Detection of DNA methyltransferase activity using template-free DNA polymerization amplification based on aggregation-induced emission

Article abstract of DOI:10.1016/j.ab.2019.113532

A sensitive and selective fluorescence assay for DNA methyltransferase (MTase) activity detection was designed based on aggregation-induced emission (AIE) and target initiated template-free DNA polymerization. Quaternized tetraphenylethene salt was synthe

Full text of DOI:10.1016/j.ab.2019.113532

AnalyticalBiochemistry590(2020)113532
Contents lists available at ScienceDirect
Analytical Biochemistry
journal homepage: www.elsevier.com/locate/yabio
Detection of DNA methyltransferase activity using template-free DNA
polymerization amplification based on aggregation-induced emission
Shuyan Niu, Cheng Bi, Weiling Song∗
Key Laboratory of Sensor Analysis of Tumor Marker, Ministry of Education, Shangdong Key Laboratory of Biochemical Analysis, Key Laboratory of Analytical Chemistry
for Life Science in Universities of Shandong, College of Chemistry and Molecular Engineering, Qingdao University of Science and Technology, Qingdao, 266042, PR China.
A R T I C L E I N F O
A B S T R A C T
Keywords:
Quaternized tetraphenylethene salt
Fluorescence
Terminal deoxynucleotidyl transferase
Hairpin probe
DNA adenine methyltransferase
A sensitive and selective fluorescence assay for DNA methyltransferase (MTase) activity detection was designed
based on aggregation-induced emission (AIE) and target initiated template-free DNA polymerization.
Quaternized tetraphenylethene salt was synthesized as the AIE probe, which binds to single-stranded DNA by
electrostatic interaction. A hairpin probe was designed with a specific sequence for DNA MTase. In the presence
of DNA MTase, the methylation reaction initiated DNA polymerization with terminal deoxynucleotidyl trans-
ferase (TdT), which activated the fluorescence intensity through AIE. The designed DNA sensor displayed a
linear response to concentrations of DNA adenine methyltransferase (Dam) MTase from 0.5 U·mL−1 to 100
U mL−1, with a limit of detection of 0.16 U mL−1. The assay was also effective for detection of DNA MTase
activity in human serum and for showing the inhibitory effect of 5-fluorouracil on Dam MTase.
1. Introduction
restriction of intramolecular rotations (RIR) [8]. Benefiting from ad-
vanced features, such as the novel light-up probe, AIE fluorogens were
Fluorescent chemosensors play an important role in clinical diag-
nostics, environmental monitoring and analytical basic research with
prominent sensitivity and specificity. With the advantage of in-
expensive instrument and rapid detection, several analytes including
nucleic acid, protein, small biological molecules, enzyme and metal
ions could be quantitatively analyzed by fluorescence method with high
accuracy [1,2]. Many biological samples have been analyzed by fluor-
escence in situ, obtaining much more spatial information [3,4]. In the
presence of target, fluorescent probes were employed to turn on
fluorescence based on changing the distance between fluorophore and
quenched probe. Since then, several strategies have been designed for
targets analysis by using signal on or signal off model of the fluores-
cence. To date, several fluorescence activation and quench mechanisms
were employed for sensitive detection. However, many of these fluor-
escence probes were limited in biosensing applications with low turn-
on ratios and poor photobleaching thresholds.
widely used in chemo- and biosensor analysis, such as nucleic acid
(DNA [9], RNA [10]) detection, protein(Acetylcholinesterase [11],
Caspase-3/7 [12]) detection, ion detection [13,14] and cancer cell track
[15]. Specifically, tetraphenylethylene (TPE), a typical AIE chromo-
phore, is easy for chemical modification. TPE can be conjugated with
single strand DNA or RNA by click-reaction, enhancing the bio-
compatibility and bioactivity. Other TPE salt was synthesized with
charge. In general, TPE and its derivatives have been applied in various
chemo-/biosensors [11,16–19].
Recently, a template-free DNA extension reaction has received
much attention. Terminal deoxynucleotidyl transferase (TdT) is a
template-independent DNA polymerase which could catalyze the ad-
dition of deoxyribonucleoside triphosphate (dNTP) at the 3′-OH group
of DNA to produce a nonspecific and long sequence directly [20]. With
the advantage of template-free, this amplification reaction was easily
operated and applied in different sensing analysis. The single strand
DNA with the end of 3′-OH could be used as the primer for TdT reac-
tion. Therefore, the TdT assisted isothermal amplification has become
an essential strategy in nucleic acid sensor detection [21,22].
To address this problem, a novel category of fluorogens with ag-
gregation-induced emission (AIE) phenomenon were discovered by
Tang's group [5]. This unique performance makes the fluorogens
nonemissive in dissolved condition but become distinctly emissive by
aggregation [6,7]. This phenomenon was due to the mechanism of the
We designed a facile and untrasensitive biosensor for detection of
DNA
methyltransferases
(MTase)
activity.
Quaternized
∗ Corresponding author. Key Laboratory of Sensor Analysis of Tumor Marker, Ministry of Education, Shangdong Key Laboratory of Biochemical Analysis, Key
Laboratory of Analytical Chemistry for Life Science in Universities of Shandong, College of Chemistry and Molecular Engineering, Qingdao University of Science and
Technology, Qingdao, 266042, PR China.
E-mail address: swl2016@qust.edu.cn (W. Song).
https://doi.org/10.1016/j.ab.2019.113532
Received 23 October 2019; Received in revised form 4 December 2019; Accepted 4 December 2019
Availableonline07December2019
0003-2697/©2019ElsevierInc.Allrightsreserved.

S. Niu, et al.
AnalyticalBiochemistry590(2020)113532
tetraphenylethene salt (TPE-Z) was synthesized and used as the AIE
fluorescence probe in this strategy. In the presence of DNA MTase, the
quencher group labeled DNA probe could be cleaved by methyl-sensi-
tive endonuclease and then extended with TdT. Through the electro-
static force, the positively charged TPE-Z could bind to the negatively
charged extension DNA strand, inducing strong fluorescence with AIE
effect. Taking advantage of TdT enzyme amplification and AIE phe-
nomenon, fluorescence turn-on biosensor was established for precise
analysis of MTase activity.
fluorouracil was added into the methylation reaction solution, which
included DNA MTase, SAM, DpnI and the hairpin probe. The subsequent
procedures were the same as the above description.
2.5. Detection of MTase from bacterial cells
The cell culture and the preparation of cells extracts were performed
according to the previous report [25]. GW5100 (Dam-positive) and
JM110 (Dam-negative) E. coli cells were cultivated in culture-medium
(5 g/L yeast extract, 10 g/L Trypton, 10 g/L NaCl) at 37 °C for 12 h in a
shaker (250 rpm). Then, the cell suspension was diluted by 20 times for
2.5 h of cultivation. Subsequently, the E. coli cells were collected by
centrifugation and rinsing with PB solution. The resulting cells were
lysed using RIPA lysis buffer. The total extracted protein concentrations
were determined by the Bradford Protein Assay Kit, and the contained
MTase was determined according to the proposed method as above
mentioned.
2. Experimental section
2.1. Materials and instrumentation
N-bromosuccinimide (NBS), 4-methylbenzophenone, zinc powder
and benzophenone were got from Aladdin. Titanium tetrachloride
(TiCl4), dichloromethane (DCM), triethylamine (Et3N), 5-fluorouracil,
tetrahydrofuran (THF) and benzoyl peroxide (BPO) were purchased
from J&K Scientific Ltd. DNA adenine methylation (Dam) MTase,
M.SssI MTase, S-adenosylmethionine (SAM), Dpn I, HpaII and Terminal
deoxynucleotidyl transferase (TdT) were received from the New
England Biolabs (NEB). Purified oligonucleotides (5′-GTTGGGATCGA
GAAGTTTTCTTCTCGATCCCAA C-Dabcyl -3’; 5′-GTTGGGATCGAGAA
GTTTTCTTCTCGATCCCAAC-NH2-3′) were got from Sangon Biological
Engineering Technology & Services Co., Ltd. Human serum sample was
got from Lablead Biotech. Co., Ltd. (Beijing, China). Deionized water
was used throughout the experiments.
Fluorescence spectra were registered on a Hitachi F-4600 fluores-
cence spectrometer (Hitachi Ltd., Japan). Excitation and emission slits
were set for 5.0 nm and 10.0 nm band-pass. In the experiment, the
excitation wavelength for the TPE-Z was set at 303 nm, and the emis-
sion spectra were recorded between 400 nm and 600 nm. The fluor-
escence emission wavelength at 460 nm was used for investigating the
performance of the designed assay. 1H NMR and IR spectra were
measured with Bruker ARX 500 and Nicolet 510P FT-IR Spectrometer
respectively.
3. Results and discussion
3.1. Design strategy for DNA methylation assay
The MTase assay is based on the same recognition site for restriction
endonucleases and methylated reaction. A hairpin structure DNA probe
is designed for the dual enzyme-linkage (Dam MTase and Dpn I en-
donuclease) reaction, which includes the palindromic sequence of 5′-G-
A-T-C-3′ in the stem and labeled with a quencher group on 3′ end.
Before the methylation and polymerization reaction, the fluorescence
resonance energy transfer (FRET) was occurred between the TPE-Z and
quencher. The design of fluorescence assay for Dam MTase activity
detection is schematically shown in Scheme 1. This strategy involves
three principal processes: (1) methylation and restriction endonuclease
enzyme-linkage reaction; (2) TdT assisted DNA polymerization and (3)
fluorescence detection with AIE effect. In the first step, the hairpin
probe was employed as the reaction substrate. After being methylated
by Dam MTase and SAM, the hairpin probe was digested by Dpn I,
resulting in three pieces of ssDNA. One of these ssDNA was labeled with
a quencher group on 3′ end, which could not be polymerized. The other
two ssDNA with 3′-OH end performed as primers to initiate DNA
polymerization with TdT and dNTPs, which produced long strand of
ssDNA. Then, the long ssDNA is obtained with more negative charge
and binds to more TPE-Z molecules through electrostatic force. After
that, the AIE effect is occurred and fluorescence intensity light up as the
quencher far away from TPE-Z molecules.
2.2. Synthesis of TPE-Z
TPE-Z, as the AIE probe, was synthesized according to the previous
reported methods [23,24]. 1, 2-Bis[4-(bromomethyl)-phenyl] −1,2-
diphenylethene (2) was synthesized at first, the detail of the process
showing in the supporting materials. 104 mg (0.2 mmol) compound (2)
and 30 mL trimethylamine were added into a 250 mL round-bottom
flask. This mixture was refluxed with 12h and cooled to room tem-
perature. After being rinsed and filtrated, the white solid (TPE-Z) was
gained in 34.23% yield (38.4 mg). 1H NMR (500 MHz, D2O), δ (TMS,
ppm): 7.13 (m, 18H), 4.21 (s, 4H), 3.06(m, 12H), 1.24(t, 18H).
3.2. Feasibility
In order to confirm the quench effect, 3′-NH2 end of the hairpin
probe was used in the process of methylation assay. Under the same
experiments condition, the fluorescence intensity was observed with
different end of hairpin substrate. According to the electrostatic inter-
action, the longer ssDNA will bind to more TPE-Z with significant
fluorescence increase. As shown in Fig. 1A, the fluorescence signal was
increased after bound to the positive charged TPE-Z. Compared with
the control experiment (curve a), the fluorescence signal was 612%
increased when the quencher group labeled hairpin (curve c). By con-
trast, only 303% of signal increase was obtained when the hairpin was
labeled with NH2 (comparison of curve b and d). These data suggested
that the use of quencher group could decrease the background signal
and increase the signal-to-noise (S/N) ratio.
To further validate the enzymatic reaction, PAGE experiment was
carried out to reveal the products of each step. As seen from Fig. 1C, the
bands of lane 1–6 exhibited the same length. When the hairpin probe
existed alone, only one band was shown in lane 1. After being treated
with TdT, Dam and TdT, Dpn I and TdT, lane 2–4 were similar as lane a,
which suggested that the methylated reaction and polymerization were
2.3. Methylation and fluorescence detection with TPE-Z
The methylation was carried out in 50 μL of reaction mixture con-
taining hairpin probe (50 nM, chemical modified quencher Dabcyl at 3’
end of the nucleic acid), different concentration of Dam MTase,
10 × Dam MTase buffer, SAM (80 U mL−1), DpnI (4 U) and buffer at
37 °C for 2 h. After digestion, 10 μL of reaction mixture containing TdT
enzyme (5 U), 0.5 μL dNTPs (1 mM), 5 × TdT buffer (4 μL) and
5.3 μL H2O was introduced to the above pretreated solution. This
mixture was incubated at 37 °C for 3 h for DNA extended. After that,
80 μL TPE-Z (7.4 μM) was added the reaction products for fluorescence
measurements.
2.4. Influence of 5-fluorouracil on dam MTase activity
5-fluorouracil as the drug model was used for investigating the in-
fluence on Dam MTase activity. Different concentration of 5-
2

S. Niu, et al.
AnalyticalBiochemistry590(2020)113532
Scheme 1. Illustration of Dam MTase activity assay based on Aggregation-Induced Emission and template-free DNA polymerization.
not occurred. When the Dam and Dpn I were added, a new short band
was exhibited in lane 5 due to the methylation reaction occurred. After
mixed with Dam, Dpn I, and TdT, a new long trailing band was ap-
peared in lane 6. This further conformed that 3′-OH of hairpin was
formed after methylation cleavage reaction and polymerization was
occurred by TdT. These results clearly demonstrated that the hairpin
probe was modified with Dam and digested by Dpn I, releasing the
cleavage fragments for polymerization with TdT. After the whole
Fig. 1. (A) Fluorescence emission spectra of TPE-Z bonds hairpin DNA labeled with (a) or without quencher (b), and in the presence of DNA MTase by polymerization
with (c) or without quencher (d). (B) Fluorescent intensity of TPE-Z in different conditions. (C) Polyacrylamide gel electrophoresis (PAGE) analysis of Dam MTase by
hairpin probe: (1) control; (2) treated with TdT; (3) treated with TdT and Dam; (4) treated with TdT and DpnI; (5) treated with Dam and DpnI; (6) treated with Dam,
DpnI and TdT.
3

S. Niu, et al.
AnalyticalBiochemistry590(2020)113532
experiment, the long DNA strand was produced for binding to TPE-Z
molecules. Therefore, the Dam MTase activity could be detected by the
fluorescence intensity.
coefficients (CVs) of the intraassay for this method were 9.7 and 8.6%
at Dam MTase concentrations of 10 and 50 U mL−1, respectively. The
inter-assay variability was evaluated by determining, in duplicate, the
spiked Dam MTase in one serum sample with different batches of TPE-
Z. The CV of the inter-assay was 14.3% for the fluorescence determined
at 10 U mL−1. These results were indicated an acceptable reproduci-
bility for this method.
The endogenous DAM activity of E. coli cells were further in-
vestigated by using the designed system. A certain number of E. coli
cells lysate were added to the reaction mixture and the fluorescence
intensity were recorded with the total protein of E. coli cells. The total
protein concentration was measured using the Bradford Protein Assay.
JM110 (Dam-negative) and GW5100 (Dam-positive) were employed in
this experiment. As shown in Fig. 3A, the signals were obtained nearly
the same between the Lysis and JM110. Obviously, the signal for
GW5100 was much higher than others, owing to the endogenous me-
thyltransferases not for other interfering proteins. Furthermore, the
inhibition for DAM from E. coli cells was also examined by gentamycin.
The signal was obtained much lower than GW5100 only, suggesting the
efficient inhibitory effect. In addition, a linear relationship was ob-
tained between the fluorescence ratio and the total protein concentra-
tion in the range of 25.4–198.6 ng (Fig. 3B). These results suggest that
the developed assay can be applied to DAM activity assay in the prac-
tical complex samples.
In addition, the fluorescence intensity was detected to verify the
feasibility of the designed sensor for Dam MTase activity assay. As
expected, the fluorescence intensity in Fig. 1B was in a good agreement
with those obtained from PAGE measurements. As shown in the gel
image, lane 1–6 exhibited short band which suggested the DNA strands
were quite short. The fluorescence intensities of TPE-Z were weak after
binding with short strand DNA. After the reaction completed, the
fluorescence intensity was strong as the binding between the TPE-Z and
long strand DNA. The fluorescence signals were varied with the pro-
cesses based on enzymes reactions. All these experimental results
clearly proved that the essential role of Dam MTase, Dpn I and TdT for
the amplification strategy.
3.3. Optimization
A series of experiments were carried out to find the optimal con-
ditions for MTase assay. The following factors were optimized: the
concentration of TPE-Z(a), SAM(b), TdT(c) and dNTPs (d), and the TdT
incubation time (e). Respective data and Figures were provided in the
supplementary material. The following experimental parameters were
investigated to give best results: Optimal concentration of TPE-Z (a),
SAM(b), TdT(c) and dNTPs (d) were 7.4 μM, 80 U/mL, 5.0 U/mL and
5 μM respectively; Optimal reaction time of TdT: 180 min (e).
3.6. Universality of the designed strategy
3.4. Dam MTase detection
The proposed MTase assay is a universal biosensing system and is
able to investigate more sequence-specific biotransformations through
redesigning the hairpin probe. The present Dam/DpnI pair can be
substituted with M.SssI/HpaII pair. The recognition site 5′-GATC-3′ was
replaced to 5′-CCGG-3′ for evaluating M.SssI MTase (Fig. S3). Different
from the Dam/DpnI system, the HpaII endonuclease cannot cleave the
methylated hairpin substrate, resulting in the low fluorescence in-
tensity. Without M.SssI MTase, the hairpin can be cleaved to three
parts, which triggered the TdT assisted polymerization. As shown in
Fig. 4, a good linear relationship was obtained for M.SssI MTase ranging
from 0 to 40 U mL−1 with a detection limit of 0.03 U mL−1 (3σ,
n = 11). Therefore, the universal applicability of the designed system
can analyze other MTase through changing the sequence of hairpin
probe.
The fluorescence signal was directly related to the quantity of TPE-
Z, which was bind to the long DNA strand through the electrostatic
interaction. The long DNA strand was produced by methylation and
polymerization. So, the fluorescence intensity was dependent on the
concentration of Dam MTase. The designed assay for Dam MTase ac-
tivity detection was carried out under the optimized condition. Fig. 2A
shows the fluorescence intensity changes with the different concentra-
tion of Dam MTase. A linear plot was obtained in the range of 0.5–100
U mL−1 (Fig. 2B), and the detection limit of this sensor is estimated to
be 0.16 U mL−1 (3σ, n = 11). Notably, the sensitivity of this optical
method for Dam MTase detection was superior to other reported assay
in Table S1 (see supplementary material).
3.5. Selectivity
3.7. Influence of drug on dam MTase activity
The specificity of this assay was examined with other methyl-
transferases, including M. SssI and HhaI. M. SssI recognized the 5′-CG-3′
sequence (CpG) and HhaI methylated the cytosine residues in 5′-GGCC-
3’. The fluorescence intensity of Dam MTase was about five-fold higher
than M. SssI and HhaI, even the concentration of other methyl-
transferases was the same or two-fold (Fig. 2C). This indicated that the
sequence 5′-GATC-3′ can be only methylated by Dam MTase. Conse-
quently, the single DNA was prolonged with polymerase and bound the
AIE probe. These results demonstrated that the designed biosensor ex-
hibited good selectivity.
In addition, the practical applicability of this designed biosensor
was investigated in 20% diluted human serum samples (Table S2,
supplementary material). Different concentrations of Dam MTase at 1,
10, 50 U mL−1 were separately spiked into the diluted human serum
samples. The recoveries were obtained in the range of 98.34–100.83%
and the RSD was 3.3%, 4.2% and 4.7%, respectively. Therefore, the
designed biosensor has the potential to quantify of Dam MTase in a
complex system.
The inhibition of this assay was investigated to provide further the
application of antibacterial therapy [26]. 5-fluorouracil as the antic-
ancer drug is chosen for a representative inhibitor in this assay. There
are three enzymes involved in this reaction system, including DpnI, TdT
and Dam MTase. So, the effect of 5-fluorouracil on DpnI and TdT was
evaluated before Dam MTase. The activity of the DpnI and TdT had
been relatively unaffected with 5-fluorouracil in the range of 0–10 μM
(Fig. S2). Subsequently, the influence of 5-fluorouracil on Dam MTase
activity was investigated. After the addition of 5-fluorouracil, the re-
lative activity of Dam decreased with the increasing concentration of 5-
fluorouracil (Fig. 2D), showing visible dose-dependent inhibition of
Dam. In the presence of 5-fluorouracil, it was difficult to transfer the
methyl group to the DNA sequence, which resulted in fluorescence in-
tensity decrease. The half maximal inhibition values (IC50) of 5-fluor-
ouracil are calculated to be about 2 μM, which are approximate to those
in previous report [27,28]. In addition, the lower and higher values of
IC50 for inhibition are reported with 0.6 μM [29] and 100 μM [30]
respectively.
Furthermore, the reproducibility of the method was investigated
with intra-assay and inter-assay. The intra-assay variability was eval-
uated by parallel detection of the spiked Dam MTase level of two pre-
pared human serum by the same batch of TPE-Z. The variation
4. Conclusions
In summary, a positively charged fluorescence probe (TPE-Z) was
4

S. Niu, et al.
AnalyticalBiochemistry590(2020)113532
Fig. 2. (A) Fluorescence spectra of TPE-Z in response to Dam MTase in different concentrations (0, 0.1, 0.5, 1, 2.5, 5, 10, 20, 40, 80, 100, 200, 400 U/mL). (B)
Corresponding fluorescence ratio at 462 nm. Inset represent the linear relationship between the signal and Dam MTase concentrations from 0.5 U/mL to 100 U/mL.
(C) Selectivity study. (D) Inhibition assay for Dam MTase with different concentration of 5-Fluorouracil. The error bars were based on three repetitive experiments
performed.
Fig. 3. (A) Evaluation of the activity of Dam in E. coli cells, GW5100 cells with 198.6 ng total proteins and the inhibition of gentamycin. (B) The linear calibration
between the fluorescence ratio and total protein contents.
synthesized for sensitive detection of DNA methyltransferase activity.
Through electrostatic attraction, TPE-Z was aggregated on the DNA
strand with fluorescence intensity enhanced. Integrating the template-
free DNA polymerization, methyl-sensitive endonuclease and aggrega-
tion-induced emission (AIE) phenomenon, the detection limit of this
method was 0.16 U mL−1 with a linear range from 0.5 to 100 U·mL−1
Compared with other fluorescent detection methods, this assay is facile,
quite simple and possibly rapid. In addition, the inhibitor of MTase was
measured, which was possibly used for screening suitable anticancer
drug. Furthermore, the real sample investigation was also implemented
with the diluted human serum samples and cells. Therefore, this
strategy holds great promise application for early diagnosis of methy-
lation related diseases.
5

S. Niu, et al.
AnalyticalBiochemistry590(2020)113532
Fig. 4. (A) Fluorescence ratio in the presence of increasing amounts of M.SssI MTase. (B) The corresponding linear calibration curve.
CRediT authorship contribution statement
chemosensor for highly selective and sensitive detection and bioimaging of Al3+ in
living cells based on ion-induced aggregation, Anal. Chem. 87 (2015) 1470–1474.
[14] A. Chatterjee, M. Banerjee, D.G. Khandare, R.U. Gawas, H. Joshi, Aggregation-in-
duced emission-based chemodosimeter approach for selective sensing and imaging
of Hg(II) and methylmercury species, Anal. Chem. 89 (2017) 126 98–12704.
[15] Y. Cheng, F.J. Huang, X.H. Min, P.C. Gao, T.C. Zhang, X.C. Li, B.F. Liu, Correction to
protease-responsive prodrug with aggregation-induced emission probe for con-
trolled drug delivery and drug release tracking in living cells, Anal. Chem. 88
(2016) 10773-10773.
Shuyan Niu: Conceptualization, Methodology. Cheng Bi: Data
curation, Investigation, Validation. Weiling Song: Writing - review &
editing.
Acknowledgments
[16] W. Xue, G. Zhang, D.B. Zhu, A new label-free continuous fluorometric assay for
trypsin and inhibitor screening with tetraphenylethene compounds, Org. Lett. 12
(2010) 2274–2277.
[17] F. Sun, G.X. Zhang, D.Q. Zhang, L. Xue, H. Jiang, Aqueous fluorescence turn-on
sensor for Zn2+ with a tetraphenylethylene compound, Org. Lett. 13 (2011)
6378–6381.
[18] M. Faisal, Y.N. Hong, J.Z. Liu, Y. Yu, J.W.Y. Lam, A.J. Qin, P. Lu, B.Z. Tang,
Fabrication of fluorescent silica nanoparticles hybridized with AIE luminogens and
exploration of their applications as nanobiosensors in intracellular imaging, Chem.
Eur J. 16 (2010) 4266–4272.
[19] Y. Liu, C.M. Deng, L. Tang, A.J. Qin, R.R. Hu, J.Z. Sun, B.Z. Tang, Specific detection
of d-glucose by a tetraphenylethene-based fluorescent sensor, J. Am. Chem. Soc.
133 (2011) 660–663.
[20] V. Tjong, H. Yu, A. Hucknall, A. Chilkoti, Amplified on-chip fluorescence detection
of DNA hybridization by surface-initiated enzymatic polymerization, Anal. Chem.
83 (2013) 5153–5159.
[21] J. Guo, C. Yuan, Q. Yan, Q. Duan, X. Li, G. Yi, An electrochemical biosensor for
microRNA-196a detection based on cyclic enzymatic signal amplification and
template-free DNA extension reaction with the adsorption of methylene blue,
Biosens. Bioelectron. 105 (2018) 103–108.
[22] Y.C. Du, Y.X. Cui, X.Y. Li, G.Y. Sun, Y.P. Zhang, A.N. Tang, K. Kim, Terminal
deoxynucleotidyl transferase and T7 exonuclease-aided amplification strategy for
ultrasensitive detection of uracil-DNA glycosylase, Anal. Chem. 90 (2018)
8629–8634.
[23] R.R. Hu, J.L. Maldonado, M. Rodriguez, C.M. Deng, C.K.W. Jim, J.W.Y. Lam,
M.M.F. Yuen, G. Ramos-Ortiz, B.Z. Tang, Luminogenic materials constructed from
tetraphenylethene building blocks: synthesis, aggregation-induced emission, two-
photon absorption, light refraction, and explosive detection, J. Mater. Chem. 22
(2012) 232–240.
This work was supported by the National Natural Science
Foundation of China (21705086)
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.ab.2019.113532.
References
[1] T. Kurkina, A. Vlandas, A. Ahmad, K. Kern, K. Balasubramanian, Label-free detec-
tion of few copies of DNA with carbon nanotube impedance biosensors, Angew.
Chem. 123 (2011) 3794–3798.
[2] A. Mishra, R.K. Behera, P.K. Behera, B.K. Mishra, G.B. Behera, Cyanines during the
1990s: a review, Chem. Rev. 100 (2000) 1973–2012.
[3] H. Li, H.T. Hu, Y.J. Zhao, X. Chen, W. Li, W. Qiang, Multifunctional aptamer–silver
conjugates as theragnostic agents for specific cancer cell therapy and fluorescence-
enhanced cell imaging, Anal. Chem. 87 (2015) 3736–3745.
[4] L. Yang, N. Li, W. Pan, Z. Yu, B. Tang, Real-time imaging of mitochondrial hydrogen
peroxide and pH fluctuations in living cells using a fluorescent nanosensor, Anal.
Chem. 87 (2015) 3678–3684.
[5] J. Luo, Z. Xie, J.W.Y. Lam, L. Cheng, B.Z. Tang, H. Chen, Aggregation-induced
emission of 1-methyl-1,2,3,4,5-pentaphenylsilole, Chem. Commun. 18 (2001)
1740–1741.
[6] M. Wang, G. Zhang, D. Zhang, D. Zhu, B.Z. Tang, Fluorescent bio/chemosensors
based on silole and tetraphenylethene luminogens with aggregation-induced
emission feature, J. Mater. Chem. 20 (2010) 1858–1867.
[7] X. Lou, Z. Zhao, Y. Hong, C. Dong, X. Min, Y. Zhuang, A new turn-on chemosensor
for bio-thiols based on the nanoaggregates of a tetraphenylethene-coumarin fluor-
ophore, Nanoscale 6 (2014) 14691–14696.
[8] J. Mei, Y. Hong, J.W.Y. Lam, A. Qin, Y. Tang, B.Z. Tang, Aggregation-induced
emission: the whole is more brilliant than the parts, Adv. Mater. 26 (2014)
5429–5479.
[9] R.Y. Zhang, R.T.K. Kwok, B.Z. Tang, B. Liu, Hybridization induced fluorescence
turn-on of AIEgen–oligonucleotide conjugates for specific DNA detection, RSC Adv.
5 (2015) 28332–28337.
[10] X.H. Min, Y. Zhuang, Z.Y. Zhang, Y.M. Jia, A. Hakeem, F.X. Zheng, Lab in a tube:
sensitive detection of microRNAs in urine samples from bladder cancer patients
using a single-label DNA probe with AIEgens, ACS Appl. Mater. Interfaces 7 (2015)
16813–16818.
[11] L.H. Peng, G. Zhang, D. Zhang, J. Xiang, R. Zhao, Y. Wang, A fluorescence “turn-
On” ensemble for acetylcholinesterase activity assay and inhibitor screening, Org.
Lett. 11 (2009) 4014–4017.
[12] H. Shi, R.T.K. Kwok, J. Liu, B. Xing, B.Z. Tang, B. Liu, Real-time monitoring of cell
apoptosis and drug screening using fluorescent light-up probe with aggregation-
induced emission characteristics, J. Am. Chem. Soc. 134 (2012) 17972–17981.
[13] S.L. Gui, Y.Y. Huang, F. Hu, Y.L. Jin, G.X. Zhang, L.L. Yan, Fluorescence turn-on
[24] J.P. Xu, Y. Fang, Z.G. Song, J. Mei, L. Jia, A.J. Qin, J.Z. Sun, J. Ji, B.Z. Tang,
BSA–tetraphenylethene derivative conjugates with aggregation-induced emission
properties: fluorescent probes for label-free and homogeneous detection of protease
and α1-antitrypsin, Analyst 136 (2011) 2315–2321.
[25] C. Li, H. Wang, J. Shang, X. Liu, B. Yuan, F. Wang, Highly sensitive assay of me-
thyltransferase activity based on an autonomous concatenated DNA circuit, ACS
Sens. 3 (2018) 2359–2366.
[26] S. Rauf, L. Zhang, A. Ali, J. Ahmad, Y. Liu, J. Li, Nanopore-based, label-free, and
real-time monitoring assay for DNA methyltransferase activity and inhibition, Anal.
Chem. 89 (2017) 13252–13260.
[27] T. Tian, H. Xiao, Y. Long, X. Zhang, S. Wang, X. Zhou, S. Liu, X. Zhou, Sensitive
analysis of DNA methyltransferase based on a hairpin-shaped DNAzyme, Chem.
Commun. 48 (2012) 10031–10033.
[28] D. Li, G. Lu, C. Lei, Z. Wang, L. Li, Z. Nie, Y. Huang, S. Yao, Sensitive detection of
DNA methyltransferase activity based on supercharged fluorescent protein and
template-free DNA polymerization, Sci. China Chem. 59 (2016) 809–815.
[29] J. Zhou, X. Zhang, E. Xiong, P. Yu, X. Li, J. Chen, SDR-recycling signal amplification
for highly sensitive methyltransferase activity assay, J. Electroanal. Chem. 781
(2016) 304–309.
[30] X. He, J. Su, Y. Wang, K. Wang, X. Ni, Z. Chen, A sensitive signal-on electrochemical
assay for MTase activity using AuNPs amplification, Biosens. Bioelectron. 28 (2011)
298–303.
6