3478
F. Bakir et al. / Bioorg. Med. Chem. Lett. 17 (2007) 3473–3479
11. Grefhorst, A.; van Dijk, T. H.; Hammer, A.; van der
Sluijs, F. H.; Havinga, R.; Havekes, L. M.; Romijn, J. A.;
Groot, P. H.; Reijngoud, D. J.; Kuipers, F. F. Am. J.
Physiol. Endocrinol. Metab. 2005, 289, 829.
12. Cao, G.; Liang, Y.; Broderick, C. L.; Oldham, B. A.;
Beyer, T. P.; Schmid, R. J.; Zhang, Y.; Stayrook, K. R.;
Suen, C.; Otto, K. A.; Miller, A. R.; Dai, J.; Foxworthy,
P.; Gao, H.; Ryan, T. P.; Jiang, X. C.; Burris, T. P.;
Eacho, P. I.; Etgen, G. J. J. Biol. Chem. 2003, 278, 1131.
13. Michael, L. F.; Schkeryantz, J. M.; Burris, T. P. Mini-Rev.
Med. Chem. 2005, 5, 729.
14. Virtual screening was performed with the program
GLIDE (Schro¨dinger). A set of 145 LXR agonists
reported in the literature were used to establish conditions
using the crystal structure of human LXRb (P8D.pdb). A
collection of 135,000 compounds was screened and the
1290 top scoring compounds were selected for assay.
15. High-throughput genomics screening was performed using
the ArrayPlate technology in a contract service provided
by HTG, Inc. The ArrayPlate technology is a quantitative
nuclease protection assay for multiplex gene profiling
16. The HTRF cofactor peptide recruitment assay was modi-
fied from a previous report.24 Polyhistidine-tagged human
LXRa (2 nM) or b (1 nM) ligand-binding domain (Roche
Diagnostics, Indianapolis, IN) was mixed with the test
compound, 20 nM biotin-SRC1 peptide (Synpep, Dublin,
CA), 5 nM streptavidin–allophycocyanin, and europium-
labeled anti-polyhistidine antibody (1 and 0.5 nM for a and
b, respectively) in 50 mM Tris, pH 7.5, 50 mM KCl, 1 mM
EDTA, 0.1% BSA, and 1 mM DTT. The final volume of the
mixture was 40 lL in a 384-well assay plate. The mixture
was incubated at room temperature for 1 h with shaking.
Time-resolved fluorescence was measured at 615 and
665 nm on a LJL Analyst plate reader. The ratio of 665/
615 was used to calculate EC50 values of test compounds.
17. Prashad, M.; Hu, B.; Har, D.; Repic, O.; Blacklock, T. J.;
Acemoglu, M. Adv. Synth. Catal. 2001, 343, 461.
Figure 4. Plausible binding mode of compound 1 in LXRb LBD.
LXR into the agonistic conformation. Selected indole
compounds were shown to regulate LXR target genes
and they tended to show slightly improved profiles in
cell based functional assays as compared to GW3965
and T0901317.
Acknowledgment
We thank Dr. Fabio Tucci for his comments on the
manuscript.
References and notes
1. Willy, P. J.; Umesono, K.; Ong, E. S.; Evans, R. M.;
Heyman, R. A.; Mangelsdorf, D. J. Gene Dev. 1995, 9,
1033.
2. Janowski, B. A.; Grogan, M. J.; Jones, S. A.; Wisely, G.
B.; Liewer, S. A.; Corey, E. J.; Mangelsdorf, D. J. Proc.
Natl. Acad. Sci. U.S.A. 1999, 96, 206.
3. Peet, D. J.; Turley, S. D.; Ma, W.; Janowski, B. A.;
Lobaccaro, J.-M. A.; Hammer, R. E.; Mangelsdorf, D. J.
Cell 1998, 93, 693.
4. Tontonoz, P.; Mangelsdorf, D. J. Mol. Endocrinol. 2003,
17, 985.
18. (a) Fang, Y.-Q.; Lautens, M. Org. Lett. 2005, 16, 3549; (b)
Thielges, S.; Meddah, E.; Bisseret, P.; Eustache, J.
Tetrhedron Lett. 2004, 45, 907.
19. (a) Leuckart, R. Ber. 1885, 18, 2341; (b) Loupy, A.;
Monteux, D.; Petit, A.; Aizpurua, J.; Domlnguez, E.;
Palomo, C. Tetrahedron Lett. 1996, 37, 8177.
20. COS-7 cells were transfected for 24 h with plasmids of the
human LXRb receptor (OriGene, Rockville, MD), the
LXR reporter +-GACCAGCAGTAACCTTGACCAG
CAGTAACCTTGACCAGCAGTAACCT (prepared in
house), and the RXRa receptor (OriGene, Rockville,
MD). Subsequently, cells were treated with vehicle or
compound for 16 h. LXR reporter activation was moni-
tored by quantifying the luciferase activity in the cell
lysate. EC50 values were calculated from mean values of
quadruplicate samples in a single experiment.
21. Compound induction of cholesterol efflux was measured
as described previously25 with small modifications. THP-1
cells were differentiated into macrophages in a 48-well
tissue culture plate using 30 h treatment with 200 nM
PMA. The cells were then labeled with 0.6 lCi of 1,2-3H
(N)-cholesterol for 18 h in the presence of 16 lg/ml acLDL
and 200 nM PMA. Cells were then incubated with vehicle
or compound for 6 h in serum-free medium containing
2 mg/ml BSA. Subsequently, 5 lg/ml of APO-AI was
added in fresh serum-free medium along with vehicle or
compound for additional 18 h incubation. Cholesterol
efflux was monitored by quantifying the radioactivity in
the cell supernatant and presented as fold-induction versus
control (vehicle only). Results shown are mean values of
triplicate samples in a single experiment.
5. Attie, A. D.; Kastelein, J. P.; Hayden, M. R. J. Lipid. Res
2001, 42, 1717.
6. Repa, J. J.; Mangelsdorf, D. J. Nat. Med. 2002, 8, 1243.
7. Collins, J. L.; Flvush, A. M.; Watson, M. A.; Galardi, C.
M.; Lewis, M. C.; Moore, L. B.; Parks, D. J.; Wilson, J.
G.; Tippin, T. K.; Binz, J. G.; Plunket, K. D.; Morgan, D.
G.; Beaudet, E. J.; Whitney, K. D.; Kliewer, S. A.; Wilson,
T. M. J. Med. Chem. 2002, 45, 1963.
8. Jaye, M. C.; Krawiec, J. A.; Campobasso, N.; Smallwood,
A.; Qiu, C.; Lu, Q.; Kerrigan, J. J.; De Los Frailes Alvaro,
M.; Laffitte, B.; Liu, W.; Marino, J. P., Jr.; Meyer, C. R.;
Nichols, J. A.; Parks, D. J.; Perez, P.; Sarov-Blat, L.;
Seepersaud, S. D.; Steplewski, K. M.; Thompson, S. K.;
Wang, P.; Watson, M. A.; Webb, C. L.; Haigh, D.;
Caravella, J. A.; Macphee, C. H.; Wilson, T. M.; Collins,
J. L. J. Med. Chem. 2005, 48, 5419.
9. Li, L.; Liu, J.; Zhu, L.; Cutler, S.; Hasegawa, H.; Shan, B.;
Medina, J. C. Bioorg. Med. Chem. Lett. 2006, 16, 1638.
10. For a recent review on LXR modulator patents, see:
Bennett, D. J.; Cooke, A. J.; Edwards, A. S.; Moir, E.;
Ray, P. C. Expert Opin. Ther. Patents 2004, 14, 967.