Quinazolinone linked pyrrolo[2,1-c][1,4]benzodiazepine (PBD) conjugates: Design, synthesis and biological evaluation as potential anticancer agents

Article abstract of DOI:10.1016/j.bmc.2009.12.015

A series of novel quinazolinone linked pyrrolobenzodiazepine (PBD) conjugates were synthesized. These compounds 4a-f and 5a-f were prepared in good yields by linking C-8 of DC-81 with quinazolinone moiety through different alkane spacers. These conjugates were tested for anticancer activity against 11 human cancer cell lines and found to be very potent anticancer agents with GI₅₀ values in the range of <0.1-26.2 μM. Among all the PBD conjugates, one of the conjugate 5c was tested against a panel of 60 human cancer cells. This compound showed activity for individual cancer cell lines with GI₅₀ values of <0.1 μM. The thermal denaturation studies exhibited effective DNA binding ability compared to DC-81 and these results are further supported by molecular modeling studies. The detailed biological aspects of these conjugates on A375 cell line were studied. It was observed that compounds 4b and 5c induced the release of cytochrome c, activation of caspase-3, cleavage of PARP and subsequent cell death. Further, these compounds when treated with A375 cells showed the characteristic features of apoptosis like enhancement in the levels of p53, p21 and p27 inhibition of cyclin dependent kinase-2 (CDK2) and suppression of NF-κB. Moreover, these two compounds 4b and 5c control the cell proliferation by regulating anti-apoptotic genes like (B-cell lymphoma 2) Bcl-2. Therefore, the data generated suggests that these PBD conjugates activate p53 and inhibit NF-κB and thereby these compounds could be promising anticancer agents with better therapeutic potential for the suppression of tumours.

Full text of DOI:10.1016/j.bmc.2009.12.015

Bioorganic & Medicinal Chemistry 18 (2010) 526–542
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Quinazolinone linked pyrrolo[2,1-c][1,4]benzodiazepine (PBD) conjugates:
Design, synthesis and biological evaluation as potential anticancer agents
a
a
a
a
Ahmed Kamal a, , E. Vijaya Bharathi , M. Janaki Ramaiah , D. Dastagiri , J. Surendranadha Reddy ,
*
A. Viswanath a, Farheen Sultana a, S. N. C. V. L. Pushpavalli a, Manika Pal-Bhadra a,
,
*
Hemant Kumar Srivastava b, G. Narahari Sastry b, , Aarti Juvekar , Subrata Sen , Surekha Zingde
c
c
c
*
a Chemical Biology Laboratory, Indian Institute of Chemical Technology, Tarnaka, Hyderabad 500 607, India
b Molecular Modeling Group, Division of Organic Chemistry, Indian Institute of Chemical Technology, Tarnaka, Hyderabad 500 607, India
c Advanced Centre for Treatment, Research and Education in Cancer, Navi Mumbai, India
a r t i c l e i n f o
a b s t r a c t
Article history:
A series of novel quinazolinone linked pyrrolobenzodiazepine (PBD) conjugates were synthesized. These
compounds 4a–f and 5a–f were prepared in good yields by linking C-8 of DC-81 with quinazolinone
moiety through different alkane spacers. These conjugates were tested for anticancer activity against
11 human cancer cell lines and found to be very potent anticancer agents with GI50 values in the range
Received 5 October 2009
Revised 3 December 2009
Accepted 4 December 2009
Available online 11 December 2009
of <0.1–26.2
human cancer cells. This compound showed activity for individual cancer cell lines with GI50 values of
<0.1 M. The thermal denaturation studies exhibited effective DNA binding ability compared to DC-81
lM. Among all the PBD conjugates, one of the conjugate 5c was tested against a panel of 60
Keywords:
l
Pyrrolobenzodiazepine
Quinazolinone
DNA binding affinity
Anticancer activity
Molecular modeling
Molecular dynamics
Apoptosis
p53
p21
p27
NF-
jB
and these results are further supported by molecular modeling studies. The detailed biological aspects
of these conjugates on A375 cell line were studied. It was observed that compounds 4b and 5c induced
the release of cytochrome c, activation of caspase-3, cleavage of PARP and subsequent cell death. Further,
these compounds when treated with A375 cells showed the characteristic features of apoptosis like
enhancement in the levels of p53, p21 and p27 inhibition of cyclin dependent kinase-2 (CDK2) and sup-
pression of NF-
anti-apoptotic genes like (B-cell lymphoma 2) Bcl-2. Therefore, the data generated suggests that these
PBD conjugates activate p53 and inhibit NF- B and thereby these compounds could be promising anti-
cancer agents with better therapeutic potential for the suppression of tumours.
Ó 2009 Elsevier Ltd. All rights reserved.
jB. Moreover, these two compounds 4b and 5c control the cell proliferation by regulating
j
Cytochrome-c
B-cell lymphoma 2 (Bcl-2)
Cyclin dependent kinase-2 (CDK-2)
Active caspase-3
Poly (ADP-ribose) polymerase (PARP)
1. Introduction
pharmacologically active compounds because they are associated
with inhibitory effects on tubulin polymerization.7–9 Moreover,
the quinazolinone moiety has been extensively utilized as a
drug-like scaffold in medicinal chemistry, and as such, the quinaz-
olinone skeleton is considered to be a privileged structure. Further,
2-methyl quinazolinones act as inhibitors of DNA repair enzyme
poly (ADP-ribose) polymerase (PARP).10 Therapeutic agents con-
taining the quinazolinone core structure are in the market or are
in clinical trials for the treatment of cancer.
Similarly, pyrrolo[2,1-c][1,4]benzodiazepines (PBDs) are natu-
rally occurring DNA interactive antitumor antibiotics isolated from
various Streptomyces species. The PBD cytotoxins exert a powerful
antitumoural activity by binding in the minor groove of double
stranded DNA and forming a covalent bond to the exocyclic amino
group of a central guanine within a three base pair recognition
site.11–13 Some representative members of the quinazolinones,
DC-81 and its conjugates are illustrated in Figure 1.
In recent years, combination chemotherapy with different
mechanisms of action is one of the methods that are being adopted
to treat cancer. Therefore, a single molecule containing more than
one pharmacophore, each with different mode of action could be
beneficial for the treatment of cancer. Quinazolinone is a naturally
occurring alkaloid and found in a variety of bioactive natural
products. In addition to a wide range of biological activities,1–6
cytotoxicity is a frequently found property in several members of
quinazolinones. Among the various classes of quinazolinones,
2-styryl substituted derivatives form an important component of
* Corresponding authors. Tel.: +91 40 27193157; fax: +91 40 27193189 (A.K.);
tel.: +91 40 27193236 (M.P.B.).
E-mail addresses: ahmedkamal@iict.res.in (A. Kamal), manika@iict.res.in
(M. Pal-Bhadra).
0968-0896/$ - see front matter Ó 2009 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2009.12.015

A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
527
In the past few years, several hybrid compounds, in which
known antitumour agents tethered to PBD moiety, have been
designed, synthesized and evaluated for their biological activ-
ity.14–18 Recently Wang and co-workers have synthesized DC-81-
indole conjugates and DC-81-enediyne conjugates as potential
anticancer agents and a correlation between antitumor activity
and apoptosis has been well explained in these conjugates.19,20
For the last few years, we have been involved in the development
of new synthetic strategies21–23 for the preparation of PBD ring sys-
tem and also in the design as well as synthesis of structurally mod-
ified PBDs and their conjugates.24–29
In continuation of these efforts it has been considered of inter-
est to design and synthesize hybrid molecules in which the PBD
ring system is linked to the quinazolinone moiety with different
alkane spacers. Moreover, such a moiety could enhance the DNA-
binding ability as well as improve the bioavailability upon
attaching this to the PBD ring system. Initially DNA binding ability,
molecular modeling studies and in vitro cytotoxicity has been
carried out for these new PBD conjugates. The promising activity
obtained, prompted us to investigate their role in the cell prolifer-
ation and apoptosis by using the human melanoma cell line A375.
In this context some biological assays have been carried out for
studying the compound induced cell cycle distribution and levels
of cell cycle control proteins (p53, p27 and p21). Moreover, apop-
nilic acid 10 with acetic anhydride to afford the desired
benzoxazinones 7 and 11, respectively in quantitative yields.30
After evaporation of the excess of anhydride under reduced pres-
sure, the crude product was used without any further purification.
Compound 7 was coupled to substituted anilines to give com-
pounds 8a–e, which upon etherification by employing dibromo al-
kanes provided the compounds 9a–f as shown in Scheme 1. The
other types of quinazolinones were obtained by reaction of com-
pound 11 with 4-aminophenol to afford compound 12,31 which
upon etherification by employing dibromo alkanes provided the
compounds 13a–c. Compounds 14a–c32 were prepared by employ-
ing benzaldehyde and 13a–c as shown in Scheme 2.
The synthesis of C8-linked quinazolinone-PBD conjugates (4a–f
and 5a–f) was carried out from the (2S)-N-[4-hydroxy-5-meth-
oxy-2-nitrobenzoyl]pyrrolidine-2-carboxaldehyde diethyl thioac-
etal 15 which was prepared by the methods reported in our earlier
studies.21–29 Compound 15 on etherification with quinazolinone
precursors (9a–f, 13a–c and 14a–c) using K2CO3 in acetone provided
the corresponding nitro thioacetals (16a–f and 17a–f). Further,
reduction of nitro compounds by using SnCl2ꢀ2H2O in methanol fol-
lowed by deprotection employing HgCl2/CaCO3 afforded the desired
PBD conjugates (4a–f and 5a–f) as shown in Scheme 3.
2.2. Biological activity
tosis associated active caspase-3, PARP, cytochrome c and NF-jB
inhibition has also been carried out in order to understand the
underlying mechanisms and pathways involved. Further, studies
on anti-apoptotic genes like Bcl-2 which in turn prevents mito-
chondrial protein (cytochrome c) release have been investigated.
The data obtained clearly suggests that these PBD conjugates are
potential anticancer agents that follow a mitochondrial mediated
intrinsic pathway involving anti-apoptotic genes like Bcl-2.
2.2.1. DNA interaction: thermal denaturation studies
DNA-binding ability of these PBD conjugates (4a–f and 5a–f)
was investigated by thermal denaturation studies using calf thy-
mus (CT) DNA. Melting studies showed that these compounds sta-
bilize the thermal helix coil or melting stabilization for the CT-DNA
duplex at pH 7.0, and incubated at 37 °C with DNA/ligand molar ra-
tio of 5:1. The increase in the helix melting temperature (DTm) for
each compound was examined at 0 h and 18 h incubation at 37 °C.
Interestingly, all the compounds 4a–f and 5a–f elevated the helix
melting temperature of CT-DNA in the range of 1.0–2.3 °C. All the
2. Results and discussion
2.1. Chemistry
compounds 4a–f and 5a–f had shown
DTm ranges from 1.0 to
1.2 °C at 0 h and increased up to 2.0–2.3 °C after 18 h incubation.
Moreover, the naturally occurring PBD like DC-81 (3) exhibited a
The synthesis of the quinazolinone derivatives 9a–f, 13a–c and
14a–c is outlined in Schemes 1 and 2. The first synthetic step in-
volved the condensation of 5-hydroxy anthranilic acid 6 or anthra-
D
Tm of 0.7 °C under similar experimental conditions as illustrated
in Table 1.
O
O
NH
N
HO
H
N
NH
N
OCH3
N
H3CO
N
1
2
O
(3, DC-81)
Y
Z
X
N
O
N
N
O
( )
O
H
H
n
N
N
H3CO
4a
−f
O
N
( )
O
O
O
N
n
N
H3CO
O
R
5a−f
Figure 1. Structures of styryl quinzolinone (1), phenyl quinazolinone (2), DC-81 (3), and quinazolinone-PBD conjugates (4a–f and 5a–f).

528
A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
Y
X
N
Z
O
O
O
HO
HO
HO
OH
NH2
(ii)
O
(i)
N
8a−e
N
6
7
8a: X = H, Y = H, Z= F
8b: X = H, Y = Cl, Z = F
8c: X = Cl, Y = H, Z = Cl
(iii)
8d: X = CH3, Y = H, Z = iodo
8e: X = H, Y = H, Z= OCH3
Y
X
N
Z
O
9a: X = H, Y = H, Z= F,
9b: X = H, Y = Cl, Z = F,
n = 3
n = 3
Br
O
( )
9c: X = Cl, Y = H, Z = Cl, n = 2
9d: X = CH3, Y = H, Z = iodo, n = 2
9e: X = CH3, Y = H, Z = iodo, n = 3
n
N
9a−f
9f:
X = H, Y = H, Z= OCH3, n = 3
Scheme 1. Reagents and conditions: (i) (CH3CO)2O, 160–180 °C, 1 h; (ii) substituted anilines, 180 °C, 2 h, 80–86%; (iii) dibromoalkanes, K2CO3, acetone, reflux, 24 h, 80–88%.
OH
O
O
N
O
N
OH
(ii)
O
(i)
N
NH2
10
11
12
(iii)
O
Br
O
Br
( )
( )
O
O
N
n
n
N
N
(iv)
N
14a−c
13a−c
n = 1−3
Scheme 2. Reagents and conditions: (i) (CH3CO)2O, 160–180 °C, 1 h; (ii) 4-amino phenol, 180 °C, 2 h; (iii) dibromo alkanes, K2CO3, acetone, 80 °C, 24 h, 85–90%; (iv)
benzaldehyde, glacial acetic acid, 120 °C, 12 h, 80–82%.
2.2.2. Molecular modeling studies
2.2.3. Molecular dynamics simulation
The melting temperature study indicated that PBD conjugates
possess DNA binding affinity, it is considered worthwhile to ratio-
nalize this data. Hence molecular modeling study was estimated
by carrying out docking calculation. The dependence of docking
score in the type of DNA motif employed was tested by taking
about nine different DNA model sequences (A–I).33,34 These studies
are helpful to identify the suitable DNA sequence to be employed.
The results of Supplementary Table S1 revealed that DNA sequence
B (50-CGCAGAAAATTTCTGCG-30) was the best among all the se-
Considering all the compounds with almost same DTm values,
we performed molecular dynamics (MD) simulation of three com-
pounds, the ones with highest and lowest GOLD score 5c and 5b,
respectively, and the one with highest GI50 value 4b, to rigorously
evaluate the dynamic nature of the complexes. MD simulation is
a single-molecule atomistic in-silico technique limited by the
1–100+ ns simulation time scale and quality of the force fields.
The AMBER force field provides a balanced description of base stack-
ing and base pairing so we used AMBER 8.036 for the MD simulations.
We used ‘xmgrace’ program to make graphs after MD production
run. Supplementary Figure S1.Ia and Supplementary Figure S1.Ib
is the graph between root mean square deviation (RMSD) versus
time of DNA and ligand, respectively in MD production run. It
was clear that the docked conformation of compound 5c is stable
till 2.5 ns MD simulation and after that RMSD increased, although
it remains close to 3 Å till 5 ns MD simulation as shown in Supple-
mentary Figure S1.IIIa and Supplementary Figure S1.IIIb. The com-
pound with lowest GOLD score (5b) showed the highest variation in
RMSDs (Supplementary Fig. S1.IIa for DNA and Supplementary
Fig. S1.IIb for ligand) which is according to our expectations. In this
case the DNA was also showing higher variation in RMSDs during
MD simulation and RMSD of ligand is more than 4.0 Å. The snap-
shots of these two MD runs (Supplementary Fig. S1) showed that
quences employed. As the
DTm values are very similar, we expect
that the binding fitness scores are comparable. Encouragingly, all
the fitnesses scores spanned in a very narrow range, which was
in good agreement with the experimental observation. Sequence
B was chosen as it seem to provide more reliable results in the ear-
lier studies carried out by us. We used GOLD 3.2 program35 for the
docking studies. Although straightforward comparisons are not
reliable between the docking score and experimental
DTm values,
the docked poses provide the orientation of the ligand binding to
DNA and confirm that they are indeed minor groove binders as
shown in Figure 2. Further, the modeling results reveal that the
nature of interaction of these compounds is non-intercalative. Thus
the interaction is based on hydrogen bonding, Van der Waals con-
tacts, hydrophobic effects and electrostatic effects.

A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
529
Y
Z
X
N
O
N
(i)
NO2
O
O
( )
CH(SEt)2
9a−f
n
N
H3CO
16a
O
−f
Y
(ii),(iii)
Z
X
N
O
N
N
O
O
( )
n
H
N
NO2
HO
CH(SEt)2
H3CO
4a−f
O
N
H3CO
4a: X = H, Y = H, Z = F,
4b: X = H, Y = Cl, Z = F,
4c: X = Cl, Y = H, Z = Cl,
n = 3
n = 3
n = 2
O
15
4d: X = CH3, Y = H, Z = iodo, n = 2
4e: X = CH3, Y = H, Z = iodo, n = 3
4f: X = H, Y = H, Z =OCH3, n = 3
NO2
O
O
( )
CH(SEt)2
O
N
n
N
N
H3CO
17a
(i)
O
−f
R
13a
−
c
(ii),(iii)
and
14a−
c
N
O
O
( )
n
H
O
N
N
H3CO
O
5a−f
N
R
5a: R= Methyl, n = 1
5b: R= Methyl, n = 2
5c: R= Methyl, n = 3
5d: R= Styryl, n = 1
5e: R= Styryl, n = 2
5f: R= Styryl, n = 3
Scheme 3. Reagents and conditions: (i) K2CO3, dry acetone, reflux, 24 h, 80–88%; (ii) SnCl2ꢀ2H2O, CH3OH, reflux, 6 h; (iii) HgCl2, CaCO3, CH3CN–H2O, (4:1), 12 h, 55–58%.
the part of ligand is going out from minor-groove after 2.5 ns MD
simulation but in the later case it completely moved out of the
groove indicating that the lowest score prediction of GOLD is valu-
able. The interesting results were found in the case of compound
4b. The RMSD values of this MD run (Supplementary Fig. S1.Ia for
DNA and Supplementary Fig. S1.Ib for ligand) clearly showed that
this compound is strongly bound to the minor-groove of DNA
and 5 ns MD simulation run did not affect the stability of docked
pose. The snapshots of this MD run confirmed the strong binding
ability of the compound to DNA minor-groove as shown in Figure
3. The GOLD score of this compound was also high. In principle, inter-
action energy is a promising approach to estimate interactions of
ligands to macromolecules. The energy of interaction (Eint) be-
Table 1
Thermal denaturation data for PBD conjugates (4a–f and 5a–f) with calf thymus (CT)-
DNA
[PBD]:[DNA] molar ratiob
D
Tm (°C) after incubation
at 37 °C for
a
Compound
0 h
18 h
4a
4b
4c
4d
4e
4f
5a
5b
5c
5d
5e
5f
1:5
1:5
1:5
1:5
1:5
1:5
1:5
1:5
1:5
1:5
1:5
1:5
1:5
1.2
1.0
1.1
1.0
1.0
1.1
1.0
1.0
1.1
1.0
1.2
1.1
0.3
2.2
2.3
2.3
2.0
2.1
2.2
2.0
2.1
2.3
2.0
2.3
2.0
0.7
tween the DNA and the PBD molecule in
a complex was
calculated as a measure of stability of that complex as shown in
Table 2. Poisson–Boltzmann (PB) continuum electrostatic model
was used for the calculation on interaction energies in which the
influence of the solvent was incorporated implicitly.37,38 It was
very clear from the negative interaction energies that all the
docked complexes are favorable and stable. Further compound
4b, which possesses experimentally highest activity, showed the
highest interaction energy while the compound 5b which had the
DC-81 (3)
a
For CT-DNA alone at pH 7.00 0.01,
separate determinations), all Tm values are 0.1–0.2 °C.
For a 1:5 molar ratio of [PBD]/[DNA], where CT-DNA concentration = 100
and ligand concentration = 20 M in aqueous sodium phosphate buffer [10 mM
sodium phosphate + 1 mM EDTA, pH 7.00 0.01].
DTm = 68.5 °C 0.01 (mean value from 10
D
b
lM
l

530
A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
shown in Table 3. The mean GI50 value for the compound 5c is
0.27 M, which exhibited an interesting profile of activity for var-
l
ious cell lines, indicating that this compound 5c had the potent
broad-spectrum anticancer activity. The promising activity shown
by compound 5c prompted us to evaluate the anticancer activity of
the other analogues (4a–f, 5a, 5b, and 5d–f) in selected human
cancer cell lines of breast, cervix, lung, colon, oral, ovarian and
prostate by using Sulforhodamine B (SRB) method. The compounds
exhibiting GI50 610ꢁ5
lM are considered to be active on the
respective cell lines. Table 4 reveals that compounds 4a–f, 5a, 5b,
and 5d–f exhibited anticancer activity with GI50 values ranging
from <0.1 to 26.2
demonstrated highly significant activity with the GI50 in the range
from 0.10 to 7.25 M and for DC-81 the GI50 ranged from 0.10 to
2.37 M. SAR (structure–activity relationship) was examined for
lM. The positive control compound adriamycin
l
l
the effect of substituents on N-3 phenyl ring of quinazolinone moi-
ety. Compound 4a bearing fluorine at position 4 of N-3 phenyl ring
showed good anticancer activity against all the 11 human cancer
cell lines. Replacement of fluorine with methoxy group increased
the anticancer activity in compound 4f particularly for MCF7 and
GURAV cell lines. By introducing chlorine at position 3 of N-3 phe-
nyl ring, in compound 4b, the anticancer activity increased partic-
ularly for MCF7 and GURAV cell lines with GI50 values of <0.1 lM.
Introducing two chlorines at 2 and 4 positions in compound 4c
slightly decreased the activity. Further replacement of chlorines
at positions 2 and 4 with iodine and methyl affected a slight in-
crease in the activity in compounds 4d and 4e. Similarly, we ob-
served the effect of substituents at position-2 of quinazolinone
moiety. Compounds 5a–c substituted by a methyl group at the 2
position of quinazolinone ring exhibited more activity. Replace-
ment of 2-methyl group with a styryl group in quinazolinone ring
system decreased the activity in compounds 5d–f. Hence it is as-
sumed that the methyl substitution at position 2 of the quinazoli-
none ring could play an important role in increasing the anticancer
activity. Further, the PBD conjugates with odd number of alkyl
spacers (n = 3 and 5) exhibited more activity than their counterpart
with an even number of alkyl spacers (n = 4). The significant anti-
cancer activity showed by the two promising compounds 4b and
5c prompted us to evaluate the cell viability of A375 cells, as these
A375 cancerous cells are selected to carry out the further biological
assays because of their resistance to radio and chemotherapy. The
cell viability of these drugs is calculated as the percentage of viable
drug treated cells compared with untreated cells. The cell viability
of A375 cells was 58.72% and 49.01% in case of compounds 4b and
5c, respectively. Amongst both these series of conjugates, 5c was
found to be the most effective one as shown in Supplementary
Figure S2.
Figure 2. Docked pose of 5c in the minor-groove of sequence-B of DNA.
2.2.5. Cell cycle effects
To investigate the effect of quinazolinone-PBD conjugates on
the cell cycle progression of human cancerous cell line A375,
the DNA content of the cell nuclei was measured by flow cyto-
metric (FACS) analysis. Drug induced hypodiploid DNA (i.e., sub-
G1 phase) is the characteristic feature of apoptosis. The majority
of the control cells exposed to DMSO were in the G1 phase. Cells
(5.61%) were in G0, 60.65% in G1, 15.67% in S and 18.07% in G2/M
phase. Treatment of A375 cells with the most promising com-
lowest GOLD score also had the lowest interaction energy. Com-
pound 5c which had the highest GOLD score had higher interaction
energy. Irrespective of the ligand and the simulation conditions this
compound (5c) remains bound to the DNA near the preferential
binding position in aqueous conditions and did not experience sub-
stantial fluctuations with respect to their initial placements in the
minor groove. Docking, interaction energy calculation and varia-
tions in RMSDs obtained in the molecular dynamics simulations
further validate the experimental observations apart from showing
the site of interaction of the ligand with DNA.
pounds 4b and 5c at 4
lM concentration for 24 h induced apop-
tosis effects up to 24.1%, 31.52%, respectively, of sub-G1 DNA
peak. Simultaneously there was a concomitant decrease in the
G2/M phase in A375 cells when treated with 4b (11.92%) and
5c (9.15%) compounds. Increased cells of sub-G1 phase, decrease
of G2/M phase cells clearly showed that all the compounds are
effective in causing apoptosis in case of A375 cells as shown in
Figure 4a and b.
2.2.4. In vitro cytotoxic activity
The anticancer activity of compound 5c (NSC: 744332) was
evaluated against sixty human cancer cell lines derived from nine
cancer cell types at the National Cancer Institute, Bethesda as

A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
531
Figure 3. Snapshots of DNA–ligand complexes at different times.
dent apoptotic pathway, the cells were treated with compounds
4b and 5c at a concentration of 4 M for 24 h and the cell lysate
Table 2
Interaction energies (kcal/mol) calculated by Poisson–Boltzmann (PB) method for
DNA–ligand complexes
l
was used for western blot analysis using p53 and p27 specific anti-
bodies. It was observed that both the p53 and p27 levels were
upregulated in the case of compounds 4b and 5c compared to
the untreated controls. Interestingly, increase of both p53 and
p27 protein levels were more prominent in compound 5c as shown
in Figure 5.
Complex
IE/PB
DTm
DNA-4b
DNA-5b
DNA-5c
ꢁ126.35
ꢁ48.59
ꢁ90.03
2.3
2.1
2.3
2.2.6. Effect on p53 and p27 protein expressions
2.2.7. Effect on p21 mRNA levels
Activation of tumor suppressor genes such as p53 and p27 is
found to be important in the regulation of apoptotic pathway in-
duced by various stimuli.39 The p53 gene, is a tumor suppressor
gene, that is, its activity stops the formation of tumors. It exerts
antiproliferative effect through its ability to function as a se-
quence-specific DNA-binding transcription factor. In order to
understand the exploit of PBD conjugates on p53 and p27 depen-
Most of the biochemical and genetic studies indicate that p21
acts as a master effector of multiple tumour suppressor pathways
for anti-proliferation, which are independent of classical p53 tu-
mour suppressor pathway.40,41 Binding of p21 inhibits the kinase
activity of cyclin dependent kinases, CDK1 and CDK2 resulting in
growth arrest at specific stages of cell cycle. Hence it was consid-
ered of interest to test whether the PBD conjugates 4b and 5c could

532
A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
Table 3
Chain Reaction (RT-PCR) was carried out using p21 and GAPDH
(internal or loading control) specific primers. As shown in Figure
6, an increased level of p21 transcript especially when treated with
compound 5c was observed indicating the suppression of genes
that are important for cell cycle progression.
In vitro anticancer activity of compound 5c in selected cancer cell linesa
Cancer panels/cell lines
GI50
(l
M)
Cancer panels/cell lines
GI50
(
lM)
Leukemia
CCRF-CEM
HL-60(TB)
K-562
MOLT-4
RPMI-8226
SR
Ovarian
0.16
0.18
0.06
0.19
0.19
0.11
IGROV1
0.18
0.20
0.37
0.33
0.34
0.43
OVCAR-3
OVCAR-4
OVCAR-5
OVCAR-8
SK-OV-3
2.2.8. Effect on cell cycle proteins
Cell cycle progression is regulated by cyclin dependent kinases
(CDKs) that are activated by the binding of cyclins such as cyclin A,
B, C and D and inhibited by CDK inhibitors. CDK inhibitors like
p21cip1, p27kip1 and p57kip2 have opposite effects on the func-
tions mediated by CDK. p27Kip1 and p21Cip1 are thought to sup-
press tumor growth and prevent cell cycle progression by
inhibiting Cdk2-cyclin E/A kinases. Sequestering of p27 from the
cyclin E/CDK2 complex can favour the progression from G1 to S
phase. The progression from G1 to S phase is mediated by cyclin
E/CDK2 and is crucial for cell cycle progression. Since we observed
an increased level of p21, it was considered of interest to know the
levels of CDK2 upon treatment with these PBD conjugates (4b and
Non-small cell lung
A549/ATCC
EKVX
HOP-92
NCI-H226
NCI-H23
NCI-H322 M
NCI-H460
NCI-H522
Renal
0.23
0.87
0.35
0.16
0.23
0.26
0.20
0.12
786-0
A498
0.17
0.16
0.29
0.19
0.21
0.24
0.31
0.36
ACHN
CAKI-1
RXF 393
SN12C
TK-10
UO-31
Colon
Breast
COLO 205
HCC-2998
HCT-116
HCT-15
HT29
0.18
0.26
0.15
1.09
0.26
0.17
0.16
MCF7
0.17
1.73
0.17
0.16
0.16
0.11
0.17
0.16
NCI/ADR-RES
MDA-MB-231/ATCC
HS 578T
MDA-MB-435
BT-549
5c) at 4 lM concentration for 24 h. The CDK2 level upon treating
the A375 cells was decreased in case of 5c as shown in Figure 7
indicating a G1 arrest.
KM12
SW-620
T-47D
MDA-MB-468
2.2.9. Effect on NF-
Suppression of NF-
totic response, which is a prerequisite in the selection of drugs for
treatment of cancer.42,43 NF-
B is a heterodimer of two subunits
(p50 and p65). To confirm whether these PBD conjugates (4b and
5c) could suppress the NF- B activity, A375 cells were treated with
M concentration for 24 h. The cell lysates were collected and
western blot analysis was carried out using p65 antibody. A
reduction of NF- B (p65) was observed upon treatment of A375
cells with the compounds 4b and 5c compared to untreated cells.
The present study revealed that decrease in NF- B expression
was more pronounced in case of 5c indicating its involvement in
NF- B pathway for activation of apoptotic response as shown in
j
B activity
j
B activity is required for induction of apop-
CNS
Prostate
PC-3
DU-145
SF-268
SF-539
SNB-19
SNB-75
U251
0.26
0.22
0.28
0.38
0.16
0.29
0.26
j
j
4
l
Melanoma
LOX IMVI
MALME-3M
M14
Melanoma
SK-MEL-28
SK-MEL-5
UACC-257
UACC-62
0.15
0.23
0.17
0.42
0.20
0.16
0.39
0.16
j
j
SK-MEL-2
Meanb
0.27
j
a
Data obtained from NCI’s in vitro anticancer activity cells screen.
Mean values over 60 cell lines tested.
Figure 8.
b
2.2.10. Effect on cytochrome c
act on p21. RNA was isolated from A375 cells treated with 4
compounds 4b and 5c and Reverse Transcription-Polymerase
l
M of
An important consequence of intrinsic apoptotic pathway is the
mitochondrial dysfunction and cytochrome c release.44 Cytosolic
Table 4
GI50 values (in
l
M) for compounds 4a–f, 5a, 5b and 5d–f in selected human cancer cell linesa
Compound
MCF7b
Zr-75–1b
A549c
HOP62c
SiHad
Colo205e
KBf
GURAVf
DWDf
PC3g
A2780h
4a
4b
4c
4d
4e
4f
5a
5b
0.15
<0.1
0.14
0.12
0.11
<0.1
1.83
2.30
2.03
NA
0.16
0.15
0.17
0.16
0.16
0.15
0.15
0.17
0.16
0.16
0.15
1.79
2.37
0.13
0.13
0.18
0.17
0.16
0.14
1.48
1.93
1.88
2.39
26.2
7.25
0.16
0.18
0.14
0.18
0.17
0.16
0.18
0.16
1.95
2.15
2.33
2.31
0.14
0.15
0.19
0.17
0.18
0.18
0.17
0.18
0.16
1.90
2.00
2.19
2.08
0.17
0.17
0.15
0.13
0.17
0.17
0.16
0.14
0.14
1.81
2.12
2.23
2.00
0.14
0.11
0.15
0.15
0.16
0.15
0.15
0.16
0.15
1.98
1.78
2.07
2.15
0.17
0.17
0.13
<0.1
0.17
0.17
0.16
<0.1
0.13
1.95
1.85
1.93
1.82
0.17
0.16
0.15
0.13
0.15
0.15
0.13
0.13
0.11
1.60
0.14
0.16
0.17
0.10
1.49
0.17
0.17
0.18
0.17
0.16
0.17
0.13
0.17
0.16
1.91
1.83
1.81
0.20
0.14
0.11
0.15
0.15
0.14
0.14
0.10
1.65
0.14
0.16
0.15
0.16
0.14
5d
5e
5f
2.50
0.17
0.17
ADRi
DC-81(3)
a
50% Growth inhibition and the values are mean of three determinations.
b
c
d
e
f
Breast cancer.
Lung cancer.
Cervix cancer.
Colon cancer.
Oral cancer.
Prostate cancer.
Ovarian cancer.
Adriamycin.
g
h
i

A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
533
Figure 7. Effect of PBD conjugates on cyclin dependent kinase-2 (CDK2) protein
levels. A375 were treated with 4 M concentration of quinazolinones for 24 h. The
l
cell lysates were collected and western blot analysis was carried out using CDK2
specific antibody. (C) Control (untreated), (C+D) control (untreated) + DMSO.
b-Tubulin was used as internal protein loading control.
Figure 8. Effect on NF-
PBD conjugates for 24 h. The cell lysates were collected and observed for the NF-
protein levels using NF- B (p65) specific antibody. (C) control (untreated), (C+D)
control (untreated) + DMSO. b-Actin was used as loading control.
jB activation. Cells were treated with 4 lM concentration of
jB
j
cytochrome c is known to cause activation of caspase-3.45 To inves-
tigate the effect on cytochrome c, A375 cells were treated with PBD
conjugates (4b and 5c) at 4 lM concentration for 24 h and ob-
served that there was increase in cytochrome c protein levels.
The enhancement in cytochrome c level was prominent in case of
compound 5c indicating its role in apoptosis through the involve-
ment of mitochondrial pathway as shown in Figure 9.
2.2.11. Effect on anti-apoptotic genes (Bcl-2)
Bcl-2 family of proteins precisely regulates the protein release
from mitochondria. This family is divided into two subgroups;
pro-apoptotic members and anti-apoptotic members. The anti-
apoptotic members like Bcl-2 prevent mitochondrial protein re-
lease.46,47 As we observed an increase in cytosolic cytochrome c,
it was expected a decrease in the levels of anti-apopototic factors.
Figure 4. (a and b) Flow cytometric analysis of cell cycle distribution on A375 after
exposure to PBD conjugates at
analysis.
4 lM concentration for 24 h before cell cycle
Hence we treated A375 cells with 4 lM of the PBD conjugates (4b
and 5c) for 24 h. RNA was isolated and a RT-PCR was carried out
with Bcl-2 (anti-apopotitic gene) specific primers to compare the
transcript levels in the treated and untreated cells. GAPDH was
used as internal or loading control. As expected we observed a
prominent decrease in the expression of mRNA levels of anti-apop-
totic gene, Bcl-2 in both the compounds 4b and 5c. This study con-
firmed that these PBD conjugates control cell proliferation by
regulating the anti-apoptotic genes as shown in Figure 10.
Figure 5. Effect on p53 and p27 protein expression. Cells were treated with 4 lM
concentration of PBD conjugates for 24 h. The cell lysates were collected and
western blot analysis was carried out using p53 and p27 specific antibody. (C)
Control (untreated), (C+D) control (untreated) + DMSO. b-Actin was used as internal
loading control.
2.2.12. Effect on activation of caspase-3 and cleavage of PARP
One of the important characteristic features of apoptosis is the
degradation of procaspase-3 to active caspase-3 and cleavage of
DNA repair enzyme PARP by caspase-3.48 Cytosolic cytochrome c
is known to cause activation of caspase-3.45 As we observed
tremendous increase in cytosolic cytochrome c, it was expected
Figure 6. Expression of p21 mRNA levels in PBD conjugates treated cells by RT-PCR
Figure 9. Effect on cytochrome c release from mitochondria. A375 cells were
studies. A375 cells were exposed to 4 lM concentration of PBD conjugates for 24 h.
exposed to 4
lM concentration PBD conjugates for 24 h and cell lysates were
RNA was extracted and RT-PCR was carried out using p21 specific primers and
GAPDH was used as internal loading control. (C) Untreated cells, (C+D) untreated
cells with DMSO compound.
collected. Western blot analysis was carried out with cytochrome
antibody. (C) Control (untreated), (C+D) control (untreated) + DMSO. b-Actin was
used as internal protein loading control.
c
specific

534
A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
to understand the mechanism and pathways, further biological as-
says like western blot analysis of p53, p27, p21 and NF- B were
j
carried out. It was observed from the results that the p53 and
p21 levels were enhanced when treated with compounds 4b and
5c. Moreover, the decrease in the levels of CDK2 was observed,
as there is increase in the levels of p21. Further, suppression of
NF-jB (p65) was observed and this was more pronounced in case
Figure 10. Expression of Bcl-2, anti-apoptotic gene, in A375 cells at mRNA level by
of 5c. Release of cytochrome c was prominent in compound 5c
indicating the involvement of mitochondrial pathway. Concomi-
tant with this a huge decrease in the levels of anti-apoptotic gene,
Bcl-2, which regulates the mitochondrial proteins, was also ob-
served when the cells were treated with the compounds 4b and
5c. An increase in the levels of active caspase-3 and cleavage of
PARP was also observed when cells were treated with compound
5c. Hence in the present study out of a set of quinazolinone-PBD
conjugates synthesized one of them 5c, activated p53 pathway
RT-PCR analysis. A375 cells were exposed to 4 lM concentration of PBD conjugates
for 24 h. RNA was extracted and RT-PCR was carried out using Bcl-2 specific primers
and GAPDH specific primers. GAPDH was used as internal control. (C) Control
(untreated), (C+D) control (untreated) + DMSO.
an increase in the levels of active caspase-3, which inturn cleaves
the DNA repair enzyme PARP. To assess the role of PBD conjugates
on the levels of active caspase-3 and cleavage of PARP, A375 cells
were treated with 4 lM of the compounds 4b and 5c for 24 h
and also simultaneously inhibited NF-jB activity indicating its po-
and the expression levels of active caspase-3 was analyzed by wes-
tern blot analysis. An increase in the levels of active caspase-3 was
observed when the cells were treated with compounds 4b and 5c.
An increase in the expression of cleaved PARP product (85 kDa)
specific to apoptosis was observed and the levels were more pro-
nounced in the case of compound 5c. This data clearly indicated
that these PBD conjugates induce apoptosis by caspase-mediated
mechanism as shown in Figure 11a and b.
tential for activation of apoptosis in the treatment of cancer. Fur-
ther, all the conjugates in which quinazolinone moiety linked to
PBD ring system particularly compounds 4a–f and 5a–c showed
significant anticancer activity with GI50 values in the range of
<0.1–2.30
C-8 linked 1,2,3-triazole-PBD conjugates (GI50 values in the range
of 0.13–30.50 M), triazolobenzothiadiazine-PBD conjugates (GI50
values in the range of 0.22–30.30 M) and phosphonate linked
PBD conjugates (GI50 values in the range of 0.17–30.50 M) against
lM when compared to some of the PBD conjugates like
l
l
l
3. Conclusion
9–11 human cancer cell lines in SRB assay. Hence from this data we
can conclude that linking of quinazolinone moiety to PBD ring sys-
tem improved the anticancer activity. Further, in this investigation,
antitumour proliferation mechanism of novel quinazolinone-PBD
conjugates was also examined which could be helpful for future
studies on such conjugates. Finally, it may be concluded that the
compound 5c has the potential to be taken up for further preclin-
ical studies either alone or in combination with existing therapies.
In the present study, we designed and synthesized a series of
quinazolinone–pyrrolobenzodiazepine conjugates. Compound 5c
was evaluated by the National Cancer Institute, Bethesda which
exhibited potent anticancer activity against various cancer cell
lines indicating that this compound had the potential for its devel-
opment as a broad spectrum anticancer agent. Further the other
PBD analogues (4a–f, 5a, 5b and 5d–f) also showed good antican-
cer activity against 11 human cancer cell lines. The thermal dena-
turation studies showed that these conjugates have better DNA
binding ability when compared to DC-81. Moreover, these binding
studies were further validated by the molecular modeling studies.
In MTT proliferation assay the two promising compounds 4b and
4. Experimental section
4.1. General
All chemicals and reagents were obtained from Aldrich (Sigma–
Aldrich, St. Louis, MO, USA), Lancaster (Alfa Aesar, Johnson Matthey
Company, Ward Hill, MA, USA) or Spectrochem Pvt. Ltd (Mumbai,
India) and were used without further purification. Reactions were
monitored by TLC, performed on silica gel glass plates containing
60 GF-254, and visualization on TLC was achieved by UV light or
iodine indicator. Column chromatography was performed with
Merck 60–120 mesh silica gel. 1H spectra were recorded on Gemini
Varian-VXR-unity (200 MHz) or Bruker UXNMR/XWIN-NMR
(300 MHz) instruments. Chemical shifts (d) are reported in ppm
downfield from internal TMS standard. ESI spectra were recorded
on Micro mass, Quattro LC using ESI+ software with capillary volt-
age 3.98 kV and ESI mode positive ion trap detector. High-resolu-
tion mass spectra (HRMS) were recorded on QSTAR XL Hybrid
MS/MS mass spectrometer. Melting points were determined with
an Electro thermal melting point apparatus, and are uncorrected.
5c showed potent cytotoxicity in A375 cells at 4 lM. The FACS
analysis showed more population in sub-G1 phase indicating that
these two PBD conjugates had apoptosis inducing ability. In order
4.2. General procedures
4.2.1. Synthesis of 3-(4-fluorophenyl)-6-hydroxy-2-methylqui-
nazolin-4(3H)-one (8a)
Figure 11. (a and b) Effect of PBD conjugates on active/cleaved caspase-3 and
cleavage of PARP. A375 cells were treated with
4 lM concentration of PBD
conjugates for 24 h. The cell lysates were collected and expression levels of active/
cleaved caspase-3 (a) (antibody from Imgenex detects 21 kDa) and PARP (b) were
determined by western blot analysis with specific antibodies (PARP antibody from
roche detects both the 113 kDa and 85 kDa proteins). (C) Control (untreated), (C+D)
control (untreated) + DMSO, in which the drug was dissolved. b-Tubulin was used
as internal loading control.
Equimolar amounts 7 (354 mg, 2 mmol) and 4-flouro aniline
(222 mg, 2 mmol) were heated at 120 °C for 12 h in glacial acetic
acid. The reaction mixture then washed with cool sodium bicar-
bonate solution and then extracted with ethylacetate. The solvent
was evaporated under reduced pressure to get the crude product.

A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
535
This was further purified by column chromatography (15% ethyl
acetate–hexane) to afford the compound 8a as a white solid
(464 mg, 86%). Mp 182–185 °C; 1H NMR (CDCl3, 300 MHz): d 2.21
(s, 3H), 7.22–7.49 (m, 4H), 7.32 (d, 1H, J = 8.6 Hz), 7.54 (d, 1H,
J = 8.6 Hz), 7.60 (s, 1H), 9.59 (s, OH); MS (ESI): m/z 271.1 (M+1)+.
(t, 2H, J = 6.0 Hz), 7.25 (d, 4H, J = 6.0 Hz), 7.35 (d, 1H, J = 8.3 Hz),
7.58 (s, 1H), 7.61 (d, 1H, J = 9.0 Hz); MS (ESI): m/z 421.1 (M+1)+.
4.2.7. 6-(5-Bromopentyloxy)-3-(3-chloro-4-fluorophenyl)-2-
methylquinazolin-4(3H)-one (9b)
The compound 9b was prepared following the met od described
for the preparation of the compound 9a, employing 8b (305 mg,
1 mmol) and 1,5-dibromo pentane (690 mg, 3 mmol), and the
crude product was purified by column chromatography (10% ethyl
acetate–hexane) to afford the compound 9b (384 mg, 85%). Mp
108–110 °C; 1H NMR (CDCl3, 300 MHz): d 1.52–1.74 (m, 2H),
1.78–2.06 (m, 4H), 2.23 (s, 3H), 3.45 (t, 2H, J = 6.7 Hz), 4.08 (t,
2H, J = 6.0 Hz), 7.15–7.20 (m, 1H), 7.31–7.39 (m, 3H), 7.56–7.61
(m, 2H); MS (ESI): m/z 454 (M+1)+.
4.2.2. 3-(3-Chloro-4-fluorophenyl)-6-hydroxy-2-methylquinaz-
olin-4(3H)-one (8b)
The compound 8b was prepared following the method de-
scribed for the preparation of the compound 8a, employing 7
(354 mg, 2 mmol) and 3-chloro-4-flouroaniline (292 mg, 2 mmol),
and the crude product was purified by column chromatography
(15% ethyl acetate–hexane) to afford the compound 8b as a white
solid (518 mg, 85%); mp 144–148 °C; 1H NMR (CDCl3, 300 MHz): d
2.18 (s, 3H), 7.15–7.20 (m, 1H), 7.31–7.39 (m, 3H), 7.56–7.61 (m,
2H), 9.63 (s, 1H–OH); MS (ESI): m/z 306 (M+1)+.
4.2.8. 6-(4-Bromobutoxy)-3-(2,4-dichlorophenyl)-2-methylqui-
nazolin-4(3H)-one (9c)
The compound 9c was prepared following the method de-
scribed for the preparation of the compound 9a, employing 8c
(321 mg, 1 mmol) and 1,5-dibromopentane (690 mg, 3 mmol),
and the crude product was purified by column chromatography
(10% ethyl acetate–hexane) to afford the compound 9c as a white
solid (385 mg, 85%). Mp 110–115 °C; 1H NMR (CDCl3, 300 MHz):
d 1.95–2.04 (m, 2H), 2.04–2.13 (m, 2H), 2.16 (s, 3H), 3.47 (t, 2H,
J = 6.5 Hz), 4.10 (t, 2H, J = 6.0 Hz), 7.26–7.33 (m, 2H), 7.44 (d, 1H,
J = 8.7 Hz), 7.51 (d, 1H, J = 2.1 Hz), 7.55 (d, 1H, J = 8.7 Hz), 7.63 (s,
1H); MS (ESI): m/z 454 (M+1)+.
4.2.3. 3-(2,4-Dichlorophenyl)-6-hydroxy-2-methylquinazolin-
4(3H)-one (8c)
The compound 8c was prepared following the method de-
scribed for the preparation of the compound 8a, employing 7
(354 mg, 2 mmol) and 2,4-dichloroaniline (324 mg, 2 mmol), and
the crude product was purified by column chromatography (16%
ethyl acetate–hexane) to afford the compound 8c as a white solid
(526 mg, 82%). Mp 128–132 °C; 1H NMR (CDCl3, 300 MHz): d 2.16
(s, 3H), 7.20 (d, 1H, J = 8.6 Hz), 7.25 (d, 1H, J = 7.7 Hz), 7.41 (d,
1H, J = 8.6 Hz), 7.48 (d, 2H, J = 9.4 Hz), 7.95 (d, 1H, J = 7.7 Hz),
8.93 (s, 1H–OH); MS (ESI): m/z 322 (M+1)+.
4.2.9. 6-(4-Bromobutoxy)-3-(4-iodo-2-methylphenyl)-2-methyl-
quinazolin-4(3H)-one (9d)
4.2.4. 6-Hydroxy-3-(4-iodo-2-methylphenyl)-2-methylquinaz-
olin-4(3H)-one (8d)
The compound 9d was prepared following the method de-
scribed for the preparation of the compound 9a, employing 8d
(392 mg, 1 mmol) and 1,4-dibromobutane (648 mg, 3 mmol), and
the crude product was purified by column chromatography (10%
ethyl acetate–hexane) to afford the compound 9d as a white solid
(422 mg, 80%). Mp 75–77 °C; 1H NMR (CDCl3, 300 MHz): d 1.92–
2.01 (m, 2H), 2.02–2.07 (m, 2H), 2.09 (s, 3H), 2.20 (s, 3H), 3.45 (t,
2H, J = 6.0 Hz), 4.08 (t, 2H, J = 6.0 Hz), 6.90 (d, 1H, J = 8.3 Hz), 7.38
(d, 1H, J = 8.3 Hz), 7.61 (s, 1H), 7.63–7.76 (m, 2H), 7.79 (s, 1H);
MS (ESI): m/z 528 (M+1)+.
The compound 8d was prepared following the method de-
scribed for the preparation of the compound 8a, employing 7
(354 mg, 2 mmol) and 4-iodo-2-methylaniline (466 mg, 2 mmol),
and the crude product was purified by column chromatography
(16% ethyl acetate–hexane) to afford the compound 8d as a white
solid (628 mg, 80%). Mp 119–120 °C; 1H NMR (CDCl3, 300 MHz): d
2.07 (s, 3H), 2.14 (s, 3H), 6.92 (d, 1H, J = 8.0 Hz), 7.23 (d, 1H,
J = 8.0 Hz), 7.53 (d, 1H, J = 8.7 Hz), 7.67 (s, 2H), 7.73 (s, 1H), 8.33
(s, 1H–OH); MS (ESI): m/z 393 (M+1)+.
4.2.10. 6-(5-Bromopentyloxy)-3-(4-iodo-2-methylphenyl)-2-
methylquinazolin-4(3H)-one (9e)
4.2.5. 6-Hydroxy-3-(4-methoxyphenyl)-2-methylquinazolin-
4(3H)-one (8e)
The compound 9e was prepared following the method de-
scribed for the preparation of the compound 9a, employing 8d
(392 mg, 1 mmol) and 1,5-dibromopentane (690 mg, 3 mmol),
and the crude product was purified by column chromatography
(10% ethyl acetate–hexane) to afford the compound 9e as a white
solid (432 mg, 80%). Mp 85–90 °C; 1H NMR (CDCl3, 300 MHz): d
1.60–1.71 (m, 2H), 1.80–2.02 (m, 4H), 2.08 (s, 3H), 2.19 (s, 3H),
3.45 (t, 2H, J = 6.0 Hz), 4.08 (t, 2H, J = 6.0 Hz), 6.90 (d, 1H,
J = 8.3 Hz), 7.38 (d, 1H, J = 8.3 Hz), 7.60 (s, 1H), 7.63–7.76 (m, 2H),
7.79 (s, 1H); MS (ESI): m/z 542 (M+1)+.
The compound 8e was prepared following the method de-
scribed for the preparation of the compound 8a, employing 7
(354 mg, 2 mmol) and 4-methoxyaniline (246 mg, 2 mmol), and
the crude product was purified by column chromatography (14%
ethyl acetate–hexane) to afford the compound 8e as a white solid
(456 mg, 81%). Mp 262–264 °C; 1H NMR (CDCl3, 300 MHz): d 2.16
(s, 3H), 3.87 (s, 3H) 7.02 (d, 2H, J = 8.6 Hz), 7.16 (d, 2H,
J = 8.6 Hz), 7.21 (dd, 1H, J = 8.6 Hz), 7.44 (d, 1H, J = 8.6 Hz) 7.46 (s,
1H), 9.50 (s, 1H-OH); MS (ESI): m/z 283 (M+1)+.
4.2.6. Synthesis of 6-(5-bromopentyloxy)-3-(4-fluorophenyl)-2-
methylquinazolin-4(3H)-one (9a)
4.2.11. 6-(5-Bromopentyloxy)-3-(4-methoxyphenyl)-2-methyl-
quinazolin-4(3H)-one (9f)
To a solution of compound 8a (270 mg, 1 mmol) in acetone
(30 mL), anhydrous K2CO3 (553 mg, 4 mmol) and 1,5-dibromopen-
tane (690 mg, 3 mmol) were added and the mixture was refluxed
for 12 h. After completion of the reaction, potassium carbonate
was removed by filtration and the solvent was evaporated under
reduced pressure to get the crude product. This was further puri-
fied by column chromatography using ethyl acetate–hexane
(10%) to afford the compound 9a as a white solid (337 mg, 88%).
Mp 137–140 °C; 1H NMR (CDCl3, 300 MHz): d 1.52–1.75 (m, 2H),
1.77–2.05 (m, 4H), 2.24 (s, 3H), 3.46 (t, 2H, J = 6.7 Hz), 4.08
The compound 9f was prepared following the method described
for the preparation of the compound 9a, employing 8e (282 mg,
1 mmol) and 1,5-dibromopentane (690 mg, 3 mmol), and the crude
product was purified by column chromatography (10% EtOAc–hex-
ane) to afford the compound 9f as a white solid (366 mg, 85%). Mp
81–83 °C; 1H NMR (CDCl3, 300 MHz): d 1.59–1.72 (m, 2H), 1.79–
2.02 (m, 4H), 2.24 (s, 3H), 3.45 (t, 2H, J = 6.0 Hz), 3.88 (s, 3H),
4.07 (t, 2H, J = 6.0 Hz), 7.05 (d, 2H, J = 7.6 Hz), 7.17 (d, 2H,
J = 7.6 Hz), 7.35 (d, 1H, J = 7.6 Hz), 7.57–7.63 (m, 2H); MS (ESI):
m/z 432 (M+1)+.

536
A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
4.2.12. Synthesis of 3-(4-hydroxyphenyl)-2-methylquinazolin-
4(3H)-one (12)
7.75–7.85 (m, 3H), 7.98 (d, 1H, J = 15.2 Hz), 8.30 (dd, 1H, J = 1.5,
8.3 Hz); MS (ESI): m/z 462 (M+1)+.
Equimolar amounts (1.61 g, 10 mmol) of 2-methyl-4H-
benzo[d][1,3]oxazin-4-one (11) and 4-amino phenol (1.30 g,
12 mmol) were heated at 160–180 °C for 2 h in oil bath. Upon cool-
ing, the solid reaction material was crystallized from ethanol to
give pure 3-(4-hydroxyphenyl)-2-methylquinazolin-4(3H)-one
12, which can be used for the next step without any further
purification.
4.2.17. (E)-3-(4-(4-Bromobutoxy)phenyl)-2-styrylquinazolin-
4(3H)-one (14b)
The compound 14b was prepared following the method de-
scribed for the preparation of the compound 14a, employing 13b
(386 mg, 1 mmol) and benzaldehyde (127 mg, 1.2 mmol), and the
crude product was purified by column chromatography (10% ethyl
acetate–hexane) to afford the compound 14b as a creamish white
solid (380 mg, 80%). Mp 158–161 °C; 1H NMR (CDCl3, 300 MHz): d
1.96–2.05 (m, 2H), 2.06–2.15 (m, 2H), 3.43 (t, 2H, J = 6.5 Hz), 4.05
(t, 2H, J = 6.5 Hz), 6.43 (d, 1H, J = 15.5 Hz), 7.03 (d, 2H, J = 8.1 Hz),
7.20 (d, 2H, J = 9.0 Hz), 7.25–7.35 (m, 5H), 7.72–7.78 (m, 3H),
7.95 (d, 1H, J = 15.5 Hz), 8.26 (dd, 1H, J = 1.5, 8.1 Hz); MS (ESI):
m/z 476 (M+1)+.
4.2.13. Synthesis of 3-(4-(3-bromopropoxy)phenyl)-2-methyl-
quinazolin-4(3H)-one (13a)
The compound 13a was prepared following the method de-
scribed for the preparation of the compound 9a, employing 12
(252 mg, 1 mmol) and 1,3-dibromopropane (606 mg, 3 mmol)
and the crude product was purified by column chromatography
using ethylacetate-hexane (10%) to afford the compound 13a as a
light yellow solid (335 mg, 90% yield). Mp 122–124 °C; 1H NMR
(CDCl3, 300 MHz): d 2.23 (s, 3H), 2.31–2.41 (m, 2H), 3.61 (t, 2H,
J = 6.0 Hz), 4.17 (t, 2H, J = 6.0 Hz), 7.03 (d, 2H, J = 9.0 Hz), 7.15 (d,
2H, J = 9.0 Hz), 7.39–7.46 (m, 1H), 7.62 (d, 1H, J = 7.5 Hz), 7.68–
7.76 (m, 1H), 8.23 (dd, 1H, J = 1.5, 8.3 Hz); MS (ESI): m/z 373
(M+1)+.
4.2.18. (E)-3-(4-(5-Bromopentyloxy)phenyl)-2-styrylquinaz-
olin-4(3H)-one (14c)
The compound 14c was prepared following the method de-
scribed for the preparation of the compound 14a, employing 13c
(400 mg, 1 mmol) and benzaldehyde (127 mg, 1.2 mmol), and the
crude product was purified by column chromatography (10% ethyl
acetate–hexane) to afford the compound 14c as a creamish white
solid (396 mg, 81%). Mp 128–130 °C; 1H NMR (CDCl3, 300 MHz):
d 1.65–1.71 (m, 2H), 1.84–1.92 (m, 2H), 1.93–2.03 (m, 2H), 3.43
(t, 2H, J = 6.5 Hz), 4.06 (t, 2H, J = 6.5 Hz), 6.43 (d, 1H, J = 15.5 Hz),
7.03 (d, 2H, J = 8.1 Hz), 7.20 (d, 2H, J = 9.0 Hz), 7.25–7.35 (m, 5H),
7.72–7.78 (m, 3H), 7.95 (d, 1H, J = 15.5 Hz), 8.27 (dd, 1H, J = 1.5,
8.1 Hz); MS (ESI): m/z 490 (M+1)+.
4.2.14. 3-(4-(4-Bromobutoxy)phenyl)-2-methylquinazolin-4(3H)-
one (13b)
The compound 13b was prepared following the method de-
scribed for the preparation of the compound 9a, employing 12
(252 mg, 1 mmol) and 1,4-dibromobutane (648 mg, 3 mmol), and
the crude product was purified by column chromatography (10%
ethyl acetate–hexane) to afford the compound 9b as a light yellow
solid (328 mg, 85% yield). Mp 132–133 °C; 1H NMR (CDCl3,
300 MHz): d 1.95–2.05 (m, 2H), 2.06–2.15 (m, 2H), 2.26 (s, 3H),
3.51 (t, 2H, J = 6.0 Hz), 4.06 (t, 2H, J = 6.0 Hz), 7.03 (d, 2H,
J = 9.0 Hz), 7.16 (d, 2H, J = 9.0 Hz), 7.43–7.49 (m, 1H), 7.66 (d, 1H,
J = 7.5 Hz) 7.72–7.79 (m, 1H) 8.25 (dd, 1H, J = 1.5, 8.3 Hz); MS
(ESI): m/z 387 (M+1)+.
4.2.19. Synthesis of (2S)-N-{4-{5-[3-(4-fluorophenyl)-2-methyl-
4-oxo-3,4-dihydro-6-quinazolinyl ]oxypentyloxy}-5-methoxy-2-
nitrobenzoyl}pyrrolidine-2-carboxaldehyde diethylthioacetal
(16a)
To a solution of (2S)-N-[4-hydroxy-5-methoxy-2-nitrobenzoyl)-
pyrrolidine-2-carboxaldehyde diethyl thioacetal 15 (400 mg,
1 mmol) in acetone (10 mL) anhydrous K2CO3 (552 mg, 4 mmol)
and the compound 9a (419 mg, 1 mmol) were added. The reaction
mixture was heated to reflux for 4–6 h. After completion of the reac-
tion as indicated by TLC, potassium carbonate was removed by suc-
tion filtration and the solvent was removed under vacuum. The
crude product thus obtained was purified by column chromatogra-
phy (50% ethyl acetate–hexane) to afford the pure compound 16a
as a yellow solid (590 mg, 80%). Mp 120–122 °C; 1H NMR (CDCl3,
300 MHz): d 1.31–1.39 (m, 6H), 1.68–1.78 (m, 2H), 1.79–2.16 (m,
8H), 2.13 (s, 3H), 2.69–2.86 (m, 4H), 3.19–3.32 (m, 2H), 3.87 (s,
3H), 4.00–4.10 (m, 4H), 4.54–4.66 (m, 1H), 4.77 (d, 1H, J = 3.6 Hz),
6.72 (s, 1H), 7.17 (d, 4H, J = 6.7 Hz), 7.25 (dd, 1H, J = 2.6, 9.2 Hz),
7.45–7.53 (m, 1H), 7.56 (s, 1H), 7.92 (s, 1H); MS (ESI): m/z 740
(M+1)+.
4.2.15. 3-(4-(5-Bromopentyloxy)phenyl)-2-methylquinazolin-
4(3H)-one (13c)
The compound 13c was prepared following the method de-
scribed for the preparation of the compound 9a, employing 12
(252 mg, 1 mmol) and 1,5-dibromopentane (690 mg, 3 mmol),
and the crude product was purified by column chromatography
(10% ethyl acetate–hexane) to afford the compound 13c as a light
yellow solid (353 mg, 88%). Mp 119–121 °C; 1H NMR (CDCl3,
300 MHz): d 1.59–1.72 (m, 2H), 1.81–2.01 (m, 4H), 2.26 (s, 3H),
3.51 (t, 2H, J = 6.0 Hz), 4.06 (t, 2H, J = 6.0 Hz), 7.03 (d, 2H,
J = 9.0 Hz), 7.16 (d, 2H, J = 9.0 Hz), 7.43–7.49 (m, 1H), 7.66 (d, 1H,
J = 7.5 Hz), 7.72–7.79 (m, 1H), 8.25 (dd, 1H, J = 1.5, 8.3 Hz); MS
(ESI): m/z 401 (M+1)+.
4.2.16. Synthesis of (E)-3-(4-(3-bromopropoxy)phenyl)-2-
styrylquinazolin-4(3H)-one (14a)
4.2.20. (2S)-N-{4-{5-[3-(3-chloro-4-fluorophenyl)-2-methyl-4-
oxo-3,4-dihydro-6-quinazolinyl]oxypentyloxy}-5-methoxy-2-
nitrobenzoyl}pyrrolidine-2 carboxaldehyde diethyl thioacetal
(16b)
This compound was prepared according to the method de-
scribed for compound 16a employing compound 15 (400 mg,
1 mmol) and compound 9b (454 mg, 1 mmol). The crude product
was purified by column chromatography (50% ethyl acetate–hex-
ane) to afford the compound 16b as a yellow solid (633 mg, 82%).
Mp 93–95 °C; 1H NMR (CDCl3, 300 MHz): d 1.31–1.39 (m, 6H),
1.68–1.78 (m, 2H), 1.79–2.16 (m, 8H), 2.24 (s, 3H), 2.67–2.86
(m, 4H), 3.19–3.32 (m, 2H), 3.94 (s, 3H), 4.09–4.16 (m, 4H), 4.67–
4.73 (m, 1H), 4.86 (d, 1H, J = 3.6 Hz), 6.81 (s, 1H), 7.15–7.20
To a solution of compound 13a (372 mg, 1 mmol) in acetic acid
(10 mL), benzaldehyde (127 mg, 1.2 mmol) was added and the
mixture was refluxed for 12 h. The reaction mixture then washed
with cool sodium bicarbonate solution and then extracted with
ethylacetate. The solvent was evaporated under reduced pressure
to get the crude product. This was further purified by column chro-
matography (10% ethyl acetate–hexane) to afford the compound
14a as a creamish white solid (378 mg, 82%). Mp 178–181 °C; 1H
NMR (CDCl3, 300 MHz):
d 2.33–2.44 (m, 2H), 3.66 (t, 2H,
J = 6.0 Hz), 4.21 (t, 2H, J = 6.0 Hz), 6.47 (d, 1H, J = 15.2 Hz), 7.09
(d, 2H, J = 8.4 Hz), 7.21 (d, 2H, J = 8.4 Hz), 7.28–7.41 (m, 5H),

A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
537
(m, 1H), 7.31–7.39 (m, 3H), 7.56–7.61 (m, 2H), 7.65 (s, 1H); MS
4.2.25. Synthesis of (2S)-N-{4-[3-[4-(2-methyl-4-oxo-3,4-dihydro-
3-quinazolinyl) phenoxy]propoxy}-5-methoxy-2-nitrobenzoyl}-
pyrrolidine-2-carboxaldehyde diethylthioacetal (17a)
(ESI): m/z 774 (M+1)+.
This compound was prepared according to the method de-
scribed for compound 16a, employing compound 15 (400 mg,
1 mmol) and the compound 13a (373 mg, 1 mmol). The crude
product was purified by column chromatography (50% ethyl ace-
tate–hexane) to afford the pure compound 17a as a yellow solid
(567 mg, 82%). Mp 72–74 °C; 1H NMR (CDCl3, 300 MHz): d 1.30–
1.40 (m, 6H), 1.72–1.79 (m, 2H), 1.88–2.03 (m, 4H), 2.27 (s, 3H),
2.67–2.90 (m, 4H), 3.21–3.31 (m, 2H), 3.96 (s, 3H), 4.03–4.18 (m,
4H), 4.67–4.76 (m, 1H), 4.89 (d, 1H, J = 3.7 Hz), 6.84 (s, 1H), 7.04
(d, 2H, J = 8.3 Hz), 7.17 (d, 2H, J = 7.5 Hz), 7.39–7.49 (m, 1H), 7.62
(d, 1H, J = 8.30 Hz), 7.65 (s, 1H), 7.69–7.78 (m, 1H), 8.22 (d, 1H,
J = 7.5 Hz); MS (ESI): m/z 693.91 (M+1)+.
4.2.21. (2S)-N-{4-{4-[3-(2,4-Dichlorophenyl)-2-methyl-4-oxo-3,4-
dihydro-6-quinazoli nyl]oxybutyloxy}-5-methoxy-2-nitroben-
zoyl}pyrrolidine-2-carboxaldehyde diethylthioacetal (16c)
This compound was prepared according to the method de-
scribed for compound 16a, employing compound 15 (400 mg,
1 mmol) and compound 9c (456 mg, 1 mmol). The crude product
was purified by column chromatography (50% ethyl acetate–hex-
ane) to afford the compound 16c as a yellow solid (620 mg, 80%).
Mp 99–101 °C; 1H NMR (CDCl3, 300 MHz): d 1.30–1.40 (m, 6H),
1.67–1.78 (m, 2H), 1.79–2.13 (m, 6H), 2.17 (s, 3H), 2.65–2.86 (m,
4H), 3.18–3.26 (m, 2H), 3.92 (s, 3H), 4.13–4.24 (m, 4H), 4.62–
4.71 (m, 1H), 4.83 (d, 1H, J = 3.7 Hz), 6.75 (s, 1H), 7.27 (d, 1H,
J = 8.4 Hz), 7.32 (dd, 1H, J = 2.6, 8.6 Hz), 7.45 (dd, 1H, J = 2.2,
8.4 Hz), 7.54–7.59 (m, 2H), 7.62 (s, 1H), 7.64 (d, 1H, J = 2.2 Hz);
MS (ESI): m/z 776 (M+1)+.
4.2.26. (2S)-N-{4-[4-[4-(2-Methyl-4-oxo-3,4-dihydro-3-quinaz-
olin-yl)phenoxy]butyl oxy}-5-methoxy-2-nitrobenzoyl}pyrrol-
idine-2-carboxaldehydediethylthioacetal (17b)
This compound was prepared according to the method de-
scribed for compound 16a, employing compound 15 (400 mg,
1 mmol) and compound 13b (387 mg, 1 mmol). The crude product
was purified by column chromatography (50% ethyl acetate–hex-
ane) to afford the compound 17b as a yellow solid (564 mg, 80%).
Mp 76–79 °C; 1H NMR (CDCl3, 300 MHz): d 1.30–1.40 (m, 6H),
1.66–2.16 (m, 8H), 2.27 (s, 3H), 2.67–2.90 (m, 4H), 3.21–3.31 (m,
2H), 3.96 (s, 3H), 4.03–4.18 (m, 4H), 4.67–4.76 (m, 1H), 4.89 (d,
1H, J = 3.7 Hz), 6.84 (s, 1H), 7.04 (d, 2H, J = 8.3 Hz), 7.17 (d, 2H,
J = 7.5 Hz), 7.39–7.49 (m, 1H), 7.62 (d, 1H, J = 8.30 Hz), 7.65 (s,
1H), 7.69–7.78 (m, 1H), 8.22 (d, 1H, J = 7.5 Hz); MS (ESI): m/z
707.91 (M+1)+.
4.2.22. (2S)-N-{4-{4-[3-(4-Iodo-2-methylphenyl)-2-methyl-4-oxo-
3,4-dihydro-6-quinazolinyl]oxybutyloxy}-5-methoxy-2-nitroben-
zoyl}pyrrolidine-2-carboxaldehyde diethylthio acetal (16d)
This compound was prepared according to the method de-
scribed for compound 16a, employing compound 15 (400 mg,
1 mmol) and compound 9d (527 mg, 1 mmol). The crude product
was purified by column chromatography (50% ethyl acetate–hex-
ane) to afford the compound 16d as a yellow solid (677 mg, 80%).
Mp 88–90 °C; 1H NMR (CDCl3, 300 MHz): d 1.30–1.40 (m, 6H),
1.79–2.16 (m, 8H), 2.15 (s, 3H), 2.08 (s, 3H), 2.67–2.86 (m, 4H),
3.18–3.30 (m, 2H), 3.93 (s, 3H), 4.14–4.22 (m, 4H), 4.65–4.72 (m,
1H), 4.85 (d, 1H, J = 3.7 Hz), 6.75 (s, 1H), 6.89 (d, 1H, J = 8.1 Hz),
7.32 (dd, 1H, J = 2.1, 8.4 Hz), 7.51–7.65 (m, 3H), 7.70 (d, 1H,
J = 8.1 Hz), 7.76 (s, 1H); MS (ESI): m/z 847 (M+1)+.
4.2.27. (2S)-N-{4-[5-[4-(2-Methyl-4-oxo-3,4-dihydro-3-quina-
zolin-yl)phenoxy] pentyl oxy}-5-methoxy-2-nitrobenzoyl}-
pyrrolidine-2-carboxaldehyde diethythioacetal (17c)
4.2.23. (2S)-N-{4-{5-[3-(4-Iodo-2-methylphenyl)-2-methyl-4-oxo-
3,4-dihydro-6-quinazolinyl]oxypentyloxy}-5-methoxy-2-nitro-
benzoyl}pyrrolidine-2-carboxaldehyde diethylthio acetal (16e)
This compound was prepared according to the method de-
scribed for compound 16a, employing compound 15 (400 mg,
1 mmol) and compound 9e (541 mg, 1 mmol). The crude product
was purified by column chromatography (50% ethyl acetate–hex-
ane) to afford the compound 16e as a yellow solid (696 mg, 81%).
Mp 93–95 °C; 1H NMR (CDCl3, 300 MHz): d 1.30–1.40 (m, 6H),
1.67–1.78 (m, 2H), 1.79–2.16 (m, 8H), 2.08 (s, 3H), 2.15 (s, 3H),
2.67–2.86 (m, 4H), 3.18–3.30 (m, 2H), 3.93 (s, 3H), 4.14–4.22 (m,
4H), 4.65–4.72 (m, 1H), 4.85 (d, 1H, J = 3.7 Hz), 6.75 (s, 1H), 6.89
(d, 1H, J = 8.1 Hz), 7.32 (dd, 1H, J = 2.1, 8.4 Hz), 7.51–7.65 (m, 3H),
7.70 (d, 1H, J = 8.1 Hz), 7.76 (s, 1H); MS (ESI): m/z 861 (M+1)+.
This compound was prepared according to the method de-
scribed for compound 16a, employing compound 15 (400 mg,
1 mmol) and compound 13c (401 mg, 1 mmol). The crude product
was purified by column chromatography (50% ethyl acetate–hex-
ane) to afford the compound 17c as a yellow solid (612 mg, 85%).
Mp 79–82 °C; 1H NMR (CDCl3, 300 MHz): d 1.30–1.40 (m, 6H),
1.67–1.78 (m, 2H), 1.79–2.16 (m, 8H), 2.27 (s, 3H), 2.67–2.90 (m,
4H), 3.21–3.31 (m, 2H), 3.96 (s, 3H), 4.03–4.18 (m, 4H), 4.67–
4.76 (m, 1H), 4.89 (d, 1H, J = 3.7 Hz), 6.84 (s, 1H), 7.05 (d, 2H,
J = 9.0 Hz), 7.17 (d, 2H, J = 9.0 Hz), 7.43–7.50 (m, 1H), 7.66 (s, 1H),
7.68 (d, 1H, J = 8.3 Hz), 7.73–7.80 (m, 1H), 8.27 (d, 1H, J = 7.5 Hz);
MS (ESI): m/z 721.91 (M+1)+.
4.2.28. (2S)-N-{4-{3-[(4–4-Oxo-2-[(E)-2-phenyl-1-ethenyl]-3,4-
dihydro-3-quinazoliny l)phenyl)oxy]propoxy}}-5-methoxy-2-
nitrobenzoyl}pyrrolidine-2-carboxaldehyde diethylthioacetal
(17d)
4.2.24. (2S)-N-{4-{5-[3-(4-Methoxyphenyl)-2-methyl-4-oxo-3,4-
dihydro-6-quinazolin yl]oxypentyloxy}-5-methoxy-2-nitroben-
zoyl}pyrrolidine-2-carboxaldehyde diethylthioacetal (16f)
This compound was prepared according to the method de-
scribed for compound 16a, employing compound 15 (400 mg,
1 mmol) and compound 9f (431 mg, 1 mmol). The crude product
was purified by column chromatography (50% ethyl acetate–hex-
ane) to afford the compound 16f as a yellow solid (638 mg, 85%).
Mp 75–78 °C; 1H NMR (CDCl3, 300 MHz): d 1.31–1.39 (m, 6H),
1.67–1.77 (m, 2H), 1.89–2.16 (m, 8H), 2.23 (s, 3H), 2.67–2.86 (m,
4H), 3.20–3.32 (m, 2H), 3.88 (s, 3H), 3.94 (s, 3H), 4.08–4.16 (m,
4H), 4.67–4.73 (m, 1H), 4.87 (d, 1H, J = 3.7 Hz), 6.81 (s, 1H), 7.05
(d, 2H, J = 8.8 Hz), 7.16 (d, 2H, J = 8.8 Hz), 7.34 (dd, 1H, J = 3.3,
8.8 Hz), 7.58 (d, 1H, J = 8.8 Hz), 7.60 (s, 1H), 7.66 (s, 1H); MS
(ESI): m/z 752 (M+1)+.
This compound was prepared according to the method de-
scribed for compound 16a, employing compound 15 (400 mg,
1 mmol) and compound 14a (461 mg, 1 mmol). The crude product
was purified by column chromatography (40% ethyl acetate–hex-
ane) to afford the compound 17d as a yellow solid (640 mg, 82%).
Mp 100–102 °C; 1H NMR (CDCl3, 300 MHz): d 1.30–1.40 (m, 6H),
1.72–1.79 (m, 2H), 1.88–2.03 (m, 4H), 2.65–2.86 (m, 4H), 3.18–
3.29 (m, 2H), 3.92 (s, 3H), 4.09–4.25 (m, 4H), 4.62–4.71 (m, 1H),
4.83 (d, 1H, J = 3.7 Hz), 6.43 (d, 1H, J = 15.1 Hz), 6.78 (s, 1H), 7.05
(d, 2H, J = 9.0 Hz), 7.20 (d, 2H, J = 8.3 Hz), 7.27–7.33 (m, 5H),
7.40–7.47 (m, 1H), 7.64 (s, 1H), 772–7.77 (m, 2H), 7.95 (d, 1H,
J = 15.1 Hz), 8.26 (d, 1H, J = 7.5 Hz); MS (ESI): m/z 782 (M+1)+.

538
A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
4.2.29. 2S)-N-{4-{4-[(4-4-Oxo-2-[(E)-2-phenyl-1-ethenyl]-3,4-
dihydro-3-quinazolinyl)phenyl)oxy]butyloxy}}-5-methoxy-2-
nitrobenzoyl}pyrrolidine-2-carboxaldehyde diethylthioacetal
(17e)
4.2.32. 7-Methoxy-8-{5-[3-(3-chloro-4-fluorophenyl)-2-methyl-
4-oxo-3,4-dihydro-6-quinazolinyl]oxypentyloxy}-(11aS)-1,2,3,-
11a-tetrahydro-5H-pyrrolo[2,1-c][1,4] benzodiazepine-5-one
(4b)
This compound was prepared according to the method de-
scribed for compound 16a, employing compound 15 (400 mg,
1 mmol) and compound 14b (475 mg, 1 mmol). The crude product
was purified by column chromatography (40% ethyl acetate–hex-
ane) to afford the compound 17e as a yellow solid (637 mg, 80%).
Mp 102–104 °C; 1H NMR (CDCl3, 300 MHz): d 1.30–1.40 (m, 6H),
1.66–2.16 (m, 8H), 2.65–2.86 (m, 4H), 3.18–3.29 (m, 2H), 3.94 (s,
3H), 4.06–4.19 (m, 4H), 4.62–4.71 (m, 1H), 4.83 (d, 1H,
J = 3.7 Hz), 6.43 (d, 1H, J = 15.10 Hz), 6.78 (s, 1H), 7.05 (d, 2H,
J = 9.0 Hz), 7.20 (d, 2H, J = 8.3 Hz), 7.27–7.33 (m, 5H), 7.40–7.47
(m, 1H), 7.64 (s, 1H), 7.72–7.77 (m, 2H), 7.95 (d, 1H, J = 15.1 Hz),
8.26 (d, 1H, J = 7.5 Hz); MS (ESI): m/z 796 (M+1)+.
The compound 4b was prepared according to the method de-
scribed for the compound 4a, employing the compound 16b
(773 mg, 1.0 mmol). The crude product was purified by column
chromatography (MeOH/CHCl3, 2%) to afford the compound 4b as
a white solid (346 mg, 56% yield). mp 95–97 °C; ½a D27
ꢂ
+159.5
(c = 0.1, CHCl3); 1H NMR (CDCl3, 300 MHz): d 1.59–1.74 (m, 4H),
1.84–2.11 (m, 6H), 2.25 (s, 3H), 3.53–3.63 (m, 1H), 3.68–3.88 (m,
2H), 3.94 (s, 3H), 4.02–4.16 (m, 4H), 6.81 (s, 1H), 7.13–7.23 (m,
1H), 7.30–7.41 (m, 3H), 7.51 (s, 1H), 7.56–7.63 (m, 2H), 7.67 (d,
1H, J = 3.3 Hz): MS (ESI): m/z 619 (M+1)+; HRMS (ESI m/z) for
C33H32FClN4O5 calcd 619.2123, found 619.2123 (M+1)+; Anal. Calcd
for C33H32FClN4O5: C, 64.02; H, 5.21; N, 9.05. Found: C, 63.79; H,
5.28; N, 9.22.
4.2.30. (2S)-N-{4-{5-[(4-4-Oxo-2-[(E)-2-phenyl-1-ethenyl]-3,4-
dihydro-3-quinazoliny l) phenyl)oxy]pentyloxy}}-5-methoxy
-2-nitrobenzoyl}pyrrolidine-2-carboxaldehyde
4.2.33. 7-Methoxy-8-{4-[3-(2,4-dichlorophenyl)-2-methyl-4-
oxo-3,4-dihydro-6-quinazolinyl]oxybutyloxy}-(11aS)-1,2,3,
11a-tetrahydro-5H-pyrrolo[2,1-c][1,4] benzodiazepine-5-one (4c)
The compound 4c was prepared according to the method de-
scribed for the compound 4a, employing the compound 16c
(775 mg, 1.0 mmol). The crude product was purified by column
chromatography (MeOH/CHCl3, 2%) to afford the compound 4c as
diethylthioacetal (17f)
This compound was prepared according to the method de-
scribed for compound 16a, employing compound 15 (400 mg,
1 mmol) and compound 14c (489 mg, 1 mmol). The crude product
was purified by column chromatography (40% ethyl acetate–hex-
ane) to afford the compound 17f as a yellow solid (711 mg, 88%).
Mp 106–108 °C; 1H NMR (CDCl3, 300 MHz): d 1.30–1.40 (m, 6H),
1.67–1.78 (m, 2H), 1.79–2.16 (m, 8H), 2.65–2.86 (m, 4H), 3.18–
3.29 (m, 2H), 3.94 (s, 3H), 4.06–4.19 (m, 4H), 4.62–4.71 (m, 1H),
4.83 (d, 1H, J = 3.7 Hz), 6.43 (d, 1H, J = 15.1 Hz), 6.78 (s, 1H), 7.05
(d, 2H, J = 9.0 Hz), 7.20 (d, 2H, J = 8.3 Hz), 7.27–7.33 (m, 5H),
7.40–7.47 (m, 1H), 7.64 (s, 1H), 7.72–7.77 (m, 2H), 7.95 (d, 1H,
J = 15.1 Hz), 8.26 (d, 1H, J = 7.5 Hz); MS (ESI): m/z 810 (M+1)+.
a white solid (341 mg, 55% yield). Mp 114–116 °C; ½a D27
ꢂ
+147.5
(c = 0.1, CHCl3); 1H NMR (CDCl3, 300 MHz): d 1.64–1.80 (m, 2H),
1.96–2.13 (m, 6H), 2.20 (s, 3H), 3.53–3.86 (m, 3H), 3.92 (s, 3H),
4.07–4.24 (m, 4H), 6.82 (s, 1H), 7.26–7.32 (m, 1H), 7.37 (d, 1H,
J = 7.8 Hz), 7.46 (d, 1H, J = 6.8 Hz), 7.51 (s, 1H), 7.61 (s, 1H), 7.62–
7.68 (m, 3H); MS (ESI): m/z 621 (M+1)+; HRMS (ESI m/z) for
C32H30Cl2N4O5 calcd 621.1671, found 621.1650 (M+1)+; Anal. Calcd
for C32H30Cl2N4O5: C, 61.84; H, 4.87; N, 9.01. Found: C, 61.69; H,
4.47; N, 8.85.
4.2.31. 7-Methoxy-8-{5-[3-(4-fluorophenyl)-2-methyl-4-oxo-
3,4-dihydro-6-quinazolinyl]oxypentyloxy}-(11aS)-1,2,3,11a-
tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepine-5-one (4a)
To a solution of compound 16a (739 mg, 1 mmol) in methanol
(20 mL), SnCl2ꢀ2H2O (5 mmol) was added and refluxed for 1–2 h.
The methanol was evaporated in vacuum and the aqueous layer
was then carefully adjusted to pH 8 with 10% NaHCO3 solution
and then extracted with ethyl acetate (20–30 mL). The combined
organic phase was dried over anhydrous Na2SO4 and evaporated
under vacuum to afford the amino diethyl thioacetal, which due
to potential stability problems proceeded for the next step. A solu-
tion of amino diethyl thioacetal (1 mmol), HgCl2 (2.26 mmol) and
CaCO3 (2.46 mmol) in CH3CN–water (4:1) was stirred slowly at
room temperature until TLC indicated complete loss of starting
material (12 h). The reaction mixture was diluted with ethylace-
tate (30 mL) and filtered through a Celite bed. The clear yellow or-
ganic supernatant was washed with saturated 5% NaHCO3 (20 mL)
and brine (20 mL), and the combined organic phase was dried over
anhydrous Na2SO4. The organic layer was evaporated in vacuum
and purified by column chromatography (MeOH/CHCl3, 2%) to give
the final product 4a as a white solid (390 mg, 58% yield). Mp 96–
4.2.34. 7-Methoxy-8-{4-[3-(4-iodo-2-methylphenyl)-2-methyl-
4-oxo-3,4-dihydro-6-quinazolinyl]oxybutyloxy}-(11aS)-1,2,3,-
11a-tetrahydro-5H-pyrrolo[2,1-c][1,4] benzodiazepine-5-one
(4d)
The compound 4d was prepared according to the method de-
scribed for the compound 4a, employing the compound 16d
(846 mg, 1.0 mmol). The crude product was purified by column
chromatography (MeOH/CHCl3, 2%) to afford the compound 4d as
a white solid (402 mg, 58% yield). Mp 98–100 °C; ½a D27
ꢂ
+112.5
(c = 0.1, CHCl3); 1H NMR (CDCl3, 300 MHz): d 1.57–1.75 (m, 4H),
1.85–2.10 (m, 4H), 2.08 (s, 3H), 2.16 (s, 3H), 3.51–3.88 (m, 3H),
3.94 (s, 3H), 4.02–4.16 (m, 4H), 6.81 (s, 1H), 6.90 (d, 1H,
J = 8.3 Hz), 7.37 (d, 1H, J = 2.4, 9.1 Hz), 7.51 (s, 1H), 7.57–7.81 (m,
5H); MS (ESI): m/z 693 (M+1)+; HRMS (ESI m/z) for C33H33IN4O5
calcd 693.1573, found 693.1569 (M+1)+; Anal. Calcd for
C33H33IN4O5: C, 57.23; H, 4.80; N, 8.09. Found: C, 57.39; H, 4.57;
N, 7.95.
4.2.35. 7-Methoxy-8-{5-[3-(4-iodo-2-methylphenyl)-2-methyl-
4-oxo-3,4-dihydro-6-quinazolinyl]oxypentyloxy}-(11aS)-1,2,3,-
11a-tetrahydro-5H-pyrrolo[2,1-c][1,4] benzodiazepine-5-one (4e)
The compound 4e was prepared according to the method de-
scribed for the compound 4a, employing the compound 16e
(860 mg, 1.0 mmol). The crude product was purified by column
chromatography (MeOH/CHCl3, 2%) to afford the compound 4e as
98 °C; ½a 2D7
ꢂ
+118.5 (c = 0.1, CHCl3); 1H NMR (CDCl3, 300 MHz): d
1.53–1.75 (m, 4H), 1.76–2.11 (m, 6H), 2.20 (s, 3H), 3.50–3.87 (m,
3H), 3.92 (s, 3H), 4.00–4.20 (m, 4H), 6.81 (s, 1H), 7.17–7.40 (m,
6H), 7.46–7.70 (m, 3H); 13C NMR (CDCl3, 75 MHz): d 22.5, 24.0,
28.6, 28.7, 29.5, 46.6, 53.6, 56.1, 68.2, 68.7, 107.1, 110.3, 110.5,
116.9, 117.1, 120.0, 121.2, 125.0, 128.3, 129.8, 129.8, 133.7,
140.5, 141.7, 147.7, 150.7, 151.5, 157.7, 161.4, 162.1, 162.3,
163.9, 164.6; MS (ESI): m/z 585 (M+1)+; HRMS (ESI m/z) for
C33H33FN4O5 calcd 585.2513, found 585.2498 (M+1)+; Anal. Calcd
for C33H33FN4O5: C, 67.79; H, 5.69; N, 9.58. Found: C, 67.56; H,
5.40; N, 9.34.
a white solid (395 mg, 56% yield). Mp 104–106 °C; ½a D27
ꢂ
+123.5
(c = 0.1, CHCl3); 1H NMR (CDCl3, 300 MHz): d 1.59–1.75 (m, 4H),
1.84–2.02 (m, 6H), 2.08 (s, 3H), 2.16 (s, 3H), 3.51–3.88 (m, 3H),
3.94 (s, 3H), 4.02–4.16 (m, 4H), 6.81 (s, 1H), 6.90 (d, 1H,
J = 8.3 Hz), 7.37 (d, 1H, J = 2.4, 9.1 Hz), 7.51 (s, 1H), 7.57–7.81 (m,
5H); 13C NMR (CDCl3, 75 MHz): d 17.0, 22.5, 23.5, 24.1, 28.5,

A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
539
28.7, 29.5, 46.5, 53.6, 56.1, 68.2, 68.6, 95.2, 107.1, 110.3, 111.4,
120.0, 121.1, 125.1, 128.3, 129.6, 136.7, 136.8, 137.8, 140.3,
140.5, 141.9, 147.7, 150.7, 151.1, 157.7, 161.3, 162.3, 164.5; MS
(ESI): m/z 707 (M+1)+; HRMS (ESI m/z) for C34H35IN4O5 calcd
707.1730, found 707.1720 (M+1)+; Anal. Calcd for C34H35IN4O5: C,
57.80; H, 4.99; N, 7.93. Found: C, 57.79; H, 4.69; N, 7.36.
Calcd for C32H32N4O5: C, 69.55; H, 5.84; N, 10.14. Found: C,
69.23; H, 5.62; N, 9.89.
4.2.39. 7-Methoxy-8{-5-[4-(2-methyl-4-oxo-3,4-dihydro-3-qui-
nazolinyl)phenoxy] pentyloxy}-(11aS)-1,2,3,11a-tetrahydro-5H-
pyrrolo[2,1-c][1,4]benzodiazepine-5-one (5c)
The compound 5c was prepared according to the method de-
scribed for the compound 4a, employing the compound 17c
(720 mg, 1.0 mmol). The crude product was purified by column
chromatography (MeOH/CHCl3, 2%) to afford the compound 5c as
4.2.36. 7-Methoxy-8-{5-[3-(4-methoxyphenyl)-2-methyl-4-oxo-
3,4-dihydro-6-quinazolinyl]oxypentyloxy}-(11aS)-1,2,3,11a-tet-
rahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepine-5-one (4f)
The compound 4f was prepared according to the method de-
scribed for the compound 4a, employing the compound 16f
(751 mg, 1.0 mmol). The crude product was purified by column
chromatography (MeOH/CHCl3, 2%) to afford the compound 4f as
a white solid (328 mg, 58% yield). Mp 83–85 °C; ½a D27
ꢂ
+142.5
(c = 0.1, CHCl3); 1H NMR (CDCl3, 300 MHz): d 1.57–1.75 (m, 4H),
1.86–2.11 (m, 6H), 2.26 (s, 3H), 3.70–3.87 (m, 3H), 3.95 (s, 3H),
4.01–4.10 (m, 4H), 6.82 (s, 1H), 7.03 (d, 2H, J = 8.8 Hz), 7.15 (d,
2H, J = 8.8 Hz), 7.44–7.49 (m, 1H), 7.52 (s, 1H), 7.67 (d, 2H,
J = 6.3 Hz), 7.74–7.79 (m, 1H), 8.27 (d, 1H, J = 8.5 Hz); 13C NMR
(CDCl3, 75 MHz): d 22.5, 24.1, 24.3, 28.6, 28.8, 29.5, 46.6, 53.6,
56.1, 67.9, 68.7, 110.4, 111.5, 115.6, 120.0, 120.7, 126.4, 126.6,
127.0, 128.9, 130.0, 134.4, 140.5, 147.3, 147.7, 150.7, 154.7,
159.3, 162.3, 164.5; MS (ESI): m/z 567 (M+1)+; HRMS (ESI m/z)
for C33H34N4O5 calcd 567.2607, found 567.2600 (M+1)+; Anal.
Calcd for C33H34N4O5: C, 69.95; H, 6.05; N, 9.89. Found: C, 69.76;
H, 6.00; N, 9.52.
a white solid (390 mg, 58% yield). Mp 100–102 °C; ½a D27
ꢂ
+152.5
(c = 0.1, CHCl3); 1H NMR (CDCl3, 300 MHz): d 1.59–1.75 (m, 4H),
1.84–2.02 (m, 6H), 2.08 (s, 3H), 2.16 (s, 3H), 3.51–3.88 (m, 3H),
3.94 (s, 3H), 4.02–4.16 (m, 4H), 6.81 (s, 1H), 7.07 (d, 2H,
J = 8.8 Hz), 7.19 (d, 2H, J = 8.8 Hz), 7.35 (dd, 1H, J = 2.4, 8.8 Hz),
7.47 (s, 1H), 7.55 (s, 1H), 7.56–7.61 (m, 1H), 7.69 (d, 1H,
J = 4.0 Hz); 13C NMR (CDCl3, 75 MHz): d 22.6, 24.1, 28.6, 28.7,
29.5, 46.6, 53.6, 55.5, 56.1, 68.1, 68.7, 107.1, 110.3, 111.5, 115.1,
120.0, 121.4, 124.8, 128.2, 128.9, 130.4, 140.5, 141.9, 147.7,
150.7, 152.2, 157.5, 159.8, 162.3, 162.3, 164.6; MS (ESI): m/z 597
(M+1)+; HRMS (ESI m/z) for C34H36N4O6 calcd 597.2713; found
597.2700 (M+1)+; Anal. Calcd for C34H36N4O6: C, 68.44; H, 6.08;
N, 9.39. Found: C, 68.12; H, 6.22; N, 9.16.
4.2.40. 7-Methoxy-8-{3-[(4–4-oxo-2-[(E)-2-phenyl-1-ethenyl]-
3,4-dihydro-3-quinazolinylphenyl)oxy]propoxy}-(11aS)-1,2,3,-
11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzo diazepine-5-one
(5d)
4.2.37. Synthesis of 7-methoxy-8{-3-[4-(2-methyl-4-oxo-3,4-
dihydro-3-quinazolinyl) phenoxy]propoxy}-(11aS)-1,2,3,11a-
tetrahydro-5H-pyrrolo[2,1-c][1,4]benzo diazepine-5-one (5a)
The compound 5a was prepared according to the method de-
scribed for the compound 4a, employing the compound 17a
(693 mg, 1.0 mmol). The crude product was purified by column
chromatography (MeOH/CHCl3, 2%) to afford the compound 5a as
The compound 5d was prepared according to the method de-
scribed for the compound 4a, employing the compound 17d
(781 mg, 1.0 mmol). The crude product was purified by column
chromatography (MeOH/CHCl3, 2%) to afford the compound 5d as
a white solid (344 mg, 55% yield). Mp 74–76 °C; ½a D27
ꢂ
+158.5
(c = 0.1, CHCl3); 1H NMR (CDCl3, 300 MHz): d 1.87–2.14 (m, 6H),
3.70–3.87 (m, 3H), 3.96 (s, 3H), 4.04–4.20 (m, 4H), 6.47 (d, 1H,
J = 15.3 Hz), 6.89 (s, 1H), 7.09 (d, 2H, J = 8.0 Hz), 7.21 (d, 2H,
J = 8.0 Hz), 7.28–7.38 (m, 5H), 7.46 (d, 1H, J = 8.0 Hz), 7.53 (s, 1H),
7.67 (d, 1H, J = 5.1 Hz), 7.78 (d, 2H, J = 3.6 Hz), 7.97 (d, 1H,
J = 15.3 Hz), 8.28 (d, 1H, J = 6.8 Hz); MS (ESI): m/z 627 (M+1)+;
HRMS (ESI m/z) for C38H34N4O5 calcd 627.2607, found 627.2600
(M+1)+; Anal. Calcd for C38H34N4O5: C, 72.83; H, 5.47; N, 8.94.
Found: C, 72.57; H, 5.19; N, 8.78.
a white solid (312 mg, 58%). Mp 76–78 °C; ½a D27
ꢂ
+135.5 (c = 0.1,
CHCl3); 1H NMR (CDCl3, 300 MHz): d 1.84–2.09 (m, 6H), 2.26 (s,
3H), 3.70–3.87 (m, 3H), 3.95 (s, 3H), 4.01–4.10 (m, 4H), 6.82 (s,
1H), 7.03 (d, 2H, J = 8.8 Hz), 7.15 (d, 2H, J = 8.8 Hz), 7.44–7.49 (m,
1H), 7.52 (s, 1H), 7.67 (d, 2H, J = 6.3 Hz), 7.74–7.79 (m, 1H), 8.27
(d, 1H, J = 8.5 Hz); 13C NMR (CDCl3, 75 MHz): d 24.0, 24.2, 28.8,
29.4, 46.5, 53.6, 56.0, 64.4, 65.2, 110.5, 111.5, 115.3, 115.9, 120.2,
120.6, 126.4, 126.6, 126.9, 128.8, 130.1, 134.4, 140.4, 147.3,
147.7, 150.5, 154.7, 159.1, 162.4, 164.5; MS (ESI): m/z 539
(M+1)+; HRMS (ESI m/z) for C31H30N4O5 calcd 539.2294, found
539.2290 (M+1)+; Anal. Calcd for C31H30N4O5: C, 69.13; H, 5.61;
N, 10.40. Found: C, 68.96; H, 5.44; N, 9.93.
4.2.41. 7-Methoxy-8-{4-[(4–4-oxo-2-[(E)-2-phenyl-1-ethenyl]-
3,4-dihydro-3-quinazolinylphenyl)oxy]butyloxy}-(11aS)-1,2,3,-
11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepine-5-one (5e)
The compound 5e was prepared according to the method de-
scribed for the compound 4a, employing the compound 17e
(795 mg, 1.0 mmol). The crude product was purified by column
chromatography (MeOH/CHCl3, 2%) to afford the compound 5e as
4.2.38. 7-Methoxy-8{-4-[4-(2-methyl-4-oxo-3,4-dihydro-3-qui-
nazolinyl)phenoxy] butyloxy}-(11aS)-1,2,3,11a-tetrahydro-5H-
pyrrolo[2,1-c][1,4]benzodiazepine-5-one (5b)
The compound 5b was prepared according to the method de-
scribed for the compound 4a, employing the compound 17b
(706 mg, 1.0 mmol). The crude product was purified by column
chromatography (MeOH/CHCl3, 2%) to afford the compound 5b as
a white solid (358 mg, 56% yield). Mp 76–78 °C; ½a D27
ꢂ
+171.5
(c = 0.1, CHCl3); 1H NMR (CDCl3, 300 MHz): d 1.57–1.75 (m, 4H),
1.85–2.10 (m, 4H), 3.70–3.87 (m, 3H), 3.95 (s, 3H), 4.04–4.20 (m,
4H), 6.47 (d, 1H, J = 15.3 Hz), 6.89 (s, 1H), 7.09 (d, 2H, J = 8.0 Hz),
7.21 (d, 2H, J = 8.0 Hz), 7.28–7.38 (m, 5H), 7.47 (d, 1H, J = 8.0 Hz),
7.53 (s, 1H), 7.67 (d, 1H, J = 5.1 Hz), 7.78 (d, 2H, J = 3.6 Hz), 7.99
(d, 1H, J = 15.3 Hz), 8.30 (d, 1H, J = 6.8 Hz); MS (ESI): m/z 641
(M+1)+; HRMS (ESI m/z) for C39H36N4O5 calcd 641.2742, found
641.2734 (M+1)+; Anal. Calcd for C39H36N4O5: C, 73.11; H, 5.66;
N, 8.74. Found: C, 72.89; H, 5.39; N, 8.51.
a white solid (303 mg, 55% yield). Mp 79–80 °C; ½a D27
ꢂ
+139.5
(c = 0.1, CHCl3); 1H NMR (CDCl3, 300 MHz): d 1.57–1.75 (m, 4H),
1.85–2.10 (m, 4H), 2.26 (s, 3H), 3.70–3.87 (m, 3H), 3.95 (s, 3H),
4.01–4.10 (m, 4H), 6.82 (s, 1H), 7.03 (d, 2H, J = 8.8 Hz), 7.15 (d,
2H, J = 8.8 Hz), 7.44–7.49 (m, 1H), 7.52 (s, 1H), 7.67 (d, 2H,
J = 6.3 Hz), 7.74–7.79 (m, 1H), 8.27 (d, 1H, J = 8.5 Hz); 13C NMR
(CDCl3, 75 MHz): d 24.0, 24.2, 25.5, 25.8, 29.4, 46.5, 53.5, 55.9,
67.5, 68.3, 110.2, 111.3, 115.4, 115.5, 120.0, 120.5, 126.3, 126.5,
126.8, 128.8, 129.9, 134.3, 140.3, 147.2, 147.6, 150.5, 154.6,
159.1, 162.3, 164.4; MS (ESI): m/z 553 (M+1)+; HRMS (ESI m/z)
for C32H32N4O5 calcd 539.2294, found 539.2290 (M+1)+; Anal.
4.2.42. 7-Methoxy-8-{5-[(4-4-oxo-2-[(E)-2-phenyl-1-ethenyl]-
3,4-dihydro-3-quinazolinylphenyl)oxy]pentyloxy}-(11aS)-1,2,3,-
11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepine-5-one (5f)
The compound 5f was prepared according to the method de-
scribed for the compound 4a, employing the compound 17f

540
A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
(809 mg, 1.0 mmol). The crude product was purified by column
to neutralize the system. The ‘solvateoct’ command was used to
solvate the complex in a 10 Å water box with TIP3P water. Equili-
bration of the solvated complex was done by carrying out a short
minimization (500 steps of each steepest descent and conjugate
gradient method), 50 ps of heating and 50 ps of density equilibra-
tion with weak restraints on the complex followed by 500 ps of
constant pressure equilibration at 300 K. The final production run
was performed for the 5 ns and the coordinates were recorded in
every 10 ps. Before submitting for the MM-PBSA production run
we verified that the system has equilibrated. We extracted 500
snapshots from production runs by using ‘extract_coords.mmpbsa’
script and calculated the interaction energies by using ‘bind-
ing_energy.mmpbsa’ script. Both the scripts are available on AMBER
web-site. The final reported binding energies are the average of all
the 500 snapshots.
chromatography (MeOH/CHCl3, 2%) to afford the compound 5f as
a white solid (372 mg, 57% yield). Mp 78–80 °C; ½a D27
ꢂ
+162.5
(c = 0.1, CHCl3); 1H NMR (CDCl3, 300 MHz): d 1.61–1.82 (m, 4H),
1.87–2.14 (m, 6H), 3.70–3.87 (m, 3H), 3.96 (s, 3H) 4.04–4.20 (m,
4H), 6.47 (d, 1H, J = 15.3 Hz), 6.89 (s, 1H), 7.08 (d, 2H, J = 8.7 Hz),
7.22 (d, 2H, J = 8.0 Hz), 7.30–7.42 (m, 5H), 7.48 (dd, 1H, J = 3.6,
8.0 Hz), 7.53 (s, 1H), 7.69 (d, 1H, J = 5.1 Hz), 7.80 (d, 2H,
J = 3.6 Hz), 7.98 (d, 1H, J = 15.3 Hz), 8.31 (d, 1H, J = 8.0 Hz); 13C
NMR (CDCl3, 75 MHz): d 22.5, 24.0, 28.5, 28.8, 29.4, 46.5, 53.5,
56.0, 67.9, 68.6, 110.3, 111.4, 115.4, 115.5, 119.8, 120.0, 120.7,
126.3, 126.9, 127.1, 127.6, 128.6, 129.1, 129.4, 134.3, 135.2,
139.6, 140.4, 147.6, 150.6, 151.9, 159.2, 162.2, 162.4, 164.4; MS
(ESI): m/z 655 (M+1)+; HRMS (ESI m/z) for C40H38N4O5 calcd
655.2920, found 655.2899 (M+1)+; Anal. Calcd for C40H38N4O5: C,
73.38; H, 5.85; N, 8.56. Found: C, 73.53; H, 6.08; N, 8.72.
4.5. In vitro evaluation of cytotoxic activity
4.3. Thermal denaturation studies
The synthesized compounds 4a–f and 5a–f were evaluated for
their in vitro cytotoxicity in selected human cancer cell lines of
breast (Zr-75-1, MCF7), lung (A-549, HOP62), colon (Colo205), oral
(KB, DWD, GURAV), prostate (PC-3), ovarian (A2780) and cervix
(SiHa) origin. A protocol of 48 h continuous drug exposure was
used and a sulforhodamine B (SRB) protein assay was used to esti-
mate cell viability or growth. The cell lines were grown in RPMI
The compounds 4a–f and 5a–f were subjected to DNA thermal
melting (denaturation) studies using duplex form calf thymus DNA
(CT-DNA) using modification reported procedure.49 Working solu-
tions were produced by appropriate dilution in aqueous buffer
(10 mM NaH2PO4/NaH2PO4, 1 mM Na2EDTA, pH 7.00+0.01) con-
taining CT-DNA, (100 lM in phosphate) and the PBD (20 lM) were
prepared by addition of concentrated PBD solutions in methanol to
obtain a fixed [PBD]/[DNA] molar ratio of 1:5 The DNA–PBD solu-
tions were incubated at 37 °C for 0 h prior to analysis sample were
monitored a 260 nm using a Beckman DU-7400 spectrophotometer
fitted with high performance temperature controller. Heating was
applied at a rate of 1 °C minꢁ1 in the 40–90 °C range. DNA helix-
coil transition temperatures (Tm) were determined from the max-
ima in the d (A260)/dT derivative plots. Results for each compound
are shown as mean standard derivation from the least three
determinations and are corrected for the effects of methanol co sol-
vent using a linear correction term. Ligand-induced alteration in
1640 medium containing 10% fetal bovine serum and 2 mM
tamine, and were inoculated into 96-well microtiter plates in 90
at plating densities depending on the doubling time of individual
cell lines. The microtiter plates were incubated at 37 °C, 5% CO2,
95% air and 100% relative humidity for 24 h prior to addition of
L-glu-
lL
experimental drugs. Aliquots of 10
added to the appropriate microtiter wells already containing
90 L of cells, resulting in the required final drug concentrations.
Each compound was evaluated for four concentrations (0.1, 1, 10
and 100 M) and each was done in triplicate wells. Plates were
incubated further for 48 h, and assay was terminated by the addi-
tion of 50 L of cold trichloro acetic acid (TCA) (final concentration,
lL of the drug dilutions were
l
l
DNA melting behavior are given by
D
Tm = Tm (DNA + PBD) ꢁ Tm
l
(DNA alone), where the Tm value for the PBD free CT-DNA is
68.5 0.001 the fixed [PBD]/[DNA] ratio used did not result in
binding saturation of the host DNA duplex for any compound
examined.
10% TCA) and plates were again incubated for 60 min at 4 °C. The
plates were washed five times with tap water and air-dried. Sulfo-
rhodamine B (SRB) solution (50 lL) at 0.4% (w/v) in 1% acetic acid
was added to each of the wells, and plates were incubated for
20 min at room temperature. The residual dye was removed by
washing five times with 1% acetic acid. The plates were air-dried.
Bound stain was subsequently eluted with 10 mM trizma base,
and the absorbance was read on an ELISA plate reader at a wave-
length of 540 nm with 690 nm reference wavelengths. Percent
growth was calculated on a plate-by-plate basis for test wells rel-
ative to control wells. The above determinations were repeated
three times.
4.4. Molecular modeling studies
SYBYL 6.9.2 program (Tripos Inc., St. Louis, MO) was used for
drawing the quinazolinone derivatives. All the compounds were
minimized to 0.001 k cal molꢁ1/Å root-mean-square gradient by
using Gasteiger–Hückel partial atomic charges and Tripos force
field. Radius (30 Å) from the middle atom of DNA was used as a
central atom to scan the entire DNA sequences in molecular dock-
ing. Our ongoing studies indicate that the GOLD docking on DNA se-
quences is the best docking protocol and can reproduce the
crystallographic poses of DNA–ligand complex. Thus we used GOLD
3.2 program for docking of this series of compounds. The default
parameter in GOLD 3.2 (number of islands 5, population size of
100, number of operations was 100,000, a niche size of 2, and a
selection pressure of 1.1, and the van der Waals and hydrogen
bonding were set to 4.0 and 2.5, respectively) was used. The 10
best conformations were generated for each compound. The final
docked conformation of DNA (50-CGCAGAAAATTTCTGCG30)–ligand
complexes from the GOLD docking were opted as an input for MD
simulations. The ‘leaprc.gaff’ (generalized AMBER force filed) was
used to prepare the ligands while ‘leaprc.ff03’ was used for DNA.
The final input files were created by merging DNA and ligand in
a complex as docked pose. The ‘addions’ command implemented
in ‘xleap’ of AMBER 8.0 was used to add the 32 Na+ ions explicitly
4.6. Cell culture
The human melanoma cell line A375 purchased from American
Type culture collection was maintained in Dulbecco’s modified Ea-
gle’s medium (DMEM) (Invitrogen), supplemented with 10% fetal
calf serum and 100 U/ml Penicillin and 100 lg/ml streptomycin
sulfate (Sigma). These cell lines were maintained at 37 °C in a
humidified atmosphere containing 5% CO2 in the incubator.
4.7. MTT cell proliferation assay
A375 cell lines were seeded in a 96-well plate at a cell density of
10,000 cells/well. After overnight (O/N) incubation, the PBD conju-
gates (4b and 5c) were added to the culture media and incubated
for 24 h. The cytotoxicity was assayed by 3-(4,5-dimethyl-2-thioz-
olyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) dye uptake. The

A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
541
cell lines (A375) were incubated at 37 °C for 2 h with MTT at 10%
(i.e., 30 L) of the culture volume. After incubation period, cultures
were removed from incubator and dissolved the resulting forma-
zan by adding 100 L of extraction buffer (20% SDS, 50% dimethyl
formamide). After overnight incubation at 37 °C, the absorbance
was measured at 570 nm using Multimode VarioskanFlash (Ther-
mo Fisher Scientifics) with medium as blank.
GTTT30. The amplified PCR product was visualized on a 1% agarose
gel stained with ethidium bromide.
l
l
Acknowledgments
We thank the National Cancer Institute, Bethesda, for in vitro
anticancer assay in human cell lines. E. V. B., D. D. G., J. S. N. R.,
A. V. and F. S. are thankful to CSIR, New Delhi, for the award of re-
search fellowships. We are also thankful to the Department of Bio-
4.8. Cell cycle analysis
technology
financial assistance.
(BT/PR/7037/Med/14/933/2006), New Delhi; for
5 ꢃ 105 Cells each of A375 cell lines were seeded in 60 mm dish
and were allowed to grow for 24 h. Various concentrations (0–
4 lM) of 4b and 5c were added to the culture media, and the cells
Supplementary data
were incubated for an additional 24 h. Cells were harvested with
Trypsin-EDTA, fixed with ice-cold 70% ethanol at 4 °C for 30 min,
washed with PBS and incubated with 1 mg/ml RNaseA solution
(Sigma) at 37 °C for 30 min. Cells were collected by centrifugation
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.bmc.2009.12.015.
at 2000 rpm for 5 min and further stained with 250 lL of DNA
staining solution [10 mg of Propidium Iodide (PI), 0.1 mg of triso-
dium citrate, and 0.03 mL of Triton X-100 were dissolved in
100 mL of sterile MilliQ water at room temperature for 30 min in
the dark]. The DNA contents of 20,000 events were measured by
flowcytometer (DAKO CYTOMATION, Beckman Coulter, Brea, CA).
Histograms were analyzed using Summit Software.
References and notes
1. Mhaske, S. B.; Argade, N. P. Tetrahedron 2006, 62, 9787.
2. Sinha, S.; Srivastava, M. Prog. Drug Res. 1994, 43, 143.
3. Laszlo, S. E. D.; Quagliato, C. S.; Greenlee, W. J.; Patchett, A. A.; Chang, R. S. L.;
Lotti, V. J.; Chen, T.-B.; Scheck, S. A.; Faust, K. A.; Kivlighn, S. S.; Schorn, T. S.;
Zingaro, G. J.; Siegl, P. K. S. J. Med. Chem. 1993, 36, 3207.
4. Liverton, N. J.; Armstrong, D. J.; Claremon, D. A.; Remy, D. C.; Baldwin, J. J.;
Lynch, R. J.; Zhang, G.; Gould, R. J. Bioorg. Med. Chem. Lett. 1998, 8, 483.
5. Zhang, W.; Mayer, J. P.; Hall, S. E.; Weigel, J. A. J. Comb. Chem. 2001, 3, 255.
6. Gopalsamy, A.; Yang, H. J. Comb. Chem. 2000, 2, 378.
4.9. Protein extraction and western blot analysis
7. Hour, M. J.; Huang, L. J.; Kuo, S. C.; Xia, Y.; Bastow, K.; Nakanishi, Y.; Hamel, E.;
Lee, K. H. J. Med. Chem. 2000, 43, 4479.
8. Xia, Y.; Yang, Z. Y.; Hour, M. J.; Kuo, S. C.; Xia, P.; Bastow, K. F.; Nakanishi, Y.;
Nampoothiri, P.; Hackl, T.; Hamel, E.; Lee, K. H. Bioorg. Med. Chem. Lett. 2001, 11,
1193.
9. Jiang, J. B.; Hesson, D. P.; Dusak, B. A.; Dexter, D. L.; Kang, G. J.; Hamel, E. J. Med.
Chem. 1990, 33, 1721.
10. Griffin, R. J.; Srinivasan, S.; Bowman, K.; Calvert, A. H.; Curtin, N. J.; Newell, D.
R.; Pemberton, L. C.; Golding, B. T. J. Med. Chem. 1998, 41, 5247.
11. Thurston, D. E. Molecular Aspects of Anticancer Drug DNA Interactions; The
Macmillan Press Ltd: London, UK, 1993. pp 54-88.
12. Petrusek, R. L.; Uhlenhopp, E. L.; Duteau, N.; Hurley, L. H. J. Biol. Chem. 1982,
257, 6207.
13. Hurley, L. H.; Reck, T.; Thurston, D. E.; Langley, D. R.; Holden, K. G.; Hertzberg,
R. P.; Hoover, J. R. E.; Gallagher, G. J.; Faucette, L. F.; Mong, S. M.; Johnson, R. K.
Chem. Res. Toxicol. 1988, 1, 258.
14. Thurston, D. E.; Morris, S. J.; Hartley, J. A. Chem. Commun. 1996, 563.
15. Wilson, S. C.; Howard, P. W.; Forrow, S. M.; Hartley, J. A.; Adams, L. J.; Jenkins, T.
C.; Kelland, L. R.; Thurston, D. E. J. Med. Chem. 1999, 42, 4028.
16. Baraldi, P. G.; Balboni, G.; Cacciari, B.; Guiotto, A.; Manfredini, S.; Romagnoli, R.;
Spalluto, G.; Thurston, D. E.; Howard, P. W.; Bianchi, N.; Rutigiiano, C.;
Mischiati, C.; Gambari, R. J. Med. Chem. 1999, 42, 5131.
17. Damayanthi, Y.; Reddy, B. S. P.; Lown, J. W. J. Org. Chem. 1999, 64, 290.
18. Kamal, A.; Praveen Kumar, P.; Seshadri, B. N.; Srinivas, O.; Shiva Kumar, M.;
Sen, S.; Kurian, N.; Aarti, S. J.; Surekha, M. Z. Bioorg. Med. Chem. 2008, 16, 3895.
19. Wang, J. J.; Shen, Y. K.; Hu, W. P.; Hsieh, M. C.; Lin, F. L.; Hsu, M. K.; Hsu, M. H. J.
Med. Chem. 2006, 49, 1442.
Total cell lysates from cultured A375 cells were obtained by lys-
ing the cells in ice-cold RIPA buffer (1XPBS, 1% NP-40, 0.5% sodium
deoxycholate and 0.1% SDS) and containing 100
l
g/mL PMSF, 5
l
l
g/
g/
mL Aprotinin, 5 g/mL leupeptin, 5 g/mL pepstatin and 100
l
l
mL NaF. After centrifugation at 12,000 rpm for 10 min, the protein
in supernatant was quantified by Bradford method (BIO-RAD)
using Multimode varioskan instrument (Thermo-Fischer Scienti-
fics). Thirty micrograms of protein per lane was applied in 12%
SDS–polyacrylamide gel. After electrophoresis, the protein was
transferred to polyvinylidine difluoride (PVDF) membrane (Amer-
sham Biosciences). The membrane was blocked at room tempera-
ture for 2 h in TBS + 0.1% Tween20 (TBST) containing 5% blocking
powder (Santacruz). The membrane was washed with TBST for
5 min, and primary antibody was added and incubated at 4 °C
overnight (O/N). Mouse monoclonal antibodies against p53
(1:100); Goat polyclonal b-tubulin (1:100), Rabbit p27 (c-19)
(1:500) and rabbit polyclonal cdk-2 (M2) (1:500) were purchased
from Santacruz, CA. NF-jB (1:500), cytochrome c (1:500), rabbit
polyclonal b-tubulin (1:500), cleaved/active caspase-3 (1:200)
and b-actin (1:500) antibodies were purchased from Imgenex,
USA. Rabbit polyclonal PARP (1:2000) was purchased from Roche
Scientifics. The membrane was incubated with corresponding
horseradish peroxidase-labeled secondary antibody (1:2000) (San-
ta Cruz) at room temperature for 1 h. Membranes were washed
with TBST three times for 15 min and the protein blots were visu-
alized with chemiluminescence reagent (Thermo Fischer Scienti-
fics Ltd). The X-ray films were developed with developer and
fixed with fixer solution.
20. Hu, W. P.; Liang, J. J.; Kao, C. L.; Chen, Y. C.; Chen, C. Y.; Tsai, F. Y.; Wu, M. J.;
Chang, L. S.; Chen, Y. L.; Wang, J. J. Bioorg. Med. Chem. 2009, 17, 1172.
21. Kamal, A.; Laxman, E.; Reddy, P. S. M. M. Tetrahedron Lett. 2000, 41, 7743.
22. Kamal, A.; Reddy, G. S. K.; Raghavan, S. Bioorg. Med. Chem. Lett. 2001, 13, 387.
23. Kamal, A.; Shankaraiah, N.; Devaiah, V.; Reddy, K. L. Tetrahedron Lett. 2006, 47,
6553.
24. Kamal, A.; Ramesh, G.; Laxman, N.; Ramulu, P.; Srinivas, O.; Neelima, K.;
Kondapi, A. K.; Srinu, V. B.; Nagarajaram, H. M. J. Med. Chem. 2002, 45, 4679.
25. Kamal, A.; Ramesh, G.; Ramulu, P.; Srinivas, O.; Rehana, T.; Sheelu, G. Bioorg.
Med. Chem. Lett. 2003, 13, 3451.
26. Kamal, A.; Devaiah, V.; Reddy, K. L.; Kumar, M. S. Bioorg. Med. Chem. 2005, 13, 2021.
27. Kamal, A.; Naseer, A. K.; Reddy, S.; Ahmed, S. K.; Kumar, M. S.; Juvekar, A.; Sen,
S.; Zingde, S. Bioorg. Med. Chem. Lett. 2007, 19, 5345.
4.10. RNA isolation and quantitative RT-PCR
28. Kamal, A.; Kumar, P. P.; Seshadri, B. N.; Srinivas, O.; Kumar, M. S.; Sen, S.;
Kurian, N.; Juvekar, A.; Zingde, S. Bioorg. Med. Chem. 2008, 16, 3895.
29. Kamal, A.; Shankaraiah, N.; Devaiah, V.; Reddy, K. L.; Juvekar, A.; Kurian, N.;
Zingde, S. Bioorg. Med. Chem. Lett. 2008, 18, 1468.
30. Tomisek, A. J.; Christensen, B. E. J. Am. Chem. Soc. 1948, 70, 2423.
31. Raffa, D.; Edler, M. C.; Daidone, G.; Maggio, B.; Merickech, M.; Plescia, S.;
Schillaci, D.; Bai, R.; Hamel, E. Eur. J. Med. Chem. 2004, 39, 299.
32. Sailaja, S.; Rao, F. T.; Rajanarendar, E.; Krishnamurthhy, A. J. Ind. Chem. Soc.
1988, 65, 200.
RNA isolation was carried out by trizol method (Invitrogen)
according to the manufacturer’s recommendation. C DNA synthesis
was carried out using Invitrogen Super Script II (first strand syn-
thesis kit). Second strand synthesis was done by carrying out PCR
with gene specific primers and GAPDH was used as internal con-
trol. Bcl-2 primer sequence FP-50CTGTGGATGACTGAGTACCT30
and RP-50GAGACAGCCAGGAGA AATCA30 p21 primer sequence FP-
50 CACCGAGACACCACTGGAGG30 and RP-50GAGAAGATCAGCCGGC
33. Kamal, A.; Rajendra, D.; Reddy, R.; Reddy, M. K.; Balakishan, G.; Shaik, T. B.;
Chourasia, M.; Sastry, G. N. Bioorg. Med. Chem. 2009, 17, 1557.

542
A. Kamal et al. / Bioorg. Med. Chem. 18 (2010) 526–542
34. Reddy, A. S.; Pati, S. P.; Kumar, P. P.; Pradeep, H. N.; Sastry, G. N. Curr. Protein
Pept. Sci. 2007, 8, 329.
35. Jones, G.; Willett, P.; Glen, R. C.; Leach, A. R.; Taylor, R. J. Mol. Biol. 1997, 267,
727.
41. Luo, Y.; Hurwitz, J.; Massague, J. Nature 1995, 375, 159.
42. Bharti, A. C.; Aggarwal, B. B. Biochem. Pharmacol. 2002, 64, 883.
43. Shishodia, S.; Amin, H.; Lai, R.; Aggarwal, B. B. Biochem. Pharmacol. 2005, 70,
700.
36. Case, D. A.; Darden, T. A.; Cheatham, T. E.; Simmerling, C. L.; Wang, J.; Duke, R.
E.; Luo, R.; Merz, K. M.; Wang, B.; Pearlman, D. A.; Crowley, M.; Brozell, S.; Tsui,
V.; Gohlke, H.; Mongan, J.; Hornak, V.; Cui, G.; Beroza, P.; Schafmeister, C.;
Caldwell, J. W.; Ross, W. S.; Kollman, P. A. AMBER8, University of California: San
Francisco, CA, 2004.
44. Wang, X.; Jiang, X. Ann. Rev. Biochem. 2004, 3, 87.
45. Kluck, R. M.; Wetzel, E. B.; Green, D. R.; Newmeyer, D. D. Science 1997, 275,
1132.
46. Gross, A.; McDonnell, J. M.; Korsmeyer, S. J. Genes Dev. 1999, 13, 1899.
47. Adams, J. M.; Cory, S. Curr. Opin. Immunol. 2007, 19, 488.
48. Hu, W. P.; Yu, H. S.; Sung, P. J.; Tsai, F. Y.; Shen, Y. K.; Chang, L. S.; Wang, J. J.
Chem. Res. Toxicol. 2007, 20, 905.
37. Roux, B.; Simonson, T. Biophys. Chem. 1999, 78, 1.
38. Honig, B.; Nicholls, A. Science 1995, 268, 1144.
39. Taguchi, T.; Kato, Y.; Baba, Y.; Nishimura, G.; Tanigaki, Y.; Horiuchi, C.;
Mochmatsu, I.; Tsukuda, M. Oncol. Rep. 2004, 11, 421.
40. Chen, J.; Jackson, P. K.; Kirschner, M. W.; Dutta, A. Nature 1995, 374, 386.
49. Jones, G. B.; Davey, C. L.; Jenkins, T. C.; Kamal, A.; Kneale, G. G.;
Neidle, S.; Webster, G. D.; Thurston, D. E. Anti-Cancer Drug Des. 1990,
5, 249.