,

5 mg/mL complete Mini protease inhibitor cocktail, EDTA-free

(Roche)] to remove yolks. Following centrifugation (500g, 5 min,

4 °C), the TM1 solution was replaced, and the pelleted cells were

homogenized again with a pipet and recentrifuged. Eighteen

deyolked embryos from each set of experimental conditions were

vortexed in SDS-PAGE loading buffer [50 µL/sample; 100 mM

Tris-HCl (pH 6.8), 330 mM 2-mercaptoethanol, 4% (w/v) SDS,

20% (v/v) glycerol, 100 mM DTT], sonicated for 1 min, and heated

to 100 °C for 5 min. The lysates were resolved on a 4-12% Bis-

Tris gradient acrylamide gel (ﬁve embryos/lane) and blotted onto

nitrocellulose according to standard protocols. Anti-Ntla antibody

was used at a 1:2000 dilution in 1× phosphate-buffered saline

containing 0.1% (v/v) Tween 20 and 0.2% (w/v) I-Block (Roche).

The anti-Ntla antibody was then detected using a horseradish

peroxidase-conjugated anti-rabbit IgG antibodies (GE) at 1:10000

dilution and the SuperSignal West Dura Extended Duration

Substrate kit (Pierce) according to the manufacturer’s instructions.

The chemiluminescence from the membrane was digitally imaged

(ChemiDoc XRS, Biorad), and the band intensity was measured

with Quantity One 4.5 software. The nitrocellulose membranes were

then reprobed with mouse anti-ꢀ-actin [sc-8432 (Santa Cruz

Biotechnology) at a 1:250 dilution or clone AC-15 (Sigma) at a

1:10000 dilution] and horseradish peroxidase-conjugated anti-mouse

IgG antibodies (GE) at 1:10000 dilution to normalize for loading

differences between lanes.

Acknowledgment. We thank Profs. Dan Herschlag (Stanford),

Eric Kool (Stanford), and Timothy Dore (University of Georgia)

for thoughtful discussions, Prof. Kool and the Stanford Center on

Polymer Interfaces and Macromolar Assemblies for access to

instrumentation, and Profs. John Mably (Harvard) and Nathan

Lawson (University of Massachusetts-Worcester) for providing us

with MO reagents that we used to synthesize the heg and etV2

cMOs, respectively. I.A.S. and X.O. acknowledge training support

from the California Institute for Regenerative Medicine (T1-0001)

and a Bio-X Stanford Interdisciplinary Graduate Fellowship,

respectively. This work was supported by the National Institutes

of Health (R01 GM072600 to J.K.C. and R01 GM077593 to W.-

H.L.), the March of Dimes Foundation (Basil O’Connor Research

Starter Awards 5-FY04-205 and 1-FY-08-433 to J.K.C.), and the

Welch Foundation (I-1510 to W.-H. L.).

Supporting Information Available: Synthetic procedures,

NMR spectra, and mass spectrometry data for all compounds;

supporting ﬁgures, charts, and schemes; supplementary movies;

and derivations of eqs 1-9. This material is available free of

charge via the Internet at http://pubs.acs.org.

Gel-Shift Analysis of MO/Inhibitor Exchange with RNA.

Targeting and inhibitory oligomers corresponding to ntla cMOs

8a and 8e (5 µM, 1:1 molar ratio) in buffer [100 mM KCl, 20 mM

HEPES, 10 mM MgCl₂, 0.1 mM EDTA (pH 7.0), 28 µL] were

JA809933H

9

J. AM. CHEM. SOC. VOL. 131, NO. 37, 2009 13269

Article Doi

Versatile synthesis and rational design of caged morpholinos

DOI: 10.1021/ja809933h

Source and publish data:

Authors:

Article abstract of DOI:10.1021/ja809933h

Full text of DOI:10.1021/ja809933h

Products guided by the article

R&D Labs maybe for 1185730-53-3

Relevant to this article

Hot Product