Original 2-(3-alkoxy-1 H -pyrazol-1-yl)pyrimidine derivatives as inhibitors of human dihydroorotate dehydrogenase (DHODH)

Article abstract of DOI:10.1021/jm501446r

From a research program aimed at the design of new chemical entities followed by extensive screening on various models of infectious diseases, an original series of 2-(3-alkoxy-1H-pyrazol-1-yl)pyrimidines endowed with notable antiviral properties were found. Using a whole cell measles virus replication assay, we describe here some aspects of the iterative process that, from 2-(4-benzyl-3-ethoxy-5-methyl-1H-pyrazol-1-yl)pyrimidine, led to 2-(4-(2,6-difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyrazol-1-yl)-5-ethylpyrimidine and a 4000-fold improvement of antiviral activity with a subnanomolar level of inhibition. Moreover, recent precedents in the literature describing antiviral derivatives acting at the level of the de novo pyrimidine biosynthetic pathway led us to determine that the mode of action of this series is based on the inhibition of the cellular dihydroorotate dehydrogenase (DHODH), the fourth enzyme of this pathway. Biochemical studies with recombinant human DHODH led us to measure IC₅₀ as low as 13 nM for the best example of this original series when using 2,3-dimethoxy-5-methyl-6-(3-methyl-2-butenyl)-1,4-benzoquinone (coenzyme Q₁) as a surrogate for coenzyme Q₁₀, the cofactor of this enzyme.

Full text of DOI:10.1021/jm501446r

Article
pubs.acs.org/jmc
Original 2‑(3-Alkoxy‑1H‑pyrazol-1-yl)pyrimidine Derivatives as
Inhibitors of Human Dihydroorotate Dehydrogenase (DHODH)
Helene Munier-Lehmann,†,‡ Marianne Lucas-Hourani,§,∥ Sandrine Guillou,†,‡ Olivier Helynck,†,‡
́
̀
Gigliola Zanghi,†,‡ Anne Noel,†,‡ Frederic Tangy,§,∥ Pierre-Olivier Vidalain,§,∥ and Yves L. Janin*,†,‡
́
́
†Unite
́
́
de Chimie et Biocatalyse, Departement de Biologie Structurale et Chimie, Institut Pasteur, 28 Rue du Dr. Roux, 75724 Paris
Cedex 15, France
‡Unite
§Unite
́
́
Mixte de Recherche 3523, Centre National de la Recherche Scientifique, 28 Rue du Dr. Roux, 75724 Paris Cedex 15, France
de Genomique Virale et Vaccination, Departement de Virologie, Institut Pasteur, 28 Rue du Dr. Roux, 75724 Paris Cedex 15,
́
́
France
∥Unite
́
Mixte de Recherche 3569, Centre National de la Recherche Scientifique, 25 Rue du Dr. Roux, 75724 Paris Cedex 15, France
S
* Supporting Information
ABSTRACT: From a research program aimed at the design of new
chemical entities followed by extensive screening on various models
of infectious diseases, an original series of 2-(3-alkoxy-1H-pyrazol-1-
yl)pyrimidines endowed with notable antiviral properties were found.
Using a whole cell measles virus replication assay, we describe here
some aspects of the iterative process that, from 2-(4-benzyl-3-ethoxy-
5-methyl-1H-pyrazol-1-yl)pyrimidine, led to 2-(4-(2,6-difluorophe-
noxy)-3-isopropoxy-5-methyl-1H-pyrazol-1-yl)-5-ethylpyrimidine and
a 4000-fold improvement of antiviral activity with a subnanomolar
level of inhibition. Moreover, recent precedents in the literature
describing antiviral derivatives acting at the level of the de novo
pyrimidine biosynthetic pathway led us to determine that the mode
of action of this series is based on the inhibition of the cellular dihydroorotate dehydrogenase (DHODH), the fourth enzyme of
this pathway. Biochemical studies with recombinant human DHODH led us to measure IC50 as low as 13 nM for the best
example of this original series when using 2,3-dimethoxy-5-methyl-6-(3-methyl-2-butenyl)-1,4-benzoquinone (coenzyme Q1) as
a surrogate for coenzyme Q10, the cofactor of this enzyme.
that the vast majority of N-arylpyrazoles have been made using
the Knorr condensation between β-ketoesters and arylhydra-
zines which leads to 5-hydroxy-N-arylpyrazoles.10,11 The
preparation of the far less described isomeric N-arylated 3-
alkoxypyrazoles or 3-hydroxypyrazoles led us to report on few
original aspects of 3/5-alkoxypyrazoles chemistry, which indeed
provided synthetic paths to new chemical entities.12−21 Luckily,
the 3-alkoxypyrazoles 1 and 2 depicted in Figure 1 turned out
to be active on the antiviral assays described above. Since these
INTRODUCTION
■
Close to a decade ago, we initiated a program focusing on the
syntheses of series of new chemicals entities, which would avoid
the features found in the structures of frequent hitters,1
promiscuous,2−5 nuisances,6 or PAINS7,8 substances, and to
submit them to the many assays targeting infectious diseases
designed at Institut Pasteur. Among other functional assays, a
high-throughput screening pipeline was developed to identify
broad-spectrum antivirals.9 This pipeline relies on recombinant
measles (MV) and chikungunya (CHIKV) viruses, which
express luciferase when replicating in target cells. As the
luciferase activity level measured is directly proportional to viral
replication, this makes such cellular assays extremely con-
venient to screen chemical libraries for antiviral molecules. MV
and CHIKV are respectively negative- and positive-strand RNA
viruses and are completely unrelated from a phylogenetic
standpoint. Thus, molecules inhibiting the replication of both
viruses stand a great chance to block a large panel of RNA
viruses. Among many libraries, close to 800 new chemical
entities featuring a pyrazole nucleus were thus assayed.
Concerning the structural originality of the N-arylated 3-
ethoxypyrazoles included in this library, it is based on the fact
Figure 1. Structures of compounds 1 and 2 and MIC50 (in μM) or
pMIC50 (from MIC50 in mol/L) on the measles virus replication assay.
Received: September 19, 2014
© XXXX American Chemical Society
A
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
fairly original compounds had no significant cellular toxicity at
their antiviral concentration, they became the starting points of
an iterative process of synthesis and evaluation which, as
described in this report, led to 2-(3-alkoxy-1H-pyrazol-1-
yl)pyrimidine derivatives endowed with nanomolar level of
antiviral effect.
3-ethoxypyrazoles 5a−f although in some cases, a small amount
of the corresponding 5-ethoxy isomers could be isolated. The
structure of compound 1 was firmly established to be the
depicted regioisomer, as its treatment with borontribromide
led, as fully described in the Experimental Section, to the 4-
benzyl-5-methyl-1-(pyrimidin-2-yl)-1H-pyrazol-3-ol. A compar-
ison with the Knorr condensation product between ethyl 2-
benzyl-3-oxobutanoate and 2-pyrimidylhydrazine gave the
alternative 4-benzyl-3-methyl-1-(pyrimidin-2-yl)-1H-pyrazol-5-
ol isomer as a control. As reported in the experimental part, the
2-chloro-5-cyclopropyl derivative 4g was prepared by Suzuki−
Miyaura coupling reactions.24 Although the corresponding 2-
chloropyrimidine 4h turned out to be commercially available,
we could also prepare the 5-methyl analogue 5h by a Suzuki−
Miyaura reaction between the 5-bromopyrimidine 5a and
methylboronic acid. The bis-substituted pyrimidine derivative
5i was obtained in 28% by making good use of a methyl
magnesium chloride addition on position 4 of the pyrimidine
ring of 5d followed by an in situ oxidation of the resulting
dihydropyrimidine intermediate. As seen in Table 1, the small
alkyl substituents on position 5 of the pyrimidine ring of
compounds 5d, 5e, 5g, and 5h led to nanomolar level of effects
(pMIC50 between 7.5 and 7.7) on MV replication. Increasing
the size of this alkyl chain to a pentyl (compound 5f) caused a
collapse of the inhibition measured. Moreover, the introduction
of a polar oxygen atom as seen for the 5-methoxy compound
5b was also detrimental (pMIC50 = 6.2) in comparison with the
neutral ethyl derivative 5d (pMIC50 = 7.7). Shifting the methyl
from position 5 of the pyrimidine (compound 5h) to the
position 4 (compound 5c) led to a 25-fold loss of activity (from
a pMIC50 of 7.5 to 6.1). Finally, the combination of an ethyl on
carbon 5 and a methyl on carbon 4 seen in analogue 5i also
RESULTS AND DISCUSSION
■
Structure−Activity Relationship Study. In the following
we have tried to describe initial results of this ongoing work.
Accordingly, we are providing a description of a succession of
synthesis campaigns followed by comments on the antiviral
effect obtained. Most of these results are presented in tables in
which the first result column (%) provides the yield of the
reaction depicted and the second column describes the
observed antiviral effect expressed as pMIC50 values.22 This
corresponds to the negative log of the minimum compound
concentration required to inhibit viral growth by 50% when
using a recombinant measles virus strain expressing luciferase as
a reporter. In view of the low micromolar effects of the 2-
pyrimidyl and the 2-pyridyl derivatives 1 and 2 on both MV
and CHIKV replication, we first focused on altering the
substituents on the pyrimidine ring of compounds 1. As
depicted in Table 1, the analogues 5a−f were prepared via N-
Table 1. Preparation and Antiviral Effect of Compounds 5a−
a
g
caused a more modest drop of the antiviral effect (pMIC50
7.4) in comparison with the 5-ethyl derivative 5d (pMIC50
7.7).
=
=
These initial results thus pointed out the importance of a
small aliphatic group on position 5 of the pyrimidine ring to
achieve a strong virus replication inhibition. As depicted in
Table 2, we then set to evaluate the contribution of the
pyrazole 3-ethoxy group on the antiviral effect. From the 5-
ethylpyrimidyl compounds 5d or the 5-cyclopropylpyrimidyl
derivative 6 depicted in Table 2 (made by N-arylation of the
corresponding 4-benzyl-3-isopropoxy-5-methyl-1H-pyrazole),
we prepared the 3-hydroxy derivatives 7 and 8. This was
achieved using boron tribromide in dichloromethane at room
temperature, as harsher conditions would cleave the pyrimidyl−
pyrazole bond. From 6 and 7, O-alkylation reactions using
various alkylating agents gave the corresponding 3-alkoxypyr-
azoles 9a−e. Concerning the selectivity of these reactions,
methylation of 7, under basic conditions using methyl iodide at
room temperature, gave the O-methyl 11a and the correspond-
ing N-methyl derivative in equal proportions. On the other
hand, the use of isopropyl bromide, 2-bromobutane, or 2-
bromopentane, at 80 °C, gave the O-alkyl products 9b−d in
similar yields but only traces of the corresponding N-alkyl
derivatives were isolated from the reaction mixture. The
preparation of compound 9f was achieved via the N-arylation
of the corresponding 3-alkoxypyrazole as described in the
Experimental Section. Moreover, a catalytic hydrogenation of 9f
led to the corresponding alcohol 9g. The biological results
shown in Table 2 demonstrated that the removal of the alkyl
ether component to give the 3-hydroxypyrazoles 7 and 8 led to
an important loss of antiviral activity (pMIC50 of 6.0 and 5.6, in
b
c
compd
R4
R5
%
pMIC50
5a
5b
5c
5d
5e
5f
H
Br
58
44
40
65
45
52
64
30
28
7.0
6.2
6.1
7.7
7.5
<5
H
OMe
H
Me
H
Et
H
n-Pr
n-pentyl
c-Pr
Me
H
5g
5h
5i
H
7.6
7.5
7.4
d
e
H
Me
Et
a
Reagents and conditions of reaction: (i) Cs2CO3, DMF/MeCN,
microwave, 150−160 °C. Reaction yield. −log(MIC50), MIC50 in
mol/L, standard deviation of <2%. From 5a; see text and
b
c
d
e
Experimental Section. From 5d; see text and Experimental Section.
arylation of the 3-ethoxypyrazole 3 with 2-chloropyrimidines
4a−f. We initially used the Taillefer and Cristau copper-
catalyzed arylation conditions23 to achieve this reaction (i.e., for
the preparation of compound 1) although it turned out that
with these 2-chloropyrimidines, simple heating of compound 3
in the presence of cesium carbonate was sufficient. From 2-
chloropyrimidines featuring electron-attracting groups, heating
for 1 h at 150 °C using a microwave oven was enough. On the
other hand, from 2-chloropyrimidines featuring electron-
donating substituents a higher temperature (i.e., 160 °C) was
found necessary. This led almost regioselectivity to the depicted
B
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
Table 2. Preparation and Antiviral Effect of Compounds 9a−
Table 3. Preparation and Antiviral Effect of Compounds 6
and 11b−h
a
a
g
b
c
b
c
compd
R1
R5
%
pMIC50
compd
Ar
C6H5-
R5
%
pMIC50
d
e
f
6
c-Pr
Et
46
47
51
43
34
37
40
34
81
64
8.2
6.3
5.6
7.3
8.4
8.7
8.8
6.1
7.3
6.6
6
c-Pr
Et
46
46
41
46
43
36
38
38
8.2
8.8
8.9
8.2
7.4
8.2
8.2
7.1
7
11b
11c
11d
11e
11f
11g
11h
2-FC6H4-
8
c-Pr
c-Pr
Et
2-FC6H4-
c-Pr
Et
9a
9b
9c
9d
9e
9f
9g
Me
3-FC6H4-
i-Pr
4-FC6H4-
Et
2-butyl
c-Pr
c-Pr
Et
2-MeOC6H4-
3-MeOC6H4-
4-MeOC6H4-
Et
3-pentyl
Et
-(CH2)3NMe2
-CH2CH2OBn
-CH2CH2OH
Et
d
g
a
Et
Reagents and conditions of reaction: (i) Cs2CO3, DMF/MeCN,
microwave, 160 °C. Reaction yield. −log(MIC50), MIC50 in mol/L,
b
c
Et
a
standard deviation of <2%.
Reagents and conditions of reaction: (i) R1X, Cs2CO3, DMF, 20 or
85 °C. Reaction yield. −log(MIC50), MIC50 in mol/L, standard
deviation of <2%. Prepared by N-arylation; see text and Experimental
b
c
d
e
f
Section. From the deprotection of 5g. From the deprotection of 6.
as well as a methoxy group on position 2 or 3 of the benzyl
moiety (compounds 11b, 11d, 11f, 11g) had a small influence
on the antiviral effect (pMIC50 of 8.8, 8.2, 8.2, and 8.2) in
comparison with the parent inhibitor 9b (pMIC50 = 8.4). On
the other hand, a fluoride or a methoxy substituent on position
4 (compounds 11e and 11h) led to a relative loss of activity
(pMIC50 of 7.4 and 7.1). Of note is also the fact that similarly
strong antiviral activities were seen for the 2-fluoro derivatives
11b and 11c featuring either a 5-ethyl or a 5-cyclopropyl on
their pyrimidine ring (pMIC50 = 8.8 or 8.9).
g
From the hydrogenation of 9f.
comparison with 7.7 and 7.6 for compounds 5d and 5g,
respectively). Replacing the ethoxy group by the isopropyloxy
seen in compounds 9b and 6 pointed out a sizable
improvement in the case of the pair sharing a 5-ethylpyrimidine
moiety (pMIC50 from 7.7 for compound 5d to 8.4 for
compound 9b) as well as for the pair of analogues 5g (pMIC50
= 7.6) and 6 (pMIC50 = 8.2) sharing a 5-cyclopropyl moiety.
Within this series of 5-cyclopropylpyrimidine derivatives, the
methoxy derivative 9a turned out to have a pMIC50 of 7.3 (the
pMIC50 of the corresponding N-methyl isomer was of only 4.5)
in comparison with the ethoxy analogue 5g (pMIC50 = 7.6) and
the isopropoxy analogue 6 (pMIC50 = 8.2). Increasing the size
of this aliphatic chain as seen for the more lipophilic sec-butyl
As depicted in Scheme 1, at this stage we checked the
importance of few other structural features of this series of
inhibitors. Accordingly, we prepared the analogue 12 devoid of
the oxygen atom on the pyrazole ring by the N-arylation of the
corresponding 4-benzyl-3-isobutyl-5-methyl-1H-pyrazole with
2-chloropyrimidine 4d. We also synthesized the 4-ethylphenyl
analogue 13 missing the two nitrogen of the pyrimidine group
via a Lam and Chan arylation of 4-benzyl-3-isopropoxy-5-
methyl-1H-pyrazole (10a) with 4-ethylbenzeneboronic acid
and copper acetate.26 Moreover, in the course of a large-scale
preparation of compound 6 we could isolate a sufficient amount
of the 5-isopropyloxy isomer 14. Finally, since methylenes
linking two aromatics are in general prone to oxidation, we
altered this part and prepared the analogues 16a−c. The
shortened 4-phenyl derivative 16a was obtained in 60% yield by
a Suzuki−Miyaura reaction between the 4-iododerivative 15
and phenylboronic acid. An attempt to achieve the correspond-
ing Negishi reaction with benzylzinc bromide was very much
hampered by nucleophilic addition reaction on the pyrimidine
ring. The phenyl ketone 16b was prepared by the benzoylation
of the anion generated by the lithium−iodine exchange reaction
on compound 15. As detected by LC/MS, the low yield (23%)
of ketone 16b was due to many side reactions stemming again
from the butyllithium addition on the pyrimidine ring leading
to dihydropyrimidine derivatives. Quenching the anion made
from 15 with diphenyl sulfide led to the thioether 16c analogue
in an even lower 4.5% yield. The cerium ammonium nitrate
oxidation (CAN) of compound 6 led to an inseparable mixture
ether 9c (pMIC50 = 8.7) or the sec-pentyl ether 9d (pMIC50
=
8.8) also improved the antiviral effect. However, if the larger 2-
benzyloxyethyl derivative 9f retained an effect (pMIC50 = 7.4),
attempts to introduce aminated or hydroxyl function on this
part of the scaffold led to the less active analogues 9e and 9g
(pMIC50 of 6.6 and 6.6).
According to these results, we retained a 5-ethyl or a 5-
cyclopropyl group on the pyrimidine ring along with a 3-
isopropyloxypyrazole for the exploration of the structure−
activity relationships depicted in Table 3. As described in the
Experimental Section, the 3-isopropyloxypyrazoles 10a−h were
prepared, in one pot, via the reaction of hydrazine
monohydrochloride21 on the corresponding β-ketoesters.
These β-ketoesters were readily obtained by palladium-
catalyzed hydrogenations of the crude unsaturated β-ketoesters
obtained from Knoevenagel condensations25 between isopropyl
acetoacetate and an array of substituted benzaldehydes.
Following N-arylations of the 3-isopropyloxypyrazoles 10a−h
with the 2-chloropyrimidine 4d or 4g, we could explore the
effect of a fluoride or a methoxy group on the benzyl moiety
with the resulting 2-pyrimidyl analogues 6 and 11b−h. This
iteration of synthesis and evaluation pointed out that a fluoride
C
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
a
seen, in comparison with a pMIC50 of 8.4 for the corresponding
3-isopropyloxypyrazole 9b. The much lower antiviral effect of
the 4-ethylphenyl analogue 13 (pMIC50 of 6.2) pointed out the
importance of the 2-pyrimidyl substituent of the pyrazole ring.
On the other hand, with a pMIC50 of 6.8, the minor 5-
isopropyloxy isomer 14 is fairly active, although 23-fold less
than the corresponding major isomer 6 (pMIC50 = 8.2). If the
4-phenyl analogue 16a displayed a weak antiviral effect, with a
pMIC50 of 5.4, the ketone analogue 16b displayed a relatively
better one (pMIC50 = 6.2), although far less than the parent
methylene derivative 9b (pMIC50 = 8.4). The thioaryl ether
16c turned out to be modestly active with a pMIC50 of 6.9.
Interestingly, with a pMIC50 of 8.8, alcohol 17 turned out to be
among our strongest inhibitor. The introduction of the ether
function seen in compound 19a led to a 10-fold decrease of
antiviral effect (from a pMIC50 of 8.2 down to 7.2), and far
worse losses of activity were seen for the aminated analogues
19b and 19c.
Scheme 1
As depicted in Table 4, in view of the strong antiviral effect of
alcohol 17 which fed some concerns on an eventual cellular
Table 4. Preparation and Antiviral Effect of Compounds
a
21a−q
b
c
compd
R3
Ar
C6H5
%
pMIC50
21a
21b
21c
21d
21e
21f
Et
63
46
49
66
49
54
27
62
46
49
55
78
70
58
57
71
56
6.2
7.2
6.9
6.9
6.2
7.3
5.2
6.8
7.6
5.9
8.1
6.6
6.5
7.2
7.9
7.3
9.1
Et
2-FC6H4
Et
2-ClC6H4
2-BrC6H4
2-CF3C6H4
3-CF3C6H4
4-CF3C6H4
2,3-Cl2C6H3
2,5-Cl2C6H3
3,5-Cl2C6H3
2-FC6H4
Et
Et
Et
21g
21h
21i
Et
Et
Et
a
(i) PhB(OH)2, Pddppf, Cs2CO3, DMF, 120 °C, microwave; (ii) (a)
21j
Et
BuLi, THF, −78 °C; (b) PhCOCl; (ii) (a) BuLi, THF, −78 °C; (b)
PhSSPh; (iv) (a) CAN, MeCN/H2O; (b) NaBH4, EtOH; (v) NBS,
MeCN; (vi) nucleophile, 20 °C.
21k
21l
i-Pr
i-Pr
i-Pr
i-Pr
i-Pr
i-Pr
i-Pr
3-FC6H4
21m
21n
21o
21p
21q
4-FC6H4
2,3-F2C6H3
2,4-F2C6H3
2,5-F2C6H3
2,6-F2C6H3
of unreacted and oxidized material. A treatment of this partially
purified mixture with sodium borohydride allowed the isolation
of alcohol 17 in 24% overall yield. Of note concerning alcohol
17 is the occurrence of a stable internal hydrogen bond
between its hydroxyl function and the pyrazole oxygen (as
depicted in Scheme 1). This is apparent, as the alcohol
a
Reagents and conditions of reaction: Cs2CO3, DMF/MeCN,
b
c
microwave, 160 °C. Reaction yield. −log(MIC50), MIC50 in mol/
L, standard deviation of <2%.
1
hydrogen is clearly visible on the H NMR spectra and the
asymmetric center is also causing a split of the NMR signals
corresponding to the methyl of the isopropyloxy group. A far
more selective oxidation of compound 6 was also achieved
using N-bromosuccinimide, and the brominated derivative 18
was obtained in 81% yield. Nucleophilic substitution then
provided an access to the ether and aminated analogues 19a−c.
Concerning the antiviral effect of these compounds, the
importance of the pyrazole oxygen turned out to be relatively
modest as a pMIC50 of 7.5 for the 3-isobutyl derivative 12 was
oxidative activation of the methylene-bearing inhibitors, we
synthesized a series of aryl ethers such as the 3-ethoxy and the
3-isopropyloxy pyrazoles 21a−q. These were also prepared by
an N-arylation reaction between corresponding 3-ethoxy or 3-
isopropyloxy pyrazoles 20a−p and 2-chloro-5-ethylpyrimidine
(4d). As described in the Experimental Section, the
introduction of the 4-aryloxy group required the preparation
of the corresponding 3-oxo-2-aryloxybutanoates, made by O-
alkylation of the phenols with ethyl or isopropyl 2-chloro-
D
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
acetoacetate, followed by their reactions with hydrazine
monohydrochloride. As seen in this table, with a pMIC50 of
6.2, the 4-phenoxy derivative 21a was 30 times less active than
the parent 4-benzyl derivative 5d (pMIC50 = 7.7). An
improvement of the antiviral effect was observed for the
three ortho-halogenated derivatives 21b−d, the 2-fluorophe-
noxy moiety of compound 21b being the best (pMIC50 = 7.2)
in comparison with the 2-chlorophenoxy of 2-bromophenoxy
derivatives 21c and 21d (pMIC50 = 6.9 for both). Interestingly,
replacement with a 2-trifluoromethyl group to give compound
21e (pMIC50 = 6.2) canceled any improvement in regard with
the phenoxy derivative 21a. Moving this trifluoromethyl group
on position 3 (pMIC50 of 7.3 for compound 21f) led to a level
of activity comparable with compound 21b. On the other hand,
moving the trifluoromethyl group to position 4 caused a great
loss of activity (pMIC50 of 5.2 for compound 21g). Adding a
second chloride group on the phenoxy moiety pointed out the
benefit of the 2,5-dichloro configuration seen in compound 21i
(pMIC50 = 7.6) in comparison with the relatively active 2,3-
dichlorophenoxy derivative 21h (pMIC50 = 6.8) or the less
efficient 3,5-dichloro derivative 21j (pMIC50 = 5.9). Moving to
the 3-isopropyloxy series 21k−q, close to an order of
magnitude was gained when comparing the 3-ethoxy derivative
featuring a 2-fluorophenoxy 21b (pMIC50 = 7.2) with the
corresponding 3-isopropyloxy analogue 21k (pMIC50 = 8.1).
The fluorine atom on position 3 or 4 was not beneficial, as seen
by the antiviral effect of the analogues 21l (pMIC50 = 6.6) and
21m (pMIC50 = 6.5). Interestingly, some restoration of the
antiviral effects was achieved with the 2,3- difluorophenoxy and
2,4-difluorophenoxy derivatives 21n (pMIC50 = 7.2) and 21o
(pMIC50 = 7.9). Moreover, if the 2,5-difluorophenoxy
derivative 21p turned out to also be active (pMIC50 = 7.3),
the 2,6-difluorophenoxy analogue 21q displayed a subnano-
molar efficiency (pMIC50 = 9.1)!
Finally, as depicted in Table 5, from the pyrazole ether 20q,
the analogues 23a−k, featuring a variety of substituted
pyrimidines, were prepared. Compounds 23a−g were made
via N-arylation reactions using the corresponding 2-chloropyr-
imidines 4a, 4b, 4e, 4g, 22a−c. Moreover, the hydroxy-bearing
analogues 23h,i were prepared in modest yield using the
pyrazole nitrogen nucleophilic displacement of the thiomethyl
group of the 2-(methylthio)pyrimidin-4-ols 22h−k (the
preparation of 22j−k is provided in the Experimental Section)
at 200 °C. Concerning this nucleophilic substitution reaction, a
major improvement has been reported for many examples with
the use of pivalic acid as the solvent.27 However, in our case the
LC/MS monitoring of trials pointed out an amidification of the
pyrazole nitrogen by the acid which then prevented any
nucleophilic displacement. Concerning the antiviral effects of
this series of analogues, again a small aliphatic group in position
5 of the pyrimidine ring appears to be important. When going
from the unsubstituted analogue 23a (pMIC50 = 5.6), the 5-
methyl derivative 23c (pMIC50 = 7.9), the 5-ethyl derivative
21q (pMIC50 = 9.1), and the 5-propyl derivative 23e (pMIC50
= 8.5), some sort of ebb is reached as seen for the series 5a−i.
The 5-cyclopropyl group of the analogue 23d (pMIC50 = 8.9) is
also strongly active, whereas the introduction of polar groups
such as the methoxy or the bromine groups of compounds 23f
and 23g leads to lesser antiviral effects (pMIC50 of 7.3 and 7.9).
Of interest is the progression seen for the 4-hydroxylated
derivatives 23h−k. If the unsubstituted analogue 23h is only
very weakly active, the 5-methyl analogue 23i displays a more
sizable antiviral effect (pMIC50 = 6.8) and the 5-ethyl derivative
Table 5. Preparation and Antiviral Effect of Compounds
23a−k
a
b
c
compd
R4
R5
%
pMIC50
23a
23b
23c
23d
23e
23f
H
H
78
18
77
83
67
45
69
20
23
10
17
5.6
6.6
7.9
8.9
8.5
7.3
7.9
<5
H
F
H
Me
cPr
nPr
OMe
Br
H
H
H
23g
23h
23i
H
OH
OH
OH
OH
H
Me
Et
6.8
7.8
7.2
23j
23k
nPr
a
Reagents and conditions of reaction: (i) Cs2CO3, DMF/MeCN,
b
c
microwave, 130−180 °C; (ii) neat 200 °C. Reaction yield.
log(MIC50), MIC50 in mol/L, standard deviation of <2%.
−
23j is among the fairly effective analogues (pMIC50 = 7.8). On
the other hand, a decrease of antiviral effect is observed in the
case of the propyl-bearing analogue 23k (pMIC50 = 7.2).
Elucidation of the Mechanism of Antiviral Action.
Finding out the mode of action of this series of compounds was
greatly helped by recent precedents28−33 involving screening
for antivirals. Indeed, strong antiviral compounds that turned
out to be inhibitors of the host cell enzymes involved in the de
novo pyrimidine biosynthetic pathway34−36 were discovered.
The inhibitors reported so far are acting either on the
trifunctional enzymatic complex (comprising a carbamoyl
phosphate synthetase II, a L-aspartate transcarbamylase, and a
dihydroorotase) or on the dihydroorotate dehydrogenase
(DHODH).30,31,37−40 Moreover, in a mice model of
cytomegalovirus infection, a reduction of the virus replication
was recently reported for another DHODH inhibitor.33 As
depicted in Figure 2, the addition of uridine to the cell culture
medium treated with compound 5d actually restored the
measles virus replication (Figure 2C), and this was also the case
when adding orotic acid (Figure 2A). On the other hand,
addition to the culture medium of L-dihydroorotic acid (L-
DHO), the precursor of orotic acid in the pyrimidine
biosynthetic pathway, did not restore the measles virus
replication (Figure 2B).
Accordingly, to further demonstrate that DHODH is the
cellular target of this series of antivirals, we undertook the
production of the recombinant human enzyme and assessed the
inhibition profiles for several compounds. The inhibitory
potency of these compounds at concentrations between 5
nM to 200 μM was measured on the DHODH catalytic activity,
using the traditional electron acceptor dichloroindophenol at
fixed concentrations of L-DHO and coenzyme Q1
(CoQ1).40−43 As shown in Table 6, the pMIC50 and pIC50 of
selected compounds were compared with brequinar (24) and
E
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
Table 6. Comparison of Inhibition of Measles Virus
a
Replication and of Human Recombinant DHODH
Figure 2. Compound 5d is an inhibitor of the pyrimidine biosynthesis
pathway. HEK-293T cells were infected with recombinant measles
virus (MV) strain expressing luciferase (MOI = 0.1) and incubated
with DMSO alone or compound 5d, and culture medium was
supplemented with orotic acid (A) or with dihydroorotic acid (B).
After 24 h, the bioluminescence caused by the luciferase expression
was determined. Experiment was performed in duplicate, and data
represent mean values
SD (C). The same experiment was
performed, but the culture medium was supplemented or not with
uridine.
teriflunomide (25) which are reference inhibitors of human
DHODH.44−50 The strongest antivirals (compounds 11c, 17,
and 21q) also displayed the strongest inhibition on the catalytic
activity (pIC50 between 7.8 and 7.9). Increasing the
concentrations of L-DHO revealed that these are not
competitive inhibitors of this substrate (data not shown).
Moreover, a clear correlation between the extent of antiviral
effect and the inhibition of DHODH is seen for all the
compounds we assayed so far. Interestingly, contrary to
brequinar (24) and teriflunomide (25), which are 10 and 5
times less active on the cellular assay than on the biochemical
one, all our inhibitors turned out to be at least 10-fold more
active on the cellular than on the biochemical assay. This
unusual situation, which may point out differences in cell
membrane permeability and/or an amplification of antiviral
effect by this series of compounds, is the current subject of
further research in our lab.
a
Footnotes: (i) −log(MIC50), MIC50 in mol/L, for measles virus
replication, standard deviation of <2%. (ii) −log(IC50), IC50 in mol/L,
on recombinant human DHODH, standard deviation of 2%. (iii) An
pIC50 of 8 was reported, although using decylubiquinone (CoQD).44,46
(iv) Reported value using decylubiquinone (CoQD).45,46
groups especially on position 5 of the pyrimidine ring. Ongoing
study is currently aiming at the design and selection of potent
compounds with a less lipophilic character to further invest in
the determination of some of their pharmacological character-
istics. Concerning their mechanism of action, similar to recently
reported compounds displaying an antiviral effect in
cellulo,28−33,51,52 this series turned out to inhibit the cellular
DHODH, the fourth enzyme involved in the de novo
pyrimidine biosynthetic pathway. As depicted in Table 6,
with the use of recombinant DHODH, we could demonstrate
that the inhibition of this enzyme by an array of compounds is
correlating with their inhibition of measles virus replication. It
would be much beyond our means to invest the time and
resources in measuring the actual enzyme inhibition power for
all the analogues prepared. However, because of its simplicity as
well as the fact that it is phenotypic, we are using the antiviral
assay as the primary selecting tool to pursue this research
which, for this series of compounds, is aiming at the design of
strong inhibitors of human DHODH. Concerning the potential
CONCLUSION
■
This work describes the initial structure−activity relationship
studies of an original series of new chemical entities displaying a
strong inhibitory activity on measles virus replication in vitro.
The knowledge gathered in the course of this work is currently
being used in additional iterations of synthesis and extensive
biological evaluations of different analogues, including many 2-
(3-alkoxy-1H-pyrazol-1-yl)pyridine derivatives related to com-
pound 2. The aim of this work was to identify some of the
structural parameters governing the antiviral effect. The results
so far obtained are pointing out a necessity for fairly lipophilic
F
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
mM HEPES, pH 7.5, 300 mM NaCl, 20% glycerol) supplemented
with Complete protease inhibitor cocktail EDTA-free (Roche) and
disrupted by sonication. Before centrifugation at 10000g for 30 min at
4 °C, Triton X-100 was added to a final concentration of 1% into the
lysate. The supernatant was added to 3 mL of BD TALON resin
(Clontech) previously equilibrated with buffer A and gently stirred at
room temperature on a platform shaker. The additional steps are
described by BD Biosciences in the batch/gravity-flow column
purification section. The recombinant protein began to elute with 30
mM imidazole, as indicated by the appearance of a yellow color in the
eluate. At this point, it was rapidly eluted with 160 mM imidazole.
Fractions were analyzed by SDS−PAGE for purity, and appropriate
fractions were pooled and concentrated using a stirred cell system
(Pall Life Sciences). The His-tag was not removed for further studies.
DHODH Enzymatic Assay. DHODH activity was determined at
25 °C following the reduction of DCIP at 600 nm (ε = 18 800 M−1
cm−1) on a spectrophotometer. The reaction medium used for this
contained 50 mM Tris-HCl, pH 8.0, 0.1% Triton X-100, 0.1 mM L-
DHO, 0.025 mM CoQ1, and 0.06 mM DCIP. The reaction was started
by addition of the enzyme. The inhibitory potency of the compounds
was evaluated by measuring the initial velocity of the reaction either in
the absence or in the presence of the compounds at concentrations
between 5 nM and 200 μM. Brequinar (24) was assessed as a
reference.
of such class of inhibitors, teriflunomide (25) has been used for
the past decade in the treatment of rheumatoid arthritis and
more recently in the treatment of multiple sclerosis, and many
other series of DHODH inhibitors are currently developed.40
Hopefully, optimized compounds from this original series of
inhibitors will find uses against some of these health problems.
EXPERIMENTAL SECTION
■
Biological Protocols. General. I.M.A.G.E. full length cDNA
clone IRATp970D0185D was purchased from Biovalley S.A. The E.
coli DH5α strain (Life Technologies) was used for DNA purification.
DNA polymerases, restriction enzymes, and T4 DNA ligase were from
New England Biolabs. Oligonucleotides were purchased from Eurofins
MWG Operon. BD TALON metal affinity resin was obtained from
BD Biosciences Clontech and Hepes. Triton X-100, L-dihydroorotic
acid (L-DHO), riboflavin 5′-monophosphate sodium salt (FMN), 2,3-
dimethoxy-5-methyl-6-(3-methyl-2-butenyl)-1,4-benzoquinone (coen-
zyme Q1/CoQ1), and 2,6-dichloroindophenol sodium salt (DCIP)
were from Sigma-Aldrich.
Screening To Identify Broad-Spectrum Antivirals. The
experiments were performed on a TECAN Freedom EVOware
platform. The screening pipeline that we developed to select for
broad-spectrum antivirals was recently described.9 Briefly, stock
solutions of compounds in DMSO were spiked in white, flat bottom,
bar-coded tissue culture 96-wells plates. Then culture wells were
loaded with human HEK-293T cells infected with a recombinant strain
of measles virus expressing firefly luciferase from an additional
transcription unit (rMV2/Luc) at a multiplicity of infection of 0.1.
Cells were grown for 24 h at 37 °C and 5% CO2 in Dulbecco’s
modified Eagle medium (DMEM) with stabilized L-glutamine and
supplemented with 10% fetal calf serum (FCS), streptomycin (100
μg/mL), and penicillin (100 IU/ml). Luciferase activity was
determined by adding 50 μL of luciferase substrate (Bright-GLO,
Promega) directly to culture wells. After 6 min of incubation at room
temperature, bioluminescence level was measured with a luminometer
(Safire 2 or Infinite M1000, TECAN). In parallel, a second set of
culture plates containing test compounds were loaded with non-
infected HEK-293T cells to determine cellular toxicity. After 24 h of
culture, cellular viability was determined by adding 50 μL of CellTiter-
GLO (Promega), a luciferase-based reagent that evaluates, by ATP
quantification, the number of metabolically active cells in culture.
Compounds that inhibited rMV2/Luc replication by more than 75%
without significant reduction of cellular viability were selected for
further characterization. Finally, selected hit compounds were retested
in dose−response experiments for their capacity to block the
replication of both measles virus using rMV2/Luc and tested as well
for the inhibition of chikungunya virus. For this later experiment,
chikungunya virus replication was assessed with the recombinant strain
CHIKV/Ren that expresses Renilla luciferase as a reporter.
Recombinant DHODH Production and Purification. The
cDNA encoding an N-terminally truncated (first 29 amino acids)
human DHODH was amplified by PCR from full length cDNA clone
IRATp970D0185D as template using primers 1 (GGGAATTCCAT-
atggccacgggagatgagcgtttctat) and 2 (CCCCAAGCTTtcacctccgat-
gatctgctccaatgg), which introduce NdeI and HindIII restriction sites,
respectively. The PCR product was inserted into the pCR II-TOPO
vector (Life Technologies). This intermediate plasmid was digested by
NdeI and HindIII restriction enzymes, and the purified 1104-bp insert
was ligated into NdeI/HindIII linearized pET28a plasmid (Novagen,
Inc.). The resulting plasmid pHL200-1 was sequenced to verify its
integrity and introduced into the E. coli strain BL21(DE3)/pDIA1753
to overproduce a N-terminal His-tagged human DHODH. Bacteria
were grown at 25 °C in 2YT medium supplemented with 0.1 mM
flavin mononucleotide, 35 μg/mL kanamycin, and 30 μg/mL
chloramphenicol. Production of recombinant enzyme was induced
with isopropyl-1-β-D-thiogalactopyranoside (5 μM final concentration)
when cultures reached an absorbance of 0.5 at 600 nm. Cells were
harvested after an additional 20 h of growth at 25 °C. A cell pellet
from 650 mL of culture was resuspended in 50 mL of lysis buffer A (50
Chemistry. A Biotage initiator 2 microwave oven was used for
1
reactions mentioning such heating method. H NMR and 13C NMR
spectra were recorded on a Bruker Avance 400 spectrometer at 400
and 100 MHz, respectively. Shifts (δ) are given in ppm with respect to
the TMS signal, and coupling constants (J) are given in hertz. Column
chromatography was performed on either Merck silica gel 60 (0.035−
0.070 mm) or neutral alumina containing 1.5% of added water using a
solvent pump and an automated collecting system driven by a UV
detector set to 254 nm unless required otherwise. Sample deposition
was carried out by absorption of the mixture to be purified on a small
amount of the solid phase followed by its deposition on the top of the
column. The low resolution mass spectra were obtained on an Agilent
1100 series LC/MSD system using an atmospheric electrospray
ionization system, and the high resolution mass spectra (HRMS) were
obtained using a Waters Micromass Q-Tof with an electrospray ion
source. Unless stated otherwise, a purity of at least 95% was obtained
for all the compounds by means of chromatography, recrystallization,
or distillation, and this level of purity was established by TLC, LC/MS,
and NMR spectroscopy.
Preparation of 2-(4-Benzyl-3-ethoxy-5-methyl-1H-pyrazol-
1-yl)pyrimidine (1). In a 20 mL tube designed for microwave
heating, 4-benzyl-3-ethoxy-5-methyl-1H-pyrazole (0.62 g, 2.87 mol),
2-chloropyrimidine (0.34 g, 3.01 mmol), cesium carbonate (0.98 g,
3.01 mmol), 4 Å molecular sieves (0.3 g, 3.2 mm pellets) [N,N′-bis-
((2′-pyridine)methylene)]-1,2-diaminocyclohexane54 (0.084 g, 0.28
mmol) were dispersed in acetonitrile (10 mL, dried over 4 Å molecular
sieves). This was degassed using a slow stream of argon bubbling in
the suspension. Copper oxide (0.02 g, 0.14 mmol) was then added,
and the tube was sealed. This was shaken thoroughly, heated for 30 s
in the microwave oven at 100 °C, and shaken again. At this stage the
pink copper oxide is well dissolved in the reaction mixture; if not,
another 30 s of heating at 100 °C is required. The heating is then
resumed at 180 °C for 2 h. The resulting suspension was dispersed in
ethyl acetate, directly adsorbed over a small amount of silica, purified
by chromatography over silica gel (cyclohexane−ethyl acetate 1/2) to
1
yield the pyrimidine derivative as a solid (0.62 g, 73%). H NMR
(CDCl3): 1.39 (t, 3H, J = 7.0 Hz); 2.59 (s, 3H); 3.76 (s, 2H); 4.46 (q,
2H, J = 7.0 Hz); 7.05 (t, 1H, J = 4.8); 7.24 (m, 5H); 8.71 (d, 2H, J =
4.8). 13C NMR (CDCl3): 14.0; 14.8; 27.7; 64.5; 109.1; 116.6; 125.9;
128.2; 128.3; 140.4; 141.0; 157.5; 158.3; 163.7. HRMS calcd for
C17H18N4O + H: 295.1559. Found: 295.1544. A second fraction was
further purified by an additional chromatography over alumina
containing 1.5% of water (cyclohexane−ethyl acetate 1/1) to yield
the isomeric 2-(4-benzyl-5-ethoxy-3-methyl-1H-pyrazol-1-yl)-
1
pyrimidine as a wax (0.03 g, 3.5%). H NMR (CDCl3): 1.35 (t, 3H,
J = 7.0 Hz); 2.18 (s, 3H); 3.79 (s, 2H); 4.13 (q, 2H, J = 7.0 Hz); 7.20
G
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
(m, 6H); 8.77 (d, 2H, J = 4.8). 13C NMR (CDCl3): 13.4; 15.2; 28.2 ;
71.7; 107.8; 117.9; 126.1; 128.2; 128.4; 139.8; 151.4; 153.0; 156.5;
158.6. HRMS calcd for C17H18N4O + H: 295.1559. Found: 295.1544.
Deprotection of Alkoxypyrazoles with Boron Tribromide.
Preparation of 4-Benzyl-5-methyl-1-(pyrimidin-2-yl)-1H-pyra-
zol-3-ol. In a 100 mL tube fitted with a Teflon-coated screw cap,
compound 1 (0.22 g, 0.73 mmol) and 1 M boron tribromide in
dichloromethane (1.5 mL) were stirred for 2 days at room
temperature. Ethanol was cautiously added and the solution
concentrated to dryness. The residue was made basic with 2 N
ethanolic ammonia, and this was concentrated to dryness again. The
residue was purified by chromatography over silica gel (dichloro-
methane−ethanol from 100/0 to 95/5) to give the deprotected
chromatography over silica gel (cyclohexane−dichloromethane 1/2).
1H NMR (CDCl3): 1.40 (t, 3H, J = 7.0); 2.56 (s, 3H); 3.75 (s, 2H);
4.44 (q, 2H, J = 7.0); 7.24 (m, 5H); 8.71 (s, 2H). 13C NMR (CDCl3):
14.1; 14.7; 27.7; 64.6; 109.7; 114.0; 125.9; 128.2; 128.3; 140.2; 141.2;
155.8; 158.7; 163.9. HRMS calcd for C17H17BrN4O + H: 373.0664.
Found: 373.0788.
2-(4-Benzyl-3-ethoxy-5-methyl-1H-pyrazol-1-yl)-5-methoxy-
pyrimidine (5b). Obtained in 44% yield as a solid, using 2-chloro-5-
methoxypyrimidine (4b) in dimethylformamide at 160 °C for 1 h and
after two consecutive chromatography processes, the first one over
silica gel (cyclohexane−ethyl acetate 2/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane
1
from 1/1 to 2/3). H NMR (CDCl3): 1.38 (t, 3H, J = 7.0); 2.51 (s,
1
pyrazol-3-ol (0.12 g, 61%) as a white powder. H NMR (DMSO-d6):
3H); 3.75 (s, 2H); 3.92 (s, 3H); 4.42 (q, 2H, J = 7.0); 7.18 (m, 1H);
7.25 (m, 4H); 8.39 (s, 2H). 13C NMR (CDCl3): 13.4; 14.8; 27.8; 56.3;
64.4; 107.6; 125.8; 128.2; 128.3; 140.1; 140.7; 144.4; 150.5; 151.9;
163.2. HRMS calcd for C18H20N4O2 + H: 325.1665. Found: 325.1673.
2-(4-Benzyl-3-ethoxy-5-methyl-1H-pyrazol-1-yl)-4-methyl-
pyrimidine (5c). Obtained in 40% yield as an oil, using 2-chloro-4-
methylpyrimidine (4c) in dimethylformamide at 160 °C for 1 h and
after two consecutive chromatography processes, the first one over
silica gel (cyclohexane−ethyl acetate 1/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 2/
2.52 (s, 3H); 3.66 (s, 2H); 7.21 (m, 6H); 8.73 (d, 2H, J = 4.8); 10.69
(s(br), 1H). 13C NMR (DMSO-d6): 13.9; 27.7; 108.7; 117.9; 126.2;
128.4; 128.7; 140.1; 141.2; 157.3; 159.0; 162.1. HRMS calcd for
C15H14N4O + H: 267.1246. Found: 267.1191.
4-Benzyl-1-(5-ethylpyrimidin-2-yl)-5-methyl-1H-pyrazol-3-ol
(7). From compound 5g, by use of the procedure described above (for
4 days at room temperature), the deprotected pyrazol-3-ol 7 was
obtained as a white powder (47%). 1H NMR (DMSO-d6): 1.21 (t, 3H,
J = 7.2); 2.61 (q, 2H, J = 7.2); 3.33 (s, 3H); 3.65 (s, 2H); 7.14 (m,
1H); 7.25 (m, 4H); 8.63 (s, 2H); 10.63 (s(l), 1H). 13C NMR
(DMSO-d6): 13.7; 15.4; 22.6; 27.7; 108.0; 126.2; 128.5; 128.7; 132.7;
139.6; 141.3; 155.9; 158.1; 161.8. HRMS calcd for C17H18N4O + H:
295.1559. Found: 295.1459.
4-Benzyl-1-(5-cyclopropylpyrimidin-2-yl)-5-methyl-1H-pyra-
zol-3-ol (8). From compound 6, by use of the procedure described
above (for 4 days at room temperature), the deprotected pyrazol-3-ol
8 was obtained as a light yellow powder (51%). 1H NMR (DMSO-d6):
0.83 (m, 2H); 1.02 (m, 2H); 1.94 (m, 1H); 3.47 (s, 3H); 3.65 (s, 2H);
7.13 (m, 1H); 7.24 (m, 4H); 8.52 (s, 2H); 10.57 (s(l), 1H). 13C NMR
(DMSO-d6): 9.2; 10.5; 13.6; 27.7; 107.9; 126.2; 128.4; 128.7; 133.0;
139.5; 141.3; 155.6; 156.2; 161.8. HRMS calcd for C18H18N4O + H:
307.1559. Found: 307.1556.
1
1). H NMR (CDCl3): 1.38 (t, 3H, J = 7.0); 2.53 (s, 3H); 2.57 (s,
3H); 3.75 (s, 2H); 4.45 (q, 2H, J = 7.0); 6.92 (d, 1H, J = 5.1); 7.16 (m,
1H); 7.24 (m, 4H); 8.56 (d, 1H, J = 5.1). 13C NMR (CDCl3): 14.0;
14.8; 24.3; 27.7; 64.4; 108.6; 116.4; 125.8; 128.2; 128.3; 140.5; 140.9;
157.4; 158.1; 163.5; 168.7. HRMS calcd for C18H20N4O + H:
309.1715. Found: 309.1711.
2-(4-Benzyl-3-ethoxy-5-methyl-1H-pyrazol-1-yl)-5-ethylpyri-
midine (5d). Obtained on a larger scale (6.9 mmol) in 65% yield as a
solid, using 2-chloro-5-ethylpyrimidine (4d) in dimethylformamide at
160 °C for 1 h and after two consecutive chromatography processes,
the first one over silica gel (cyclohexane−ethyl acetate 3/1), the
second one over alumina containing 1.5% of water (cyclohexane−
1
dichloromethane 1/1). H NMR (CDCl3): 1.29 (t, 3H, J = 7.3); 1.39
Control Experiment. Preparation of 4-Benzyl-3-methyl-1-
(pyrimidin-2-yl)-1H-pyrazol-5-ol. Ethyl 2-benzyl-3-oxobutanoate
(0.24 g, 1.08 mmol) and 2-pyrimidinylhydrazine55 were heated at
130 °C in acetic acid (1 mL) for 5 min using a microwave oven. This
was concentrated to dryness under high vacuum and the residue
purified by chromatography over silica gel (dichloromethane−ethanol
99/1 to 97/3) to yield the 5-hydroxypyrazole (0.13 g, 53%) as a glass.
1H NMR (DMSO-d6): 2.09 (s, 3H); 3.58 (s, 2H); 7.14 (m, 1H); 7.23
(t, 3H, J = 7.0); 2.56 (s, 3H); 2.66 (q, 2H, J = 7.3); 3.76 (s, 2H); 4.45
(q, 2H, J = 7.0); 7.25 (m, 5H); 8.57 (s, 2H). 13C NMR (CDCl3): 13.8;
14.8; 15.1; 23.0; 27.7; 64.4; 108.3; 125.8; 128.2; 128.3; 131.9; 140.5;
140.6; 156.1; 157.6; 163.4. HRMS calcd for C19H22N4O + H:
323.1872. Found: 323.1581.
2-(4-Benzyl-3-ethoxy-5-methyl-1H-pyrazol-1-yl)-5-propyl-
pyrimidine (5e). Obtained in 45% yield as an oil, using 2-chloro-5-
propylpyrimidine (4e) in dimethylformamide at 160 °C for 1 h and
after two consecutive chromatography processes, the first one over
silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 2/
1). 1H NMR (CDCl3): 0.98 (t, 3H, J = 7.3); 1.38 (t, 3H, J = 7.1); 1.66
(m, 2H); 2.56 (s, 3H); 2.58 (q, 2H, J = 7.4); 3.76 (s, 2H); 4.45 (q, 2H,
J = 7.1); 7.17 (m, 1H); 7.24 (m, 4H); 8.53 (s, 2H). 13C NMR
(CDCl3): 13.4; 13.8; 14.8; 20.1; 27.7; 31.7; 64.5; 108.4; 125.8; 128.2;
128.3; 130.4; 140.5; 140.7; 156.0; 158.0; 163.4. HRMS calcd for
C20H24N4O + H: 337.2028. Found: 337.1985.
2-(4-Benzyl-3-ethoxy-5-methyl-1H-pyrazol-1-yl)-5-pentyl-
pyrimidine (5f). Obtained in 52% yield as an oil, using 2-chloro-5-
propylpyrimidine in dimethylformamide at 160 °C for 1 h and after
two consecutive chromatography processes, the first one over silica gel
(cyclohexane−ethyl acetate 3/1), the second one over alumina
containing 1.5% of water (cyclohexane−dichloromethane 2/1). 1H
NMR (CDCl3): 0.91 (t, 3H, J = 7.3); 1.35 (m, 7H); 1.63 (m, 2H);
2.57 (s, 3H); 2.59 (q, 2H, J = 7.4); 3.76 (s, 2H); 4.45 (q, 2H, J = 7.0);
7.18 (m, 1H); 7.25 (m, 4H); 8.53 (s, 2H). 13C NMR (CDCl3): 13.8;
14.0; 14.8; 22.4; 27.7; 29.7; 30.5; 31.0; 64.5; 108.4; 125.8; 128.2;
128.3; 130.6; 140.5; 140.7; 155.9; 158.0; 163.4. HRMS calcd for
C22H28N4O + H: 365.2341. Found: 365.2336.
2-(4-Benzyl-3-ethoxy-5-methyl-1H-pyrazol-1-yl)-5-cyclopro-
pylpyrimidine (5g). Obtained in 64% yield as an oil, using 2-chloro-
5-cyclopropylpyrimidine (4g) in dimethylformamide at 160 °C for 1 h
and after two consecutive chromatography processes, the first one over
silica gel (cyclohexane−ethyl acetate 3/1), the second one over
(m, 4H); 7.35 (m, 1H); 8.80 (d, 2H, J = 4.8); 11.3 (s(br), 1H). 13C
NMR (DMSO-d6): 12.3; 27.7; 102.4; 118.1; 126.2; 128.5; 128.7;
141.3; 150.2; 158.8; 158.0 (br); 159.1. HRMS calcd for C15H14N4O +
H: 267.1246. Found: 267.1170.
N-Arylation of Pyrazoles without Copper Catalyst. General
Method. In a reaction vial designed for microwave heating, the
considered alkoxypyrazole (2 mmol), the considered halogenated
heteroaryl (2.2 mmol), and cesium carbonate (2.8 mmol) were mixed
in dimethylformamide or acetonitrile (3 mL) as specified. This was
heated using a microwave at a temperature between 120 and 180 °C
for the specified duration. The resulting suspension was diluted in
water, extracted with ethyl acetate, and the organic layer was washed
with brine, dried over magnesium sulfate, and concentrated to dryness.
The residue was further purified as specified below.
2-(4-Benzyl-3-ethoxy-5-methyl-1H-pyrazol-1-yl)-5-methyl-
pyridine (2). Obtained in 32% yield as an oil, using 2-fluoro-5-
methylpyridine in acetonitrile at 180 °C for 2 h and after
chromatography over silica gel (dichloromethane). 1H NMR
(CDCl3): 1.40 (t, 3H, J = 7.0 Hz); 2.34 (s, 3H); 2.54 (s, 3H); 3.75
(s, 2H); 4.34 (q, 2H, J = 7.0 Hz); 7.17 (m, 1H); 7.27 (m, 4H); 7.54
(m, 1H); 7.64 (m, 1H); 8.19 (m, 1H). 13C NMR (CDCl3): 12.9; 14.9;
17.8; 27.8; 64.2; 106.3; 114.9; 125.7; 128.2 (two signals); 129.1; 138.7;
139.1; 141.0; 147.2; 151.9; 162.2. HRMS calcd for C19H21N3O + H:
308.1763. Found: 308.1751.
2-(4-Benzyl-3-ethoxy-5-methyl-1H-pyrazol-1-yl)-5-bromo-
pyrimidine (5a). Obtained in 58% yield as a solid, using 2-chloro-5-
bromopyrimidine (4a) in dimethylformamide at 150 °C for 1 h and
H
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
6.84 (m, 1H); 6.95 (m, 1H); 7.00 (m, 1H); 7.22 (m, 1H); 8.55 (s,
2H). 13C NMR (CDCl3): 13.7; 15.0; 22.2; 23.0; 27.6; 71.3; 108.4;
112.6 (21 Hz); 115.1 (21 Hz); 123.8; 129.5; 132.0; 140.4; 143.3;
156.2; 157.6; 162.5; 163.0 (241 Hz). HRMS calcd for C20H23FN4O +
H: 355.1934. Found: 355.1937.
5-Ethyl-2-(4-(4-fluorobenzyl)-3-isopropoxy-5-methyl-1H-
pyrazol-1-yl)pyrimidine (11e). Obtained in 43% yield as an oil,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.28 (t, 3H, J = 7.6); 1.33 (d, 6H, J = 6.1); 2.54
(s, 3H); 2.64 (q, 2H, J = 7.6); 3.68 (s, 2H); 5.21 (sept, 1H, J = 6.1);
6.93 (m, 2H); 7.18 (m, 2H); 8.54 (s, 2H). 13C NMR (CDCl3): 13.6;
15.0; 22.2; 23.0; 27.1; 71.2; 109.0; 114.8 (21 Hz); 129.6; 131.9; 136.4;
140.2; 156.2; 157.6; 161.3 (243 Hz); 162.5. HRMS calcd for
C20H23FN4O + H: 355.1934. Found: 355.1900.
1
1). H NMR (CDCl3): 0.74 (m, 2H); 1.06 (m, 2H); 1.38 (t, 3H, J =
7.1); 1.87 (m, 1H); 2.54 (s, 3H); 3.75 (s, 2H); 4.44 (q, 2H, J = 7.1);
7.17 (m, 1H); 7.27 (m, 4H); 8.45 (s, 2H). 13C NMR (CDCl3): 8.3;
10.4; 13.7; 14.8; 27.7; 64.4; 108.3; 125.8; 128.2; 128.3; 132.0; 140.5;
140.6; 155.9; 156.2; 163.4. HRMS calcd for C20H22N4O + H:
335.1872. Found: 335.1859.
2-(4-Benzyl-3-isopropoxy-5-methyl-1H-pyrazol-1-yl)-5-cy-
clopropylpyrimidine (6). Obtained in 46% yield as an oil, using 2-
chloro-5-cyclopropylpyrimidine in dimethylformamide at 160 °C for 1
h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1
1). H NMR (CDCl3): 0.75 (m, 2H); 1.06 (m, 2H); 1.34 (d, 6H, J =
6.0); 1.87 (m, 1H); 2.53 (s, 3H); 3.73 (s, 2H); 5.22 (sept, 1H, J =
6.0); 7.26 (m, 1H); 7.24 (m, 4H); 8.44 (s, 2H). 13C NMR (CDCl3):
8.3; 10.4; 13.7; 22.3; 27.8; 71.2; 109.1; 125.7; 128.2; 128.3; 131.9;
140.3; 140.8; 156.0; 156.2; 162.6. HRMS calcd for C21H24N4O + H:
349.2028. Found: 349.2009. On a larger scale (20 mmol), the 2-(4-
benzyl-5-isopropoxy-3-methyl-1H-pyrazol-1-yl)-5-cyclopropylpyrimi-
dine isomer (14) was also isolated as a wax in 1.5% yield after a second
chromatography process over alumina containing 1.5% of water
(cyclohexane−dichloromethane 1/1). 1H NMR (CDCl3): 0.79 (m,
2H); 1.11 (m, 2H); 1.28 (d, 6H, J = 6.2); 1.89 (m, 1H); 2.13 (s, 3H);
3.78 (s, 2H); 4.40 (sept, 1H, J = 6.2); 7.18−7.28 (m, 5H); 8.50 (s,
2H). 13C NMR (CDCl3): 8.6; 10.5; 13.6; 22.1; 28.5; 78.6; 108.1;
126.0; 128.2; 128.3; 133.4; 139.8; 151.0; 151.4; 154.8; 156.3. HRMS
calcd for C21H24N4O + H: 349.2028. Found: 349.1977.
2-(4-Benzyl-3-(2-(benzyloxy)ethoxy)-5-methyl-1H-pyrazol-
1-yl)-5-ethylpyrimidine (9f). Obtained in 81% yield, using 2-chloro-
5-ethylpyrimidine in dimethylformamide at 160 °C for 1 h and after
chromatography over silica gel (cyclohexane−ethyl acetate 2/1), as an
oil. 1H NMR (CDCl3): 1.29 (t, 3H, J = 7.3); 2.58 (s, 3H); 2.65 (q, 2H,
J = 7.3); 3.79 (s, 2H); 3.85 (m, 2H); 4.60 (s, 2H); 4.61 (m, 2H);
7.15−7.36 (m, 10H); 8.56 (s, 2H). 13C NMR (CDCl3): 13.8; 15.1;
23.0; 28.7; 68.2; 68.6; 73.0; 108.3; 125.8; 127.5; 127.6; 128.2; 128.3;
128.4; 132.0; 138.4; 140.5; 140.8; 156.2; 157.6; 163.1. HRMS calcd for
C26H28N4O2 + H: 429.2291. Found: 429.2293.
5-Ethyl-2-(3-isopropoxy-4-(2-methoxybenzyl)-5-methyl-1H-
pyrazol-1-yl)pyrimidine (11f). Obtained in 36% yield as a white
powder, using 2-chloro-5-ethylpyrimidine in dimethylformamide at
160 °C for 1 h and after two consecutive chromatography processes,
the first one over silica gel (cyclohexane−ethyl acetate 3/1), the
second one over alumina containing 1.5% of water (cyclohexane−
1
dichloromethane 1/1). H NMR (CDCl3): 1.28 (t, 3H, J = 7.6); 1.32
(d, 6H, J = 6.2); 2.55 (s, 3H); 2.63 (q, 2H, J = 7.6); 3.70 (s, 2H); 3.86
(s, 3H); 5.21 (sept, 1H, J = 6.2); 6.85 (m, 2H); 7.14 (m, 1H); 8.54 (s,
2H). 13C NMR (CDCl3): 13.6; 15.1; 21.7; 22.3; 23.0; 55.2; 71.0;
108.3; 109.8; 120.2; 126.9; 128.7; 129.5; 131.7; 140.7; 156.4; 157.1;
157.5; 163.0. HRMS calcd for C21H20N4O2 + H: 367.2134. Found:
367.2143.
5-Ethyl-2-(3-isopropoxy-4-(3-methoxybenzyl)-5-methyl-1H-
pyrazol-1-yl)pyrimidine (11g). Obtained in 38% yield as an oil,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.26 (t, 3H, J = 7.6); 1.34 (d, 6H, J = 6.1); 2.53
(s, 3H); 2.62 (q, 2H, J = 7.6); 3.65 (s, 2H); 3.76 (s, 3H); 5.22 (sept,
1H, J = 6.1); 6.80 (m, 2H); 7.15 (m, 2H); 8.52 (s, 2H). 13C NMR
(CDCl3): 13.7; 15.0; 22.3; 23.0; 26.9; 51.2; 71.2; 109.5; 113.6; 129.1;
131.8; 132.9; 140.2; 157.3; 157.5; 157.8; 162.6. HRMS calcd for
C21H20N4O2 + H: 367.2134. Found: 367.2134.
5-Ethyl-2-(4-(2-fluorobenzyl)-3-isopropoxy-5-methyl-1H-
pyrazol-1-yl)pyrimidine (11b). Obtained in 46% yield as an oil,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.27 (t, 3H, J = 7.6); 1.32 (d, 6H, J = 6.2); 2.56
(s, 3H); 2.64 (q, 2H, J = 7.6); 3.74 (s, 2H); 5.21 (sept, 1H, J = 6.2);
6.99 (m, 2H); 7.14 (m, 1H); 7.28 (m, 1H); 8.54 (s, 2H). 13C NMR
(CDCl3): 13.5; 15.1; 20.6; 22.2; 23.0; 71.2; 107.6; 114.8 (22 Hz);
123.7; 127.2; 127.4; 130.6; 131.9; 140.6; 156.2; 157.6; 160.8 (245 Hz);
162.6. HRMS calcd for C20H23FN4O + H: 355.1934. Found: 355.1921.
5-Cyclopropyl-2-(4-(2-fluorobenzyl)-3-isopropoxy-5-meth-
yl-1H-pyrazol-1-yl)pyrimidine (11c). Obtained in 41% yield as a
solid, using 2-chloro-5-cyclopropylpyrimidine in dimethylformamide at
160 °C for 1 h and after two consecutive chromatography processes,
the first one over silica gel (cyclohexane−ethyl acetate 3/1), the
second one over alumina containing 1.5% of water (cyclohexane−
5-Ethyl-2-(3-isopropoxy-4-(4-methoxybenzyl)-5-methyl-1H-
pyrazol-1-yl)pyrimidine (11h). Obtained in 38% yield as a white
powder, using 2-chloro-5-ethylpyrimidine in dimethylformamide at
160 °C for 1 h and after two consecutive chromatography processes,
the first one over silica gel (cyclohexane−ethyl acetate 3/1), the
second one over alumina containing 1.5% of water (cyclohexane−
1
dichloromethane 1/1). H NMR (CDCl3): 1.28 (t, 3H, J = 7.6); 1.32
(d, 6H, J = 6.2); 2.55 (s, 3H); 2.63 (q, 2H, J = 7.6); 3.70 (s, 2H); 3.86
(s, 3H); 5.21 (sept, 1H, J = 6.2); 6.85 (m, 2H); 7.14 (m, 2H); 8.54 (s,
2H). 13C NMR (CDCl3): 13.6; 15.1; 21.7; 22.3; 23.0; 55.2; 71.0;
108.3; 109.8; 120.2; 126.9; 128.7; 129.5; 131.7; 140.7; 156.4; 157.1;
157.5; 163.0. HRMS calcd for C21H20N4O2 + H: 367.2134. Found:
367.2143.
2-(3-Ethoxy-4-iodo-5-methyl-1H-pyrazol-1-yl)-5-ethylpyri-
midine (15). Obtained as a solid in 52% yield, using 3-ethoxy-4-iodo-
5-methyl-1H-pyrazole16 and 2-chloro-5-ethylpyrimidine in dimethyl-
formamide at 160 °C for 1 h, after chromatography over silica gel
(cyclohexane−ethyl acetate from 4/1 to 8/3). 1H NMR (CDCl3): 1.30
(t, 3H, J = 7.4); 1.45 (t, 3H, J = 7.0); 2.67 (q, 2H, J = 7.4); 2.71 (s,
3H); 4.46 (q, 2H, J = 7.0); 8.58 (s, 2H). 13C NMR (CDCl3): 14.7;
15.0; 16.3; 23.0; 55.8; 65.3; 132.8; 144.7; 155.6; 157.3; 163.3. HRMS
calcd for C12H15IN4O + H: 359.0369. Found: 359.0305.
2-(3-Ethoxy-5-methyl-4-phenoxy-1H-pyrazol-1-yl)-5-ethyl-
pyrimidine (21a). Obtained in 63% yield as a solid, using 2-chloro-5-
ethylpyrimidine in dimethylformamide at 160 °C for 1 h and after two
consecutive chromatography processes, the first one over silica gel
(cyclohexane−ethyl acetate from 9/1 to 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1
dichloromethane 1/1). H NMR (CDCl3): 0.75 (m, 2H); 1.02 (m,
2H); 1.31 (d, 6H, J = 6.1); 1.84 (m, 1H); 2.54 (s, 3H); 3.73 (s, 2H);
5.22 (sept, 1H, J = 6.1); 7.00 (m, 2H); 7.20 (m, 2H); 8.44 (s, 2H). 13C
NMR (CDCl3): 8.3; 10.4; 13.5; 20.6; 22.2; 71.2; 107.5; 114.9 (22 Hz);
123.7; 127.2; 127.4; 127.5; 130.5; 132.0; 140.5; 156.2; 160.9 (244 Hz);
162.6. HRMS calcd for C21H23FN4O + H: 367.1934. Found: 367.1911.
5-Ethyl-2-(4-(3-fluorobenzyl)-3-isopropoxy-5-methyl-1H-
pyrazol-1-yl)pyrimidine (11d). Obtained in 46% yield as an oil,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.22 (t, 3H, J = 7.6); 1.33 (d, 6H, J = 6.1); 2.55
(s, 3H); 2.67 (q, 2H, J = 7.6); 3.72 (s, 2H); 5.23 (sept, 1H, J = 6.1);
I
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
1). 1H NMR (CDCl3): 1.29 (t, 3H, J = 7.3); 1.34 (t, 3H, J = 7.0); 2.53
(s, 3H); 2.66 (q, 2H, J = 7.3); 4.45 (q, 2H, J = 7.0); 7.01 (m, 3H); 7.29
(m, 2H); 8.57 (s, 2H). 13C NMR (CDCl3): 12.6; 14.7; 15.1; 23.0;
64.4; 115.1; 122.1; 125.8; 129.4; 132.3; 134.8; 156.1; 157.0; 157.7;
158.3. HRMS calcd for C18H20N4O2 + H: 325.1665. Found: 325.1698.
2-(3-Ethoxy-4-(2-fluorophenoxy)-5-methyl-1H-pyrazol-1-yl)-
5-ethylpyrimidine (21b). Obtained in 46% yield as a solid, using 2-
chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for 1 h and
after two consecutive chromatography processes, the first one over
silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.21 (t, 3H, J = 7.5); 1.25 (t, 3H, J = 7.0); 2.57
(s, 3H); 2.67 (q, 2H, J = 7.5); 4.45 (q, 2H, J = 7.0); 6.89−7.00 (m,
3H); 7.16 (m, 1H); 8.57 (s, 2H). 13C NMR (CDCl3): 12.5; 14.7; 15.0;
23.0; 65.0; 116.1; 116.5 (18 Hz); 122.6; 124.1; 125.8; 132.4; 132.6;
146.1; 152.2 (248 Hz); 156.1; 156.7; 157.7. HRMS calcd for
C18H19FN4O2 + H: 343.1570. Found: 343.1551.
2-(4-(2-Chlorophenoxy)-3-ethoxy-5-methyl-1H-pyrazol-1-
yl)-5-ethylpyrimidine (21c). Obtained in 49% yield as a solid, using
2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for 1 h
and after two consecutive chromatography processes, the first one over
silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.30 (t, 3H, J = 7.6); 1.34 (t, 3H, J = 7.0); 2.55
(s, 3H); 2.66 (q, 2H, J = 7.6); 4.46 (q, 2H, J = 7.0); 6.85 (m, 1H); 6.97
(m, 1H); 7.15 (m, 1H); 7.42 (m, 1H); 8.57 (s, 2H). 13C NMR
(CDCl3): 12.5; 14.7; 15.0; 23.0; 65.0; 115.0; 122.4; 122.8; 125.8;
127.5; 130.4; 132.5; 134.7; 153.9; 156.1; 156.7; 157.7. HRMS calcd for
C18H19ClN4O2 + H: 359.1275. Found: 359.1260.
2-(4-(2-Bromophenoxy)-3-ethoxy-5-methyl-1H-pyrazol-1-
yl)-5-ethylpyrimidine (21d). Obtained in 66% yield as a solid, using
2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for 1 h
and after two consecutive chromatography processes, the first one over
silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.30 (t, 3H, J = 7.6); 1.35 (t, 3H, J = 7.0); 2.55
(s, 3H); 2.67 (q, 2H, J = 7.6); 4.46 (q, 2H, J = 7.0); 6.84 (m, 1H); 6.91
(m, 1H); 7.19 (m, 1H); 7.60 (m, 1H); 8.57 (s, 2H). 13C NMR
(CDCl3): 12.6; 14.7; 15.0; 23.0; 65.0; 111.2; 114.9; 123.3; 125.9;
128.3; 132.5; 133.4; 134.7; 154.9; 156.1; 156.7; 157.7. HRMS calcd for
C18H19BrN4O2 + H: 403.0770. Found: 403.0780.
2-(3-Ethoxy-5-methyl-4-(2-(trifluoromethyl)phenoxy)-1H-
pyrazol-1-yl)-5-ethylpyrimidine (21e). Obtained in 49% yield as a
solid, using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160
°C for 1 h and after two consecutive chromatography processes, the
first one over silica gel (cyclohexane−ethyl acetate 3/1), the second
one over alumina containing 1.5% of water (cyclohexane−dichloro-
methane 1/1). 1H NMR (CDCl3): 1.31 (t, 3H, J = 7.6); 1.33 (t, 3H, J
= 7.0); 2.54 (s, 3H); 2.68 (q, 2H, J = 7.6); 4.45 (q, 2H, J = 7.0); 6.94
(m, 1H); 7.10 (m, 1H); 7.42 (m, 1H); 7.65 (m, 1H); 8.58 (s, 2H). 13C
NMR (CDCl3): (one signal missing) 12.3; 14.7; 15.0; 26.9; 65.1;
114.6; 118.7 (31 Hz); 121.6; 123.6 (273 Hz); 125.2; 127.0; 132.5;
133.1; 134.8; 156.1; 156.7; 157.7. HRMS calcd for C19H19F3N4O2 +
H: 393.1538. Found: 393.1541.
silica gel (cyclohexane−ethyl acetate 4/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.30 (t, 3H, J = 7.7); 1.34 (t, 3H, J = 7.0); 2.53
(s, 3H); 2.68 (q, 2H, J = 7.0); 4.46 (q, 2H, J = 7.7); 7.07 (d, 2H, J =
8.7); 7.55 (d, 2H, J = 8.7); 8.58 (s, 2H). 13C NMR (CDCl3): 12.5;
14.7; 15.1; 23.0; 65.0; 115.2 124.2 (270 Hz); 124.4 (33 Hz); 125.1;
126.9 (4 Hz); 132.6; 134.8; 156.0; 156.5; 157.8; 160.7. HRMS calcd
for C19H19F3N4O2 + H: 393.1538. Found: 393.1483.
2-(4-(2,3-Dichlorophenoxy)-3-ethoxy-5-methyl-1H-pyrazol-
1-yl)-5-ethylpyrimidine (21h). Obtained in 62% yield as a solid,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.30 (t, 3H, J = 7.6); 1.34 (t, 3H, J = 7.0); 2.55
(s, 3H); 2.67 (q, 2H, J = 7.6); 4.46 (q, 2H, J = 7.0); 6.78 (dd, 1H, J =
1.4 and 8.3); 7.08 (t, 1H, J = 8.3); 7.16 (dd, 1H, J = 1.4 and 8.3); 8.58
(s, 2H). 13C NMR (CDCl3): 12.5; 14.7; 15.0; 23.0; 65.1; 112.9; 121.6;
123.7; 125.6; 127.1; 132.6; 134.0; 134.7; 155.3; 156.0; 156.4; 157.7.
HRMS calcd for C18H18N4O2Cl2 + H: 393.0885. Found: 393.0867.
2-(4-(2,5-Dichlorophenoxy)-3-ethoxy-5-methyl-1H-pyrazol-
1-yl)-5-ethylpyrimidine (21i). Obtained in 46% yield as a solid,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.31 (t, 3H, J = 7.6); 1.36 (t, 3H, J = 7.0); 2.56
(s, 3H); 2.68 (q, 2H, J = 7.6); 4.46 (q, 2H, J = 7.0); 6.86 (d, 1H, J =
2.3); 6.96 (dd, 1H, J = 2.3 and 8.5); 7.34 (d, 1H, J = 8.5); 8.58 (s, 2H).
13C NMR (CDCl3): 12.5; 14.7; 15.0; 23.0; 65.1; 115.5; 120.9; 123.0;
125.2; 131.0; 132.7; 133.1; 134.8; 154.3; 156.0; 156.3; 157.8. HRMS
calcd for C18H18Cl2N4O2 + H: 393.0885. Found: 393.0875.
2-(4-(3,5-Dichlorophenoxy)-3-ethoxy-5-methyl-1H-pyrazol-
1-yl)-5-ethylpyrimidine (21j). Obtained in 49% yield as a solid,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.22 (t, 3H, J = 7.6); 1.27 (t, 3H, J = 7.0); 2.54
(s, 3H); 2.68 (q, 2H, J = 7.6); 4.46 (q, 2H, J = 7.0); 6.82 (d, 1H, J =
1.8); 6.95 (d, 1H, J = 1.8); 8.58 (s, 2H). 13C NMR (CDCl3): 12.5;
14.7; 15.0; 23.0; 65.1; 114.3; 122.6; 124.9; 132.7; 134.8; 135.5; 156.0;
156.3; 157.7; 159.3. HRMS calcd for C18H18Cl2N4O2 + H: 393.0885.
Found: 393.0858.
5-Ethyl-2-(4-(2-fluorophenoxy)-3-isopropoxy-5-methyl-1H-
pyrazol-1-yl)pyrimidine (21k). Obtained in 55% yield as a solid,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.29 (t, 3H, J = 7.6); 1.31 (d, 6H, J = 6.1); 2.55
(s, 3H); 2.66 (q, 2H, J = 7.6); 5.20 (sept, 1H, J = 6.1); 6.96 (m, 3H);
7.13 (m, 1H); 8.56 (s, 2H). 13C NMR (CDCl3): 12.4; 15.0; 22.1; 23.0;
72.1; 116.3; 116.4 (18 Hz); 122.5; 124.0; 126.5; 132.4; 132.4; 146.2;
152.2 (246 Hz); 156.0; 156.1; 157.7. HRMS calcd for C19H21FN4O2 +
H: 357.1727. Found: 357.1715.
2-(3-Ethoxy-5-methyl-4-(3-(trifluoromethyl)phenoxy)-1H-
pyrazol-1-yl)-5-ethylpyrimidine (21f). Obtained in 54% yield as a
solid, using 2-chloro-5-ethylpyrimidine in acetonitrile at 160 °C for 1 h
and after two consecutive chromatography processes, the first one over
silica gel (cyclohexane−ethyl acetate 4/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
5-Ethyl-2-(4-(3-fluorophenoxy)-3-isopropoxy-5-methyl-1H-
pyrazol-1-yl)pyrimidine (21l). Obtained in 78% yield as a solid,
using 2-chloro-5-ethylpyrimidine in acetonitrile at 160 °C for 1 h and
after chromatography over silica gel (cyclohexane−ethyl acetate 4/1).
1H NMR (CDCl3): 1.30 (m, 9H); 2.52 (s, 3H); 2.66 (q, 2H, J = 7.6);
1
1). H NMR (CDCl3): 1.32 (m, 6H); 2.55 (s, 3H); 2.68 (q, 2H, J =
7.0); 4.46 (q, 2H, J = 7.7); 7.17 (m, 1H); 7.24 (s, 1H); 7.28 (m, 1H);
7.41 (m, 1H); 8.58 (s, 2H). 13C NMR (CDCl3): 12.6; 14.6; 15.1; 23.0;
65.0; 112.2 (4 Hz); 118.5; 119.9 (4 Hz); 123.8 (272 Hz); 125.2;
130.0; 131.9 (33 Hz); 132.6; 134.7; 156.0; 156.5; 157.8; 158.3. HRMS
calcd for C19H19F3N4O2 + H: 393.1538. Found: 393.1521.
5.22 (sept, 1H, J = 6.1); 6.70 (m, 1H); 6.77 (m, 1H); 7.23 (m, 1H);
8.56 (s, 2H). 13C NMR (CDCl3): 12.5; 15.1; 22.1; 23.0; 72.1; 103.1
(25 Hz); 108.9 (21 Hz); 110.9 (3 Hz); 126.1; 130.1 (10 Hz); 132.4;
134.6; 156.0; 156.1; 157.7; 159.7 (10 Hz); 163.5 (245 Hz). HRMS
calcd for C19H21FN4O2 + H: 357.1727. Found: 357.1687.
2-(3-Ethoxy-5-methyl-4-(4-(trifluoromethyl)phenoxy)-1H-
pyrazol-1-yl)-5-ethylpyrimidine (21g). Obtained in 27% yield as a
solid, using 2-chloro-5-ethylpyrimidine in acetonitrile at 160 °C for 1 h
and after two consecutive chromatography processes, the first one over
5-Ethyl-2-(4-(4-fluorophenoxy)-3-isopropoxy-5-methyl-1H-
pyrazol-1-yl)pyrimidine (21m). Obtained in 70% yield as a solid,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
J
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.30 (t, 3H, J = 7.6); 1.32 (d, 6H, J = 6.0); 2.53
(s, 3H); 2.67 (q, 2H, J = 7.6); 5.21 (sept, 1H, J = 6.0); 6.96 (m, 4H);
8.57 (s, 2H). 13C NMR (CDCl3): 12.5; 15.0; 22.1; 23.0; 72.1; 115.7
(23 Hz); 116.3 (8 Hz); 126.9; 132.4; 134.4; 154.4; 155.1; 156.2;
157.7; 158.1 (240 Hz). HRMS calcd for C19H21FN4O2 + H: 357.1727.
Found: 357.1690.
2-(4-(2,3-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)-5-ethylpyrimidine (21n). Obtained in 58% yield as a solid,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.28 (t, 3H, J = 7.6); 1.30 (d, 6H, J = 6.1); 2.54
(s, 3H); 2.65 (q, 2H, J = 7.6); 5.19 (sept, 1H, J = 6.1); 6.67 (m, 1H);
6.82 (m, 1H); 6.89 (m, 1H); 8.55 (s, 2H). 13C NMR (CDCl3): 12.4;
15.0; 22.1; 23.0; 72.2; 104.8 (18 Hz); 111.3 (3 Hz); 122.8 (8 and 5
Hz); 126.2; 132.5; 134.4; 141.2 (250 and 15 Hz); 147.7 (8 Hz); 151.5
(247 and 10 Hz); 155.7; 156.0; 157.7. HRMS calcd for C19H20F2N4O2
+ H: 375.1633. Found: 375.1609.
2-(4-(2,6-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)-5-fluoropyrimidine (23b). Obtained in 18% yield as solid,
using 2-chloro-5-fluoropyrimidine in acetonitrile at 150 °C for 1 h and
after two consecutive chromatography over silica gel (dichloro-
1
methane) and (cyclohexane−ethyl acetate 4/1). H NMR (CDCl3):
1.21 (d, 6H, J = 6.2); 2.65 (s, 3H); 5.08 (sept, 1H, J = 6.2); 6.89 (m,
2H); 7.01 (m, 1H); 8.57 (s, 2H). 13C NMR (CDCl3): 12.4; 21.9; 72.1;
111.9 (6 and 16 Hz); 123.7 (9 Hz); 130.5; 132.4; 134.3 (13 Hz);
145.8 (22 Hz); 153.9 (3 Hz); 155.0 (260 Hz); 155.3; 155.7 (4 and 250
Hz). HRMS calcd for C17H15F3N4O2 + H: 365.1225. Found:
365.1222.
5-Methyl-2-(4-(2,6-difluorophenoxy)-3-isopropoxy-5-meth-
yl-1H-pyrazol-1-yl)pyrimidine (23c). Obtained in 77% yield as a
solid, using 2-chloro-5-methylpyrimidine in acetonitrile at 160 °C for 1
h after chromatography over silica gel (cyclohexane−ethyl acetate 3/
1
2). H NMR (CDCl3): 1.19 (d, 6H, J = 6.2); 2.29 (s, 3H); 2.64 (s,
3H); 5.09 (sept, 1H, J = 6.2); 6.87 (m, 2H); 7.01 (m, 1H); 8.51 (s,
2H). 13C NMR (CDCl3): 12.2; 14.9; 21.9; 71.9; 111.9 (6 and 17 Hz);
123.5 (9 Hz); 126.1; 130.2; 132.2; 134.5 (14 Hz); 154.9; 155.6 (250
and 4 Hz); 156.1; 158.2. HRMS calcd for C18H18F2N4O2 + H:
361.1476. Found: 361.1467.
5-Cyclopropyl-2-(4-(2,6-difluorophenoxy)-3-isopropoxy-5-
methyl-1H-pyrazol-1-yl)pyrimidine (23d). Obtained in 83% yield
as a solid using 2-chloro-5-cyclopropylpyrimidine in acetonitrile at 160
°C for 1 h after chromatography over silica gel (cyclohexane−ethyl
acetate 4/1). 1H NMR (CDCl3): 0.75 (m, 2H); 1.08 (m, 2H); 1.21 (d,
6H, J = 6.2); 1.85 (m, 1H); 2.64 (s, 3H); 5.10 (sept, 1H, J = 6.2); 6.90
(m, 2H); 7.00 (m, 1H); 8.44 (s, 2H). 13C NMR (CDCl3): 8.2; 10.4;
12.3; 21.9; 71.9; 111.9 (6 and 16 Hz); 123.5 (9 Hz); 130.2; 132.1;
132.3; 134.8 (13 Hz); 154.9; 155.6 (251 and 4 Hz); 155.9; 156.2; one
signal missing. HRMS calcd for C20H20F2N4O2 + H: 387.1633. Found:
387.1599.
2-(4-(2,6-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)-5-propylpyrimidine (23e). Obtained in 67% yield as a
solid using 2-chloro-5-propylpyrimidine in acetonitrile at 160 °C for 1
h after chromatography over silica gel (cyclohexane−ethyl acetate 4/
1). 1H NMR (CDCl3): 0.95 (t, 3H, J = 7.4); 1.21 (d, 6H, J = 6.2); 1.63
(m, 2H); 2.56 (t, 2H, J = 7.5); 2.65 (s, 3H); 5.10 (sept, 1H, J = 6.2);
6.89 (m, 2H); 7.01 (m, 1H); 8.51 (s, 2H). 13C NMR (CDCl3): 12.3;
13.4; 21.9; 24.0; 31.7; 71.9; 111.9 (6 and 16 Hz); 123.5 (9 Hz); 130.2;
130.6; 132.2; 134.5 (13 Hz); 154.9; 155.6 (250 and 4 Hz); 155.2;
158.0. HRMS calcd for C20H22F2N4O2 + H: 389.1789. Found:
389.1765.
2-(4-(2,4-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)-5-ethylpyrimidine (21o). Obtained in 57% yield as a solid,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.29 (t, 3H, J = 7.6); 1.31 (d, 6H, J = 6.1); 2.56
(s, 3H); 2.66 (q, 2H, J = 7.6); 5.19 (sept, 1H, J = 6.1); 6.73 (m, 1H);
6.90 (m, 2H); 8.56 (s, 2H). 13C NMR (CDCl3): 12.4; 15.0; 22.1; 23.0;
72.1; 104.8 (22 and 27 Hz); 110.2 (23 Hz); 117.0 (10 Hz); 126.8;
132.5; 134.3; 142.6(11 Hz); 152.0 (250 and 12 Hz); 155.8; 156.1;
157.3 (243 and 10 Hz); 157.7. HRMS calcd for C19H20F2N4O2 + H:
375.1633. Found: 375.1639.
2-(4-(2,5-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)-5-ethylpyrimidine (21p). Obtained in 71% yield as a solid,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.29 (t, 3H, J = 7.6); 1.32 (d, 6H, J = 6.1); 2.55
(s, 3H); 2.67 (q, 2H, J = 7.6); 5.22 (sept, 1H, J = 6.1); 6.66 (m, 2H);
7.06 (m, 1H); 8.57 (s, 2H). 13C NMR (CDCl3): 12.4; 15.0; 22.1; 23.0;
72.2; 104.1 (28 Hz); 108.4 (24 and 7 Hz); 116.6 (21 and 10 Hz);
125.9; 132.6; 134.5; 146.7 (12 and 10 Hz); 148.5 (242 and 3 Hz);
155.6; 156.0; 157.7; 158.6 (243 and 2 Hz). HRMS calcd for
C19H20F2N4O2 + H: 375.1633. Found: 375.1643.
2-(4-(2,6-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)-5-methoxypyrimidine (23f). Obtained in 45% yield as a
solid using 2-chloro-5-methoxypyrimidine in acetonitrile at 160 °C for
90 min after chromatography over silica gel (cyclohexane−ethyl
1
acetate 2/1). H NMR (CDCl3): 1.20 (d, 6H, J = 6.2); 2.61 (s, 3H);
2-(4-(2,6-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)-5-ethylpyrimidine (21q). Obtained in 56% yield as an oil,
using 2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for
1 h and after two consecutive chromatography processes, the first one
over silica gel (cyclohexane−ethyl acetate 3/1), the second one over
alumina containing 1.5% of water (cyclohexane−dichloromethane 1/
1). 1H NMR (CDCl3): 1.20 (d, 6H, J = 6.1); 1.27 (t, 3H, J = 7.5); 2.64
(q, 2H, J = 7.5); 2.65 (s, 3H); 5.10 (sept, 1H, J = 6.1); 6.88 (m, 2H);
7.01 (m, 1H); 8.53 (s, 2H). 13C NMR (CDCl3): 12.3; 15.0; 21.9; 23.0;
71.9; 111.9 (6 and 16 Hz); 123.5 (9 Hz); 130.2; 132.1; 132.2; 134.5
(14 Hz); 154.9; 155.6 (250 and 4 Hz); 156.2; 157.6. HRMS calcd for
C19H20F2N4O2 + H: 375.1633. Found: 375.1625.
3.92 (s, 3H); 5.07 (sept, 1H, J = 6.2); 6.88 (m, 2H); 7.02 (m, 1H);
8.38 (s, 2H). 13C NMR (CDCl3): 12.0; 21.9; 56.3; 71.9; 111.8 (6 and
16 Hz); 123.5 (8 Hz); 129.8; 131.8; 134.5 (13 Hz); 144.4; 150.6;
151.8; 154.6; 155.6 (4 and 250 Hz). HRMS calcd for C18H18F2N4O3 +
H: 377.1425. Found: 377.1370.
5-Bromo-2-(4-(2,6-difluorophenoxy)-3-isopropoxy-5-meth-
yl-1H-pyrazol-1-yl)pyrimidine (23g). Obtained in 69% yield as a
solid using 5-bromo-2-chloropyrimidine in acetonitrile at 150 °C for 1
h after chromatography over silica gel (cyclohexane−dichloromethane
1
from 1/2 to 2/1). H NMR (CDCl3): 1.20 (d, 6H, J = 6.2); 2.65 (s,
3H); 5.08 (sept, 1H, J = 6.2); 6.90 (m, 2H); 7.00 (m, 1H); 8.70 (s,
2H). 13C NMR (CDCl3): 12.6; 21.8; 72.1; 111.8 (6 and 17 Hz);
114.2; 123.7 (9 Hz); 130.9; 132.6; 134.2 (13 Hz); 155.6; 155.6 (4 and
250 Hz); 155.9; 158.7. HRMS calcd for C17H15BrF2N4O2 + H:
425.0425. Found: 425.0381.
2-Chloro-5-cyclopropylpyrimidine (4g). Under an inert atmos-
phere, 5-bromo-2-chloropyrimidine (10 g, 0.051 mol) and cesium
carbonate (60 g, 0.18 mol) were dispersed in a 95/5 v/v mixture of
toluene and water (400 mL). This was degassed by gently bubbling
argon in the reaction, and [1,1′-bis(diphenylphosphino)ferrocene]-
dichloropalladium complexed with dichloromethane (2.1 g, 0.0025
mol) and cyclopropylboronic acid (5.3 g, 0.062 mol) were added. The
2-(4-(2,6-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)-5-pyrimidine (23a). Obtained in 78% yield as an oil, using
2-chloropyrimidine (22a) in acetonitrile at 160 °C for 1 h after
1
chromatography over silica gel (cyclohexane−ethyl acetate 2/3). H
NMR (CDCl3): 1.20 (d, 6H, J = 6.2); 2.65 (s, 3H); 5.11 (sept, 1H, J =
6.2); 6.87 (m, 2H); 7.04 (m, 2H); 8.68 (d, 2H, J = 4.7). 13C NMR
(CDCl3): 12.6; 21.9; 72.0; 111.9 (6 and 17 Hz); 116.8; 123.6 (9 Hz);
130.5; 134.4 (13 Hz); 155.2; 155.7; (250 and 4 Hz); 157.7; 158.3;
158.4. HRMS calcd for C17H16F2N4O2 + H: 347.1320. Found:
347.1333.
K
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
flask was heated to reflux for 20 min. Upon cooling, the suspension
was diluted in ethyl acetate. The filtered organic layer was washed with
water, brine, dried over magnesium sulfate, and concentrated to
dryness. The residue was purified by chromatography over silica gel
(cyclohexane−ethyl acetate 6/1) to yield the pyrimidine as a white
powder (5.3 g, 69%). 1H NMR (CDCl3): 0.79 (m, 2H); 1.13 (m, 2H);
1.88 (m, 1H); 8.36 (s, 2H). 13C NMR (CDCl3): 9.0; 10.3; 135.7;
157.3; 158.5. HRMS calcd for C7H7ClN2 + H: 155.0376. Found:
155.0370.
Alkylation of 3-Hydroxypyrazoles. Preparation of 2-(4-
Benzyl-3-isopropoxy-5-methyl-1H-pyrazol-1-yl)-5-ethylpyrimi-
dine (9b). Under a moisture-protected atmosphere, compound 7 (0.1
g, 0.339 mmol), isopropyl bromide (0.04 mL, 0.40 mmol), and
potassium carbonate (0.1 g, 6.79 mmol) were heated at 80 °C in
dimethylformamide (3 mL, dried over 4 Å molecular sieves) for 1 h.
The solution was diluted in water and extracted with ethyl acetate. The
organic layer was washed with water four times with brine once, dried
over magnesium sulfate, and concentrated to dryness. The residue was
purified by chromatography over silica gel (cyclohexane−ethyl acetate
from 2/1 to 1/1) to yield the 3-pyrazole isopropyl ether as an oil (0.04
2-(4-Benzyl-3-ethoxy-5-methyl-1H-pyrazol-1-yl)-5-methyl-
pyrimidine (5h). In a tube adapted for microwave oven, 2-(4-benzyl-
3-ethoxy-5-methyl-1H-pyrazol-1-yl)-5-bromopyrimidine (5a) (0.24 g,
0.64 mmol), cesium carbonate (1.04 g, 3.21 mmol), methylboronic
acid (0.11 g, 1.93 mmol) in dimethylformamide (4 mL, dried over 4A
molecular sieves) were mixed. This suspension was degassed by a
gentle stream of argon, and [1,1′-bis(diphenylphosphino)ferrocene]-
dichloropalladium complexed with dichloromethane (0.026 g, 0.032
mmol) was added. The tube was sealed and heated in a microwave
oven at 100 °C for 1 h. The resulting suspension was diluted in water,
extracted with ethyl acetate. The organic layer was washed with brine,
dried over sodium sulfate, and concentrated to dryness. The residue
was purified first by chromatography over silica gel (cyclohexane−
ethyl acetate from 2/1 to 3/2) followed by a second chromatography
over alumina oxide containing 1.5% of water (cyclohexane−dichloro-
methane from 2/1 to 1/1) to yield the 5-methyl derivative as a white
1
g, 34%). H NMR (CDCl3): 1.27 (t, 3H, J = 7.3); 1.34 (d, 6H, J =
6.1); 2.55 (s, 3H); 2.62 (q, 2H, J = 7.3); 3.73 (s, 2H); 5.23 (sept, 1H, J
= 6.1); 7.17 (m, 1H); 7.25 (m, 4H); 8.54 (s, 2H). 13C NMR (CDCl3):
13.8; 15.1; 22.3; 23.0; 27.8; 71.2; 109.1; 125.7; 128.2; 128.3; 131.8;
140.4; 140.8; 156.2; 157.6; 162.6. HRMS calcd for C20H24N4O + H:
337.2028. Found: 337.2006.
2-(4-Benzyl-3-sec-butoxy-5-methyl-1H-pyrazol-1-yl)-5-cyclo-
propylpyrimidine (9c). From compound 8, following a similar
protocol using 2-bromobutane, the corresponding ether was obtained
(0.04 g, 37%) as an oil after chromatography over silica gel
(cyclohexane−ethyl acetate 3/1 to 1/1). 1H NMR (CDCl3): 0.75
(m, 2H); 0.92 (t, 6H, J = 7.5); 1.08 (m, 2H); 1.32 (d, 3H, J 6.1); 1.68
(m, 2H); 1.87 (m, 1H); 2.54 (s, 3H); 3.73 (s, 2H); 5.04 (m, 1H); 7.16
(m, 1H); 7.25 (m, 4H); 8.44 (s, 2H). 13C NMR (CDCl3): 8.2; 9.4;
10.4; 13.7; 19.5; 27.9; 29.2; 75.6; 109.0; 125.7; 128.2; 128.3; 131.9;
140.3; 140.8; 156.0; 156.2; 162.8. HRMS calcd for C22H26N4O + H:
363.2185. Found: 363.2129.
2-(4-Benzyl-5-methyl-3-(pentan-3-yloxy)-1H-pyrazol-1-yl)-5-
cyclopropylpyrimidine (9d). From compound 8, following a similar
protocol using 3-bromopentane, the corresponding ether was obtained
(0.03 g, 40%) as an oil after chromatography over silica gel
(cyclohexane−ethyl acetate 3/1 to 1/1). 1H NMR (CDCl3): 0.76
(m, 2H); 0.89 (t, 6H, J = 7.4); 1.07 (m, 2H); 1.70 (m, 4H); 1.84 (m,
1H); 2.54 (s, 3H); 3.74 (s, 2H); 4.94 (pent, 1H, J = 5.8); 7.16 (m,
1H); 7.25 (m, 4H); 8.44 (s, 2H). 13C NMR (CDCl3): 8.2; 9.1; 10.4;
13.7; 25.8; 27.9; 79.7; 108.9; 125.7; 128.2; 128.3; 131.8; 140.2; 140.8;
156.0; 156.2; 163.1. HRMS calcd for C23H28N4O + H: 377.2341.
Found: 377.2303.
1
powder (0.06 g, 30%). H NMR (CDCl3): 1.38 (t, 3H, J = 7.0); 2.30
(s, 3H); 2.55 (s, 3H); 3.75 (s, 2H); 4.44 (q, 2H, J = 7.0); 7.17 (m,
1H); 7.24 (m, 4H); 8.53 (s, 2H). 13C NMR (CDCl3): 13.8; 14.9; 15.0;
27.7; 64.4; 108.3; 125.8; 125.9; 128.2; 128.3; 140.5; 140.6; 156.0;
158.3; 163.4. HRMS calcd for C18H20N4O + H: 309.1715. Found:
309.1705.
2-(4-Benzyl-3-ethoxy-5-methyl-1H-pyrazol-1-yl)-5-ethyl-4-
methylpyrimidine (5i). Under an inert atmosphere, 2-(4-benzyl-3-
ethoxy-5-methyl-1H-pyrazol-1-yl)-5-ethylpyrimidine (0.17 g, 0.52
mmol) and a 3 N solution of methylmagnesium chloride in
tetrahydrofuran (3 mL, 2.95 mmol) were stirred overnight at room
temperature. The resulting solution was cautiously quenched with
ethanol, and dichlorodicyanoquinone (0.14 g, 0.63 mmol) was added
at room temperature. After 30 min, the solution was diluted in ethyl
acetate, washed with water, dried over magnesium sulfate, and
concentrated to dryness. The resulting residue was purified by
chromatography over silica gel (cyclohexane−ethyl acetate 2/1) to
3-(4-Benzyl-1-(5-ethylpyrimidin-2-yl)-5-methyl-1H-pyrazol-
3-yloxy)-N,N-dimethylpropan-1-amine (9e). From compound 7,
following a similar protocol using the hydrochloride of 3-chloro-N,N-
dimethylpropan-1-amine, the title compound was obtained after a
purification by chromatography over alumina oxide containing 1.5% of
water (dichloromethane−ethanol from 99/1 to 98/2) to yield the 3-
1
yield the 4-methylated derivative as an oil (0.05 g, 28%). H NMR
(CDCl3): 1.24 (t, 3H, J = 7.3); 1.37 (t, 3H, J = 7.0); 2.52 (s, 3H); 2.55
(s, 3H); 2.63 (q, 2H, J = 7.3); 3.75 (s, 2H); 4.44 (q, 2H, J = 7.0); 7.16
(m, 1H); 7.24 (m, 4H); 8.41 (s, 1H). 13C NMR (CDCl3): 13.7; 14.0;
14.9; 21.8; 22.5; 27.7; 64.3; 107.9; 125.8; 128.2; 128.3; 130.2; 140.5;
140.7; 155.8; 157.1; 163.2; 166.5. HRMS calcd for C20H24N4O + H:
337.2028. Found: 337.2025.
1
pyrazole isopropyl ether (0.04 g, 34%). H NMR (CDCl3): 1.25 (t,
3H, J = 7.6); 1.92 (m, 2H); 2.35 (s, 6H); 2.37 (m, 2H); 2.55 (s, 3H);
2.62 (q, 2H, J = 7.6); 3.72 (s, 2H); 4.39 (t, 2H, J = 6.2); 7.15 (m, 1H);
7.24 (m, 4H); 8.52 (s, 2H). 13C NMR (CDCl3): 13.7; 15.1; 23.0; 27.3;
27.8; 45.2; 56.2; 66.7; 108.2; 125.8; 128.2; 128.3; 132.0; 140.5; 140.6;
156.2; 157.6; 163.2. HRMS calcd for C22H29N5O + H: 380.2450.
Found: 380.2395.
2-(4-Benzyl-3-methoxy-5-methyl-1H-pyrazol-1-yl)-5-cyclo-
propylpyrimidine (9a). Under a moisture-protected atmosphere,
compound 8 (0.11 g, 0.359 mmol), methyl iodide (0.076 g, 0.535
mmol), and potassium carbonate (0.074 g, 0.535 mmol) were stirred
overnight at 20 °C in dimethylformamide (3 mL, dried over 4 Å
molecular sieves). The solution was concentrated to dryness. The
residue was purified by chromatography over silica gel (cyclohexane−
ethyl acetate from 2/1 to 1/2) to yield the 3-methoxypyrazole 9a as a
solid (0.05 g, 43%). 1H NMR (CDCl3): 0.76 (m, 2H); 1.08 (m, 2H);
1.89 (m, 1H); 2.55 (s, 3H); 3.75 (s, 2H); 4.07 (s, 3H); 7.17−7.29 (m,
5H); 8.46 (s, 2H). 13C NMR (CDCl3): 8.3; 10.4; 13.7; 27.7; 56.1;
107.9; 125.9; 128.1; 128.3; 132.1; 140.4; 140.9; 155.9; 156.2; 163.8.
HRMS calcd for C19H20N4O + H: 321.1715. Found: 321.1660. A
lesser migrating oily product (0.05 g, 43%) turned out to be the N-
methylated isomer 4-benzyl-1-(5-cyclopropylpyrimidin-2-yl)-2,5-di-
methyl-1H-pyrazol-3(2H)-one. 1H NMR (CDCl3): 0.78 (m, 2H);
1.01 (m, 2H); 1.87 (m, 1H); 2.35 (s, 3H); 3.45 (s, 3H); 3.70 (s, 2H);
7.15 (m, 1H); 7.24−7.31 (m, 4H); 8.41 (s, 2H). 13C NMR (CDCl3):
8.6; 10.4; 13.3; 28.2; 33.0; 111.0; 125.9; 128.3; 128.4; 133.1; 140.0;
148.9; 154.7; 156.2; 168.2. HRMS calcd for C19H20N4O + H:
321.1715. Found: 321.1767.
2-(4-Benzyl-1-(5-ethylpyrimidin-2-yl)-5-methyl-1H-pyrazol-
3-yloxy)ethanol (9g). A suspension of 2-(4-benzyl-3-(2-(benzyloxy)-
ethoxy)-5-methyl-1H-pyrazol-1-yl)-5-ethylpyrimidine (0.45 g, 1.05
mmol), ammonium formate (0.40 g, 6.3 mmol), and 10% palladium
over charcoal (0.05 g, 0.052 mmol) was boiled in ethanol (20 mL) for
4 h. The resulting suspension was adsorbed over silica and purified by
chromatography over silica gel (dichloromethane−ethanol, from 98/2
to 97/3) to yield the corresponding alcohol as a white powder (0.23 g,
64%). 1H NMR (CDCl3): 1.29 (t, 3H, J = 7.3); 2.60 (s, 3H); 2.66 (q,
2H, J = 7.3); 3.77 (s, 2H); 3.89 (m, 2H); 4.49 (m, 2H); 7.18−7.30 (m,
5H); 8.55 (s, 2H). 13C NMR (CDCl3): 13.7; 15.0; 23.0; 27.9; 62.3;
71.3; 108.1; 126.0; 128.1; 128.4; 132.2; 140.2; 141.0; 155.9; 157.6;
162.9. HRMS calcd for C19H22N4O2 + H: 339.1821. Found: 339.1766.
4-Benzyl-3-(2-(benzyloxy)ethoxy)-5-methyl-1H-pyrazole
(9f). Ethyl 2-benzyl-3-oxobutanoate (18 g, 0.081 mol) and 2-
(benzyloxy)ethanol (13.09 g, 0.085 mol) were dissolved in toluene
(200 mL). Sodium hydride (60% in oil, 0.34 g, 0.008 mol) was added,
and the solution was heated to reflux for 24 h. The resulting solution
L
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
was washed with water, brine, dried over magnesium sulfate, and
concentrated to dryness. The residue was dissolved in isopropanol
(300 mL), hydrazine monohydrochloride (5.87 g, 0.0856 mol), and
the suspension stirred at room temperature for 48 h before
concentrating to dryness. The crude residue was dispersed in water,
neutralized with solid sodium hydrogenocarbonate, and extracted with
dichloromethane. The filtered organic layer was washed with a
saturated solution of sodium hydrogenocarbonate, water, brine, dried
over magnesium sulfate, and concentrated to dryness. The resulting
residue was further purified by chromatography over silica gel
(dichloromethane−ethanol 97/3) to yield compound 9f as a white
6.0); 2.12 (s, 3H); 3.65 (s, 2H); 3.81 (s, 3H); 4.83 (sept, 1H, J = 6.0);
6.84 (m, 2H); 7.13 (m, 2H); 9.1 (s(l), 1H). 13C NMR (CDCl3): 10.2;
21.5; 22.3; 55.2; 71.1; 102.0; 109.9; 120.2; 126.8; 129.3; 129.6; 138.0;
157.1; 161.9. HRMS calcd for C15H20N2O2 + H: 261.1603. Found:
261.1571.
3-Isopropoxy-4-(3-methoxybenzyl)-5-methyl-1H-pyrazole
1
(10g). Obtained as an oil. H NMR (CDCl3): 1.36 (d, 6H, J = 6.2);
2.11 (s, 3H); 3.64 (s, 3H); 3.79 (s, 2H); 4.85 (sept, 1H, J = 6.2); 6.79
(m, 2H); 7.18 (m, 1H); 8.88 (s(l), 1H). 13C NMR (CDCl3): 10.3;
22.3; 27.7; 55.1; 71.2; 102.6; 111.1; 114.0; 120.7; 129.1; 137.8; 143.1;
159.6; 161.6. HRMS calcd for C15H20N2O2 + H: 261.1603. Found:
261.1541.
1
solid. H NMR (CDCl3): 2.18 (s, 3H); 3.69 (s, 2H); 3.82 (m, 2H);
4.40 (m, 2H); 4.60 (s, 2H); 7.15−7.36 (m, 10H). 13C NMR (CDCl3):
10.3; 27.7; 68.0; 68.8; 73.2; 102.1; 125.7; 127.5; 127.6; 128.2 (two
signals); 128.3; 138.0; 138.4; 141.2; 161.2. HRMS calcd for
C20H23N2O2 + H: 323.1760. Found: 323.1732.
3-Isopropoxy-4-(4-methoxybenzyl)-5-methyl-1H-pyrazole
1
(10h). Obtained as an oil. H NMR (CDCl3): 1.34 (d, 6H, J = 6.1);
2.09 (s, 3H); 3.60 (s, 2H); 3.79 (s, 3H); 4.83 (sept, 1H, J = 6.1); 6.81
(m, 2H); 7.13 (m, 2H); 8.70 (s(l), 1H). 13C NMR (CDCl3): 10.3;
22.3; 26.8; 55.2; 71.2; 103.2; 113.6; 129.1; 135.5; 137.6; 157.7; 161.6.
HRMS calcd for C15H20N2O2 + H: 261.1603. Found: 261.1533.
2-(4-Benzyl-3-isobutyl-5-methyl-1H-pyrazol-1-yl)-5-ethyl-
pyrimidine (12). In a tube for microwave oven, 6-methylheptane-2,4-
dione (0.78 g, 5.48 mmol), benzyl bromide (0.94 g, 5.48 mmol), and
potassium carbonate (1.13 g, 8.22 mmol) were dispersed in
dimethylformamide (10 mL, dried over 4 Å molecular sieves). This
was heated at 130 °C for 30 min before diluting it in ethyl acetate and
water. The organic layer was washed with water three times, brine
once, dried over magnesium sulfate, and concentrated to dryness. The
resulting crude residue was dissolved in ethanol. Hydrazine hydrate
(0.29 mL, 6.03 mmol) was added, and the solution was stirred
overnight at room temperature. This was concentrated to dryness and
partially purified by chromatography over silica gel (cyclohexane−
ethyl acetate from 3/2 to 1/1) to yield 4-benzyl-3-isobutyl-5-methyl-
1H-pyrazole as an oil (0.75 g) pure enough for the N-arylation step.
1H NMR (CDCl3): 0.90 (d, 6H, J = 6.7); 1.88 (m, 1H); 2.15 (s, 3H);
2.49 (d, 2H, J = 7.3); 3.77 (s, 2H); 7.11−7.29 (m, 5H); 8.30 (s(l),
1H). The arylation following step was made as described above, using
2-chloro-5-ethylpyrimidine in dimethylformamide at 160 °C for 1 h,
and after two consecutive chromatography processes, the first one over
silica gel (cyclohexane−ethyl acetate from 3/1 to 2/1), the second one
over alumina containing 1.5% of water (cyclohexane−dichloromethane
1/1), followed by removing a volatile side compound under high
vacuum compound 12 was obtained as a solid (0.21 g, 11% yield from
6-methylheptane-2,4-dione). 1H NMR (CDCl3): 0.90 (d, 6H, J = 6.6);
1.31 (t, 3H, J = 7.6); 2.00 (m, 1H, J = 6.8); 2.49 (d, 2H, J = 6.8); 2.56
(s, 3H); 2.68 (q, 2H, J = 7.6); 3.85 (s, 2H); 7.66 (m, 3H); 7.27 (m,
2H); 8.60 (s, 2H). 13C NMR (CDCl3): 13.2; 15.1; 22.6; 23.1; 28.6;
29.1; 36.0; 118.7; 125.9; 128.1; 128.3; 132.9; 139.5; 140.3; 154.2;
156.3; 157.7. HRMS calcd for C21H26N4 + H: 335.2236. Found:
335.2257.
General Method for the Preparation of Compounds 10a−h.
Preparation of 4-Benzyl-3-isopropoxy-5-methyl-1H-pyrazole
(10a) from Isopropyl Acetoacetate. In a 1000 mL flask, isopropyl
acetoacetate (21.55 g, 0.149 mol), benzaldehyde (15.86, 0.149 mol)
were dissolved in isopropanol (200 mL). Piperidine (1.3 g, 0.0149
mol) and acetic acid (0.9 g, 0.0149 mol) were added. The flask was
closed, and the mixture was stirred overnight. To the resulting solution
10% palladium over charcoal was added (3.9 g, 3.7 mmol). The flask
was charged with an excess of hydrogen using an inflatable balloon,
and the solution was stirred rapidly for 3 h. This was filtered and
concentrated to dryness. The residue was dissolved in ethyl acetate.
The organic layer was washed with water, brine, dried over magnesium
sulfate, and concentrated to dryness. This was dissolved in isopropanol
(600 mL). Hydrazine monohydrochloride was added (9.66 g, 0.14
mol) and the suspension heated to reflux for 12 h. This was
concentrated to dryness, dispersed in water (500 mL), and the
suspension was made basic with solid sodium hydrogen carbonate and
further dispersed in dichloromethane. The resulting emulsion,
containing an insoluble material (rather pure 4-benzyl-5-methyl-1H-
pyrazol-3-ol), was filtered using a large folded filter. This was rinsed
with dichloromethane. The resulting organic layer was washed with a
saturated solution of sodium hydrogen carbonate, water, brine, dried
over magnesium sulfate, and concentrated to dryness. The residue was
further purified by chromatography over silica gel (cyclohexane−ethyl
acetate 2/1, monitoring at 280 nm, relatively weak signal) to yield
compound 10a as a solid (8.63 g, 25% from isopropyl acetoacetate).
1H NMR (CDCl3): 1.33 (d, 6H, J = 6.0); 2.10 (s, 3H); 3.68 (s, 2H);
4.84 (sept, 1H, J = 6.0); 7.23 (m, 5H); 8.0 (s(l), 1H). 13C NMR
(CDCl3): 10.3; 22.3; 27.7; 71.4; 102.8; 125.7; 128.2; 128.3; 137.8;
141.4; 161.4. HRMS calcd for C14H18N2O + H: 231.1497. Found:
231.1481.
4-(2-Fluorobenzyl)-3-isopropoxy-5-methyl-1H-pyrazole
1
4-Benzyl-1-(4-ethylphenyl)-3-isopropoxy-5-methyl-1H-pyra-
zole (13). In an open flask, 4-benzyl-3-isopropoxy-5-methyl-1H-
pyrazole (0.24 g, 1.0 mmol), 4-ethylboronic acid (0.17 g, 1.1 mmol),
pyridine (0.17 mL, 2.1 mmol, dried over 4 Å molecular sieves), 4 Å
molecular sieves (0.6 g), and copper(II) acetate hydrate (0.31 g, 1.5
mmol) were dispersed in dichloromethane (20 mL). The reaction was
stirred in open air for 48 h. The suspension was absorbed on a small
amount of silica gel and purified by chromatography over silica gel
(cyclohexane−ethyl acetate 97/3) to give the N-arylated compound
(10b). Obtained as an oil. H NMR (CDCl3): 1.32 (d, 6H, J = 6.2);
2.14 (s, 3H); 3.67 (s, 2H); 4.83 (sept, 1H, J = 6.2); 7.05 (m, 2H);
7.14−7.21 (m, 2H); 8.70 (s(l), 1H). 13C NMR (CDCl3): 10.2; 20.5;
22.3; 71.2; 101.4; 114.9 (J = 23 Hz); 123.7; 127.3; 127.9 (J = 15);
130.7; 137.8; 160.8 (J = 244 Hz); 161.8. HRMS calcd for C14H17FN2O
+ H: 249.1403. Found: 249.1337.
4-(3-Fluorobenzyl)-3-isopropoxy-5-methyl-1H-pyrazole
1
(10d). Obtained as an oil which slowly solidified. H NMR (CDCl3):
1.33 (d, 6H, J = 6.2); 2.11 (s, 3H); 3.65 (s, 2H); 4.84 (sept, 1H, J =
6.2); 6.86−6.92 (m, 2H); 6.98 (m, 1H); 7.20 (m, 1H); 8.62 (s(l),
1H). 13C NMR (CDCl3): 10.3; 22.3; 27.5; 71.3; 102.1; 112.5 (J = 21
Hz); 115.1 (J = 21 Hz); 123.8; 129.5; 137.7; 144.0; 161.5; 163.0 (J =
244 Hz). HRMS calcd for C14H17FN2O + H: 249.1403. Found:
249.1321.
1
mentioned above (0.22 g, 63%) as an oil. H NMR (CDCl3): 1.27 (t,
3H, J = 7.6); 1.36 (d, 6H, J = 6.1); 2.17 (s, 3H); 2.69 (q, 2H, J = 7.6);
3.73 (s, 2H); 4.98 (sept, 1H, J = 6.1); 7.25 (m, 5H). 13C NMR
(CDCl3): 11.3; 15.6; 22.3; 28.2; 28.4; 71.1; 104.9; 124.6; 126.7; 128.2;
128.3; 128.35; 137.1; 138.0; 141.5; 142.6; 161.2. HRMS calcd for
C22H26N2O + H: 335.2123. Found: 335.2105.
2-(3-Ethoxy-5-methyl-4-phenyl-1H-pyrazol-1-yl)-5-ethylpyr-
imidine (16a). In a vial adapted for microwave heating, compound 15
(0.23 g, 0.64 mmol), phenylboronic acid (0.086 g, 0.70 mmol), and
cesium carbonate (0.62 g, 1.93 mmol) were dissolved in a 2/3 mixture
of propanol and water (3 mL). This was degassed by a gentle steam of
argon. [1,1′-Bis(diphenylphosphino)ferrocene]dichloropalladium
complexed with dichloromethane (0.026 g, 0.032 mmol) was added
4-(4-Fluorobenzyl)-3-isopropoxy-5-methyl-1H-pyrazole
1
(10e). Obtained as an oil. H NMR (CDCl3): 1.34 (d, 6H, J = 6.2);
2.10 (s, 3H); 3.62 (s, 2H); 4.83 (sept, 1H, J = 6.2); 6.95 (m, 2H); 7.15
(m, 2H); 8.79 (s(l), 1H). 13C NMR (CDCl3): 10.3; 22.3; 26.9; 71.2;
102.7; 114.8 (J = 21 Hz); 129.5; 137.0; 137.5; 161.2 (J = 243 Hz);
161.6. HRMS calcd for C14H17FN2O + H: 249.1403. Found: 249.1327.
3-Isopropoxy-4-(2-methoxybenzyl)-5-methyl-1H-pyrazole
(10f). Obtained as a yellow solid. 1H NMR (CDCl3): 1.32 (d, 6H, J =
M
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
and the sealed tube heated at 120 °C for 30 min. The resulting
solution was diluted in water, extracted with ethyl acetate. The organic
layer was washed with brine, dried over sodium sulfate, and
concentrated to dryness. The residue was purified first by
chromatography over alumina containing 1.5% water (cyclohexane−
dichloromethane 1/2) to yield the 4-phenyl derivative 16a as a solid
(0.12 g, 60%). 1H NMR (CDCl3): 1.31 (t, 3H, J = 7.4); 1.42 (t, 3H, J
= 7.0); 2.68 (q, 2H, J = 7.4); 2.70 (s, 3H); 4.51 (q, 2H, J = 7.0); 7.33
(m, 1H); 7.45 (m, 4H); 8.61 (s, 2H). 13C NMR (CDCl3): 14.5; 14.8;
15.1; 23.1; 64.7; 111.2; 126.6; 128.3; 129.4; 131.4; 132.4; 140.0; 156.1;
157.7; 162.1. HRMS calcd for C18H20N4O + H: 309.1715. Found:
309.1681.
(3-Ethoxy-1-(5-ethylpyrimidin-2-yl)-5-methyl-1H-pyrazol-4-
yl)(phenyl)methanone (16b). Under an inert atmosphere, a
solution of compound 15 (0.27 g, 0.75 mmol) in dry tetrahydrofuran
(5 mL) was cooled to −78 °C. A 2 N solution of butyllithium in
cyclohexane (0.4 mL, 0.79 mmol) was added. The resulting precipitate
was stirred for 3 min, and benzoyl chloride (0.09 mL, 0.83 mmol) was
added. The resulting suspension was diluted in water, extracted with
ethyl acetate, and the organic layer was washed with brine, dried over
magnesium sulfate, and concentrated to dryness. The resulting residue
was purified first by chromatography over silica gel (cyclohexane−
ethyl acetate from 2/1) followed by a second chromatography over
alumina oxide containing 1.5% of water (cyclohexane−dichloro-
methane from 1/1 to 1/2) to yield the 4-benzoyl derivative (0.06 g,
23%) as a solid. 1H NMR (CDCl3): 1.19 (t, 3H, J = 7.2); 1.32 (t, 3H, J
= 7.0); 2.70 (q, 2H, J = 7.2); 2.79 (s, 3H); 4.37 (q, 2H, J = 7.0); 7.42
(m, 2H); 7.54 (m, 1H); 7.85 (m, 2H); 8.65 (s, 2H). 13C NMR
(CDCl3): 14.3; 14.4; 14.9; 23.1; 64.8; 110.2; 127.8; 129.5; 132.3;
133.9; 139.0; 147.7; 155.6; 157.9; 161.9; 161.9; 190.7. HRMS calcd for
C19H20N4O2 + H: 337.1665. Found: 337.1632.
2-(3-Ethoxy-5-methyl-4-(phenylthio)-1H-pyrazol-1-yl)-5-eth-
ylpyrimidine (16c). Under an argon atmosphere, compound 15
(0.23 g, 0.64 mmol) was dissolved in dry tetrahydrofuran (5 mL,
purchased). This was cooled to −78 °C with a dry ice bath, and 2 M
butyllithium in cyclohexane (0.34 mL, 0.69 mmol) was added. A
solution of 1,2-diphenyldisulfane (0.15 g, 0.69 mmol) in dry
tetrahydrofuran (5 mL) was added after 10 s of stirring, and the
solution was stirred an additional 10 min at −78 °C before allowing it
to warm to room temperature. The resulting solution was adsorbed on
silica and purified by two consecutive chromatography processes, the
first one over silica gel (dichloromethane) and the second also over
silica gel (cyclohexane−ethyl acetate 3/1) to yield the thioether 16c
(0.01 g, 4.5%). 1H NMR (CDCl3): 1.32 (t, 3H, J = 7.3); 1.39 (t, 3H, J
= 7.7); 2.70 (q, 2H, J = 7.7); 2.72 (s, 3H); 4.49 (q, 2H, J = 7.3); 7.11
(m, 1H); 7.17 (m, 2H); 7.22 (m, 2H); 8.62 (s, 2H). 13C NMR
(CDCl3): 14.1; 14.7; 15.0; 23.0; 65.0; 97.8; 125.1; 126.2; 128.7; 133.1;
137.6; 148.4; 155.9; 157.8; 164.6. HRMS calcd for C18H20N4OS + H:
341.1436. Found: 341.1404.
(1-(5-Cyclopropylpyrimidin-2-yl)-3-isopropoxy-5-methyl-
1H-pyrazol-4-yl)(phenyl)methanol (17). In a 1/1 mixture of water
and acetonitrile (6 mL), compound 6 (0.12 g, 0.34 mmol) and cerium
ammonium nitrate (0.56 g, 1.02 mmol) were stirred overnight. This
was diluted in water, extracted with ethyl acetate. The organic layer
was washed with water, brine, dried over magnesium sulfate, and
concentrated to dryness. This residue was partially purified by
chromatography over silica gel (cyclohexane−ethyl acetate from 1/2
to 2/1). The corresponding fractions were dissolved in ethanol (10
mL), and sodium borohydride (0.033 g, 0.88 mmol) was added
followed by one drop of acetic acid. The suspension was stirred
overnight, diluted in ethyl acetate, and the organic layer was washed
with water, brine, dried over magnesium sulfate, and concentrated to
dryness. The resulting residue was purified by chromatography over
silica gel (dichloromethane−ethanol from 99/1 to 98/2) to yield the
alcohol 17 (0.03 g, 24%) as a solid. 1H NMR (CDCl3): 0.77 (m, 2H);
1.01 (m, 2H); 1.27 (d, 3H, J = 6.1); 1.37 (d, 3H, J = 6.1); 1.89 (m,
1H); 2.54 (s, 3H); 3.03 (d, 1H, J = 7.5); 5.24 (sept, 1H, J = 6.1); 5.79
(d, 1H, J = 7.5); 7.25 (m, 1H); 7.33 (m, 2H); 7.45 (m, 1H); 8.46 (s,
2H). 13C NMR (CDCl3): 8.4; 10.4; 13.6; 22.1; 22.3; 67.9; 71.9; 111.6;
126.8; 127.1; 128.2; 132.7; 140.1; 143.5; 155.8; 156.2; 161.3. HRMS
calcd for C21H24N3O2 + H: 365.1978. Found: 365.1951.
2-(4-Benzyl-5-(bromomethyl)-3-isopropoxy-1H-pyrazol-1-
yl)-5-cyclopropylpyrimidine (18). In acetonitrile (5 mL, dried over
4 Å molecular sieves) 2-(4-benzyl-3-isopropoxy-5-methyl-1H-pyrazol-
1-yl)-5-cyclopropylpyrimidine (0.28 g, 8.0 mmol) and N-bromosucci-
nimide (0.17 g, 9.6 mmol) were stirred overnight at room temperature.
The resulting solution was concentrated to dryness and redissolved in
ethyl acetate. The organic phase was washed with a saturated solution
of sodium hydrogenocarbonate, water, brine, dried over magnesium
sulfate, and concentrated to dryness to yield compound 18 as glass
1
which was used without further purification (0.28 g; 81%). H NMR
(CDCl3): 0.78 (m, 2H); 1.10 (m, 2H); 1.33 (d, 6H, J = 6.1); 1.87 (m,
1H); 3.81 (s, 2H); 5.05 (s, 2H); 5.23 (sept, 1H, J = 6.1); 7.19 (m,
1H); 7.27 (m, 4H); 8.48 (s, 2H). 13C NMR (CDCl3): 8.4; 10.5; 22.2;
22.7; 27.7; 71.7; 111.8; 126.1; 128.3; 128.5; 132.6; 138.8; 139.5; 154.4;
156.3; 162.1.
2-(4-Benzyl-3-isopropoxy-5-(methoxymethyl)-1H-pyrazol-1-
yl)-5-cyclopropylpyrimidine (19a). Under an inert atmosphere, 2-
(4-benzyl-5-(bromomethyl)-3-isopropoxy-1H-pyrazol-1-yl)-5-cyclo-
propylpyrimidine (0.28 g, 0.65 mmol) and a 30% solution of sodium
methanolate in methanol (1 mL) were stirred overnight. This was
dispersed in water and ethyl acetate, and the organic layer was washed
with water, dried over magnesium sulfate, and concentrated to dryness.
The resulting residue was purified by two consecutive chromatography
processes, the first one over silica gel (cyclohexane−ethyl acetate 3/1),
the second one over alumina containing 1.5% of water (cyclohexane−
dichloromethane 1/2) followed by the use of high vacuum to yield the
1
methoxy ether as an oil (0.07 g, 23%). H NMR (CDCl3): 0.76 (m,
2H); 1.08 (m, 2H); 1.32 (d, 6H, J = 6.1); 1.89 (m, 1H); 3.26 (s, 3H);
3.83 (s, 2H); 4.87 (s, 2H); 5.22 (sept, 1H, J = 6.1); 7.18 (m, 1H); 7.27
(m, 4H); 8.46 (s, 2H). 13C NMR (CDCl3): 8.3; 10.4; 22.2; 27.8; 58.0;
64.8; 71.5; 111.8; 125.8; 128.2; 128.4; 132.4; 139.2; 140.6; 155.6;
156.2; 162.3. HRMS calcd for C22H26FN4O2 + H: 379.2134. Found:
379.2084.
1-(4-Benzyl-1-(5-cyclopropylpyrimidin-2-yl)-3-isopropoxy-
1H-pyrazol-5-yl)-N,N-dimethylmethanamine (19b). Under an
inert atmosphere, 2-(4-benzyl-5-(bromomethyl)-3-isopropoxy-1H-pyr-
azol-1-yl)-5-cyclopropylpyrimidine (0.2 g, 0.46 mmol) and a 2 N
solution of dimethylamine in tetrahydrofuran (1 mL) were stirred
overnight. This was dispersed in water and ethyl acetate and made
basic with a saturated solution of sodium bicarbonate. The organic
layer was washed with water, dried over magnesium sulfate, and
concentrated to dryness. The resulting residue was purified by
chromatography over silica gel (dichloromethane−ethanol 95/5 to
1
yield the dimethylamine derivative as a solid (0.07 g, 38%). H NMR
(CDCl3): 0.75 (m, 2H); 1.05 (m, 2H); 1.32 (d, 6H, J = 6.1); 1.86 (m,
1H); 2.13 (s, 6H); 3.81 (s, 2H); 3.85 (s, 2H); 5.21 (sept, 1H, J = 6.1);
7.15 (m, 1H); 7.25 (m, 4H); 8.44 (s, 2H). 13C NMR (CDCl3): 8.2;
10.4; 22.2; 27.8; 45.2; 53.5; 71.3; 110.8; 125.7; 128.1; 128.4; 132.5;
140.4; 140.8; 156.0; 156.1; 162.2. HRMS calcd for C23H29N5O + H:
392.2450. Found: 392.2479.
N-((4-Benzyl-1-(5-cyclopropylpyrimidin-2-yl)-3-isopropoxy-
1H-pyrazol-5-yl)methyl)-N-ethylethanamine (19c). Under an
inert atmosphere, 2-(4-benzyl-5-(bromomethyl)-3-isopropoxy-1H-pyr-
azol-1-yl)-5-cyclopropylpyrimidine (0.18 g, 0.43 mmol) and diethyl-
amine (1 mL) were stirred overnight. This was dispersed in water and
ethyl acetate and made basic with a saturated solution of sodium
bicarbonate. The organic layer was washed with water, dried over
magnesium sulfate, and concentrated to dryness. The resulting residue
was purified by chromatography over silica gel (dichloromethane−
ethanol 95/5 to yield the diethylamine derivative as an oil (0.07 g,
39%). 1H NMR (CDCl3): 0.75 (m, 8H); 1.07 (m, 2H); 1.32 (d, 6H, J
= 6.1); 1.88 (m, 1H); 2.35 (q, 4H, J = 6.9); 3.82 (s, 2H); 3.94 (s, 2H);
5.18 (sept, 1H, J = 6.1); 7.16 (m, 1H); 7.25 (m, 4H); 8.44 (s, 2H). 13C
NMR (CDCl3): 8.4; 10.5; 11.3; 22.3; 27.8; 46.2; 48.4; 71.2; 110.2;
125.6; 128.0; 128.4; 132.7; 141.0; 141.2; 155.9; 156.1; 162.3. HRMS
calcd for C25H33N5O + H: 420.2763. Found: 420.2853.
General Method for the Preparation of Compounds 20a−n
from Ethyl or Isopropyl 2-Chloro-3-oxobutanoate. Synthesis
N
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
of 4-(2-Chlorophenoxy)-3-ethoxy-5-methyl-1H-pyrazole (20c).
Under an inert atmosphere, 2-chlorophenol (3.58 g, 0.028 mol) was
dissolved in dry dimethylformamide (100 mL, dried over 4 Å
molecular sieves). To this solution sodium hydride (60% in oil, 1.11 g,
0.028 mol) was cautiously added, and at the end of the hydrogen
evolution, ethyl 2-chloro-3-oxobutanoate (3.85 mL, 0.028 mol) was
added. This was heated at 85 °C under an inert atmosphere for 5 h,
and the suspension was concentrated to dryness. The residue was
dispersed in a mixture of water and ethyl acetate, and the organic layer
was washed with water, brine, dried over magnesium sulfate, and
concentrated to dryness. The residue, containing an ethyl ester, was
dissolved in ethanol (100 mL, in the case of isopropyl esters,
isopropanol was used). Hydrazine monohydrochloride (1.4 g, 0.020
mol) was added, and the suspension was heated to reflux for 2 h. This
was concentrated to dryness, dispersed in water (100 mL), and the
suspension was made basic with solid sodium hydrogen carbonate and
further dispersed in dichloromethane. The resulting emulsion,
containing an insoluble material (rather pure 4-(2-chlorophenoxy)-5-
methyl-1H-pyrazol-3-ol), was filtered using a large folded filter. This
was rinsed with dichloromethane. The resulting organic layer was
washed with a saturated solution of sodium hydrogen carbonate, water,
brine, dried over magnesium sulfate, and concentrated to dryness. The
residue was further purified by chromatography over silica gel
(dichloromethane−ethanol 99/1 to 98/2) to yield compound 20c
(0.79 g, 11% from ethyl 2-chloro-3-oxobutanoate) as a solid. 1H NMR
(CDCl3): 1.34 (t, 3H, J = 7.0); 2.15 (s, 3H); 4.26 (q, 2H, J = 7.0); 6.84
(m, 1H); 6.97 (m, 1H); 7.15 (m, 1H); 7.40 (m, 1H); 9.70 (s(l), 1H).
13C NMR (CDCl3): 9.0; 14.8; 64.8; 115.0; 121.9; 122.4; 122.6; 127.5;
130.3; 131.7; 154.2; 155.1. HRMS calcd for C12H13ClN2O2 + H:
253.0744. Found: 253.0667.
4-(2,3-Dichlorophenoxy)-3-ethoxy-5-methyl-1H-pyrazole
1
(20h). Obtained as a solid. H NMR (DMSO-d6): 1.20 (t, 3H, J =
7.0); 2.02 (s, 3H); 4.13 (q, 2H, J = 7.0); 6.76 (m, 1H); 7.27 (m, 2H);
11.76 (s(l), 1H). 13C NMR (DMSO-d6): 8.9; 15.2; 64.4; 113.6; 120.1;
120.3; 123.9; 129.0; 131.1; 133.0; 153.6; 155.8. HRMS calcd for
C12H12Cl2N2O2 + H: 287.0354. Found: 287.0323.
4-(2,5-Dichlorophenoxy)-3-ethoxy-5-methyl-1H-pyrazole
1
(20i). Obtained as a solid. H NMR (CDCl3): 1.35 (t, 3H, J = 7.1);
2.16 (s, 3H); 4.27 (q, 2H, J = 7.1); 6.82 (d, 1H, J = 2.3); 6.95 (m, 2H);
7.32 (d, 1H, J = 8.4); 9.4 (s(l), 1H). 13C NMR (CDCl3): 9.0; 14.8;
65.0; 115.4; 120.9; 121.3; 122.8; 130.9; 131.8; 133.1; 154.7; 159.8.
HRMS calcd for C12H12Cl2N2O2 + H: 287.0354. Found: 287.0298.
4-(3,5-Dichlorophenoxy)-3-ethoxy-5-methyl-1H-pyrazole
1
(20j). Obtained as a solid. H NMR (CDCl3): 1.35 (t, 3H, J = 7.1);
2.14 (s, 3H); 4.27 (q, 2H, J = 7.1); 6.86 (m, 2H); 7.03 (m, 1H); 9.2
(s(l), 1H). 13C NMR (CDCl3): 9.1; 14.8; 64.9; 114.2; 121.0; 122.3;
131.8; 135.4; 154.8; 159.7. HRMS calcd for C12H12Cl2N2O2 + H:
287.0354. Found: 287.0302.
4-(2-Fluorophenoxy)-3-isopropoxy-5-methyl-1H-pyrazole
1
(20k). Obtained as a solid. H NMR (CDCl3): 1.29 (d, 6H, J = 6.1);
2.16 (s, 3H); 4.79 (sept, 1H, J = 6.1); 6.88 (m, 1H); 6.97 (m, 2H);
7.13 (m, 1H); 9.3 (s(l), 1H). 13C NMR (CDCl3): 9.0; 22.1; 72.4;
116.3; 116.4 (18 Hz); 122.3; 122.6; 124.1; 131.6; 146.5; 152.3 (246
Hz); 154.2. HRMS calcd for C13H15FN2O2 + H: 251.1196. Found:
251.1110.
4-(3-Fluorophenoxy)-3-isopropoxy-5-methyl-1H-pyrazole
1
(20l). Obtained as an oil. H NMR (CDCl3): 1.30 (d, 6H, J = 6.2);
2.14 (s, 3H); 4.80 (sept, 1H, J = 6.2); 6.00 (m, 3H); 7.20 (m, 1H);
9.60 (s(l), 1H). 13C NMR (CDCl3): 9.1; 22.2; 72.3; 102.9 (25 Hz);
108.7 (21 Hz); 110.9 (3 Hz); 122.1; 130.2 (9 Hz); 131.6; 154.2; 160.0
(10 Hz); 163.5 (245 Hz). HRMS calcd for C13H15FN2O2 + H:
251.1196. Found: 251.1165.
3-Ethoxy-5-methyl-4-phenoxy-1H-pyrazole (20a). Obtained
1
as a solid. H NMR (CDCl3): 1.34 (t, 3H, J = 7.1); 2.14 (s, 3H);
4-(4-Fluorophenoxy)-3-isopropoxy-5-methyl-1H-pyrazole
1
4.26 (q, 2H, J = 7.1); 6.96 (m, 2H); 7.00 (m, 1H); 7.30 (m, 2H); 9.40
(s(l), 1H). 13C NMR (CDCl3): 9.1; 14.9; 64.9; 115.0; 121.8; 121.9;
129.4; 132.0; 155.1; 158.7. HRMS calcd for C12H14N2O2 + H:
219.1134. Found: 219.1059.
(20m). Obtained as an oil. H NMR (CDCl3): 1.28 (d, 6H, J = 6.1);
2.12 (s, 3H); 4.77 (sept, 1H, J = 6.1); 6.89 (m, 2H); 6.96 (m, 2H);
10.1 (s(l), 1H). 13C NMR (CDCl3): 9.1; 22.2; 72.4; 115.7 (23 Hz);
116.1 (8 Hz); 122.9; 131.8; 154.1; 154.8; 157.9 (239 Hz). HRMS
calcd for C13H15FN2O2 + H: 251.1196. Found: 251.1136.
3-Ethoxy-4-(2-fluorophenoxy)-5-methyl-1H-pyrazole (20b).
1
Obtained as an orange solid. H NMR (CDCl3): 1.33 (t, 3H, J =
4-(2,3-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
1
7.1); 2.16 (s, 3H); 4.26 (q, 2H, J = 7.1); 6.90 (m, 1H); 6.99 (m, 2H);
7.15 (m, 1H); 8.90 (s(l), 1H). 13C NMR (CDCl3): 9.0; 14.8; 64.8;
116.1; 116.2 (24 Hz); 121.8; 122.3; 124.1; 131.7; 146.5; 152.3 (245
Hz); 155.0. HRMS calcd for C13H15FN2O2 + H: 237.1039. Found:
237.0945.
zole (20n). Obtained as a solid. H NMR (CDCl3): 1.29 (d, 6H, J =
6.1); 2.16 (s, 3H); 4.79 (sept, 1H, J = 6.1); 6.65 (m, 1H); 6.83 (m,
1H); 6.92 (m, 1H); 9.5 (s(l), 1H). 13C NMR (CDCl3): 9.0; 22.1; 72.4;
110.2 (18 Hz); 111.2; 122.4; 122.8; 131.6; 141.2 (248 and 15 Hz);
148.1; 151.5 (247 and 10 Hz); 154.0. HRMS calcd for C13H14F2N2O2
+ H: 269.1102. Found: 269.1071.
3-Ethoxy-4-(2-bromophenoxy)-5-methyl-1H-pyrazole (20d).
Obtained as a solid. 1H NMR (CDCl3): 1.33 (t, 3H, J = 7.1); 2.14 (s,
3H); 4.25 (q, 2H, J = 7.1); 6.80 (m, 1H); 6.90 (m, 1H); 7.19 (m, 1H);
7.57 (m, 1H); 9.40 (s(l), 1H). 13C NMR (CDCl3): 9.1; 14.9; 65.0;
111.2; 114.9; 122.0; 123.1; 128.3; 131.9; 133.4; 154.9; 155.2. HRMS
calcd for C12H13BrN2O2 + H: 297.0239. Found: 297.0209.
3-Ethoxy-5-methyl-4-(2-(trifluoromethyl)phenoxy)-1H-pyra-
4-(2,4-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
1
zole (20o). Obtained as a solid. H NMR (CDCl3): 1.28 (d, 6H, J =
6.1); 2.16 (s, 3H); 4.76 (sept, 1H, J = 6.1); 6.73 (m, 1H); 6.87 (m,
2H); 9.90 (s(l), 1H). 13C NMR (CDCl3): 9.1; 22.2; 72.5; 104.9 (26
and 21 Hz); 110.3 (23 Hz); 116.9 (10 Hz); 122.9; 131.5; 143.0; 152.0
(250 and 12 Hz); 153.9; 157.2 (243 and 10 Hz). HRMS calcd for
C13H14F2N2O2 + H: 269.1102. Found: 269.1012.
1
zole (20e). Obtained as a solid. H NMR (CDCl3): 1.32 (t, 3H, J =
7.0); 2.13 (s, 3H); 4.25 (q, 2H, J = 7.0); 6.91 (m, 1H); 7.06 (m, 1H);
7.43 (m, 1H); 7.63 (m, 1H); 9.3 (s(l), 1H). 13C NMR (CDCl3): 8.9;
14.8; 65.1; 114.6; 118.7 (31 Hz); 121.4 (two signals); 123.6 (273 Hz);
126.9; 132.0; 133.1; 155.0; 156.5. HRMS calcd for C13H13F3N2O2 +
H: 287.1007. Found: 287.0924.
4-(2,5-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
1
zole (20p). Obtained as a solid. H NMR (CDCl3): 1.31 (d, 6H, J =
6.1); 2.17 (s, 3H); 4.82 (sept, 1H, J = 6.1); 6.63 (m, 2H); 7.08 (m,
1H); 9.40 (s(l), 1H). 13C NMR (CDCl3): 9.0; 21.2; 72.4; 104.0 (28
Hz); 108.2 (24 and 6 Hz); 116.6 (20 and 10 Hz); 122.0; 131.6; 147.2
(13 and 7 Hz); 148.5 (243 Hz); 154.0; 158.6 (243 Hz). HRMS calcd
for C13H14F2N2O2 + H: 269.1102. Found: 269.1028.
3-Ethoxy-5-methyl-4-(3-(trifluoromethyl)phenoxy)-1H-pyra-
1
zole (20f). Obtained as a solid. H NMR (CDCl3): 1.33 (t, 3H, J =
7.04); 2.15 (s, 3H); 4.26 (q, 2H, J = 7.04); 7.13 (s, 1H); 7.20 (m, 1H);
7.29 (m, 1H); 7.40 (m, 1H); 8.70 (s(l), 1H). 13C NMR (CDCl3): 9.1;
14.8; 64.8; 112.1 (4 Hz); 118.4; 118.6 (4 Hz); 121.1; 123.8 (272 Hz);
130.0; 131.8; 131.9 (32 Hz); 154.9; 158.7. HRMS calcd for
C13H13F3N2O2 + H: 287.1007. Found: 287.0966.
4-(2,6-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
1
zole (20q). Obtained as an oil. H NMR (CDCl3): 1.22 (d, 6H, J =
6.0); 2.24 (s, 3H); 4.73 (sept, 1H, J = 6.0); 6.90 (m, 2H); 7.02 (m,
1H); 8.6 (s(l), 1H). 13C NMR (CDCl3): 9.0; 22.0; 72.1; 111.9 (16
Hz); 123.4 (9 Hz); 126.6; 129.5; 134.8; 153.4; 155.7 (249 Hz). HRMS
calcd for C13H14F2N2O2 + H: 269.1102. Found: 269.1034.
2-(4-(2,6-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)pyrimidin-4-ol (23h). In a 4 mL tube sealed with a cap, 4-
(2,6-difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyrazole (20q)
(0.295 g, 1.09 mmol) and 2-(methylthio)pyrimidin-4-ol (22h)56
(0.156 g, 1.09 mmol) were heated at 200 °C for 12 h. The resulting
tarry solid was dispersed in ethanol, adsorbed over silica, and purified
3-Ethoxy-5-methyl-4-(4-(trifluoromethyl)phenoxy)-1H-pyra-
1
zole (20g). Obtained as a solid. H NMR (CDCl3): 1.34 (t, 3H, J =
7.0); 2.14 (s, 3H); 4.26 (q, 2H, J = 7.0); 6.91 (d, 2H, J = 9.1); 7.59 (d,
2H, J = 9.1); 9.30 (s(l), 1H). 13C NMR (CDCl3): 9.1; 14.8; 64.9;
115.1; 121.1; 124.0 (270 Hz); 124.2 (33 Hz); 129.6 (4 Hz); 131.8;
154.9; 161.1. HRMS calcd for C13H13F3N2O2 + H: 287.1007. Found:
287.0968.
O
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
by two chromatography processes over silica gel (dichloromethane−
ethanol from 98/2 to 97/3 and cyclohexane−ethyl acetate 2/1)
followed by a recrystallization in cyclohexane to yield compound 23h
as a white powder (0.08 g, 20%). 1H NMR (CDCl3): 1.22 (d, 6H, J =
6.2); 2.67 (s, 3H); 4.87 (sept, 1H, J = 6.2); 6.16 (d, 1H, J = 6.5); 6.92
(m, 2H); 7.05 (m, 1H); 7.80 (d, 1H, J = 6.5); 10.0 (s(l), 1H). 13C
NMR (CDCl3): 12.1; 21.7; 73.0; 110.6; 112.1 (6 and 17 Hz); 124.1 (9
Hz); 131.1; 132.9; 133.7 (13 Hz); 148.7; 154.4; 155.3; 155.4 (4 and
250 Hz); 161.5. HRMS calcd for C17H16F2N4O3 + H: 363.1269.
Found: 363.1243.
2-(4-(2,6-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)-5-methylpyrimidin-4-ol (23i). By following the procedure
described for compound 23h using 5-methyl-2-(methylthio)pyrimidin-
4-ol (22i),57 compound 23i was obtained as a white solid in 23% yield
after two chromatography processes over silica gel (dichloromethane−
ethanol 99/1 and cyclohexane−ethyl acetate 2/1). 1H NMR (CDCl3):
1.22 (d, 6H, J = 6.2); 2.05 (d, 3H, J = 1.0); 2.67 (s, 3H); 4.86 (sept,
1H, J = 6.2); 6.89 (m, 2H); 7.03 (m, 1H); 7.61 (q, 1H, J = 1.0); 9.95
(s(l), 1H). 13C NMR (CDCl3): 11.9; 12.6; 21.7; 73.8; 112.0 (6 and 16
Hz); 119.7; 124.0 (9 Hz); 130.8; 132.5; 133.9 (14 Hz); 147.0; 150.8;
154.8; 155.4 (4 and 250 Hz); 162.2. HRMS calcd for C18H18F2N4O3 +
H: 377.1425. Found: 377.1443.
2-(4-(2,6-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)-5-ethylpyrimidin-4-ol (23j). By following the procedure
described for compound 23h, using 5-ethyl-2-(methylthio)pyrimidin-
4-ol (22j), compound 23j was obtained in 10% yield as white crystals
after chromatography over silica gel (cyclohexane−ethyl acetate 3/1)
and a recrystallization in cyclohexane. 1H NMR (CDCl3): 1.21 (t, 3H,
J = 7.4); 1.24 (d, 6H, J = 6.2); 2.51 (dt, 2H, J = 1.0 and 7.4); 2.66 (s,
3H); 4.86 (sept, 1H, J = 6.2); 6.90 (m, 2H); 7.05 (m, 1H); 7.66 (s(l),
1H); 10.14 (s(l), 1H). 13C NMR (CDCl3): 12.0; 12.9; 20.4; 21.7;
72.8; 111.9 (6 and 16 Hz); 124.0 (9 Hz); 125.4; 130.8; 132.5; 133.9
(14 Hz); 146.8; 149.8; 154.8; 155.5 (4 and 250 Hz); 161.7. HRMS
calcd for C19H20F2N4O3 + H: 391.1582. Found: 391.1610.
2-(4-(2,6-Difluorophenoxy)-3-isopropoxy-5-methyl-1H-pyra-
zol-1-yl)-5-propylpyrimidin-4-ol (23k). By following the procedure
described for compound 23h, using 2-(methylthio)-5-propylpyrimidin-
4-ol (22k), compound 23k was obtained in 17% yield as white crystals
after chromatography over silica gel (cyclohexane−ethyl acetate 3/1)
and a recrystallization (two crops) in cyclohexane. 1H NMR (CDCl3):
0.99 (t, 3H, J = 7.3); 1.23 (d, 6H, J = 6.2); 1.63 (m, 2H); 2.44 (m,
2H); 2.67 (s, 3H); 4.86 (sept, 1H, J = 6.2); 6.92 (m, 2H); 7.04 (m,
1H); 7.64 (s(l), 1H); 10.13 (s(l), 1H). 13C NMR (CDCl3): 12.0; 13.7;
21.6; 21.7; 29.1; 72.8; 112.0 (6 and 17 Hz); 123.8; 124.0 (9 Hz);
130.8; 132.5; 133.9 (14 Hz); 146.9; 150.5; 154.8; 155.5 (4 and 250
Hz); 161.8. HRMS calcd for C20H22F2N4O3 + H: 405.1738. Found:
405.1739.
sulfate and concentrated to dryness to yield the mercaptopyridine
(0.42 g). 1H NMR (DMSO-d6): 1.01 (t, 3H, J = 7.3); 2.21 (q, 2H, J =
7.3); 7.21 (s, 1H); 12.13 (s, 1H); 12.34 (s, 1H). 13C NMR (DMSO-
d6): 13.1; 19.9; 119;9. 137.7; 161.9; 175.1.
Third Step of Preparation of Compound 22j. The mercaptopyridine
(0.4 g, 2.56 mmol) was dissolved in water (5 mL) containing sodium
hydroxide (0.2 g, 5.12 mmol). Methyl iodide (0.4 g, 2.8 mmol)
dissolved in tetrahydrofuran (1 mL) was added, and the solution was
stirred for 1 h at room temperature. This was diluted in water made
acid with acetic acid. The resulting precipitate was filtered, washed
with water, and dried under vacuum to yield pure compound 22j (0.26
g, 7.8% from methyl 2-((dimethylamino)methylene)butanoate). 1H
NMR (DMSO-d6): 1.06 (t, 3H, J = 7.4); 2.29 (q, 2H, J = 7.4); 2.45 (s,
3H); 7.69 (s, 1H); 12.61 (s, 1H). 13C NMR (DMSO-d6): 12.7; 12.8;
19.9; 124.2; 149.3; 159.5; 162.5. HRMS calcd for C7H10N2OS + H:
171.0592. Found: 171.0521.
2-(Methylthio)-5-propylpyrimidin-4-ol (22k). By use of the
procedure described above, starting with methylvalerate, the expected
methyl 2-((dimethylamino)methylene)pentanoate was obtained as an
oil still containing a small proportion of dimethylformamide. 1H NMR
(CDCl3): 0.91 (t, 3H, J = 7.4); 1.42 (m, 2H); 2.34 (m, 2H); 3.00 (s,
6H); 3.65 (s, 3H); 7.29 (s, 1H). 13C NMR (CDCl3): 13.9; 25.1; 27.1;
42.9; 50.8; 97.9; 148.7; 171.4. From this compound, by use of the
procedure described above, the 2-mercapto-5-propylpyrimidin-4-ol
1
was obtained as a solid. H NMR (DMSO-d6): 0.85 (t, 3H, J = 7.4);
1.43 (m, 2H); 2.17 (m, 2H); 7.23 (s, 1H); 12.12 (s, 1H); 12.33 (s,
1H). 13C NMR (DMSO-d6): 13.9; 21.3; 28.5; 118;1. 138.4; 162.0;
175.1. From this mercaptopyrimidine, the target 2-(methylthio)-5-
propylpyrimidin-4-ol was obtained by using the procedure described
above as a solid in a 34% overall yield from methyl 2-
1
((dimethylamino)methylene)butanoate. H NMR (DMSO-d6): 0.86
(t, 3H, J = 7.3); 1.48 (m, 2H); 2.25 (m, 2H); 2.45 (s, 3H); 7.70 (s,
1H); 12.60 (s, 1H). 13C NMR (DMSO-d6): 13.1; 14.1; 22.5; 29.1;
123.2; 150.9; 159.8; 162.9. HRMS calcd for C8H12N2OS + H:
185.0749. Found: 185.0665.
ASSOCIATED CONTENT
■
S
* Supporting Information
A csv file containing the SMILES string description of the
compounds assayed in this manuscript. This material is
available free of charge via the Internet at http://pubs.acs.org.
AUTHOR INFORMATION
■
Corresponding Author
*E-mail: yves.janin@pasteur.fr. Phone: 33 (0)1 40 61 39 92.
5-Ethyl-2-(methylthio)pyrimidin-4-ol (22j). First Step: Prepara-
tion of Methyl 2-((Dimethylamino)methylene)butanoate. Methyl butyrate
(3 g, 0.029 mol) and 1-methoxy-N,N,N′,N′-tetramethylmethanedi-
amine (2.59 g, 0.0196 mol) were diluted in dry dimethylformamide (8
mL, dried over 4 Å molecular sieve). This was heated in a microwave
oven at 150 °C for 3 h. Concentration to dryness gave the expected
aminoacrylate (2.2 g) still containing a small proportion of
dimethylformamide and was used directly in the next step. 1H
(CDCl3): 1.05 (t, 3H, J = 7.3); 2.42 (q, 2H, J = 7.3); 3.02 (s, 6H); 3.67
(s, 3H); 7.29 (s, 1H). 13C (CDCl3): 16.5; 18.3; 42.9; 50.8; 99.3; 148.5;
171.2.
Second Step: Preparation of 5-Ethyl-2-mercaptopyrimidin-4-ol. Under
an inert atmosphere, the crude acrylate of the first step (2.2 g) and
thiourea (4.26 g, 0.056 mol) were dissolved in methanol (40 mL, dried
over dried over 4 Å molecular sieve). A 25% solution of sodium
methanolate in methanol (13.3 mL, 0.056 mol) was added, and this
was heated at reflux for 17 h. The methanol was removed under
vacuum. The residue was dispersed in water and ethyl acetate, made
acid with acetic acid, and the organic phase was washed with water,
brine and dried over magnesium sulfate and concentrated to dryness.
The residue, still containing thiourea and acetic acid, was dispersed in
boiling water. Upon cooling, this was extracted with ethyl acetate. The
organic layer was washed with water, brine and dried over magnesium
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
The Medicen Initiative (Chemical Library Project, Reg
́
ion Ile
de France Grants I 06-222/R and I 09-1739/R) provided the
initial support for this work. The Institut Carnot-Pasteur
Maladies Infectieuses (Programme STING) and the Agence
Nationale pour la Recherche (ANR-RPIB, Programme STING
2.0) are acknowledged for their financial support. The 2013
Leonardo da Vinci program provided a fellowship for G.Z. Dr.
Daniel Larzul, Institut Pasteur, and Dr. Emile Bisagni are
acknowledged for their constant interest and support.
REFERENCES
■
(1) Roche, O.; Schneider, P.; Zuegge, J.; Guba, W.; Kansy, M.;
Alanine, A.; Bleicher, K.; Danel, F.; Gutknecht, E. M.; Rogers-Evans,
M.; Neidhart, W.; Stalder, H.; Dillon, M.; Sjogren, E.; Fotouhi, N.;
Gillespie, P.; Goodnow, R.; Harris, W.; Jones, P.; Taniguchi, M.; Tsujii,
S.; von der Saal, W.; Zimmermann, G.; Schneider, G. Development of
̈
P
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
a virtual screening method for identification of “frequent hitters” in
compound libraries. J. Med. Chem. 2002, 45, 137−142.
(2) McGovern, S. L.; Caselli, E.; Grigorieff, N.; Shoichet, B. K. A
common mechanism underlying promiscuous inhibitors from virtual
and high-throughput screening. J. Med. Chem. 2002, 45, 1712−1722.
(3) McGovern, S. L.; Helfand, B. T.; Feng, B.; Shoichet, B. K. A
specific mechanism of nonspecific inhibition. J. Med. Chem. 2003, 46,
4265−4272.
(25) Ohno, S.; Otani, K.; Niwa, S.; Iwayama, S.; Takahara, A.;
Koganei, H.; Ono, Y.; Fujita, S.; Takeda, T.; Hagihara, M.; Okajima, A.
Pyrimidine derivatives and new pyridine derivatives. US 2004009991,
2004.
(26) Chan, D. M. T.; Lam, P. Y. S. Recent advances in copper-
promoted C-heteroatom bond cross-coupling reactions with boronic
acids and derivatives. In Boronic Acids; Hall, D. G., Ed.; Wiley-VCH:
Weinheim, Germany, 2005; pp 205−240.
(27) Maddess, M. L.; Carter, R. SNAR reactions of methylthio-4-
pyrimidinones in pivalic acid: access to functionalized pyrimidinones
and pyrimidines. Synthesis 2012, 44, 1109−1118.
(4) Feng, B. Y.; Shelat, A.; Doman, T. N.; Guy, R. K.; Shoichet, B. K.
High-throughput assays for promiscuous inhibitors. Nat. Chem. Biol.
2005, 1, 146−148.
(28) Qing, M.; Zou, G.; Wang, Q.-Y.; Xu, H. Y.; Dong, H.; Yuan, Z.;
Shi, P.-Y. Characterization of dengue virus resistance to brequinar in
cell culture. Antimicrob. Agents Chemother. 2010, 54, 3686−3695.
(29) Hoffmann, H.-H.; Kunz, A.; Simon, V. A.; Palese, P.; Shaw, M.
L. Broad-spectrum antiviral that interferes with de novo pyrimidine
biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 2011, 108, 5777−5782.
(30) Bonavia, A.; Franti, M.; Keaney, E. P.; Kuhen, K.; Seepersaud,
M.; Radetica, B.; Shao, J.; Honda, A.; Dewhurst, J.; Balabanis, K.;
Monroe, J.; Wolff, K.; Osborne, C.; Lanieri, L.; Hoffmaster, K.; Amin,
A.; Markovits, J.; Broome, M.; Skuba, E.; Cornella-Taracido, I.;
Joberty, G.; Bouwmeester, T.; Hamann, L.; Tallarico, J. A.; Tommasi,
R.; Compton, T.; Bushell, S. M. Identification of broad-spectrum
antiviral compounds and assessment of the druggability of their target
for efficacy against respiratory syncytial virus (RSV). Proc. Natl. Acad.
Sci. U.S.A. 2011, 108, 6739−6744.
(5) Feng, B. Y.; Shoichet, B. K. A detergent-based assay for the
detection of promiscuous inhibitors. Nat. Protoc. 2006, 1, 550−553.
(6) Gentry, D. R.; Wilding, I.; Johnson, J. M.; Chen, D.; Remlinger,
K.; Richards, C.; Neill, S.; Zalacain, M.; Rittenhouse, S. F.; Gwynn, M.
N. A rapid microtiter plate assay for measuring the effect of
compounds on Staphylococcus aureus membrane potential. J. Microbiol.
Methods 2010, 83, 254−256.
(7) Baell, J. B.; Holloway, G. A. New substructure filters for removal
of pan assay interference compounds (PAINS) from screening libraries
and for their exclusion in bioassays. J. Med. Chem. 2010, 53, 2719−
2740.
(8) Baell, J.; Walters, M. A. Chemical con artists foil drug discovery.
Nature 2014, 513, 481−483.
(9) Lucas-Hourani, M.; Munier-Lehmann, H.; Helynck, O.;
Komarova, A.; Despres, P.; Tangy, F.; Vidalain, P. O. High-throughput
screening for broad-spectrum chemical inhibitors of RNA viruses. J.
Visualized Exp. 2013, 87, DOI: 10.3791/51222.
(10) Stanovik, E.; Svete, J. Product class 1: pyrazoles. In Science of
Synthesis; Neier, R., Ed.; Thieme: Stuttgart, Germany, 2002; Vol. 12,
pp 15−225.
(11) Varvounis, G.; Fiamegos, Y.; Pilidis, G. Pyrazol-3-ones, part 1:
synthesis and applications. In Advances in Heterocyclic Chemistry;
Katritzky, A. R., Ed.; Academic Press: San Diego, CA, 2001; Vol. 80,
pp 74−144.
(12) Coutant, E. P.; Janin, Y. L. A study of Negishi cross-coupling
reactions with benzylzinc halides to prepare original 3-ethoxypyrazoles.
Synthesis 2014, DOI: 10.1055/s-0034-1379458.
(13) Ermolenko, M. S.; Guillou, S.; Janin, Y. L. Pyrazole-3/5-
carboxylic acids from 3/5-trifluoromethyl NH-pyrazoles. Tetrahedron
2013, 69, 257−263.
(14) Salanouve, E.; Retailleau, P.; Janin, Y. L. Few unexpected results
from a Suzuki−Miyaura reaction. Tetrahedron 2012, 68, 2135−2140.
(15) Salanouve, E.; Guillou, S.; Bizouarne, M.; Bonhomme, F. J.;
Janin, Y. L. 3-Methoxypyrazoles from 1,1-dimethoxyethene, few
original results. Tetrahedron 2012, 68, 3165−3171.
(16) Guillou, S.; Bonhomme, F. J.; Ermolenko, M. S.; Janin, Y. L.
Simple preparations of 4 and 5-iodinated pyrazoles as useful building
blocks. Tetrahedron 2011, 67, 8451−8457.
(31) Wang, Q.-Y.; Bushell, S.; Qing, M.; Xu, H. A.; Bonavia, A.;
Nunes, S.; Zhou, J.; Poh, M. K.; Florez de Sessions, P.;
Niyomrattanakit, P.; Dong, H.; Hoffmaster, K.; Goh, A.; Nilar, S.;
Schul, W.; Jones, S.; Kramer, L.; Compton, T.; Shi, P.-Y. Inhibition of
dengue virus through suppression of host pyrimidine biosynthesis. J.
Virol. 2011, 6548−6556.
(32) Lucas-Hourani, M.; Dauzonne, D.; Jorda, P.; Cousin, G.; Lupan,
A.; Helynck, O.; Caignard, G.; Janvier, G.; Andre-
́
Leroux, G.; Khiar, S.;
Escriou, N.; Despres, P.; Jacob, Y.; Munier-Lehmann, H.; Tangy, F.;
̀
Vidalain, P. O. Inhibition of pyrimidine biosynthesis pathway
suppresses viral growth through innate immunity. PLoS Pathog.
2013, 9, e1003678.
(33) Marschall, M.; Niemann, I.; Kosulin, K.; Bootz, A.; Wagner, S.;
Dobner, T.; Herz, T.; Kramer, B.; Leban, J.; Vitt, D.; Stamminger, T.;
Hutterer, C.; Strobl, S. Assessment of drug candidates for broad-
spectrum antiviral therapy targeting cellular pyrimidine biosynthesis.
Antiviral Res. 2013, 100, 640−648.
(34) Jones, M. E. Pyrimidine nucleotide biosynthesis in animals:
genes, enzymes; regulation of UMP biosynthesis. Annu. Rev. Biochem.
1980, 49, 253−279.
(35) Evans, D. R.; Guy, H. I. Mammalian pyrimidine biosynthesis:
fresh insights into an ancient pathway. J. Biol. Chem. 2004, 279,
33035−33038.
(36) Coleman, P. F.; Suttle, D. P.; Stark, G. R. Purification from
hamster cells of the multifunctional protein that initiates de novo
synthesis of pyrimidine nucleotides. J. Biol. Chem. 1977, 252, 6379−
6385.
(37) Hsieh, H.-P.; Hsu, T.-A.; Yeh, J.-Y.; Chao, Y.-S. Quinoline
compounds and their use for treating viral infection. US 2011263620,
2011.
(38) Zhang, L.; Das, P.; Schmolke, M.; Manicassamy, B.; Wang, Y.;
Deng, X.; Cai, L.; Tu, B. P.; Forst, C. V.; Roth, M. G.; Levy, D. E.;
García-Sastre, A.; de Brabander, J.; Phillips, M. A.; Fontoura, B. M.
Inhibition of pyrimidine synthesis reverses viral virulence factor-
mediated block of mRNA nuclear export. J. Cell Biol. 2012, 196, 315−
326.
(17) Guillou, S.; Janin, Y. L. 5-Iodo-3-ethoxypyrazoles, an entry point
to new chemical entities. Chem.Eur. J. 2010, 16, 4669−4677.
(18) Guillou, S.; Bonhomme, F. J.; Chahine, D.; Nesme, O.; Janin, Y.
L. N-arylation of 3-alkoxypyrazoles, the case of the pyridines.
Tetrahedron 2010, 66, 2654−2663.
(19) Guillou, S.; Nesme, O.; Ermolenko, M. S.; Janin, Y. L. Carbon-4
arylation of 3-alkoxypyrazoles. Tetrahedron 2009, 65, 3529−3535.
(20) Guillou, S.; Bonhomme, F. J.; Janin, Y. L. Nitrogen’s reactivity of
various 3-alkoxypyrazoles. Tetrahedron 2009, 65, 2660−2668.
(21) Guillou, S.; Bonhomme, F. J.; Janin, Y. L. An improved
preparation of 3-alkoxypyrazoles. Synthesis 2008, 3504−3508.
(22) Navre, M. Why using pIC50 instead of IC50 will change your
life. https://www.collaborativedrug.com/buzz/2014/07/14/why-
using-pic50-instead-of-ic50-will-change-your-life/, 2014.
(23) Cristau, H. J.; Cellier, P. P.; Spindler, J. F.; Taillefer, M. Mild
conditions for copper-catalysed N-arylation of pyrazoles. Eur. J. Org.
Chem. 2004, No. 4, 695−709.
(39) Das, P.; Deng, X.; Zhang, L.; Roth, M. G.; Fontoura, B. M.;
Phillips, M. A.; De Brabander, J. K. SAR-based optimization of a 4-
quinoline carboxylic acid analogue with potent antiviral activity. ACS
Med. Chem. Lett. 2013, 4, 517−521.
(40) Munier-Lehmann, H.; Vidalain, P.-O.; Tangy, F.; Janin, Y. L. On
dihydroorotate dehydrogenases, their inhibitors and uses. J. Med.
Chem. 2013, 56, 3148−3167.
(24) Wacker, D. A.; Rossi, K. A.; Wang, Y. Pyridone GRP119 G
protein-coupled receptor agonist. US 20090023702, 2009.
Q
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
(41) Miller, R. W. Dihydroorotate-quinone reductase of Neurospora
crassa mitochondria. Arch. Biochem. Biophys. 1971, 146, 256−270.
(42) Miller, R. W. Dihydroorotate dehydrogenase (Neurospora).
Methods Enzymol. 1978, 51, 63−69.
(43) Karibian, D. Dihydroorotate dehydrogenase (Escherichia coli).
Methods Enzymol. 1978, 51, 58−63.
(44) Knecht, W.; Henseling, J.; Loffler, M. Kinetics of inhibition of
̈
human and rat dihydroorotate dehydrogenase by atovaquone, lawsone
derivatives, brequinar sodium and polyporic acid. Chem.-Biol. Interact.
2000, 124, 61−76.
(45) Knecht, W.; Bergjohann, U.; Gonski, S.; Kirschbaum, B.; Loffler,
̈
M. Functional expression of a fragment of human dihydroorotate
dehydrogenase by means of the baculovirus expression vector system,
and kinetic investigation of the purified recombinant enzyme. Eur. J.
Biochem. 1996, 240, 292−301.
(46) Knecht, W.; Loffler, M. Species-related inhibition of human and
̈
rat dihydroorotate dehydrogenase by immunosuppressive isoxazol and
cinchoninic acid derivatives. Biochem. Pharmacol. 1998, 56, 1259−
1264.
(47) Williamson, R. A.; Yea, C. M.; Robson, P. A.; Curnock, A. P.;
Gadher, S.; Hambleton, A. B.; Woodward, K.; Bruneau, J. M.;
Hambleton, P.; Moss, D.; Thomson, T. A.; Spinella-Jaegle, S.; Morand,
P.; Courtin, O.; Sautes, C.; Westwood, R.; Hercend, T.; Kuo, E. A.;
Ruuth, E. Dihydroorotate dehydrogenase is a high affinity binding
protein for A77 1726 and mediator of a range of biological effects of
the immunomodulatory compound. J. Biol. Chem. 1995, 270, 22467−
22472.
(48) Cherwinski, H. M.; Cohn, R. G.; Cheung, P.; Webster, D. J.; Xu,
Y. Z.; Caulfield, J. P.; Young, J. M.; Nakano, G.; Ransom, J. T. The
immunosuppressant leflunomide inhibits lymphocyte proliferation by
inhibiting pyrimidine biosynthesis. J. Pharmacol. Exp. Ther. 1995, 275,
1043−1049.
(49) Davis, J. P.; Cain, G. A.; Pitts, W. J.; Magolda, R. L.; Copeland,
R. A. The immunosuppressive metabolite of leflunomide is a potent
inhibitor of human dihydroorotate dehydrogenase. Biochemistry 1996,
35, 1270−1273.
(50) Bruneau, J. M.; Yea, C. M.; Spinella-Jaegle, S.; Fudali, S. C.;
̀
Woodward, K.; Robson, P. A.; Sautes, C.; Westwood, R.; Kuo, E. A.;
Williamson, R. A.; Ruuth, E. Purification of human dihydro-orotate
dehydrogenase and its inhibition by A77 1726, the active metabolite of
leflunomide. Biochem. J. 1998, 336, 299−303.
(51) Smee, D. F.; Hurst, B. L.; Day, C. W. D282, a non-nucleoside
inhibitor of influenca virus infection that interferes with de novo
pyrimidine biosynthesis. Antiviral Chem. Chemother. 2012, 22, 263−
272.
(52) Ortiz-Riano, E.; Ngo, N.; Devito, S.; Eggink, D.; Munger, J.;
̃
Shaw, M. L.; de la Torre, J. C.; Martínez-Sobrido, L. Inhibition of
arenavirus by A3, a pyrimidine biosynthesis inhibitor. J. Virol. 2014, 88,
878−889.
(53) Munier, H.; Gilles, A.-M.; Glaser, P.; Krin, E.; Danchin, A.;
̂
Sarfati, R. S.; Barzu, O. Isolation and characterization of catalytic and
calmodulin-binding domains of Bordetella pertussis adenylate cyclase.
Eur. J. Biochem. 1991, 196, 469−474.
(54) Cristau, H. J.; Cellier, P. P.; Hamada, S.; Spindler, J. F.; Taillefer,
M. A general and mild Ullmann-type synthesis of diaryl ethers. Org.
Lett. 2004, 6, 913−916.
(55) Kanaya, N.; Ishiyama, T.; Muto, R.; Ochiai, Y.; Watanabe, K.;
Shima, N. Amidopyrazole derivative. EP 1698626, 2004.
(56) South, M. S.; Hamme, A. T.; Neumann, W. L.; Jones, D. E.
Substituted polycyclic aryl and heteroaryl pyrimidinones useful for
selective inhibition of the coagulation cascade. US 6653316, 2003.
(57) Vanderhaeghe, H.; Claesen, M. Pyrimidines IV hydrazinopyr-
imidines. Bull. Soc. Chim. Belg. 1959, 68, 30−46.
R
DOI: 10.1021/jm501446r
J. Med. Chem. XXXX, XXX, XXX−XXX