Synthesis of new acridone derivatives, inhibitors of NS3 helicase, which efficiently and specifically inhibit subgenomic HCV replication

Article abstract of DOI:10.1021/jm901741p

A new goup of acridone derivatives, obtained by reaction of acridone-4-carboxylic acid derivatives with aromatic amines, was tested to determine the inhibitory properties toward the NS3 helicase of hepatitis C virus (HCV). Six compounds inhibited the NS3 helicase at low concentrations (IC ₅₀ from 1.5 to 20 μM). The acridone derivatives probably act via intercalation into double-stranded nucleic acids with a strong specificity for double-stranded RNA, although an interaction with the enzyme cannot be excluded. Testing in the subgenomic HCV replicon system revealed that compounds 10 and 13 are efficient RNA replication inhibitors, with EC₅₀ of 3.5 and 1 μM and therapeutic indexes of >28 and 20, respectively. Compound 16, with EC₅₀ < 1 μM and TI > 1000, is extremely specific and practically noncytotoxic at the concentrations tested, proving that the acridone derivatives may be regarded as potential antiviral agents. Although the mechanism of action of 16 in the replicon system remains unclear, it is the key lead compound for further development of anti-HCV drugs.

Full text of DOI:10.1021/jm901741p

J. Med. Chem. 2010, 53, 3117–3126 3117
DOI: 10.1021/jm901741p
Synthesis of New Acridone Derivatives, Inhibitors of NS3 Helicase, Which Efficiently and Specifically
Inhibit Subgenomic HCV Replication
ꢀ ‡,†
€
Anna Stankiewicz-Drogon, Bernd Dorner,§,† Thomas Erker,*,§ and Anna M. Boguszewska-Chachulska*, ,^
‡Institute of Biochemistry and Biophysics, PAS, Pawinskiego 5a, 02-106 Warsaw, Poland, §University of Vienna, Department of Medicinal
Chemistry, Althanstrasse 14, 1090 Vienna, Austria, Genomed, Ponczowa 12, 02-971 Warsaw, Poland, and ^Warsaw University of Technology,
Faculty of Chemistry, Noakowskiego 3, 00-664 Warsaw, Poland. †These authors contributed equally to this work.
Received November 24, 2009
A new goup of acridone derivatives, obtained by reaction of acridone-4-carboxylic acid derivatives
with aromatic amines, was tested to determine the inhibitory properties toward the NS3 helicase
of hepatitis C virus (HCV). Six compounds inhibited the NS3 helicase at low concentrations (IC50 from
1.5 to 20 μM). The acridone derivatives probably act via intercalation into double-stranded nucleic acids
with a strong specificity for double-stranded RNA, although an interaction with the enzyme cannot
be excluded. Testing in the subgenomic HCV replicon system revealed that compounds 10 and 13 are
efficient RNA replication inhibitors, with EC50 of 3.5 and 1 μM and therapeutic indexes of >28 and 20,
respectively. Compound 16, with EC50 < 1 μM and TI > 1000, is extremely specific and practically
noncytotoxic at the concentrations tested, proving that the acridone derivatives may be regarded as
potential antiviral agents. Although the mechanism of action of 16 in the replicon system remains
unclear, it is the key lead compound for further development of anti-HCV drugs.
Introduction
Still, as an enzyme indispensable for HCV replication
that unwinds double-stranded (ds) forms of RNA and allows
viral replication and translation to occur,7 the NS3 helicase/
NTPase represents a tempting target for specific anti-HCV
drug design. Another advantage is that NS3 helicase does not
possess close homologues among human cellular enzymes.6,8,9
Its inhibitors could be used together with inhibitors of other
viral proteins in a cocktail, preventing HCV from escaping
the treatment pressure by the emergence of drug-resistant
mutants. Identification of several helicase inhibitors, belong-
ing to various chemical groups, capable of inhibiting viral
replication, was reported by our laboratory10,11 but there is
still a need for compounds with lower effective concentrations
and/or higher therapeutic indices.
Recently, we presented results of our studies on a series of
acridone derivatives that inhibited HCV RNA synthesis in the
subgenomic replicon system in a dose-dependent manner with
an activity/cytotoxicity window of 40,12 supporting the pos-
sibility that acridone derivatives could feature as lead com-
pounds in the development of anti-HCV drugs. This finding
was further confirmed by Manfroni and co-workers, who
identified a group of acridone derivatives that inhibited HCV
RNA replication in the subgenomic replicon system and for
one compound demonstrated a weak inhibition of NS3 heli-
case activity.13 One main differencebetween ourleadstructure
and the acridone derivatives used by Manfroni et al. was the
carboxylic function. The amide bonding formed after the
derivatization with amines seemed to increase affinity and
selectivity for NS3 helicase as we could prove in our paper.12
In this study, we report the synthesis of new derivatives of
acridone, namely of 5-methoxyacridone-4-carboxylic acid
(MACA) and selection of compounds that not only efficiently
inhibit the NS3 helicaseinthe in vitro assay but are also potent
About 180 million people worldwide are chronically in-
fected with hepatitis C virus (HCVa), an agent responsible
for 50-76% of all cases of liver cancer and for two-thirds of
all liver transplants in the developed world (World Health
Organization (WHO), 2007). As the current combination
therapy of pegylated interferon and ribavirin is long and
ineffective in about 60% of patients chronically infected with
HCV genotype 1 and in about 20% of those with HCV
genotypes 2 and 3,1 there is an urgent need for more effective,
better tolerated, and less expensive treatments.
The development of antiviral agents directly targeting the
viral life cycle seems to be the most promising therapeutic
strategy, as it should block HCV replication and thus spread
of infection. This goal could be achieved by direct inhibition
of viral enzymes involved in the replication process, such as
the NS3 protein, exerting both serine protease and RNA
helicase/NTPase activities, or the NS5B protein—the RNA-
dependent RNA polymerase. A few drugs targeting the
NS3/4A protease,2-4 or the NS5B polymerase,5 are already
in clinical trials, but no NS3 helicase inhibitor has reached
this level of development, probably because its mechanism of
action is not yet entirely understood, thus hampering the
rational design of compounds targeting the helicase.6
*To whom correspondence should be addressed. For T.E., chemistry:
phone, þ43 1 4277 55003; fax, þ43 1 4277 9551; E-mail: thomas.
erker@univie.ac.at. For A.M.B-C., biology: phone, þ48 22 498 2948;
fax, þ48 22 644 60 25; E-mail: annab-ch@genomed.pl.
a Abbreviations: HCV, Hepatitis C virus; MACA, 5-methoxyacri-
done-4-carboxylic acid; CC50, concentration of compound that inhib-
ited cell growth by 50%; EC50, 50% effective concentration; IC50, 50%
inhibitory concentration; TI, therapeutic index; IFN, interferon; NTP,
nucleoside triphosphate.
r
2010 American Chemical Society
Published on Web 03/25/2010
pubs.acs.org/jmc

3118 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 8
Scheme 1. Synthesis of Compounds 8-18a
Stankiewicz-Drogonꢀ et al.
a Reagents and conditions: (i) Cu0/K2CO3, EtOH, reflux; (ii) POCl3, CH3CN, reflux; (iii) (1) HBr, Ac2O, reflux, (2) benzylchloride, K2CO3, DMF,
50 ꢀC, (3) aq LiOH, CH3OH, reflux; (iv) SOCl2/pyridine, toluol, amine, Et3N, room temperature.
Table 1. List of Substituents of Compounds 1-18
inhibitorsofHCVreplicationwithlowcytotoxicity for human
hepatoma cells.
compd
R1
R2
R3
1, 4
2, 5
3, 6
7
H
Cl
F
OCH3
OCH3
OCH3
Results
Chemistry. The acridone derivatives 8-18 were synthe-
sized as outlined in Scheme 1. Therefore 2-amino-3-meth-
oxybenzoic acid was coupled with either 2-bromobenzoic
acid, 2-bromo-4-chlorobenzoic acid, or 2-bromo-4-fluoro-
benzoic acid in a copper-catalyzed reaction to obtain com-
pounds 1,14 2, and 3. Cyclization with phosphorus(V)oxy-
chloride yielded the acridonic acid derivatives 4,14 5, and 6.
Compound 7 was synthesized in a three-step reaction as
described in literature15 outgoing from 4. The acridonic acid
derivatives 4, 5, 6, and 7 were activated with thionyl chloride
and then reacted with aromatic amines12 to achieve the
acridone-4-carboxamide derivatives 8-18 (Table 1).
H
H
H
H
H
Cl
Cl
Cl
F
OCH2C6H5
OCH3
OCH3
8
a
b
c
9
10
11
12
13
14
15
16
17
18
OCH3
OCH3
e
OCH3
OCH3
b
c
OCH3
OCH3
e
b
c
F
OCH3
OCH3
OCH2C6H5
F
e
H
d
Biology. Helicase Expression and Activity. The NS3 heli-
case of genotype 1a was obtained as previously described.16
New variants of the NS3 helicase (genotype 1b and 3a) were
isolated and cloned from infected blood samples from Polish
HCV-infected patients and their nucleotide sequences were
established and deposited in the GeneBank database under
the following accession numbers: 1255063 and 1255068
(Bernatowicz-Najda et al., submitted). Sequence compari-
sons with the helicase of genotype 1a revealed a significant
divergence of nucleotide and amino acid sequences, typical
of HCV isolates (79% and 91% identity for the isolates of
genotype 1, 70% and 81-83% identity for both isolates of
genotypes 1 and 3, respectively). None of the highly con-
served NTP-ase and helicase motifs was changed. New heli-
case variants of genotypes 1b and 3a were expressed in a
Bac-to-Bac expression system and purified from insect cells.
About 15 mg/mL were obtained for each of the new helicase
variants.
In the fluorometric helicase activity assay using a dsDNA
substrate,12,16 the proteins appeared to have different initial
reaction velocities (data not shown), helicase 3a being the
most potent enzyme that at 20 nM could unwind dsDNA
with an initial velocity 4-fold higher than that of helicase 1b.
Inhibition of HCV Helicase Activity. To test the poten-
tial antihelicase activity of acridone derivatives, the fluoro-
metric helicase activity assay with the genotype 1a helicase
was applied as previously described.12 The compounds dis-
solved in dimethyl sulfoxide (DMSO) were initially tested at
10-100 μM or 10-500 μM concentrations, depending on the
solubility of the inhibitor. The compounds showing antiheli-
case activity were subsequently tested in smaller increments

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 8 3119
around the approximated IC50 values (concentration of inhi-
bitor that reduces helicase activity by 50%).
of 8.6 ( 2.7 μM and 8.4 ( 0.4 μM established for compound
16 in the assay with 20 nM or 50 nM enzyme, respectively,
confirmed the hypothesis that the inhibitory properties of the
compounds tested are not influenced by helicase concentra-
tion, at least at the enzyme concentrations studied.
All the compounds studied exerted an inhibitory effect on
unwinding of dsDNA by the helicase, but the strength of this
interaction differed significantly, with IC50 values ranging
from 1.5 μM for compound 14 to 751 μM for compound 8
(Table 2). The position of the nitrogen atom in the pyridyl
ring as well as the presence of chloride or fluoride substitu-
tions at the C2 position of the acridone structure or at the C4
position of the pyridyl ring modified the inhibitory potential
of acridone derivatives. On the other hand, addition of a
3,4,5-trimethoxyphenyl group instead of the pyridyl ring led
to the weakest inhibitor, compound 8.
The mechanism of antihelicase activity of the most potent
helicase inhibitors (IC50 e 20 μM) with respect to the enzyme
or dsDNA was studied as described previously, in the helicase
assay with increasing enzyme or substrate concentration and
constant inhibitor concentration.10-12 Inhibition appeared
independent of the enzyme concentration (Figure 1), suggest-
ing lack of competition and interaction, while in the presence
of increasing substrate concentrations, a decrease of inhibi-
tion was observed (Figure 2), clearly indicating interaction of
the compounds with the substrate. Additionally, IC50 values
To further examine the possibility that the compounds
interact with the helicase, the IC50 values for compound 16
were established using 50 nM enzymes from different HCV
genotypes: 1a, 1b, and 3a. Inhibition of helicases 1a and 3a
appeared comparable (IC50 of 8.4 μM and 7.3 μM, res-
pectively), while helicase 1b was 2.5-3-fold more resistant
to the inhibitory activity of 16 (IC50 of 19.3 μM), which may
imply a specific interaction of 16 with the helicase (Figure 3).
To check if the inhibition of the helicase activity by
acridone derivatives depends on the ATP concentration,
the IC50 values of 14, 15, and 16 were measured at three
ATP concentrations, with a constant Mn2þ to ATP molar
ratio of 4:1. The three inhibition curves (data not shown) and
the IC50 values (Table 3) did not differ, proving that the
ATPase activity is not inhibited.
Compounds inhibiting the HCV helicase activity with
IC50 e 20 μM were tested for their intercalatory properties
on both dsDNA and dsRNA substrates in a dsNA gel
migration retardation assay as described previously.11,12
In this assay, the compounds that intercalate into dsNA
inhibit ethidium bromide intercalation and the dsNA
band disappears partially or totally. This approach revealed
weak dsDNA intercalation properties of the compounds at
100 μM or 500 μM, much lower than that of epidoxorubicin,
a potent intercalator, used as a positive control (Figure 4A).
Compound 9 seems to be the strongest dsDNA intercalator
of all the compounds analyzed; a slightly lower effect was
observed for 10. For dsRNA, the cellular target of the HCV
helicase, the intercalatory properties of the compounds, were
stronger, visible already at 100 μM compound 10. Com-
pounds 13 and 16 were slightly weaker intercalators because
the RNA band disappeared only at 500 μM compound,
whereas the other compounds did not intercalate into
dsRNA (Figure 4B).
Table 2. Inhibitory Activities of MACA Derivativesa
compound
IC50b ( SDc (μM)
8
751.0 ( 33.7
6.2 ( 2.1
9
10
11
12
13
14
15
16
17
18
20.6 ( 6.3
35.8 ( 10.2
64.7 ( 44.6
54.6 ( 4.0
1.5 ( 0.9
4.7 ( 1.3
8.6 ( 2.7
46.3 ( 17.9
8.0 ( 2.2
a All the data represent mean values for three independent experi-
ments. b Concentration of inhibitor necessary to reduce the NS3 helicase
activity by 50%. c Standard deviation.
Figure 1. Inhibition of the NS3 helicase activity by MACA derivatives at increasing enzyme concentrations. The results are presented as the
percent activity of the helicase tested in the same conditions but with DMSO instead of inhibitor.

3120 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 8
Stankiewicz-Drogonꢀ et al.
Figure 2. Inhibition of the NS3 helicase activity by MACA derivatives at increasing dsDNA substrate concentrations. The results are
presented as the percent activity of the helicase tested in the same conditions but with DMSO instead of inhibitor.
Table 3. Inhibition of the NS3 Helicase Activity by Compounds 14, 15,
and 16 at Three ATP Concentrationsa
IC50b ( SDc [μM]
compd
0.5 mM ATP
1.5 mM ATP
2.5 mM ATP
14
15
16
1.1 ( 0.3
6.5 ( 0.4
10.9 ( 1.9
1.5 ( 0.9
4.7 ( 1.3
8.6 ( 2.7
1.1 ( 0.2
5.1 ( 1.0
9.9 ( 2.8
a The results are presented as the percent activity of the helicase tested
in the same conditions but with DMSO instead of inhibitor. b Concen-
tration of inhibitor necessary to reduce the NS3 helicase activity by 50%.
c Standard deviation.
growth by 50%, CC50), reducing the HCV RNA level in a
dose-dependent manner with a therapeutic index (TI=CC50/
EC50) of >28, 20.1, and >1000, respectively. In our studies,
16 was a stronger inhibitor of RNA synthesis than ribavirin
(EC50 of 0.98 μM and 17.6 μM, respectively) and comparable
to 40-azidocytidine (EC50 of 1.4 μM in our assay (Table 4)
and 1.28 μM according to previous reports17).
Figure 3. Inhibition of the helicase activity of helicases derived
from various HCV genotypes: 1a (hel1a), 1b (hel1b), and 3a (hel3a)
by compound 16. IC50, concentration of inhibitor necessary to
reduce the NS3 helicase activity by 50%.
The inhibition of HCV RNA replication by the best
compound, 16, was additionally measured using reverse
transcription and real-time PCR. For this purpose, Huh-7
cells carrying the genotype 1b subgenomic replicon were
grown for 7 days with 16 (1, 10, and 100 μM) or without
inhibitor. For each sample, total RNA was isolated and 5 μg
of RNA were used to obtain cDNA in the reverse transcrip-
tion reaction. The same amount of cDNA from each sample
was used as template for real-time PCR. EC50 estimated by
this method was 4.5 ( 2.4 μM, which gives a TI above 220. At
10 μM, compound 16 replication was inhibited up to 85%
and this level of replication was maintained at 100 μM
compound.
To test a possible synergy/antagonism of acridone deriva-
tive 16, the best inhibitor of HCV RNA replication, with
other anti-HCV compounds, the antiviral activity of 16 was
investigated in combination with interferon-γ (IFN-γ) or
ribavirin. The Prichard and Shipman MacSynergy II soft-
ware,18 which examines drug interaction using either the
Bliss Independence or the Loewe Additivity as null reference
model for additivity, was used. In this algorithm, if the
Antiviral Activity in the HCV Replicon System. Selected
acridone derivatives were tested at concentrations ranging
from 1 to 200 μM or from 1 μM to 1 mM, depending on the
compound solubility in DMSO, both in the replicon RNA
amplification assay10-12 and in the cytotoxicity studies using
the XTT method.12 Of 11 compounds tested, five inhibited
RNA replication, with EC50 (50% effective concentration
defined as the inhibitor concentration that reduces lumines-
cence by 50%) values ranging from 1 to 20 μM (Table 4).
However, the strong inhibition of HCV replication observed
for compounds 9 and 12 was rather due to the cytotoxicity of
the compounds than to the actual inhibition of RNA synth-
esis. Derivatives synthesized on the basis of 9 had either weak
potency, decreasing HCV replication only by 30% without
greater decrease in RNA levels upon further addition of the
compound (11 or 15), or had no effect on RNA replication
at the concentrations examined. Nevertheless, three com-
pounds, 10, 13, and 16, exhibited antiviral activity together
with low cytotoxicity (50% cytotoxic concentration defined
as the concentration of the compound that inhibits cell

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 8 3121
Figure 4. Intercalation assay for the MACA derivatives. Their intercalatory properties are reflected by the disappearance of dsDNA (A) or
dsRNA (B) bands. DMSO: dsNA incubated with DMSO; Epi: dsNA incubated with epidoxorubicin; 8-18: dsNA incubated with selected
compounds at given concentrations (μM).
Table 4. Inhibition of HCV Replication in Huh-7 Cells Carrying the
Subgenomic Replicona
the zero plane indicates an antagonistic effect. The synergy
areas were displayed graphically after subtracting the theo-
retical additive surface from the one obtained experimen-
tally. The data presented are the result of three independent
experiments. The combinations of 16 with either IFN-γ or
ribavirin resulted in an additive activity (Figure 5).
To obtain replicon mutants resistant to compound 16,
Huh-7 cells bearing the subgenomic replicon were grown in
the presence of 10 μM 16 and under the selective pressure of
G418. In these conditions, cells lacking the replicon or
containing the replicon susceptible to 16 are killed and those
that acquire mutations conferring resistance to 16 survive.
compd
EC50b (μM)
CC50c (μM)
TId
8
202.7 ( 26.2
2.3 ( 1.0
3.5 ( 1.6
f
>500
2.5 ( 0.4
>100
>2.5
1.1
9
10
11
12
13
14
15
16
17
18
>28
n/ae
3.2
171.3 ( 26.3
15.8 ( 1.9
19.3 ( 3.2
>100
5.0 ( 0.9
0.96 ( 0.36
>100
20.1
n/a
f
>100
>1000
n/a
0.98 ( 0.37
>100
>100
>1000
n/a
n/a
>100
>100
Derivative 16 inhibited HCV RNA replication with EC50 =
0.98 μM in naıve cells but with EC as high as 251 μM in
¨
ribavirin
40azidocytidine
17.6 ( 2.2
1.4 ( 0.7
1060 ( 321
>200
60.2
>143
50
mutant cells, i.e., more than 2 orders of magnitude less
efficiently. RNA from compound 16-resistant colonies was
isolated, reverse transcribed, and sequenced to search for
mutations responsible forthe resistance to the compound. No
nucleotide (and thus no amino acid) substitution was found
in the NS3-NS5B region of the compound 16-resistant cells.
a Each experiment was performed independently at least three times.
b Inhibitor concentration needed to reduce viral replication to 50%.
c Inhibitor concentration that inhibits cell growth by 50%. d Therapeutic
index. e Not applicable. f Inhibition of HCV replication of 30% was
achieved at 5.8 μM 11 and 2.7 μM 15 and maintained at this level even
when the compound concentration was increased to 100 μM.
Discussion
inhibitory effect of the compounds studied is additive, data
points form a horizontal surface that equals the zero plane.
A surface that lies above the zero plane indicates a synergistic
effect of the combination of inhibitors, while a surface below
All MACA derivatives tested appeared efficient inhibitors
of the HCV helicase activity in the in vitro assay. The position
and nature of the substituent is important for the biological

3122 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 8
Stankiewicz-Drogonꢀ et al.
Figure 5. Inhibition of HCV RNA replication by (A) a combination of 16 and IFN- γ and (B) 16 and ribavirin (RV). Values under the zero
plane indicate antagonistic activity, values in the zero plane indicate additive activity, and the values above the zero plane indicate synergistic
activity.
activity of acridines and acridones,19,20 and our data strongly
support this assumption.
interaction of acridone derivatives with other enzymes (e.g.,
the HCV helicase) should be considered. Although direct
interaction of acridone derivatives with the viral helicase
was not detected in our enzymatic assay (Figure 1), creation
of a ternary complex enzyme:DNA:intercalator cannot be
excluded.22 A specific compound 16-NS3 interaction is sug-
gested by the differences in the inhibition of helicases from
genotypes 1a, 1b, and 3a exerted by 16 (Figure 3).
Presence of the pyridyl ring and the position of the nitrogen
atom at the ring determined the strength of the antihelicase
activity as demonstrated by virtual lack of activity of com-
pound 8 and a 3-fold lower IC50 value reached for 9 in
comparison with 10. Moreover, the addition of a chloride
(12) or a fluoride (15) atom at the C2 position of the acridone
structure of 9 led to two compounds that differed more than
10-fold in their inhibitory potential, with IC50 of 5.6 μM for 15
and 64.7 μM for 12. Halogenation of 10 at the same posi-
tion gave similar differences in activity of 16 (IC50 = 8.6 μM)
and 13 (IC50 = 55.6 μM), and in both situations the substitu-
tion of a hydrogen by a fluoride atom produced more potent
helicase inhibitors than prototype compounds, while the
substitution by a chloride atom decreased the anti-HCV
activity of MACA derivatives. The addition of a chloride or
fluoride moiety to C4 at the pyridyl ring also influenced
the antihelicase activity of the compounds, and the combina-
tion of chloride substitution at this position with chloride at
theC2positionof the acridone structure ledtothemostpotent
helicase inhibitor, 14 (IC50 = 1.5 μM).
Our studies on the mechanism of action of acridone deri-
vatives as helicase inhibitors suggest that these compounds
interact with the dsDNA substrate rather than with the
enzyme. Because natural and synthetic acridine and acridone
drugsareknown toshare the commonpropertyofnucleic acid
(NA) intercalation,21 dsDNA intercalation seems a possible
way of inhibiting the helicase in our in vitro assay. Transloca-
tion of the enzyme along the NA strand is inhibited both by
the increased demand for the energy due to stabilization of
dsNA structure by intercalators22 and by its modification as
the NS3 helicase seems sensitive to the NA duplex structure.23
Still, if dsDNA intercalation were the only mechanism of
helicase inhibition by the acridone derivatives, all of them
would inhibit NS3 helicase-mediated dsDNA unwinding with
the potency reflected by their intercalatory potential. How-
ever, this is not the case because the most potent helicase
inhibitor 14 did not reveal any intercalatory properties.
It was shown that side chain substitutions in the acridone
derivatives, protruding into the major or minor grooves of the
NA, are important for compound-NA interactions,21,24,25
and thatthe biologicalactivities of acridonedrugs arenot only
due to their binding to DNA but also to their direct interac-
tion with cellular topoisomerases and telomerases.19,26 Thus
Further studies conducted inthe HCV subgenomic replicon
system showed that antihelicase properties of the compounds
do not necessarily imply their inhibitory effect on RNA
synthesis. Although the MACA derivative 9 was a stronger
helicase inhibitor than 10, the latter and its derivatives exerted
more potent inhibition of HCV RNA synthesis in the replicon
system without cytotoxic effect on Huh-7 cells. Interestingly, a
double chloride substitution of 9 that led to the most potent
helicase inhibitor 14 resulted in complete loss of anti-HCV
properties, probably due to a decrease in the permeability of
the cell membrane for 14. These data suggest that an addi-
tional mechanism must be involved in the inhibition of viral
RNA synthesis in the replicon system, probably based on the
intercalating properties of acridone derivatives as revealed by
a strong affinity of 10, 13, and 16 for dsRNA. This preference
for dsRNA is an advantageous feature for inhibitors of
amplification of RNA viruses because such molecules could
modify the secondary structures of viral untranslated regions
(UTRs) and of dsRNA intermediates formed during genome
replication without affecting cellular DNA.
Compound 16 was also tested in the replicon system for its
synergy/antagonism in combination with ribavirin or IFN-γ;
the effect of both drug combinations was additive, which
suggests that 16 does not interfere with the metabolism of
either IFN-γ or ribavirin and probably has a different mode of
action. Both synergistic and antagonistic effects of anti-HCV
drug combinations have already been reported, e.g., telaprevir
and boceprevir, both NS3/4A inhibitors, with nitazoxanide27
or ribavirin with a nucleoside analog 20-C-methylcytidine, an
NS5B polymerase inhibitor.28 Thus the additive effect of the
16 combination with IFN-γ or ribavirin is a good prognostic
if it is considered as a lead compound for development of a
new generation of anti-HCV drugs.
Moreover, colonies resistant to compound 16 were ob-
tained, although no nucleotide substitution in the region
coding for the nonstructural proteins (NS3-NS5) was de-
tected. The possibility of a mutation in the reporter gene,

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 8 3123
luciferase, was excluded by real-time PCR experiments that
clearly showed a dose-dependent decrease in viral RNA levels
upon addition of 16. Thus, the action of 16 could consist in its
binding to the 50UTR and blocking RNA replication at the
very beginning of the process by preventing the NS5B poly-
merase from binding to the viral RNA. Another hypothesis
presumes compound 16-induced mutations of host cell fac-
tors, e.g., inosine monophosphate dehydrogenase (IMPDH).
Since acridone-based inhibitors of IMPDH have been re-
ported recently29 and since one of the putative mechanisms
of ribavirin action in anti-HCV therapy is IMPDH inhibi-
tion,30 inhibition of this enzyme by 16 could contribute to its
antiviral effect. Inhibition of topoisomerase II and protein
kinase C (PKC) should also be considered, since inhibition of
these proteins was reported for other antiviral acridone
derivatives.19,31 Yet, interaction of compound 16 with the
NS3 helicase cannot be excluded since a marginal antiviral
effect exerted by 16 in mutant cells was observed. Mechanism
of action of compound 16, whose understanding is crucial for
development of highly effective anti-HCV drugs, is a subject
of further investigations.
4.06 (s, 3H, OCH3), 7.16 (s, 2H), 7.21-7.32 (m, 1H), 7.36-7.49
(m, 2H), 7.77-7.85 (m, 1H), 8.41-8.55 (m, 2H), 10.58 (s, 1H,
NH), 12.25 (s, 1H, NH). 13C NMR (DMSO-d6): δ 55.8 (2ꢀ
OCH3), 56.4 (OCH3), 60.1 (OCH3), 99.5 (2ꢀ CH), 112.8 (CH),
116.9 (CH), 118.7 (Cq), 120.1 (CH), 120.9 (Cq), 121.5 (Cq), 121.6
(CH), 130.7 (CH), 130.9 (Cq), 133.7 (CH), 134.2 (Cq), 134.4
(Cq), 139.6 (Cq), 147.6 (Cq), 152.6 (Cq), 166.6, (CON), 176.3
(CO). MS m/z: 434 (41%, Mþ), 252 (40%), 209 (24%), 183
(100%), 168 (65%).
5-Methoxy-N-(pyridin-2-yl)-acridone-4-carboxamide (9). The
compound was synthesized according to the general proce-
dure with 4 (0.269 g, 1 mmol) as acridonic acid derivative and
2-aminopyridine (0.188 g, 2 mmol) as amine. Yield: 0.176 g
(51%) yellow solid; mp: 272-276 ꢀC. 1H NMR (DMSO-d6): δ
7.21-7.33 (m, 2H), 7.33-7.45 (m, 2H), 7.77-7.85 (m, 1H),
7.88-8.00 (m, 1H), 8.10-8.19 (m, 1H), 8.43-8.64 (m, 3H),
11.17 (s, 1H, NH), 12.26 (s, 1H, NH). 13C NMR (DMSO-d6): δ
56.5 (OCH3), 112.9 (CH), 115.9 (CH), 116.9 (CH), 117.7 (Cq),
120.2 (CH), 120.4 (CH), 120.9 (Cq), 121.6 (Cq), 121.7 (CH),
130.9 (Cq), 131.2 (CH), 134.7 (CH), 138.2 (CH), 139.9 (Cq),
147.6 (Cq), 148.1 (CH), 151.5 (Cq), 167.5 (CON), 176.3 (CO).
MS m/z: 345 (98%, Mþ), 251 (100%), 236 (32%), 223 (86%).
5-Methoxy-N-(pyridin-3-yl)-acridone-4-carboxamide (10). The
compound was synthesized according to the general proce-
dure with 4 (0.269 g, 1 mmol) as acridonic acid derivative and
3-aminopyridine (0.188 g, 2 mmol) as amine. Yield: 0.136 g (39%)
yellow solid; mp: 330-335 ꢀC. 1H NMR (DMSO-d6): δ 4.06
(s, 3H, OCH3), 7.21-7.33 (m, 1H), 7.36-7.51 (m, 3H), 7.77-7.85
(m, 1H), 8.14-8.24 (m, 1H), 8.41 (bs, 1H), 8.48-8.57 (m, 2H),
8.94 (bs, 1H), 10.85 (s, 1H, NH), 12.24 (s, 1H, NH). 13C NMR
(DMSO-d6): δ 56.5 (OCH3), 112.9 (CH), 116.9 (CH), 118.0 (Cq),
120.2 (CH), 120.9 (Cq), 121.6 (Cq), 121.7 (CH), 123.6 (CH), 128.7
(CH), 130.9 (Cq), 131.1 (CH), 134.1 (CH), 134.9 (Cq), 139.7 (Cq),
142.9 (CH), 145.3 (CH), 147.6 (Cq), 167.2 (CON), 176.3 (CO).
MS m/z: 345 (47%, Mþ), 251 (64%), 223 (69%), 209 (62%), 153
(67%), 94 (100%).
Conclusion
Although the mechanism of action of compound 16 in the
replicon system remains unclear and may involve inhibition of
various viral and host factors, compound 16 constitutes the
best inhibitor of HCV replication among all the helicase
inhibitors published until now, with a TI above 1000 and
EC50 below 1 μM, similar to values obtained for 40-azidocy-
tidine, a lead compound in the development of balapiravir, a
drug already submitted to clinical trials,17 proving that com-
pound 16 is an excellent lead for further rational design of
drugs against HCV.
N-(4-Chloropyridin-2-yl)-5-methoxyacridone-4-carboxamide
(11). The compound was synthesized using the general procedure
with 4 (0.269g, 1 mmol) as acridonic acid derivative and 2-amino-
4-chloropyridine(0.237 g, 2 mmol) as amine. Yield:0.143g (38%)
yellow solid. mp: 321-327 ꢀC. 1H NMR (DMSO-d6): δ 4.08 (s,
3H, OCH3), 7.20-7.46 (m, 4H), 7.78-7.86 (m, 1H), 8.27 (s, 1H),
8.42-8.62 (m, 3H), 11.46 (s, 1H, NH), 12.17 (s, 1H, NH). 13C
NMR (d-TFA): δ 58.4 (OCH3), 116.3 (CH), 117.6 (CH), 118.0
(Cq), 118.9 (Cq), 119.1 (Cq), 119.5(CH), 125.4 (CH), 127.2 (CH),
130.1 (CH), 135.0(CH), 135.6(Cq), 140.3(CH), 140.6(Cq), 140.9
(CH), 150.2(Cq), 150.7(Cq), 171.5 (Cq), 172.3(Cq). MSm/z: 379
(32%, Mþ), 251 (87%), 223 (100%), 152 (52%), 75 (63%).
2-Chloro-5-methoxy-N-(pyridin-2-yl)-acridone-4-carboxamide
(12). The compound was synthesized according to the general
approach with 5 (0.304 g, 1 mmol) as acridonic acid derivative
and 2-aminopyridine (0.188 g, 2 mmol) as amine. Yield: 0.197 g
Experimental Section
Chemistry. Unless otherwise stated, all chemicals were of
analytical grade and obtained from Sigma-Aldrich Chemie
GmBH (Schnelldorf, Germany), TCI Europe (Zwijndrecht,
Belgium), or Apollo Scientific Limited (Bredbury, UK) and
used without further purification. H- and 13C NMR spectra
1
were recorded on a Bruker Advance DPx200 (200 and 50 MHz).
Chemical shifts are reported in δ units (ppm) relative to Me4Si as
internal standard for DMSO-d6 spectras or alternatively the
solvent signal for d-trifluoroaceticacid (d-TFA) spectras (s, bs,
d, m, Cq for singlet, broad singlet, doublet, multiplet, and
quartenary carbon, respectively) and J values are reported in
hertz. Mass spectra (MS) were obtained with a Shimadzu
(GC-17A; MS-QP5050A) spectrometer. The purity of the tested
compounds and intermediates is larger than 95% and was
established by combustion analysis with a Perkin-Elmer 2400
CHN elemental analyzer.
General Synthesis Procedure for Compounds 8-18. To a
suspension of 4, 5, 6, or 7 (1 mmol) in 10 mL of dry toluol,
thionyl chloride (110 μL, 1.5 mmol), and pyridine (120 μL, 1.5
mmol) were added. The mixture was stirred at room tempera-
ture for 4 h, then the amine (2 mmol) and triethylamine (250 μL,
2 mmol) were added and stirred overnight. The solvent was
removed under vacuum, and water was added. The precipitate
was filtered, washed with water, and dried. The solid was
purified by crystallization in DMF/EtOH/H2O.
1
(52%) dark-yellow solid; mp: 244-251 ꢀC. H NMR (DMSO-
d6): δ 4.06 (s, 3H, OCH3), 7.21-7,35 (m, 2H), 7.36-7.47 (m, 1H),
7.75-7,83 (m, 1H), 7.88-8.00 (m, 1H), 8.08-8.17 (m, 1H),
8.28-8.50 (m, 2H), 8.64-8.70 (m, 1H), 11.38 (s, 1H, NH),
12.20 (s, 1H, NH). 13C NMR (DMSO-d6): δ 56.5 (OCH3),
113.2 (CH), 116.0 (CH), 116.8 (CH), 116.9 (CH), 120.5 (CH),
120.8 (Cq), 122.1 (CH), 122.5 (Cq), 124.7 (Cq), 129.6 (CH), 130.7
(Cq), 134.4 (CH), 138.3 (CH), 138.4 (Cq), 147.6 (Cq), 151.4 (Cq),
166.3 (CON), 175.2 (CO). MS m/z: 381 (19%, Mþ, 37Cl) 379
(56%, Mþ, 35Cl), 285 (62%), 257 (63%), 151 (54%), 78 (100%).
2-Chloro-5-methoxy-N-(pyridin-3-yl)-acridone-4-carboxamide
(13). The compound was synthesized according to the general
procedure with 5 (0.304 g, 1 mmol) as acridonic acid derivative
and 3-aminopyridine (0.188 g, 2 mmol) as amine. Yield: 0.102 g
5-Methoxy-N-(3,4,5-trimethoxyphenyl)-acridone-4-carbox-
amide (8). The title compound was synthesized according to
the general procedure with 4 (0.269 g, 1 mmol) as acridonic acid
derivative and 3,4,5-trimethoxyaniline (0.366 g, 2 mmol) as
amine. Yield: 0.169 g (39%) yellow solid; mp: 263-267 ꢀC. 1H
NMR (DMSO-d6): δ 3.69 (s, 3H, OCH3), 3.82 (s, 6H, 2ꢀ OCH3),
1
(27%) yellow solid; mp: 280-283 ꢀC. H NMR (DMSO-d6): δ
4.04 (s, 3H, OCH3), 7.20-7.54 (m, 3H), 7.72-7.80 (m, 1H),
8.13-8.21 (m, 1H), 8.37-8.46 (m, 2H), 8.56 (s, 1H), 8.92 (s, 1H),
10.88 (s, 1H, NH), 12.17 (s, 1H, NH). 13C NMR (DMSO-d6): δ

3124 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 8
Stankiewicz-Drogonꢀ et al.
56.5 (OCH3), 113.1 (CH), 116.9 (CH), 120.00 (Cq), 120.1 (Cq),
120.8 (Cq), 122.0 (CH), 122.6 (Cq), 123.6 (CH), 124.6 (Cq), 128.6
(CH), 129.5 (CH), 133.6 (CH), 138.3 (Cq), 142.9 (CH), 145.4
(CH), 147.5 (Cq), 147.6 (Cq), 165.8 (CON), 175.2 (CO). MS m/z:
381 (36%, Mþ, 37Cl), 379 (100%, Mþ, 35Cl), 285 (98%), 256
(65%).
(s, 1H, NH). 13C NMR (DMSO-d6): δ 70.0 (OCH2), 114.4 (CH),
114.5 (CH), 117.3 (CH), 118.0 (Cq), 120.1 (CH), 121.1 (Cq),
121.6 (Cq), 121.7 (CH), 126.9 (2ꢀ CH), 127.9 (CH), 128.4 (2ꢀ
CH), 131.2 (Cq), 131.4 (CH), 134.1 (CH), 136.5 (Cq), 139.8
(Cq), 145.4 (Cq), 146.4 (Cq), 150.3 (2ꢀ CH), 167.8 (CON), 176.3
(CO). MS m/z: 421 (30%, Mþ), 330 (9%), 236 (42%), 185 (11%),
91 (100%).
Biology. Protein Cloning, Expression, and Purification. The
NS3 helicase domain of genotype 1a was expressed in a baculo-
virus system and purified from insect cells as described.16 The
helicase domains of genotypes 1b and 3a were obtained by
reverse transcription and PCR amplification using RNA ex-
tracted from the blood of Polish HCV-infected patients as
templates; this was followed by cloning (Bernatowicz-Najda
et al., submitted), protein expression in the baculovirus system
and purification from insect cells performed as previously
described.16
Helicase Inhibition Assay. The fluorometric helicase activity
assay and inhibitor screening were performed as described in
Boguszewska-Chachulska et al.,32 with minor modifications
concerning the reaction temperature and volume that were
37 ꢀC and 60 μL, respectively.
Nucleic Acid Intercalation. Intercalatory properties of se-
lected compounds were studied by the dsNA migration retarda-
tion assay as described previously.12 dsRNA was prepared as
described in Krawczyk et al.11
2-Chloro-N-(4-chloropyridin-2-yl)-5-methoxyacridone-4-car-
boxamide (14). The compound was synthesized according to the
general procedure with 5 (0.304 g, 1 mmol) as acridonic acid
derivative and 2-amino-4-chloropyridine (0.237 g, 2 mmol) as
amine. Yield: 0.176 g (43%) orange solid; mp: 298-304 ꢀC. 1H
NMR (DMSO-d6): δ 4.07 (s, 3H, OCH3), 7.21-7.44 (m, 3H),
7.74-7.83 (m, 1H), 8.21-8.25 (m, 1H), 8.37-8.50 (m, 2H),
8.60-8.65 (m, 1H), 11.60 (s, 1H, NH), 12.08 (bs, 1H, NH). 13
C
NMR (d-TFA): δ 58.5 (OCH3), 116.4 (CH), 117.7 (CH), 118.5
(Cq), 119.6 (CH), 120.0 (Cq), 120.7 (Cq), 125.6 (CH), 130.3
(CH), 133.3 (CH), 134.0 (Cq), 135.6 (Cq), 138.8 (Cq), 140.5
(CH), 141.3 (CH), 149.9 (Cq), 150.8 (Cq), 160.1 (Cq), 170.5
(Cq), 172.0 (Cq). MS m/z: 415 (65%, Mþ, 37Cl35Cl), 413 (80%,
Mþ, 35Cl2), 285 (100%), 270 (32%), 257 (87%).
2-Fluoro-5-methoxy-N-(pyridine-2-yl)-acridone-4-carboxamide
(15). The compound was synthesized using the general proce-
dure with 6 (0.287 g, 1 mmol) as acridonic acid derivative and
2-aminopyridine (0.188g, 2 mmol) as amine. Yield: 0.196 g (54%)
1
yellow solid; mp: 299-305 ꢀC. H NMR (DMSO-d6): δ 4.07
(s, 3H, OCH3), 7.22-7.46(m, 3H), 7.75-7.84(m, 1H), 7.89-8.01
(m, 1H), 8.11-8.24 (m, 2H), 8.46-8.62 (m, 2H), 11.30 (s, 1H,
NH), 12.20 (s, 1H, NH). 13C NMR (DMSO-d6): δ 58.5 (OCH3),
116.0 (CH), 117.4 (CH), 117.9 (Cq), 118.4 (d, CH, J = 24.2 Hz),
119.8 (CH), 120.2 (d, Cq, J = 8.3 Hz), 121.6 (d, Cq, J = 6.5 Hz),
124.8 (CH), 130.4 (CH), 130.9 (d, CH, J = 28.8 Hz), 135.7 (Cq),
137.6 (Cq), 139.8 (CH), 149.4 (Cq), 150.6 (CH), 150.7 (Cq),
160.2 (d, CF, J = 253.3 Hz), 170.5 (d, Cq, J = 1.1 Hz), 171.8 (d,
Cq, J = 4.6 Hz). MS m/z: 363 (100%, Mþ), 269 (74%), 254
(27%), 241 (58%).
RNA Isolation and Reverse Transcription. RNA spin Mini
kit (GE Healthcare, Little Chalfont, UK) was used to isolate
total RNA from Huh-7 cells bearing the subgenomic repli-
con, according to the manufacturer’s instructions. To obtain
cDNA for sequencing of the NS3-NS5B fragment from
naıve and mutant Huh-7 cells, 8 pmoles of a specific primer
¨
(3UTR: 50ACWTGATCTGCAGAGAGRCC30 or NS3Rev1:
50GMRCAYTCYTCCATYTCRTC30) and 1-2 μg of RNA
were used. To obtain cDNA for the real-time PCR reactions,
5 μg of RNA and a mixture of primers were used: 0.25 μM
3UTR, 2.5 μM oligo(dT)15, and 2.5 ng/μL random hexamers.
To facilitate annealing, the primer was incubated with RNA
for 15 min at 65 ꢀC followed by 2-3 min incubation on ice.
After addition of Master Mix (1ꢀ First Strand buffer, 10 mM
DTT, 200 U Super Script III reverse transcriptase (Invitrogen,
Carlsbad, CA), 1 mM dNTPs (metabion, Munich, Germany),
and 40 U RiboLock RNase inhibitor (Fermentas, Vilnius,
Lithuania), the reverse transcription reaction was carried for
1 h at 50 ꢀC and stopped by placing at 75 ꢀC for 15 min.
2-Fluoro-5-methoxy-N-(pyridine-3-yl)-acridone-4-carboxamide
(16). The compound was synthesized according to the general
procedure with 6 (0.287 g, 1 mmol) as acridonic acid derivative
and 3-aminopyridine (0.188 g, 2 mmol) as amine. Yield: 0.182 g
(50%) yellow solid; mp: 289-295 ꢀC. 1H NMR (DMSO-d6-): δ
4.04 (s, 3H, OCH3), 7.20-7.44 (m, 3H), 7.73-7.80 (m, 1H),
8.14-8.22 (m, 2H), 8.42-8.51 (m, 2H), 8.94 (bs, 1H), 10.84
(s, 1H, NH), 12.15 (s, 1H, NH). 13C NMR (DMSO-d6): δ 56.5
(OCH3), 112.9 (CH), 115.2 (d, CH, J = 21.9 Hz), 116.7 (2ꢀ CH),
119.9 (Cq), 120.0 (Cq), 120.1 (Cq), 121.8 (CH), 122.1 (CH), 122.4
(d, CH, J = 26.9), 122.5 (Cq), 128.6 (CH), 130.8 (Cq), 136.6 (Cq),
142.9 (CH), 145.5 (CH), 147.5 (Cq), 155.4 (d, CF, J = 238.6 Hz),
165.9 (CON), 175.5 (CO). MS m/z: 363 (100%, Mþ), 269 (92%),
241 (59%), 213 (20%), 185 (18%).
Real-Time PCR. For each reaction, 2 μL of cDNA diluted
1:10 was used with 8 μL of the reaction mixture (JumpStart
ꢀ
Taq ReadyMix, Sigma, Poznan, Poland) and 0.2 μM forward
and reverse primer: RT1Up: 50CTGCGGAGGAAACCAAG30
and RT1Low: 50GAATGTGGGGGCGTCAG30 for the am-
plification of the viral target gene (a fragment of NS5B)
and TubF: 50CTTCAAGCGCATCTCGGAGC30 and TubR:
50TGCGGTGGCATCCTGGTACT 30 for the amplification of
the cellular reference gene (a tubulin fragment). Real-time PCR
was carried out in the Light Cyler 480 (Roche Diagnostics,
Warsaw, Poland) apparatus using the following program:
10 min initial denaturation at 95 ꢀC followed by 45 cycles of
10 s denaturation at 95 ꢀC, 20 s annealing at 56 ꢀC and 10 s
elongation at 72 ꢀC. To calculate the efficiency of reactions for
each pair of primers the absolute quantification method, a part
of the program supplied with Light Cyler 480, was applied. To
verify the inhibitory potential of 16 on viral RNA replication,
the basic relative quantification method was used.
N-(4-Chloropyridin-2-yl)-2-fluoro-5-methoxyacridone-4-carbox-
amide (17). The compound was synthesized according to the
general approach with 6 (0.287 g, 1 mmol) as acridonic acid deriva-
tive and 2-amino-4-chloropyridine (0.237 g, 2 mmol) as amine.
1
Yield: 0.254 g (64%) yellow solid; mp: >350 ꢀC. H NMR (d-
TFA): δ 4.27 (s, 3H, OCH3), 7.59-7.88 (m, 3H), 8.03 (s, 1H),
8.16-8.27 (m, 1H), 8.50-8.58 (m, 1H), 8.69-8.77 (m, 2H). 13C
NMR (d-TFA): δ 58.5 (OCH3), 116.0 (CH), 117.4 (CH), 118.0
(Cq), 118.4 (d, CH, J= 23.6 Hz), 119.6 (CH), 120.2 (d, Cq, J=8.4
Hz), 121.4 (d, Cq, J = 6.7 Hz), 125.6 (CH), 130.4 (CH), 131.0 (d,
CH, J = 28.7 Hz), 135.7 (Cq), 137.6 (Cq), 140.5 (CH), 149.9 (Cq),
150.7 (Cq), 160.1 (Cq), 160.2 (d, Cq, J = 253.2 Hz), 170.4 (d, Cq,
J = 1.5 Hz), 171.8 (d, Cq, J = 5.2 Hz). MS m/z: 399 (29%, Mþ,
37Cl), 397 (81%, Mþ, 35Cl), 269 (100%), 254 (31%), 241 (73%).
5-Benzyloxy-N-(pyridine-4-yl)-acridone-4-carboxamide (18).
The compound was synthesized according to the general pro-
cedure with 7 (0.345 g, 1 mmol) as acridonic acid derivative and
4-aminopyridine (0.188 g, 2 mmol) as amine. Yield: 0.081 g
(19%) yellow solid; mp: 283-285 ꢀC. 1H NMR (DMSO-d6): δ
5.42 (s, 2H, OCH2), 7.22-7.34 (m, 1H), 7.39-7.56 (m, 5H),
7.67-7.90 (m, 5H), 8.49-8.62 (m, 4H), 10.97 (s, 1H, NH), 12.41
HCV and Cell Toxicity Replicon Studies. The human hepa-
toma cell line Huh-7, carrying the subgenomic HCV genotype
1 replicon with the luc-ubi-neo (reporter/selective) fusion
gene,33 was kindly provided by Dr. Ralf Bartenschlager
(University of Heidelberg, Heidelberg, Germany). The cells
were grown as described.10,33 The conditions of the luminescence-
based assay used to test the antiviral activity as well as

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 8 3125
cytotoxicity of the compounds were previously described.10-12
40azidocytidine was kindly provided by Dr. Johan Neyts
(Katolik Universitat, Leuven, Belgium); ribavirin was purchased
from ICN Biochemicals (ICN Biochemicals, Cleveland, OH).
For the real time-PCR experiments, cells were seeded at a
density of 4 ꢀ 105 on a 100 mm culture dish in DMEM medium
(Invitrogen) and grown in the presence of 0, 1, 10, or 100 μM 16
for 7 days.
To evaluate the combinatorial effect of 16 with ribavirin or
IFN-γ (Institute of Biotechnology and Antibiotics, Poland) on
HCV replication, increasing concentrations of the compounds
were added: 0, 0.1, 0.25, 0.5, 0.75, 1, 10, 20 μM compound 16; 0,
0.01, 0.02, 0.03, 0.04, and 0.05 U/mL IFN-γ, and 0, 0.1, 1, 5, 10,
and 20 μM ribavirin. The final concentration of DMSO was
always 1%. After 3 days, luminescence was measured and
Prichard and Shipman’s MacSynergy II software was used to
calculate the data.18
To obtain mutants resistant to 16, Huh-7 cells bearing the
subgenomic replicon were seeded at a density of 2 ꢀ 106 cells in a
100 mm diameter culture dish (Sarstedt) and grown at 37 ꢀC and
5% CO2 in complete DMEM medium (Invitrogen) supplemen-
ted with 250 μg/mL G418 and 10 μM 16. The cells were passaged
upon reaching confluence (every 3-4 days). After 4 weeks, the
colonies of cells resistant to G418, and thus to the compound,
were obtained, and total RNA from the mutant cells isolated,
reverse transcribed and the NS3-5B fragment sequenced.
(9) Lam, A. M.; Rypma, R. S.; Frick, D. N. Enhanced nucleic acid
binding to ATP-bound hepatitis C virus NS3 helicase at low pH
activates RNA unwinding. Nucleic Acids Res. 2004, 32, 4060–4070.
(10) Gozdek, A.; Zhukov, I.; Polkowska, A.; Poznanski, J.; Stankiewicz-
Drogon, A.; Pawlowicz, J. M.; Zagorski-Ostoja, W.; Borowski, P.;
Boguszewska-Chachulska, A. NS3 Peptide, a novel potent hepatitis
C virus NS3 helicase inhibitor: its mechanism of action and antiviral
activity in the replicon system. M. Antimicrob. Agents Chemother.
2008, 52, 393–401.
(11) Krawczyk, M.; Wasowska-Lukawska, M.; Oszczapowicz, I.;
Boguszewska-Chachulska, A. M. Amidinoanthracyclines—a new
group of potential anti-hepatitis C virus compounds. Biol. Chem.
2009, 390, 351–360.
(12) Stankiewicz-Drogon, A.; Palchykovska, L. G.; Kostina, V. G.;
Alexeeva, I. V.; Shved, A. D.; Boguszewska-Chachulska, A. M.
New acridone-4-carboxylic acid derivatives as potential inhibitors of
Hepatitis C virus infection. Bioorg. Med. Chem. 2008, 16, 8846–8852.
(13) Manfroni, G.; Paeshuyse, J.; Massari, S.; Zanoli, S.; Gatto, B.;
Maga, G.; Tabarrini, O.; Cecchetti, V.; Fravolini, A.; Neyts, J.
Inhibition of subgenomic hepatitis C virus RNA replication by
acridone derivatives: identification of an NS3 helicase inhibitor.
J. Med. Chem. 2009, 52, 3354–3365.
(14) Sharp, M. J.; Mader, C. J.; Strachan, C.; Synthesis of acridine
derivative as multidrug-resistant inhibitors. (Glaxo Group Ltd.,
UK). PCT Int. Appl., 1998.
€
(15) Dorner, B.; Kuntner, C.; Bankstahl, J. P.; Bankstahl, M.; Stanek,
€
€
J.; Wanek, T.; Stundner, G.; Mairinger, S.; Loscher, W.; Muller,
M.; Langer, O.; Erker, T. Synthesis and Small-Animal Positron
Emission Tomography Evaluation of [11C]-Elacridar As a Radio-
tracer to Assess the Distribution of P-Glycoprotein at the Blood-
Brain Barrier. J. Med. Chem. 2009, 52, 6073–6082.
(16) Boguszewska-Chachulska, A. M.; Krawczyk, M.; Stankiewicz, A.;
Gozdek, A.; Haenni, A. L.; Strokovskaya, L. Direct fluorometric
measurement of hepatitis C virus helicase activity. FEBS Lett.
2004, 567, 253–258.
Acknowledgment. This work was supported by the Minis-
try of Science and Higher Education grant N N401 2329 3. We
thank Dr. Anne-Lise Haenni for careful reading of the manu-
script and helpful remarks.
(17) Klumpp, K.; Leveque, V.; Le Pogam, S.; Ma, H.; Jiang, W. R.;
Kang, H.; Granycome, C.; Singer, M.; Laxton, C.; Hang, J. Q.;
Sarma, K.; Smith, D. B.; Heindl, D.; Hobbs, C. J.; Merrett, J. H.;
Symons, J.; Cammack, N.; Martin, J. A.; Devos, R.; Najera, I. The
novel nucleoside analog R1479 (40-azidocytidine) is a potent
inhibitor of NS5B-dependent RNA synthesis and hepatitis C virus
replication in cell culture. J. Biol. Chem. 2006, 281, 3793–3799.
(18) Prichard, M. N.; Shipman, C., Jr. A three-dimensional model to
analyze drug-drug interactions. Antiviral Res. 1990, 14, 181–205.
(19) Bastow, K. F. New acridone inhibitors of human herpes virus
replication. Curr. Drug Targets Infect. Disord. 2004, 4, 323–330.
(20) Bernardino, A. M.; Castro, H. C.; Frugulhetti, I. C.; Loureiro,
N. I.; Azevedo, A. R.; Pinheiro, L. C.; Souza, T. M.; Giongo, V.;
Passamani, F.; Magalhaes, U. O.; Albuquerque, M. G.; Cabral,
L. M.; Rodrigues, C. R. SAR of a series of anti-HSV-1 acridone
derivatives, and a rational acridone-based design of a new
anti-HSV-1 3H-benzo[b]pyrazolo[3,4-h]-1,6-naphthyridine series.
Bioorg. Med. Chem. 2008, 16, 313–321.
Supporting Information Available: Synthesis and spectro-
scopic data for the nonkey compounds 1-6. Elemental analyses
for compounds 8-11, 13-18 and high resolution mass for
compound 12. This material is available free of charge via the
Internet at http://pubs.acs.org.
References
(1) Hayashi, N.; Takehara, T. Antiviral therapy for chronic hepatitis
C: past, present, and future. J. Gastroenterol. 2006, 41, 17–27.
(2) Reesink, H. W.; Zeuzem, S.; Weegink, C. J.; Forestier, N.; Van
Vliet, A.; Van De Wetering De Rooij, J.; McNair, L.; Purdy, S.;
Kauffman, R.; Alam, J.; Jansen, P. L. M. Rapid decline of viral
RNA in hepatitis C patients treated with VX-950: a phase Ib,
placebo-controlled, randomized study. Gastroenterology 2006, 131,
997–1002.
(21) Adams, A. Crystal structures of acridines complexed with nucleic
acids. Curr. Med. Chem. 2002, 9, 1667–1675.
(22) Tuteja, N.; Phan, T. N.; Tuteja, R.; Ochem, A.; Falaschi, A.
Inhibition of DNA unwinding and ATPase activities of human
DNA helicase II by chemotherapeutic agents. Biochem. Biophys.
Res. Commun. 1997, 236, 636–640.
(23) Tackett, A. J.; Wei, L.; Cameron, C. E.; Raney, K. D. Unwinding
of nucleic acids by HCV NS3 helicase is sensitive to the structure of
the duplex. Nucleic Acids Res. 2001, 29, 565–572.
(24) Goodell, J. R.; Madhok, A. A.; Hiasa, H.; Ferguson, D. M.
Synthesis and evaluation of acridine- and acridone-based anti-
herpes agents with topoisomerase activity. Bioorg. Med. Chem.
2006, 14, 5467–5480.
(3) Manns, M.; Muir, A.; Adda, N.; et al. Telaprevir in hepatitis C
genotype-1-infected patients with prior non-response, viral break-
through or relapse to peginterferon-alfa-2a/b and ribavirin ther-
apy: SVR results of the PROVE3 study. In 44th Annual Meeting of
the European Association for the Study of the Liver (EASL 2009),
Copenhagen, 2009.
(4) Kwo, P.; Lawitz, E.; McCone, J.; Schiff, E.; Vierling, J.; Pound, D.;
Davis, M.; Galati, J.; Gordon, S.; Ravendhran, N.; Rossaro, L.;
Anderson, F.; Jacobson, I.; Rubin, R.; Koury, K.; Brass, C.;
Chaudhri, E.; Albrecht, J. HCV SPRINT-1 final results: SVR 24
from a phase 2 study of boceprevir plus pegintron (peginterferon
alfa-2b)/ribavirin in treatment-naıve subjects with genotype-1
¨
(25) Piestrzeniewicz, M. K.; Wilmanska, D.; Studzian, K.; Szemraj, J.;
Czyz, M.; Denny, W. A.; Gniazdowski, M. Inhibition of RNA
synthesis in vitro by acridines—relation between structure and
activity. Z. Naturforsch., C: J. Biosci. 1998, 53, 359–368.
(26) Dziegielewski, J.; Slusarski, B.; Konitz, A.; Skladanowski, A.;
Konopa, J. Intercalation of imidazoacridinones to DNA and its
relevance to cytotoxic and antitumor activity. Biochem. Pharmacol.
2002, 63, 1653–1662.
(27) Glenn, J. S. Small molecule approaches to NS4B and other novel
non-structural protein targets. In HCV Drug Discovery, San
Diego, CA, 2009.
(28) Coelmont, L.; Paeshuyse, J.; Windisch, M. P.; De Clercq, E.;
Bartenschlager, R.; Neyts, J. Ribavirin antagonizes the in vitro
anti-hepatitis C virus activity of 20-C-methylcytidine, the active
component of valopicitabine. Antimicrob. Agents Chemother. 2006,
50, 3444–3446.
chronic hepatitis C. In 44th Annual Meeting of the European
Association for the Study of the Liver (EASL), Copenhagen, 2009.
(5) Thompson, A.; Patel, K.; Tillman, H.; McHutchison, J. G. Directly
acting antivirals for the treatment of patients with hepatitis C
infection: a clinical development update addressing key future
challenges. J. Hepatol. 2009, 50, 184–194.
(6) Frick, D. N. The hepatitis C virus NS3 protein: a model RNA helicase
and potential drug target. Curr. Issues Mol. Biol. 2007, 9, 1–20.
(7) Lam, A. M.; Frick, D. N. Hepatitis C virus subgenomic replicon
requires an active NS3 RNA helicase. J. Virol. 2006, 80, 404–411.
(8) Kim, J. L.; Morgenstern, K. A.; Griffith, J. P.; Dwyer, M. D.;
Thomson, J. A.; Murcko, M. A.; Lin, C.; Caron, P. R. Hepatitis C
virus NS3 RNA helicase domain with a bound oligonucleotide: the
crystal structure provides insights into the mode of unwinding.
Structure 1998, 6, 89–100.

3126 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 8
Stankiewicz-Drogonꢀ et al.
(29) Watterson, S. H.; Chen, P.; Zhao, Y.; Gu, H. H.; Dhar, T. G.; Xiao,
Z.; Ballentine, S. K.; Shen, Z.; Fleener, C. A.; Rouleau, K. A.;
Obermeier, M.; Yang, Z.; McIntyre, K. W.; Shuster, D. J.; Witmer,
M.; Dambach, D.; Chao, S.; Mathur, A.; Chen, B. C.; Barrish,
J. C.; Robl, J. A.; Townsend, R.; Iwanowicz, E. J. Acridone-based
inhibitors of inosine 50-monophosphate dehydrogenase: discov-
ery and SAR leading to the identification of N-(2-(6-(4-ethylpiper-
azin-1-yl)pyridin-3-yl)propan-2-yl)-2-fluoro-9-oxo-9,10-dihydro-
acridine-3-carboxamide (BMS-566419). J. Med. Chem. 2007, 50,
3730–3742.
(31) Vance, J.; Bastow, K. F. Inhibition of DNA topoisomerase II
catalytic activity by the antiviral agents 7-chloro-1,3-dihydroxya-
cridone and 1,3,7-trihydroxyacridone. Biochem. Pharmacol. 1999,
58, 703–708.
(32) Boguszewska-Chachulska, A. M.; Krawczyk, M.; Najda, A.;
Kopanska, K.; Stankiewicz-Drogon, A.; Zagorski-Ostoja, W.;
Bretner, M. Searching for a new anti-HCV therapy: synthesis
and properties of tropolone derivatives. Biochem. Biophys. Res.
Commun. 2006, 341, 641–647.
(33) Vrolijk, J. M.; Kaul, A.; Hansen, B. E.; Lohmann, V.; Haagmans,
B. L.; Schalm, S. W.; Bartenschlager, R. A replicon-based bioassay
for the measurement of interferons in patients with chronic hepa-
titis C. J. Virol. Methods 2003, 110, 201–209.
(30) Zhou, S.; Liu, R.; Baroudy, B. M.; Malcolm, B. A.; Reyes, G. R.
The effect of ribavirin and IMPDH inhibitors on hepatitis C virus
subgenomic replicon RNA. Virology 2003, 310, 333–342.