The first total synthesis of solomonsterol B, a marine pregnane X receptor agonist

Article abstract of DOI:10.1002/ejoc.201200619

A concise route to the pregnane X receptor (PXR) agonist solomonsterol B, a natural product isolated from the marine sponge Theonella swinhoei, has been developed starting from commercially available hyodeoxycholic acid. The synthesis features a one-carbon side chain degradation and the refunctionalization of the A and B rings to install the desired trans junction and the two hydroxy groups at C2 and C3 in a trans relationship. The protocol proceeded with good yields (10 % over 13 steps), also allowing the preparation of a side chain-modified derivative useful for a preliminary structure-activity relationship on PXR. The pharmacological characterization of solomonsterol B demonstrated that this compound was a PXR agonist in a transactivation assay, and when it was incubated with liver cells, it increased the expression of PXR-regulated genes. These data support the development of sponge steroids as PXR ligands endowed with therapeutic potential. Copyright

Full text of DOI:10.1002/ejoc.201200619

Job/Unit: O20619
/KAP1
Date: 17-07-12 17:39:05
Pages: 9
FULL PAPER
DOI: 10.1002/ejoc.201200619
The First Total Synthesis of Solomonsterol B, a Marine Pregnane X Receptor
Agonist
Valentina Sepe,[a] Raffaella Ummarino,[a] Maria Valeria D’Auria,[a] Barbara Renga,[b]
Stefano Fiorucci,[b] and Angela Zampella*[a]
Dedicated to the memory of Ernesto Fattorusso
Keywords: Total synthesis / Natural products / Steroids / Structure–activity relationships
A concise route to the pregnane X receptor (PXR) agonist
solomonsterol B, a natural product isolated from the marine
sponge Theonella swinhoei, has been developed starting
from commercially available hyodeoxycholic acid. The syn-
thesis features a one-carbon side chain degradation and the
refunctionalization of the A and B rings to install the desired
trans junction and the two hydroxy groups at C2 and C3 in
a trans relationship. The protocol proceeded with good yields
(10% over 13 steps), also allowing the preparation of a side
chain-modified derivative useful for a preliminary structure–
activity relationship on PXR. The pharmacological charac-
terization of solomonsterol B demonstrated that this com-
pound was a PXR agonist in a transactivation assay, and
when it was incubated with liver cells, it increased the ex-
pression of PXR-regulated genes. These data support the de-
velopment of sponge steroids as PXR ligands endowed with
therapeutic potential.
of these compounds from cells.[5,6] These genes include the
CYP3A (cytochrome P450 3A) family, and the multiple
drug resistance gene MDR1 (multidrug resistance 1).
CYP3A4 alone is involved in the processing of more than
50% of prescription drugs, and, like MDR1 and PXR, is
expressed in a variety of tissues, including the intestine and
liver, both of which are highly exposed to xenobiotics. The
canonical function of the PXR is as a sensor of cellular
metabolism, and as such, it orchestrates the expression of
specific genes in response in the to the exact metabolic or
toxicological information in the cellular environment. Re-
cently, a non-canonical anti-inflammatory role for PXR has
been demonstrated.[7,8] PXR is also expressed in immune
cells, including lymphocytes and monocytes in humans.
Several studies showed that rifampicin, a human PXR acti-
vator, suppresses both humoral and cellular immunity, and
identified rifampicin as a powerful immunosuppressive
drug. As drug metabolism and the immune system are in-
terconnected, recent work has shed some light on the mo-
lecular aspects of this interaction, and a mutual suppression
between PXR and NF-κB (nuclear factor-κB) has been
demonstrated. In the colon and liver, PXR activation sup-
presses the expression of typical NF-κB target genes such
as cyclooxygenase-2, tumor necrosis factor α (TNFα), inter-
cellular adhesion molecule-1, and several interleukins.[8]
Conversely, NF-κB-activation by lipopolysaccharide and
TNFα results in the suppression of CYP3A activity through
interactions of NF-κB with the PXR–RXR complex.[9]
Introduction
The pregnane X receptor (PXR) is a ligand-activated
transcription factor and an overarching regulator of the
xenobiotic response system, which acts to prevent toxic ac-
cumulation of xenobiotics and endobiotics within cells.[1,2]
PXR is primarily expressed in the gastrointestinal tract
and liver. As is the case for many nuclear receptors, PXR
possesses a conserved DNA-binding domain (DBD) and a
variable C terminal ligand-binding domain (LBD). Within
the LBD, the ligand-binding pocket of PXR accommodates
a wide range of structurally unrelated endogenous and ex-
ogenous ligands, including the antibiotic rifampicin, a wide
variety of prescription drugs, bile acids, and steroids.[3,4]
Following ligand binding, PXR forms a heterodimer with
retinoid X receptor (RXR). This dimer binds to specific
PXR-responsive elements, resulting in the transcriptional
activation of an array of genes, including those expressing
enzymes involved in the oxidation, conjugation, and export
[a] Dipartimento di Chimica delle Sostanze Naturali,
Università di Napoli “Federico II”,
Via D. Montesano 49, 80131 Napoli, Italy
Fax: +39-081-678552
E-mail: angela.zampella@unina.it
[b] Dipartimento di Medicina Clinica e Sperimentale,
Università di Perugia, Nuova Facoltà di Medicina e Chirurgia,
Via Gerardo Dottori 1, S. Andrea delle Fratte, 06132 Perugia,
Italy
Supporting information for this article is available on the
WWW under http://dx.doi.org/10.1002/ejoc.201200619.
Eur. J. Org. Chem. 0000, 0–0
© 0000 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
1

Job/Unit: O20619
/KAP1
Date: 17-07-12 17:39:05
Pages: 9
A. Zampella et al.
FULL PAPER
Furthermore, hepatocytes derived from PXR-null mice strongly influences the metabolism and consequently the
showed elevated NF-κB target gene expressions compared pharmacokinetic behavior of this molecule.[23–25]
to cells from the wild-type animals, suggesting that PXR
Unfortunately, any further pharmacological in vivo ex-
plays a role in suppressing NF-κB-regulated gene expres- perimentation or thorough evaluation of the pharmacoki-
sion. All these data suggest that PXR may be a useful target netic properties of solomonsterol B (2) was hampered by
for pharmacological therapies in various immune-mediated the scarcity of biological material isolated from the marine
conditions. Also, a role for PXR in the pathogenesis of in- sponge. In this paper, we report the first total synthesis of
flammatory bowel disease (IBD) has recently been demon- solomonsterol B (2) starting from commercially available
strated. Gene-expression analysis of colon tissues from hyodeoxycholic acid (3). The synthetic procedure also al-
patients with ulcerative colitis (UC) and Crohn’s disease lowed the preparation of a derivative modified in the side
(CD) has revealed a significant reduction in the expression/ chain, and thus a preliminary structure–activity relation-
function of PXR and its target genes, compared to normal ship on the interaction between solomonsterol B and PXR
intestinal samples.[10] Moreover, rifaximin, a human PXR could be established.
agonist, is in clinical trials for the treatment of IBD, and
has demonstrated efficacy in Crohn’s disease and ulcerative
colitis.[11,12]
Results and Discussion
In the course of our search for human nuclear receptor
modulators of marine origin,[13–19] we isolated two unusual
As depicted in Scheme 1, the key steps of our synthetic
sulfated sterols, solomonsterols A (1) and B (2) from the protocol are the one-carbon degradation at C24 and the
marine sponge Theonella swinhoei (Figure 1). These mole- modification of the functionalities of the A and B rings to
cules represent the first examples of C24 and C23 5α-cholane establish the desired trans junction and the two hydroxy
derivatives from the marine environment, and notably, the groups at C2 and C3.
first report of potent and selective PXR agonists from the
Hyodeoxycholic acid (HDCA, 3) was protected as per-
sea.[20,21] Recently, we reported the total synthesis of solo- formate derivative 4 by Fischer esterification with formic
monsterol A (1), and a thorough pharmacological investi- acid, followed by acetic anhydride treatment to shift the
gation on transgenic mice expressing human PXR, demon- equilibrium towards the complete formylation of 3.[26] In-
strating that the administration of solomonsterol A (1) pro- termediate 4 was subjected to the so-called second-order
tects against the development of clinical signs and symp- “Beckmann rearrangement” by treatment with sodium ni-
toms of colitis.[22]
trite in a mixture of trifluoroacetic anhydride and trifluoro-
acetic acid.[27] Prolonged alkaline hydrolysis of resulting 23-
nitrile intermediate 5 gave 24-nor-HDCA (6) in an isolated
yield of 60% over the three-step sequence. Esterification of
the carboxylic acid at C23 with methanol and p-toluene-
sulfonic acid (pTsOH), and tosylation of the resulting
methyl ester with tosyl chloride in pyridine gave methyl
3α,6α-ditosyloxy-24-nor-5α-cholan-23-oate (7) in a satisfac-
tory yield (75%, two steps).
Figure 1. Solomonsterols A and
B from the marine sponge
Theonella swinhoei.
Heating 7 with CH3COOK in refluxing DMF for 1 h re-
sulted in simultaneous inversion at C3 and elimination at
Solomonsterol A (1) reduces the generation of TNFα, a C6, with the formation of a mixture of 8 and its 3-O-acetyl
signature cytokine for this disorder, and triggers the expres- derivative. Hydrolysis with pTsOH gave methyl 3-hydroxy-
sion of TGFβ and IL-10, two potent counter-regulatory 5-cholen-24-oate (8),[28,29] which in turn was hydrogenated
cytokines in IBD by inhibition of NF-κB activation in a to give 9, with the required A/B trans ring junction.[30]
PXR-dependent mechanism. Therefore, this natural com-
Tosylation and elimination at C3 yielded the correspond-
pound could potentially be used for the treatment of human ing Δ2 ester 10 in 81% isolated yield after chromatographic
disorders related to the dysregulation of innate immunity. purification on silica gel. The introduction of three hydroxy
Solomonsterol B (2) shares the same tetracyclic nucleus groups in 11, two on ring A in a trans-diaxial disposition
with 1, but differs in the length of the side chain. We proved and one in the side chain, was obtained by epoxidation of
that this modification has no influence on the binding double bond, subsequent acid-catalyzed epoxide open-
within the LBD of PXR,[20] and therefore on the ability to ing[31,32] with sulfuric acid in THF, and finally reduction of
transactivate PXR, but recent reports have demonstrated the methyl ester at C23 with LiBH4 (56% yield over three
that in several potential drugs the length of the side chain steps).
could exert dramatic effects. For example, nor-ursodeoxy-
Sulfation of triol 11 gave the ammonium sulfate salt of
cholic acid, the C23 homologue of ursodeoxycholic acid solomonsterol B in 72% isolated yield over two steps, and
(UDCA), has been shown to be more potent that the parent this compound was transformed by ion exchange into de-
UDCA in pharmacological treatments for cholangiopathies sired target trisodium salt 2 and purified by reversed-phase
and cholestatic liver diseases, demonstrating that its thera- solid extraction on a C18 cartridge. The complete match of
peutic effects are related to the side chain structure, which optical rotation, NMR spectroscopic data and HRMS data
2
www.eurjoc.org
© 0000 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 0000, 0–0

Job/Unit: O20619
/KAP1
Date: 17-07-12 17:39:05
Pages: 9
Total Synthesis of Solomonsterol B
Scheme 1. Reagents and conditions: (a) HCOOH, HClO4 50 °C, then (Ac)2O, 97%; (b) CF3COOH, (CF3CO)2O, NaNO2, 1 h, 0 °C, then
40 °C for 1.5 h, 80%; (c) 30% KOH, EtOH/H2O (1:1), reflux, 78%; (d) pTsOH, dry MeOH, 96%; (e) pTsCl, pyridine, 78%; (f) CH3COOK,
DMF/H2O (9:1), reflux; then pTsOH, CHCl3/MeOH (5:3), 80% over two steps; (g) H2, Pd/C, THF/MeOH (1:1), room temp., 84%;
(h) pTsCl, pyridine; (i) LiBr, Li2CO3, DMF, reflux, 81% over two steps; (j) mCPBA, CHCl3, room temp.; (k) H2SO4 1 n, THF, room
temp., 81% over two steps; (l) LiBH4, MeOH/THF, 0 °C, 69%; (m) Et3N·SO3, DMF, 95 °C; then Amberlite CG-120, MeOH, 72%.
of synthetic solomonsterol B (2) with that of the natural or 23-O-sulfate) residues, and electrostatic interactions with
product confirmed the identity of the synthetic derivative.
the Ser247 (2-O-sulfate) and His407 (3-O-sulfate) residues,
This synthesis was completed in a total of 13 steps, start- and that these interactions contribute to the binding of the
ing from commercially available hyodeoxycholic acid (3), in steroid nucleus in the LBD of PXR. Therefore, the replace-
an overall yield of 10%. This route enabled us to prepare ment of the sulfate group at C23 with a polar group, such
sufficient quantities of solomonsterol B (2) to be further as a hydroxy group as in 14, could preserve the key interac-
characterized in pharmacological tests.
tion with Lys210, while at the same time introducing a func-
Advanced intermediate 12 was also used as the starting tional group suitable for conjugation to a carrier for colon-
material to obtain alcohol 14 (Scheme 2), which could be specific drug delivery. In fact, a PXR agonist, when admin-
used to investigate the pharmacophoric role played by the istered by mouth in the pharmacological treatment of colon
side chain sulfate group in the PXR-agonistic activity of diseases (IBD, UC, CD), could undergo absorption before
solomonsterol B (2). In our previous work,[20] we demon- reaching the colon, and thus cause severe systemic side-ef-
strated that solomonsterols A (1) and B (2) establish hydro- fects resulting from the activation of PXR in the liver. Thus,
gen bonds with the Cys284 (2-O-sulfate) and Lys210 (24- as reported in Scheme 2, diol 12 was sulfated with trieth-
Scheme 2. Reagents and conditions: (a) Et3N·SO3, DMF, 95 °C; then Amberlite CG-120, MeOH; (b) LiBH4, MeOH/THF, 0 °C, 78%
over two steps.
Eur. J. Org. Chem. 0000, 0–0
© 0000 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
3

Job/Unit: O20619
/KAP1
Date: 17-07-12 17:39:05
Pages: 9
A. Zampella et al.
FULL PAPER
ylammonium–sulfur-trioxide complex, and transformed in specificity of 2 and 14 as PXR activators, we tested the ef-
sodium sulfate salt 13 by Amberlite treatment and purifica- fects of these compounds in terms of the induction of classi-
tion on a C18 column. LiBH4 reduction gave C23 alcohol cal PXR target genes such as CYP3A4 (cytochrome P450
14 in 78% yield from diol 12.
3A4), CYP3A7 (cytochrome P450 3A7), SULT2A1 (sulfo-
Synthetic solomonsterol B (2) and alcohol 14 were tested transferase family, cytosolic, 2A) and MDR1 (multidrug re-
in a luciferase reporter assay on a human hepatocyte cell sistance 1). As illustrated in Figure 3, with the exception of
line (HepG2 cells), transiently transfected with pSG5-PXR, CYP3A7, solomonsterol B (2) was able to induce CYP3A4,
pSG5-RXR, pCMV-βgalactosidase, and p(CYP3A4)-TK- SULT2A1 and MDR1, while, as expected, alcohol 14 failed
Luc vectors (Figure 2). Cells were then stimulated with ri- to induce these PXR target genes on HepG2 cells.
faximin, a well known PXR agonist,[33] and with com-
pounds 2 and 14 at a concentration of 10 μm each. As
shown in Figure 2, solomonsterol B (2) was able to trans-
Conclusions
activate PXR with a potency comparable to rifaximin,
whereas C23 alcohol 14 was inactive, thus demonstrating
the pharmacophoric role played by the sulfate group in the
side chain of solomonsterol B (2). To further examine the
In this paper we report the first total synthesis of solo-
monsterol B (2), a marine steroid endowed with potent ago-
nistic activity towards the pregnane X receptor. This syn-
thesis was completed in a total of 13 steps starting from
hyodeoxycholic acid, and with an overall yield of 10%. The
preparation of a side-chain-modified derivative and a pre-
liminary structure–activity relationship on PXR are also re-
ported. The pharmacological behavior of solomonsterol B
(2) and its alcohol derivative 14 was assessed by transactiv-
ation and real-time PCR (polymerase chain reaction) as-
says.
The results of luciferase experiments demonstrated that
compound 14 failed to transactivate human PXR, in con-
trast to solomonsterol B (2), which is a potent PXR agonist.
Moreover, in agreement with the transactivation experi-
ments, PCR analysis of canonical PXR target genes clearly
demonstrated that solomonsterol B (2) was able to induce
CYP3A4, SULT2A1 and MDR1, whereas the alcohol de-
rivative 14 has lost the ability to induce the expression of
PXR target genes. This provides evidence of an important
structure–activity relationship.
Figure 2. Luciferase reporter assay performed in HepG2 transiently
transfected with pSG5-PXR, pSG5-RXR, pCMV-βgalactosidase,
and p(CYP3A4)-TK-Luc vectors, and stimulated for 18 h with ri-
faximin (10 μm), 2 (1 and 10 μm) and 14 (1 and 10 μm).
Experimental Section
General Methods: Specific rotations were measured with a Perkin–
Elmer 243 B polarimeter. High-resolution ESI-MS spectra were
performed with a Micromass QTOF Micromass spectrometer.
NMR spectra of all synthetic intermediates were obtained with
Varian Inova 400 and Varian Inova 500 NMR spectrometers (1H
at 400 and 500 MHz, 13C at 100 and 125 MHz, respectively), and
recorded in CDCl3 (δH = 7.26 and δC = 77.0 ppm) or CD3OD (δH
= 3.30 and δC = 49.0 ppm). HPLC was performed using a Waters
Model 510 pump equipped with Waters Rheodine injector and a
differential refractometer, model 401. Reaction progress was moni-
tored using thin-layer chromatography (TLC) on Alugram silica gel
G/UV254 plates. Silica gel MN Kieselgel 60 (70–230 mesh) from
Macherey–Nagel Company was used for column chromatography.
All chemicals were obtained from Sigma–Aldrich, Inc. Solvents
and reagents were used as supplied from commercial sources with
the following exceptions: tetrahydrofuran and chloroform were dis-
tilled from calcium hydride immediately prior to use; methanol was
dried from magnesium methoxide as follows: magnesium turnings
(5 g) and iodine (0.5 g) were heated at reflux in a small (50–100 mL)
quantity of methanol until all of the magnesium has reacted. The
mixture was diluted (up to 1 L) with reagent grade methanol,
Figure 3. Real-time PCR analysis of PXR target genes CYP3A4,
CYP3A7, SULT2A1 and MDR1 carried out on cDNA isolated
from HepG2 not stimulated or primed with 10 μm rifaximin, 2 and
14. Values are normalized relative to B2M mRNA, and are ex-
pressed relative to those of untreated cells, which are arbitrarily set
to 1.
4
www.eurjoc.org
© 0000 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 0000, 0–0

Job/Unit: O20619
/KAP1
Date: 17-07-12 17:39:05
Pages: 9
Total Synthesis of Solomonsterol B
heated at reflux for 2–3 h, and then distilled under nitrogen. All
reactions were carried out under an argon atmosphere using flame-
dried glassware.
the residue was extracted with EtOAc. The combined organic ex-
tracts were washed with brine, dried with Na2SO4, and evaporated
to give the desired methyl ester (1.0 g, 96%) as a colorless amorph-
ous solid. An analytical sample was obtained by silica gel
chromatography, eluting with CH2Cl2/MeOH (95:5). [α]2D4 = –1.0 (c
= 0.69, CHCl3). Selected 1H NMR (400 MHz, CDCl3): δ = 3.98
(m, 1 H), 3.61 (s, 3 H), 3.54 (m, 1 H), 2.38 (m, 1 H), 1.98 (m, 1
H), 0.92 (d, J = 6.0 Hz, 3 H), 0.84 (s, 3 H), 0.62 (s, 3 H) ppm. 13C
NMR (100 MHz, CDCl3): δ = 174.1, 71.3, 67.8, 56.1, 56.0, 51.3,
48.2, 42.8, 41.3, 39.7 (2 C), 35.8, 35.4, 34.6, 34.4, 33.7, 29.7, 28.9,
28.1, 24.1, 23.3, 20.6, 19.4, 11.9 ppm. HRMS (ESI): calcd. for
C24H41O4 [M + H]+ 393.3005; found 393.3015.
3α,6α-Diformyloxy-5β-cholan-24-oic Acid (4): A solution of hyode-
oxycholic acid (3) (2 g, 5.09 mmol) in 90% formic acid (30 mL)
containing 70% perchloric acid (70 μL) was stirred at 50 °C for
1.5 h. The temperature was lowered to 40 °C. Acetic anhydride
(24 mL) was added over 10 min, and the mixture was stirred for an
additional 10 min. The solution was cooled to room temperature
and poured into water (50 mL) with vigorous stirring. The precipi-
tate was filtered, washed with water (20 mL), and dissolved in di-
ethyl ether. The solution was dried with sodium sulfate, and evapo-
rated to give of 4 (1.9 g, 97%), which was used in the next step
without further purification. An analytical sample was obtained by
Methyl 3,6-Ditosyloxy-24-nor-5β-cholan-23-oate (7): A solution of
tosyl chloride (2.4 g, 12.7 mmol) in dry pyridine (15 mL) was added
to a solution of the above methyl ester (1.0 g, 2.55 mmol) in dry
pyridine (15 mL), and the mixture was stirred at room temperature
for 4 h. The solvent was evaporated and the precipitate was redis-
solved in CH2Cl2. The solution was washed with NaHCO3 and
water, dried with Na2SO4, and then evaporated to dryness. The
residue was passed through a short column of silica gel (120 g),
eluting with hexane/EtOAc (1:1), to give 7 (1.4 g, 78%) as a white
silica gel chromatography, eluting with hexane/EtOAc (6:4). [α]2D4
=
1
+5.8 (c = 1.3, CH3OH). Selected H NMR (400 MHz, CDCl3): δ
= 7.90 (s, 1 H), 7.87 (s, 1 H), 5.15 (m, 1 H), 4.67 (m, 1 H), 2.24
(m, 1 H), 2.10 (m, 1 H), 0.85 (s, 3 H), 0.77 (d, J = 6.5 Hz, 3 H),
0.5 (s, 3 H) ppm. 13C NMR (100 MHz, CDCl3): δ = 179.7, 160.7,
160.6, 73.4, 70.8, 55.7, 55.6, 50.0, 45.1, 42.6, 39.6, 35.8 (2 C), 35.0,
34.6, 34.4, 30.8, 30.5, 27.8, 26.2, 25.9, 23.9, 23.1, 20.5, 18.1,
11.8 ppm. HRMS (ESI): calcd. for C26H41O6 [M + H]+ 449.2903;
found 449.2913.
solid. [α]2D4 = +3.9 (c = 1.2, CHCl3). Selected H NMR (400 MHz,
1
CDCl3): δ = 7.78 (d, J = 8.3 Hz, 2 H), 7.71 (d, J = 8.3 Hz, 2 H),
7.35 (d, J = 8.3 Hz, 2 H), 7.33 (d, J = 8.3 Hz, 2 H), 4.77 (m, 1 H),
4.30 (m, 1 H), 3.65 (s, 3 H), 2.50 (s, 6 H), 2.40 (dd, J = 3.4, 15.0 Hz,
1 H), 2.02 (m, 1 H), 0.93 (d, J = 6.2 Hz, 3 H), 0.79 (s, 3 H), 0.62
(s, 3 H) ppm. 13C NMR (100 MHz, CDCl3): δ = 174.2, 145.0 (2
C), 134.7 (2 C), 130.2 (4 C), 127.8 (4 C), 82.0, 79.9, 56.1, 56.0, 51.7,
46.6, 43.2, 41.6, 39.7, 39.6, 36.4, 35.8, 35.0 (2 C), 33.9, 28.4, 27.6,
26.7, 24.2, 23.2 (2 C), 21.9, 20.7, 19.7, 12.3 ppm. HRMS (ESI):
calcd. for C38H53O8S2 [M + H]+ 701.3182; found 701.3192.
3α,6α-Diformyloxy-24-nor-5β-cholane-23-nitrile (5): 3α,6α-Diform-
yloxy-5β-cholan-24-oic acid (4; 1.9 g, 4.6 mmol) was stirred in tri-
fluoroacetic acid (6.7 mL) and trifluoroacetic anhydride (1.8 mL,
12.7 mmol) at 5 °C until dissolution occurred. Sodium nitrite
(321 mg, 4.65 mmol) was then added in small portions, and the
reaction mixture was stirred at 5 °C for 1 h and then at 40 °C for
1.5 h. The solution was allowed to cool to room temperature and
poured into 2 n NaOH (30 mL). The mixture was extracted with
diethyl ether, and the organic layer was washed with 1 n NaOH
and water, dried with sodium sulfate, and evaporated to give pure
5 (1.66 g, 80%). An analytical sample was obtained by silica gel
chromatography, eluting with hexane/EtOAc (8:2). [α]2D4 = +8.8 (c
Methyl 3β-Hydroxy-24-nor-5-cholen-23-oate (8): A solution of 7
(1.4 g, 2 mmol) and CH3COOK (196.3 mg, 2 mmol) in water
(2 mL) and DMF (14 mL) was heated at reflux for 4 h. The solu-
tion was cooled to room temperature, and then EtOAc and water
were added. The separated aqueous phase was extracted with
EtOAc (3ϫ 30 mL), and the combined organic phases were washed
with water, and dried (Na2SO4). Solvent evaporation gave a mixture
(1 g) which was used in the next step without any purification. The
mixture was dissolved in CHCl3/MeOH (5:3, 32 mL), and pTsOH
(1.14 g, 6 mmol) was added. After 24 h, the reaction was quenched
by addition of NaHCO3 solution (30 mL) and then concentrated
in vacuo. EtOAc and water were added, and the separated aqueous
phase was extracted with EtOAc (3ϫ 50 mL). The combined or-
ganic extracts were washed with water, dried (Na2SO4) and concen-
trated. Purification by silica gel, eluting with hexane/EtOAc (97:3),
gave alcohol 8 (600 mg, 80% over two steps) as a white solid.
[α]2D4 = –2.4 (c = 1.45, CHCl3). Selected 1H NMR (400 MHz,
CDCl3): δ = 5.30 (d, J = 2.4 Hz, 1 H), 3.62 (s, 3 H), 3.48 (m, 1 H),
2.39 (dd, J = 2.6, 13.7 Hz, 1 H), 2.00 (m, 1 H), 0.96 (s, 3 H), 0.94
(d, J = 6.5 Hz, 3 H), 0.67 (s, 3 H) ppm. 13C NMR (100 MHz,
CDCl3): δ = 174.4, 141.1, 121.8, 71.9, 56.9, 56.1, 51.7, 42.6, 41.6,
41.1, 39.8, 37.5, 36.7, 34.0, 32.1, 32.0 (2 C), 31.6, 28.4, 24.4, 24.1,
21.2, 19.7, 12.3 ppm. HRMS (ESI): calcd. for C24H39O3 [M + H]+
375.2899; found 375.2908.
1
= 0.22, CHCl3). Selected H NMR (400 MHz, CD3OD): δ = 8.08
(s, 1 H), 8.07 (s, 1 H), 5.27 (m, 1 H), 4.73 (m, 1 H), 2.46 (dd, J =
4.1, 16.9 Hz, 1 H), 2.34 (dd, J = 6.0, 16.9 Hz, 1 H), 0.93 (s, 3 H),
0.72 (d, J = 6.9 Hz, 3 H), 0.71 (s, 3 H) ppm. 13C NMR (100 MHz,
CD3OD): δ = 162.7, 162.6, 120.3, 72.3, 68.6, 57.3, 56.3, 49.6, 46.8,
43.9, 41.1, 40.9, 36.6, 36.4, 36.0, 35.3, 34.5, 29.8, 28.9, 26.3, 25.0,
24.1, 21.8, 19.7, 12.5 ppm. HRMS (ESI): calcd. for C25H39NO4 [M
+ H]+ 416.2801; found 416.2821.
24-nor-Hyodeoxycholic Acid (6): Crude 5 (1.66 g) was heated at re-
flux with 30% KOH in ethanol/water (1:1, ca. 50 mL) for 48 h. The
ethanol was evaporated, and the solution was saturated with so-
dium chloride and extracted with diethyl ether. The organic phase
was washed with water, dried, and evaporated to give 6 (1.18 g,
78%) as a white solid residue. An analytical sample was obtained
by silica gel chromatography, eluting with CH2Cl2/MeOH (9:1).
[α]2D4 = +3.0 (c = 2.9, CH3OH). Selected 1H NMR (400 MHz,
CD3OD): δ = 4.01 (dt, J = 4.6, 12.1 Hz, 1 H), 3.52 (m, 1 H), 2.40
(m, 1 H), 1.99 (m, 1 H), 0.98 (d, J = 6.0 Hz, 3 H), 0.91 (s, 3 H),
0.70 (s, 3 H) ppm. 13C NMR (100 MHz, CD3OD): δ = 177.8, 72.4,
68.7, 57.4, 57.2, 49.5, 43.9, 42.4, 41.1, 41.0, 36.8, 36.6, 36.0, 35.3,
34.8, 30.9, 29.7, 29.1, 25.1, 23.9, 21.7, 19.9, 12.4 ppm. HRMS
(ESI): calcd. for C23H39O4 [M + H]+ 379.2848; found 379.2858.
Methyl 3β-Hydroxy-24-nor-5α-cholan-23-oate (9): An oven-dried
100 mL flask was charged with 10% palladium on carbon (50 mg)
and compound 8 (600 mg, 1.6 mmol), and the flask was evacuated
and flushed with argon. Absolute methanol (30 mL) and dry THF
(30 mL) were added, and the reaction mixture was stirred at room
temperature under H2 for 4 h. The mixture was filtered through
Celite, and the recovered filtrate was concentrated to give pure 9
Methyl 3α,6α-dihydroxy-24-nor-5β-cholan-23-oate: A mixture of 24-
nor-hyodeoxycholic acid (6) (1.18 g, 3.11 mmol) and pTsOH (1.2 g,
6.22 mmol) in dry methanol (50 mL) was stirred at room tempera-
ture overnight. The reaction was quenched by the addition of
NaHCO3 solution, then most of the solvent was evaporated, and
Eur. J. Org. Chem. 0000, 0–0
© 0000 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
5

Job/Unit: O20619
/KAP1
Date: 17-07-12 17:39:05
Pages: 9
A. Zampella et al.
FULL PAPER
(506 mg, 84%). An analytical sample of 9 was obtained by silica
gel chromatography, eluting with hexane/EtOAc (95:5). [α]2D4 = +1.0
CDCl3): δ = 3.85 (br. s, 1 H), 3.80 (br. s, 1 H), 3.63 (s, 3 H), 2.38
(dd, J = 2.7, 14.0 Hz, 1 H), 0.95 (s, 3 H), 0.90 (d, J = 6.5 Hz, 3 H),
(c = 0.17, CHCl3). Selected 1H NMR (400 MHz, CDCl3): δ = 3.63 0.60 (s, 3 H) ppm. 13C NMR (100 MHz, CDCl3): δ = 171.3, 71.6,
(s, 3 H), 3.56 (m, 1 H), 2.40 (dd, J = 2.8, 14.3 Hz, 1 H), 1.98 (m, 70.5, 56.6, 56.2, 55.2, 51.6, 41.7, 40.4, 40.0, 39.9, 39.1, 35.1 (2 C),
1 H), 0.94 (d, J = 6.3 Hz, 3 H), 0.77 (s, 3 H), 0.66 (s, 3 H) ppm.
34.1, 32.0, 31.8, 31.7, 28.4, 24.3, 21.0, 19.7, 14.5, 12.3 ppm. HRMS
13C NMR (100 MHz, CDCl3): δ = 174.4, 71.6, 56.7, 56.3, 54.5, (ESI): calcd. for C24H41O4 [M + H]+ 393.3005; found 393.3015.
51.6, 42.9, 41.7, 40.1, 38.4, 37.2, 35.7 (2 C), 34.1, 32.3 (2 C), 31.7,
24-nor-5α-Cholan-2β,3α,23-triol (11): Dry methanol (122 μL,
28.9, 28.5, 24.4, 21.4, 19.7, 12.5, 12.3 ppm. HRMS (ESI): calcd. for
3.03 mmol) and LiBH4 (1.5 mL, 2 m in THF, 3.03 mmol) were
C24H41O3 [M + H]+ 377.3050; found 377.3060.
added to a solution of 12 (170 mg, 0.43 mmol) in dry THF (10 mL)
at 0 °C under argon, and the resulting mixture was stirred for 8 h
at 0 °C. The reaction was quenched by the addition of NaOH (1 n,
4 mL), and the mixture was then warmed to room temperature.
EtOAc was added, and the separated aqueous phase was extracted
with EtOAc (3ϫ 15 mL). The combined organic phases were
washed with water, dried (Na2SO4) and concentrated. Purification
by silica gel, eluting with CH2Cl2/MeOH (95:5), gave the alcohol
11 as a white solid (110 mg, 69%). [α]2D4 = –9.8 (c = 0.05, CH3OH).
Methyl 24-nor-5α-Chol-2-en-23-oate (10): p-Toluenesulfonyl chlor-
ide (1.2 g, 6.6 mmol) was added to a solution of 9 (500 mg,
1.3 mmol) in dry pyridine (25 mL). The solution was stirred at
room temperature for 24 h, and then poured into cold water
(20 mL) and extracted with CH2Cl2 (3ϫ 15 mL). The combined
organic extracts were washed with saturated NaHCO3 solution
(30 mL) and water (30 mL), and dried with anhydrous MgSO4. Sol-
vent evaporation gave the 3-O-tosylate derivative (665 mg), which
was used in the next step without any purification. Selected 1H
NMR (400 MHz, CDCl3): δ = 7.78 (d, J = 8.1 Hz, 2 H), 7.32 (d,
J = 8.1 Hz, 2 H), 4.41 (m, 1 H), 3.65 (s, 3 H), 2.44 (s, 3 H), 2.41
(dd, J = 2.7, 12.0 Hz, 1 H), 1.96 (m, 1 H), 0.95 (d, J = 6.3 Hz, 3
H), 0.77 (s, 3 H), 0.66 (s, 3 H) ppm. 13C NMR (100 MHz, CDCl3):
δ = 174.3, 144.6, 135.0, 130.0 (2 C), 127.7 (2 C), 82.7, 56.5, 56.2,
54.1, 51.6, 42.9, 41.6, 41.2, 39.9, 36.9, 35.5 (2 C), 35.3, 35.0, 34.0,
32.0, 28.5, 28.4, 24.3, 24.1, 21.4, 21.3, 19.7, 12.2 ppm. HRMS
(ESI): calcd. for C31H47O5S [M + H]+ 531.3144; found 531.3164.
1
Selected H NMR (400 MHz, CD3OD): δ = 3.80 (br. s, 1 H), 3.75
(br. s, 1 H), 3.46 (m, 2 H), 0.99 (s, 3 H), 0.95 (d, J = 6.3 Hz, 3 H),
0.69 (s, 3 H) ppm. 13C NMR (100 MHz, CD3OD): δ = 72.2, 71.2,
60.8, 59.9, 57.9, 56.7, 41.5, 40.9, 40.1, 39.8, 36.9, 36.3, 34.1, 33.3,
32.4, 30.7, 29.5, 29.3, 25.2, 22.0, 19.3, 14.6, 12.5 ppm. HRMS
(ESI): calcd. for C23H41O3 [M + H]+ 365.3056; found 365.3078.
24-nor-5α-Cholan-2β,3α,23-tryl-2,3,23-Sodium Trisulfate (2): Tri-
ethylamine–sulfur trioxide complex (272 mg, 1.5 mmol) was added
to 11 (110 mg, 0.3 mmol) dissolved in dry DMF (5 mL) under ar-
gon, and the mixture was stirred at 95 °C for 24 h. The reaction
mixture was quenched with water (800 μL), and the resulting solu-
tion was poured over a C18 silica gel column to remove the excess
of SO3·NEt3. Elution with MeOH, followed by evaporation of the
solvent, yielded a yellow solid [tris(triethylammonium sulfate) salt].
Amberlite CG 120 sodium form (10 g) was added to the solution
of the solid in methanol (15 mL), and the resulting mixture was
stirred for 5 h at room temperature. The resin was removed by fil-
tration, and the filtrate was concentrated to obtain a mixture that
was further purified by HPLC on a Nucleodur 100–5 C18 (5 μm,
10 mm i.d. ϫ250 mm) column with MeOH/H2O (34:66) as eluent
(flow rate 3 mL/min) to give solomonsterol B (2; 144 mg, 72%). tR
= 4.4 min. [α]2D4 = +2.1 (c = 0.08, CH3OH). Selected 1H NMR
(700 MHz, CD3OD): δ = 4.73 (br. s, 1 H), 4.70 (br. s, 1 H), 4.05
(m, 1 H), 4.01 (m, 1 H), 1.00 (s, 3 H), 0.98 (d, J = 6.5 Hz, 3 H),
0.70 (s, 3 H) ppm. 13C NMR (100 MHz, CD3OD): δ = 76.5, 71.1,
67.3, 57.8, 56.6, 56.1, 43.5, 41.4, 39.8, 38.7, 36.6, 36.4, 36.3, 34.2,
33.2, 30.5, 29.2, 29.1, 25.2, 22.0, 19.1, 14.3, 12.5 ppm. HRMS
(ESI): calcd. for C23H37Na2O12S3 [M – Na]– 647.1243; found
647.1298.
Lithium bromide (217 mg, 2.5 mmol) and lithium carbonate
(184 mg, 2.5 mmol) were added to a solution of the above deriva-
tive (665 mg, 1.25 mmol) in dry DMF (30 mL), and the mixture
was heated at reflux for 5 h. After cooling to room temperature,
the mixture was slowly poured into 10% HCl solution (150 mL)
and extracted with CH2Cl2 (3ϫ 150 mL). The combined organic
extracts were washed successively with water, saturated NaHCO3
solution, and water, and then dried with anhydrous MgSO4. The
solvents were evaporated to dryness to obtain pure 10 (380 mg,
81% over two steps). An analytical sample was obtained by silica
gel chromatography, eluting with hexane. [α]2D4 = +3.1 (c = 0.76,
1
CHCl3). Selected H NMR (400 MHz, CDCl3): δ = 5.58 (m, 2 H),
3.65 (s, 3 H), 2.42 (dd, J = 2.7, 14.0 Hz, 1 H), 1.96 (m, 1 H), 0.96
(d, J = 6.5 Hz, 3 H), 0.74 (s, 3 H), 0.69 (s, 3 H) ppm. 13C NMR
(100 MHz, CDCl3): δ = 174.4, 126.2, 126.1, 56.7, 56.3, 54.2, 51.6,
42.8, 41.7, 41.6, 40.1, 40.0, 39.9, 35.8, 34.7, 34.1, 31.9, 30.5, 28.4,
24.4, 21.1, 20.9, 19.7, 12.2 ppm. HRMS (ESI): calcd. for C24H39O2
[M + H]+ 359.2950; found 359.2963.
Methyl 2β,3α-Dihydroxy-24-nor-5α-cholan-23-oate (12): m-Chloro-
perbenzoic acid (256 mg, 1.5 mmol) was added slowly to a solution
of 10 (380 mg, 1.06 mmol) in CHCl3 (20 mL). The mixture was
stirred for 4 h at room temperature, and then CH2Cl2 (3ϫ 50 mL)
and 5% Na2SO3 solution (70 mL) were added. The combined
CH2Cl2 extracts were washed with water (70 mL), and dried with
anhydrous MgSO4. The solvents were evaporated to dryness to give
crude 2,3-epoxide (400 mg), which was used in the next step with-
out any purification. A solution of epoxide (400 mg, 1.06 mmol)
in THF (20 mL) was treated with 1 n H2SO4 (5.3 mL, 2.65 mmol)
solution, and stirred for 24 h at room temperature. After neutral-
ization with saturated NaHCO3 solution, the mixture was concen-
trated, diluted with water (50 mL), and extracted with EtOAc (3ϫ
50 mL). The combined organic extracts was washed with water,
dried with anhydrous MgSO4, and filtered, and the solvents were
evaporated to dryness. Purification on silica gel column, eluting
with CH2Cl2/MeOH (9:1), gave pure 12 (340 mg, 81% over two
steps). [α]2D4 = –0.6 (c = 0.5, CHCl3). Selected 1H NMR (400 MHz,
Sodium 2β,3α-Disulfate-24-nor-5α-cholan-23-ol (14): Triethylamine–
sulfur trioxide complex (780 mg, 4.3 mmol) was added to 12
(170 mg, 0.43 mmol) in dry DMF (10 mL) under an argon atmo-
sphere, and the mixture was stirred at 95 °C for 48 h. The reaction
mixture was quenched with water (1.6 mL) and the solution was
poured over a C18 silica gel column to remove excess SO3·NEt3.
The product was eluted with MeOH, and evaporation of the sol-
vent yielded a yellow solid [bis(triethylammonium sulfate) salt].
Amberlite CG 120 sodium form (30 g) was added to the solution
of the solid in methanol (30 mL), and the mixture was stirred for
5 h at room temperature. The resin was removed by filtration, and
the filtrate was concentrated to obtain methyl 2β,3α-disulfate-24-
nor-5α-cholan-23-oate 13 (250 mg), which was used in the next step
without any purification.
Dry methanol (54 μL, 2.15 mmol) and LiBH4 (1.0 mL, 2 m in THF,
2.15 mmol) were added to a solution of 13 (250 mg, 0.43 mmol) in
6
www.eurjoc.org
© 0000 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 0000, 0–0

Job/Unit: O20619
/KAP1
Date: 17-07-12 17:39:05
Pages: 9
Total Synthesis of Solomonsterol B
dry THF (5 mL) at 0 °C under argon, and the resulting mixture
was stirred for 3 h at 0 °C. The mixture was quenched by addition
of MeOH (2 mL), and then concentrated in vacuo. Purification by
C18 cartridge, eluting with MeOH/H2O (1:99), gave compound 14
as a white solid (190 mg, 78% over two steps). [α]2D4 = +19.8 (c =
0.02, CH3OH). Selected 1H NMR (400 MHz, CD3OD): δ = 4.72
(br. s, 1 H), 4.70 (br. s, 1 H), 3.64 (m, 1 H), 3.63 (m, 1 H), 1.00 (s,
3 H), 0.95 (d, J = 6.5 Hz, 3 H), 0.70 (s, 3 H) ppm. HRMS (ESI):
calcd. for C23H38NaO9S2 [M – Na]– 545.1855; found 545.1875.
[1]
[2]
F. P. Guengerich, Annu. Rev. Pharmacol. Toxicol. 1999, 39, 1–
17.
S. A. Kliewer, B. Goodwin, T. M. Willson, Endocr. Rev. 2002,
23, 687–702.
[3]
[4]
[5]
S. A. Kliewer, J. Nutr. 2003, 133, 2444S–2447S.
S. A. Kliewer, T. M. Willson, J. Lipid Res. 2002, 43, 359–364.
H. R. Kast, B. Goodwin, P. T. Tarr, S. A. Jones, A. M. Anis-
feld, C. M. Stoltz, P. Tontonoz, S. Kliewer, T. M. Willson, P. A.
Edwards, J. Biol. Chem. 2002, 277, 2908–2915.
J. M. Rosenfeld, R. Vargas Jr., W. Xie, R. M. Evans, Mol. En-
docrinol. 2003, 17, 1268–1282.
W. Xie, Y. Tian, Cell Metab. 2006, 4, 177–178.
C. Zhou, M. M. Tabb, E. L. Nelson, F. Grun, S. Verma, A.
Sadatrafiei, M. Lin, S. Mallick, B. M. Forman, K. E. Thum-
mel, B. Blumberg, J. Clin. Invest. 2006, 116, 2280–2289.
X. Gu, S. Ke, D. Liu, T. Sheng, P. E. Thomas, A. B. Rabson,
M. A. Gallo, W. Xie, Y. Tian, J. Biol. Chem. 2006, 281, 17882–
17889.
T. Langmann, C. Moehle, R. Mauerer, M. Scharl, G. Liebisch,
A. Zahn, W. Stremmel, G. Schmitz, Gastroenterology 2004,
127, 26–40.
A. S. Day, R. B. Gearry, Dig. Dis. Sci. 2010, 55, 877–879.
J. Cheng, Y. M. Shah, X. Ma, X. Pang, T. Tanaka, T. Kodama,
K. W. Krausz, F. J. Gonzalez, J. Pharmacol. Exp. Ther. 2010,
335, 32–41.
V. Sepe, G. Bifulco, B. Renga, C. D’Amore, S. Fiorucci, A.
Zampella, J. Med. Chem. 2011, 54, 1314–1320.
S. De Marino, R. Ummarino, M. V. D’Auria, M. G. Chini, G.
Bifulco, B. Renga, C. D’Amore, S. Fiorucci, C. Debitus, A.
Zampella, J. Med. Chem. 2011, 54, 3065–3075.
S. De Marino, V. Sepe, M. V. D’Auria, G. Bifulco, B. Renga, S.
Petek, S. Fiorucci, A. Zampella, Org. Biomol. Chem. 2011, 9,
4856–4862.
B. Renga, A. Mencarelli, C. D’Amore, S. Cipriani, M. V. D’Au-
ria, V. Sepe, M. G. Chini, M. C. Monti, G. Bifulco, A. Zam-
pella, S. Fiorucci, PLoS One 2012, 7, e30443.
S. De Marino, R. Ummarino, M. V. D’Auria, M. G. Chini, G.
Bifulco, C. D’Amore, B. Renga, A. Mencarelli, S. Petek, S.
Fiorucci, A. Zampella, Steroids 2012, 77, 484–495.
M. G. Chini, C. R. Jones, A. Zampella, M. V. D’Auria, B.
Renga, S. Fiorucci, C. P. Butts, G. Bifulco, J. Org. Chem. 2012,
77, 1489–1496.
Cell Culture Conditions and Transactivation Assay: HepG2 cells
were kept at 37 °C in E-MEM containing 10% fetal bovine serum
(FBS), 1% l-glutamine, and 1% penicillin/streptomycin. HepG2
cells were stimulated for 18 h with 10 μm of rifaximin, 2 and 14, and
the relative mRNA levels of PXR target genes CYP3A4, CYP3A7,
SULT2A1, and MDR1 were analyzed by real-time PCR. For the
transactivation experiment, HepG2 cells were transfected using a
Fugene HD transfection reagent (Roche). The plasmids used were
pSG5-PXR, pSG5-RXR, pCMV-βgalactosidase, and the reporter
vector p(CYP3A4)-TK-Luc. 24 h post-transfection, cells were
stimulated for 18 h with rifaximin (10 μm), with 2 (1 and 10 μm)
and with 14 (1 and 10 μm). After the stimulation, cells were lysed in
100 μL diluted reporter lysis buffer (Promega) and 20 μL of cellular
lysates were read using the Luciferase Substrate (Promega). Lumi-
nescence was measured using the Glomax 10/10 luminometer (Pro-
mega). Luciferase activities were normalized for transfection effi-
ciencies by dividing the relative light units by β-galactosidase ac-
tivity expressed from cotransfected pCMV-βgal.
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
Real-Time PCR: Total RNA was extracted using the TRIzol rea-
gent (Invitrogen), purified from genomic DNA by DNase I treat-
ment (Invitrogen), and random reverse-transcribed with Super-
script II (Invitrogen). A 50 ng template was amplified using the
following reagents: 0.2 μm of each primer and 12.5 μL of 2X SYBR
Green qPCR master mix (Invitrogen). All reactions were performed
in triplicate, and the thermal cycling conditions were: 2 min at
95 °C, followed by 40 cycles of 95 °C for 20 sec, 55 °C for 20 sec
and 72 °C for 30 sec in an iCycler iQ instrument (Biorad). The
relative mRNA expression was calculated and expressed as
[15]
[16]
[17]
[18]
[19]
[20]
2–(ΔΔCt)
.
The primers used for qRT-PCR were: hB2M:
TGCTATGTGTCTGGGTTTCATC and TGACAAAGTCA-
CATGGTTCACA; hCYP3A4: CAAGACCCCTTTGTGGAAAA
and CGAGGCGACTTTCTTTCATC; hCYP3A7: CAAGACCCC-
V. Sepe, R. Ummarino, M. V. D’Auria, M. G. Chini, G. Bi-
fulco, B. Renga, C. D’Amore, C. Debitus, S. Fiorucci, A. Zam-
pella, J. Med. Chem. 2012, 55, 84–93.
C. Festa, S. De Marino, M. V. D’Auria, G. Bifulco, B. Renga,
S. Fiorucci, S. Petek, A. Zampella, J. Med. Chem. 2011, 54,
401–405.
TTTGTGGAAAA
and
TGTCTCTTTGAGGCGACCTT;
hSULT2A1: GATCCAATCTGTGCCCATCT and TAAAT-
CACCTTGGCCTTGGA; hMDR1: GTGGGGCAAGTCAG-
TTCATT and TCTTCACCTCCAGGCTCAGT.
[21]
[22]
M. V. D’Auria, V. Sepe, A. Zampella, Curr. Top. Med. Chem.
2012, 12, 637–669.
V. Sepe, R. Ummarino, M. V. D’Auria, A. Mencarelli, C.
D’Amore, B. Renga, A. Zampella, S. Fiorucci, J. Med. Chem.
2011, 54, 4590–4599.
Supporting Information (see footnote on the first page of this arti-
cle): Copies of the 1H NMR and 13C NMR spectra for all key
intermediates and final products.
[23]
[24]
A. F. Hofmann, S. F. Zakko, M. Lira, C. Clerici, L. R. Hagey,
K. K. Lambert, J. H. Steinbach, C. D. Schteingart, P. Olinga,
G. M. Groothuis, Hepatology 2005, 42, 1391–1398.
P. Fickert, M. Wagner, H. U. Marschall, A. Fuchsbichler, G.
Zollner, O. Tsybrovskyy, K. Zatloukal, J. Liu, M. P. Waalkes,
C. Cover, H. Denk, A. F. Hofmann, H. Jaeschke, M. Trauner,
Gastroenterology 2006, 130, 465–481.
E. Halilbasic, R. Fiorotto, P. Fickert, H. U. Marschall, T. Mou-
stafa, C. Spirli, A. Fuchsbichler, J. Gumhold, D. Silbert, K.
Zatloukal, C. Langner, U. Maitra, H. Denk, A. F. Hofmann,
M. Strazzabosco, M. Trauner, Hepatology 2009, 49, 1972–1981.
K. Y. Tserng, P. D. Klein, Steroids 1977, 29, 635–648.
C. D. Schteingart, A. F. Hofmann, J. Lipid Res. 1988, 29, 1387–
1395.
Acknowledgments
This work was supported by grants from MAREX-Exploring Ma-
rine Resources for Bioactive Compounds: From Discovery to Sus-
tainable Production and Industrial Applications (Call FP7-KBBE-
2009-3, Project nr. 245137) and Ministero dellЈUniversità e della
Ricerca (MIUR) (PRIN 2009) “Sostanze ad attività antitumorale:
isolamento da fonti marine, sintesi di analoghi e ulteriore sviluppo
della chemoteca “LIBIOMOL”. NMR spectra were provided by
the CSIAS, Centro Interdipartimentale di Analisi Strumentale, Fa-
culty of Pharmacy, University of Naples.
[25]
[26]
[27]
Eur. J. Org. Chem. 0000, 0–0
© 0000 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
7

Job/Unit: O20619
/KAP1
Date: 17-07-12 17:39:05
Pages: 9
A. Zampella et al.
FULL PAPER
[28] T. Iida, G. Kakiyama, Y. Hibiya, S. Miyata, T. Inoue, K. Ohno,
T. Goto, N. Mano, J. Goto, T. Nambara, A. F. Hofmann, Ste-
roids 2006, 71, 18–29.
[32]
B. Voigt, A. Porzel, G. Adam, D. Golsch, W. Adam, C. Wagner,
K. Merzweiler, Collect. Czech. Chem. Commun. 2002, 67, 91–
102.
[29] T. Iida, T. Momose, T. Tamura, T. Matsumoto, F. C. Chang, J.
Goto, T. Nambara, J. Lipid Res. 1988, 29, 165–171.
[30] C. J. MacNevin, F. Atif, I. Sayeed, D. G. Stein, D. C. Liotta, J.
Med. Chem. 2009, 52, 6012–6023.
[31] R. Cong, Y. Zhang, W. Tian, Tetrahedron Lett. 2010, 51, 3890–
3892.
[33] X. Ma, Y. M. Shah, G. L. Guo, T. Wang, K. W. Krausz, J. R.
Idle, F. J. Gonzalez, J. Pharmacol. Exp. Ther. 2007, 322, 391–
398.
Received: May 15, 2012
Published Online: ᭿
8
www.eurjoc.org
© 0000 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 0000, 0–0

Job/Unit: O20619
/KAP1
Date: 17-07-12 17:39:05
Pages: 9
Total Synthesis of Solomonsterol B
Total Synthesis
We report the first total synthesis of solo-
monsterol B, a marine steroid endowed
with potent agonistic activity towards the
pregnane X receptor (PXR). This synthesis
was completed in a total of 13 steps start-
ing from hyodeoxycholic acid, with an
overall yield of 10%. The preparation of a
side-chain-modified derivative and a pre-
liminary structure–activity relationship on
PXR is also reported.
V. Sepe, R. Ummarino, M. V. D’Auria,
B. Renga, S. Fiorucci,
A. Zampella* .................................... 1–9
The First Total Synthesis of Solomonsterol
B, a Marine Pregnane X Receptor Agonist
Keywords: Total synthesis / Natural prod-
ucts / Steroids / Structure–activity relation-
ships
Eur. J. Org. Chem. 0000, 0–0
© 0000 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
9