The ODN probes conjugating the Cu(II) complex enhance the luminol chemiluminescence by assembling on the DNA template

Article abstract of DOI:10.1016/j.bmc.2010.10.007

Potent peroxidase-like activity of the β-ketoenamine (1)-dicopper (II) complex (2) for the chemiluminescence (CL) of luminol either in the presence or absence of H₂O₂ has been previously demonstrated by our group. In this study, the

Full text of DOI:10.1016/j.bmc.2010.10.007

Bioorganic & Medicinal Chemistry 18 (2010) 8614–8617
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
The ODN probes conjugating the Cu(II) complex enhance the luminol
chemiluminescence by assembling on the DNA template
Yosuke Taniguchi a,b, Akiko Nitta a, Sun Min Park c, Akiko Kohara a, Takahiro Uzu a, Shigeki Sasaki a,b,
⇑
a Graduate School of Pharmaceutical Sciences, Kyushu University, 3-1-1, Maidashi, Higashi-ku, Fukuoka 812-8582, Japan
b CREST, Japan Science and Technology Agency, Kawaguchi Center Building, 4-1-8 Honcho, Kawaguchi, Saitama 332-0012, Japan
c Department of Chemistry, BK School of Molecular Science, Pohang University of Science and Technology (POSTECH), Pohang 790-784, Republic of Korea
a r t i c l e i n f o
a b s t r a c t
Article history:
Potent peroxidase-like activity of the b-ketoenamine (1)–dicopper (II) complex (2) for the chemilumines-
cence (CL) of luminol either in the presence or absence of H2O2 has been previously demonstrated by our
group. In this study, the b-ketoenamine (1) as the ligand unit for copper(II) was incorporated into the oli-
gonucleotide (ODN) probes. It has been shown that the catalytic activity of the ODN probes conjugating
the ligand–Cu(II) complex is activated by hybridization with the target DNA with the complementary
sequence. Thus, this study has successfully demonstrated the basic concept for the sensitive detection
of nucleic acids by CL based on the template-inductive activation of the catalytic unit for CL.
Ó 2010 Elsevier Ltd. All rights reserved.
Received 7 September 2010
Revised 2 October 2010
Accepted 5 October 2010
Available online 4 November 2010
Keywords:
Copper(II) complex
Chemiluminescence
Oligonucleotide sensing
Signal-amplification
1. Introduction
the synthesis and the application of the oligonucleotides probes
incorporating the copper(II) complex for detection of nucleic acids
The sensitive detection of nucleic acids plays an essential role in
gene diagnosis and biological research for both extra- and intracel-
lular events.1 A high selectivity is required to recognize not only
the sequence, but also any minute difference in a nucleoside such
as single nucleotide polymorphism (SNP) that is closely related to
the onset of diseases and response to drugs.2 Conventionally, DNA
is analyzed after PCR amplification. On the other hand, it has be-
come an attractive theme to develop an efficient method for the
detection of intact nucleic acids without any amplification proce-
dure. In the molecular beacon strategy, the fluorescence intensity
of the probe is enhanced by forming a complex with the target nu-
cleic acids.3–5 The alternative approach utilizes the target nucleic
acid as the template to catalyze the chemical reactions6–9 in order
to amplify the signal of the complex formation. Several chemilumi-
nescence (CL) detection systems have been developed based on the
peroxidase-like activity that is induced when the hemin–quadru-
plex assembly is formed on the target sequence.10 We have previ-
ously developed a new catalytic system for the CL of luminol, in
which the dicopper(II) complexes catalyze the reduction of dis-
solved molecular oxygen and subsequent oxidation of luminol to
induce CL.11 This system is characteristic in that the corresponding
monocopper is inactive and gains catalytic activity upon assem-
bling the dicopper complex. In this paper, we describe in detail
by CL.
2. Results and discussion
The b-ketoenamine (1) as the ligand part for copper(II) was de-
signed to be conjugated with the oligonucleotide (ODN) probe at
the 50 end (probe1) or at the 30 end (probe2) through an appropri-
ate linker (Fig. 1B). It was expected that the two probes would be
assembled on the target nucleic acid to form a dicopper complex,
thus inducting the catalytic activity for the CL of luminol
(Fig. 1A). In our previous study, the b-ketoenamine ligand (1)
was mixed with Cu(OAc)2 to form the dicopper complexes, which
exhibit a high catalytic activity for the CL of luminol either in the
presence or in the absence of H2O2 (Fig. 2). To determine the site
of the ligand for conjugation with the ODN probe, the complex
structure formed with the ligand 1 and Cu(OAc)2 was investigated
by an X-ray crystal analysis. It has been revealed that the complex
is multinuclear with a cubane substructure (Fig. 2A).12 The dicop-
per complex part (2) and the tetranuclear complex part (3) are
assembled to form a cubane structure as shown by the dotted line
in Figure 2B. Although it was previously anticipated that the pri-
mary hydroxyl groups participated in the coordination with the
copper ion,11,13 the complex structure shown in Figure 2 has
clearly indicated that some primary hydroxyl groups remain
un-coordinated. Crystals suitable for an X-ray analysis were only
obtained from a solution in AcOEt as the complexes with AcOEt
⇑
Corresponding author. Tel./fax: +81 92 642 6615.
E-mail address: sasaki@phar.kyushu-u.ac.jp (S. Sasaki).
0968-0896/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2010.10.007

Y. Taniguchi et al. / Bioorg. Med. Chem. 18 (2010) 8614–8617
8615
O
O
O
O
A
Non-active complex
Probe2
Assembling dicopper complex
Peroxidase-like activity
Probe1
b
NH
NH
OH
S
OH
OR
Target
3'
5'
ODN
n
ODN
ODN
SH
O
n=1 or 2
5'-modifiedODN
Probe1 (n=1 or 2)
1: R=H
B
a
4: R=Ts
N
O
O
SH
3'-modified ODN:
Probe2 (n=1 or 2)
Cu
S
S
n=1 or 2
O
N
probe1
Linker
probe2
Linker
Cu
3'
5'
CGA CCC GCA ATT
GCT GGG CGTTAA
TTT CTC CGC TTG
AAA GAG GCG AAC
O
Target (0):
Target (1X):
Target (2):
Target (3):
Target (1T)(X):
5' TGCTGGGCGTTAAAAAGAGGCGAACC 3'
5' GCTGGGCGTTAA X AAAGAGGCGAACC 3'
5' GCTGGGCGTTAA TC AAAGAGGCGAAC 3'
5' GCTGGGCGTTAA TCT AAAGAGGCGAAC 3'
5' GCTGGGCGTTAA T AAA X AGGCGAACC 3'
(X=A, G, C, T)
Spacer
O
Catalyst for CL
Dicopper complex
(X=A, G, C, T)
Figure 1. (A) Strategy for assembling dicopper complex on the target sequence.
(B) Schematic structure of the ODN–ligand conjugates for the dicopper complex
as the catalysis for CL.
Scheme 1. The synthesis of the ligand conjugated ODN probes (1 and 2) and the
target sequence. Reagents and conditions: (a) p-TsCl, pyridine, 0 °C, 81%; (b) thiol-
modified ODNs, NaHCO3 aq/DMF (9:1), 50 °C, 6 h.
molecules. The ESI-MS of the complexes obtained in MeOH indi-
cates only 2+2 complexes. Thus, the primary hydroxyl group was
chosen as the site for attachment to the ODN probe at the 30-termi-
nal or at the 50-terminal.
After 6 hr
HPLC chart
The synthesis of the ODN–ligand conjugated probe is shown in
Scheme 1. The primary alcohol group of 1 was converted to the tos-
ylate. The 50-thiol-modified ODNs and 30-thiol-modified ODNs hav-
ing different alkyl linkers (n = 1 or 2) were reacted with the
tosylate (4) in a solution of sodium bicarbonate buffer and DMF
(9:1) at 50 °C, and the reaction was followed by HPLC. An example
of the HPLC charts is shown in Figure 3. After 6 h, a peak around
12 min of the 50-thiol-modified ODN disappeared, and a new peak
corresponding to the conjugated product (Probe2 (n = 2)) appeared
around 13 min. After purification by HPLC, the conjugated struc-
ture was confirmed by MALDI-TOF MS measurements.
Tosylate (4)
12 min
13 min
Probe2 (n=2)
Figure 3. The HPLC chart of the conjugation reactions. HPLC conditions:
column; shiseido CAPCELL PAK C18, 4.6 ꢁ 250 mm, flow rate; 1.0 mL/min,
buffer; A 0.1 M TEAA, B CH3CN, B concn 10–30%/20 min linear gradient, column
oven; 35 °C, UV-detector; 254 nm.
Before investigation of the catalysis of the ODN–ligand conju-
gates for the CL of luminol, we checked the appropriate pH for
the formation of the dicopper complex by UV–vis spectroscopy
using the monomeric ligand (1) in a buffer solution. The absorption
bands at 650 nm for the copper acetate at pH 9 was shifted to
620 nm at pH 12, indicating the formation of the dicopper
complexes (Fig. 4).12 These results suggested that the CL experi-
ments with the ODN–ligand conjugates should be carried out at
pH 12.
To optimize the alkyl linker length of the ODN probes (n = 1 or
2) and the spacer part of the target sequences with the different
nucleotide numbers between the probe binding sites, we tested
the luminol CL properties using all combinations of the ODN–li-
gand probes and the target sequences (Scheme 1). The number in
the parenthesis of the Target represents the number of nucleotides
between the probe binding sites, for instance, Target (2) contains
the C–T spacer and Target (3) has the T–C–T spacer. The different
nucleotide is inserted in Target (1), for example, Target (1T) con-
tains the T nucleotide as the spacer between the probe binding
sites.
The CL reactions were started by the addition of luminol sodium
and ascorbic acid into the mixture of the probes and the target in
the presence of Cu(OAc)2, and the CL intensities were periodically
recorded. The results are summarized in Figure 5. Among all the
combinations, Probe1 (n = 2) and Probe2 (n = 1) showed a good re-
sponse to the Target (1T). Although a detailed structure of the com-
plex between the probes and target was not clear, it was clearly
shown that the catalytic activity of the probes for the CL reaction
significantly depended on the distance of the linker of the probes
and spacer of the target DNA. Interestingly, although the combina-
tion of Probe1 (n = 1) and Probe2 (n = 2) would have an equivalent
alkyl linker length with that of Probe1 (n = 2) and Probe2 (n = 1),
they showed a low activity for the CL reaction. In the case of the
combination of Probe1 (n = 2) and Probe2 (n = 2), the CL intensity
is low in comparison to the other combinations. Based on these re-
sults, it turned out that the combined use of Probe1 (n = 2) bearing
OH
B
Me
Me
O
N
Me
O
OH
O
O
O
H
N
O
Cu
Cu
OH
O
Me
O
N
Me
Me
1
2
OH
A
Cu
O
O
O
Cu
O
O
Cu
N
N
CuO
O
O
Me
Me
Me
O
Me
3
O
Figure 2. The crystal structures of the multinuclear copper complex (A) and its
schematic drawing (B). Solvents (AcOEt) are not shown for clarity. AcOꢀ represents
an acetate bridging two Cu(II).

8616
Y. Taniguchi et al. / Bioorg. Med. Chem. 18 (2010) 8614–8617
Figure 4. (A) UV-spectra of 10 mM ligand (1) in a borate buffer (H3BO3–NaOH) contains the 10 mM Cu(OAc)2 at pH 9 or pH 12. (B) Expanded UV-spectra.
Using the probe combination of Probe1 (n = 2) and Probe2
(n = 1), we next investigated the selectivity toward the target se-
quence. This combination produced a high CL activity in the pres-
ence of Target (1T) compared to that in the absence of the target
(Fig. 6A). These CL reactions were started by the addition of
Cu(OAc)2, because it was found in the preliminary investigation
shown in Figure 5 that the non-selective background CL was min-
imized by the last addition of Cu(OAc)2 to the reaction mixture. In
the case of Target (1X), one nucleotide difference at the spacer site
of the target sequence was not discriminated, suggesting that the
nucleotide at the spacer between the binding sites had no effect
on the CL activity (Fig. 6A). In contrast, when one nucleotide differ-
ence was inserted in the Probe2 binding site, only the full-matched
target with G at X (Target 1T(G)) produced higher a CL response
(Fig. 6B). This result indicates that this probe can discriminate
the presence of a single nucleoside mismatch base. From the UV
melting experiments, only the full-matched target produced a clear
melting behavior, indicating that the selectivity in the CL response
to the one nucleotide difference of Target 1T(X) is due to the for-
Figure 5. The CL intensity of the combination use of probes1, 2, and Target. The
reaction was performed using of each oligonucleotides, 25 luminol
sodium salt, 25 M ascorbic acid, and 5 M Cu(OAc)2 in a borate buffer (50 mM
mation of hybridized complexes between the probe ODNs and
the target DNA.
1
lM
lM
l
l
H3BO3–NaOH, pH 12). Reaction was started by the addition of luminol sodium salt
and ascorbic acid.
3. Conclusion
In this study, we have synthesized the b-ketoenamine-conju-
gated ODN probe for complexation with Cu(II) ion. The alkyl linker
length between the b-ketoenamine part, the probe ODN and the
spacer nucleotide number of the target sequence between the bind-
ing sites of the two probes have been optimized. It has been success-
fully demonstrated that the b-ketoenamine-conjugated ODN probes
exhibit a catalytic activity for the luminol CL with a sequence selec-
tivity. Thisstudy hasprovideda newentry intothedesign oftheODN
probes with signal-amplifying machinery for the sensitive detection
of nucleic acids without amplification procedures.
the C6 alkyl linker and Probe2 (n = 1) bearing the C3 alkyl linker is
suitable for detecting the target sequence (1) with one nucleotide
spacer between the probe binding sites. The UV melting tempera-
ture (Tm) of the combination of Probe1 (n = 2), Probe2 (n = 1), and
Target (1T) were measured in the presence or absence of
Cu(OAc)2.14 The Tm value in the presence of Cu(OAc)2 was 3.9 °C
higher than in the absence of Cu(OAc)2. In contrast, the Tm value
of the combination of Target (1T) and the corresponding non-
conjugated probes decreased by 1.3 °C in the presence of Cu(OAc)2.
These results also supported the fact that the hybridized com-
plexes formed between the ODN probes and the target DNA are
stabilized by forming complexes with Cu(OAc)2.
4. Materials and methods
4.1. General
The 1H NMR (400 MHz) and 13C NMR (125 MHz) spectra were re-
cordedbyVarianUNITY-400spectrometers. The 31P NMR(161 MHz)
spectrum was recorded using 10% phosphoric acid in D2O for the
internalstandardat 0 ppm. TheUV–visspectraand Tm measurement
were obtained using a BECKMAN COULTER DU-800. The high-
resolution mass spectra were recorded by an Applied Biosystems
Mariner System 5299 spectrometer using bradykinin and angio-
tensin as the internal standard. The MALD-TOF/MS spectra were
recorded by a BRUKER DALTONICS Microflex instrument.
Figure 6. The selectivity of the Probe1 (n = 2) and Probe2 (n = 1) to the target
sequence. (A) The comparison of CL with Target (1T), (1A), (1G), and (1C). (B) The
discrimination of the single nucleotide difference in Target (1T)(G), (1T)(A), (1T)(T)
4.1.1. (R)-3-{(2-Acetyl-3-oxobut-1-en-1-yl)amino}-2-hydroxy
propyl 4-methylbenzenesulfonate (4)
To a solution of 1 (201 mg, 1.0 mmol) in pyridine (5.0 mL) was
added p-toluenesulfonyl chloride (229 mg, 1.2 mmol) at 0 °C. After
or (1T)(C). These reactions were performed using 1
25 M luminol sodium salt, 25 M ascorbic acid, and 5
buffer (50 mM H3BO3–NaOH, pH 12). Reaction was started at adding of Cu(OAc)2.
lM of each oligonucleotide,
l
l
l
M Cu(OAc)2 in a borate

Y. Taniguchi et al. / Bioorg. Med. Chem. 18 (2010) 8614–8617
8617
stirring for 24 h at the same temperature, the reaction was
quenched by saturated aqueous NaHCO3 and extracted with
organic solvents (chloroform/isopropanol 4:1, v/v). The organic
layer was washed with brine and dried over anhydrous MgSO4,
and then the solvent was concentrated under reduced pressure.
The crude product was purified by silica-gel column chromatogra-
phy (chloroform/methanol = 15:1) to give 4 (310 mg, 0.87 mmol,
87%) as an orange oil. 1H NMR (CDCl3, 400 MHz) d 2.26 (br s,
1H), 2.33 (br s, 6H), 2.44 (s, 3H), 3.37–3.40 (m, 1H), 3.50–3.54
(m, 1H), 4.02 (s, 3H), 7.35 (d, 2H, J = 8.24 Hz), 7.75 (d, 1H,
J = 12.4 Hz), 7.77 (d, 2H, J = 8.24 Hz), 11.0 (br s, 1H). 13C NMR
(CDCl3, 125 MHz) d 21.7, 51.8, 68.4, 70.0, 111.9, 128.0, 130.1,
132.2, 145.5, 161.1. FTIR (neat): 3357, 1629, 1200 cmꢀ1. HRMS
(ESI) m/z: calcd for C16H22NO6S (M+H)+ 356.1162, found 356.1156.
cn 25
DNA (final concn 1
concn 1 M), copper acetate (final concn 5
buffer (final concn 50 mM at pH 12) in a final reaction volume of
50 L.
Method B for Fig. 6: The reaction was initiated by the addition of
copper acetate (final concn 5 M) to a reaction mixture which was
mixed with the target DNA (final concn 1 M), Probe1 (final concn
M), Probe2 (final concn 1 M), luminol sodium (final concn
M), ascorbic acid (final concn 25 M), and H3BO3–NaOH buffer
(final concn 50 mM at pH 12) in a final reaction volume of 50 L.
l
M) to a reaction mixture which was mixed with the target
M), Probe1 (final concn 1 M), Probe2 (final
M), and H3BO3–NaOH
l
l
l
l
l
l
l
1
25
l
l
l
l
l
The luminescence was measured by a luminometer produced by
PROMEGA.
Acknowledgments
4.2. Synthesis of the oligonucleotides
This work was supported by a Grant-in-Aid for Scientific
Research (S) from Japan Society for the Promotion of Science (JSPS),
CREST from Japan Science and Technology Agency. We acknowl-
edge Dr. Kenji Yoza at BRUKER AXS for the X-ray study.
All oligonucleotides were synthesized on a 1 lmol scale by an
ABI 394 DNA/RNA synthesizer with the standard b-cyanoethyl
phosphoramidite chemistry. All amidite reagents and CPG supports
were synthesized or purchased from Glen Research. After synthesis
of the 50-modified or 30-modified ODNs, they were cleaved from
the CPG resin in 28% ammonium hydroxide solution. The crude
product was purified by RP-HPLC (column: nacalai tesque COSMO-
SIL 5C18MS-II 10 ꢁ 250 mm, solvent: A; 0.1 M TEAA, B; CH3CN, and
B concn 10–40%/20 min linear gradient, 3 mL/min flow rate, de-
tected at 254 nm). These ODNs were treated with 10% acetic acid
and washed with Et2O, and then the water phase was lyophilized
under reduced pressure to remove the DMTr-protecting group.
Supplementary data
Supplementary data (NMR spectra, crystal structure and data)
associated with this article can be found, in the online version, at
doi:10.1016/j.bmc.2010.10.007.
References and notes
1. (a) Silverman, A. P.; Kool, E. T. Chem. Rev. 2006, 106, 3775; (b) Mora, J. R.; Getts,
R. C. Expert Rev. Mol. Diagn. 2007, 7, 775; (c) Landegren, U.; Kaiser, R.; Sanders,
J.; Hood, L. Science 1988, 241, 1077.
2. (a) Syvänen, A.-C. Nat. Rev. Genet. 2001, 2, 930; (b) Slate, J.; Gratten, J.; Beraldi,
D.; Stapley, J.; Hale, M.; Pemberton, J. M. Genetica 2009, 136, 97.
3. Tyagi, S.; Kramer, F. R. Nat. Biotechnol. 1996, 14, 303.
4.3. General procedure of synthesis of ligand conjugated ODN
probes. The synthesis of Probes1 and 2
The corresponding ODNs were treated with TCEP (3.0 equiv) in
water for 1 h for conversion to the thiol group. These thiol-modi-
fied ODNs were then added to the solution of 4 (30 equiv) in the
mixture of DMF and sodium bicarbonate buffer/DMF (9:1) at
50 °C for 6 h. The resulting mixture was purified by RP-HPLC (col-
umn: nacalai tesque COSMOSIL 5C18MS-II 10 ꢁ 250 mm, solvent:
A; 0.1 M TEAA, B; CH3CN, and B concn 10–40%/20 min linear gradi-
ent, 3 mL/min flow rate, detected at 254 nm). The structures of all
ODNs were confirmed by MALDI-TOF MS measurement. The
MALD/MS data of the synthesized probes: Probe1 (n = 1), 30
CGACCCGCAATT-(C3)-ligand, calcd: 3926.4; found: 3925.6. Probe1
(n = 2): 30 CGACCCGCAATT-(C6)-ligand, calcd; 3969.9; found:
3968.4. Probe2 (n = 1), 50 GTTCGCCTCTTT-(C3)-ligand, calcd:
3915.2; found: 3914.2. Probe2 (n = 2), 50 GTTCGCCTCTTT-(C6)-li-
gand, calcd: 3953.2; found, 3952.9.
4. Recent reviews: (a) Wang, K.; Tang, Z.; Yang, C. J.; Kim, Y.; Fang, X.; Li, W.; Wu,
Y.; Medley, C. D.; Cao, Z.; Li, J.; Colon, P.; Lin, H.; Tan, W. Angew. Chem., Int. Ed.
2009, 48, 856; (b) Venkatesan, N.; Seo, Y. J.; Kim, B. H. Chem. Soc. Rev. 2008, 37,
648.
5. Recent examples: (a) Gerasimova, Y. V.; Hayson, A.; Ballantyne, J.;
Kolpashchikov, D. M. ChemBioChem 2010, 11, 1762; (b) Yuichi, H.; Taiga, F.;
Hiromu, K.; Koji, S.; Xingguo, L.; Kosuke, N.; Tomokazu, T.; Yasuko, Y.; Hiroyuki,
A. Angew. Chem., Int. Ed. 2010, 49, 5502; (c) Ihara, T.; Uemura, A.; Futamura, A.;
Shimizu, M.; Baba, N.; Nishizawa, S.; Teramae, N.; Jyo, A. J. Am. Chem. Soc. 2009,
131, 1386; (d) Li, V.; Geyer, R.; Tan, W. Nucleic Acids Res. 2000, 28, e52.
6. Shibata, A.; Abe, H.; Ito, M.; Kondo, Y.; Shimizu, S.; Akiyama, K.; Ito, Y. Chem.
Commun. 2009, 6586.
7. (a) Abe, H.; Kool, E. T. Proc. Natl. Acad. Sci. U.S.A. 2006, 103, 263; (b) Sando, S.;
Kool, E. T. J. Am. Chem. Soc. 2002, 124, 2096.
8. Grossmann, T. N.; Seitz, O. J. Am. Chem. Soc. 2006, 128, 15596.
9. (a) Sando, S.; Narita, A.; Abe, K.; Aoyama, Y. J. Am. Chem. Soc. 2005, 127, 5300;
(b) Narita, A.; Ogawa, K.; Sando, S.; Aoyama, Y. Angew. Chem., Int. Ed. 2006, 45,
2879.
10. (a) Nakayama, S.; Sintim, H. O. J. Am. Chem. Soc. 2009, 131, 10320; (b)
Kolpashchikov, D. M. J. Am. Chem. Soc. 2008, 130, 2934; (c) Xiao, Y.; Pavlov, V.;
Gill, R.; Bourenko, T.; Willner, I. ChemBioChem 2004, 5, 374.
11. Uzu, T.; Sasaki, S. Org. Lett. 2007, 9, 4383.
4.4. UV–vis measurement
12. (a) Wegner, R.; Gottschaldt, M.; Gorls, H.; Jager, E. G.; Klemm, D. Chem. Eur. J.
2001, 7, 2143; (b) Wegner, R.; Gottschaldt, M.; Poppittz, W.; Jager, E. G.;
Klemm, D. J. Mol. Catal. 2003, 201, 93; (c) Wegner, R.; Gottschaldt, M.; Gorls, H.;
Jager, E. G.; Klemm, D. Angew. Chem., Int. Ed. 2000, 39, 595.
13. Matsumoto, N.; Tsutsumi, T.; Ohyoshi, A.; Okawa, H. Bull. Chem. Soc. Jpn. 1983,
56, 1386.
The solution of copper acetate (final concn 25 mM) was added
to the H3BO3–NaOH buffer (final concn 50 mM) in the presence
of ligand 2 (final concn 25 mM) at pH 9 or 12. The spectrum was
then obtained at 400–800 nm for the d–d band.
14. Bianke, G.; Chaurin, V.; Egorov, M.; Lebretpn, J.; Constacle, E.; Housecroft, C. E.;
Haner, R. Bioconjugate Chem. 2005, 17, 1441.
4.5. Chemiluminescence (CL) measurement
Method A for Figure 5: The reaction was initiated by the addition
of luminol sodium (final concn 25 lM) and ascorbic acid (final con-