Small molecule agonists of the orphan nuclear receptors steroidogenic factor-1 (SF-1, NR5A1) and liver receptor homologue-1 (LRH-1, NR5A2)

ARTICLE

pubs.acs.org/jmc

Small Molecule Agonists of the Orphan Nuclear Receptors

Steroidogenic Factor-1 (SF-1, NR5A1) and Liver Receptor

Homologue-1 (LRH-1, NR5A2)

Richard J. Whitby,*^,†Jozef Stec,^†Raymond D. Blind,^‡Sally Dixon,^†Lisa M. Leesnitzer,^§

Lisa A. Orband-Miller,^§Shawn P. Williams,^§Timothy M. Willson,^§Robert Xu,^§William J. Zuercher,^§

Fang Cai,^‡and Holly A. Ingraham^‡

^†School of Chemistry, University of Southampton, Southampton, Hants, SO17 1BJ, United Kingdom

^‡Department of Cellular and Molecular Pharmacology, Mission Bay Campus, University of California San Francisco, San Francisco,

California 94598, United States

^§Molecular Discovery Research, GlaxoSmithKline, 5 Moore Drive, Research Triangle Park, North Carolina 27709-3398, United States

S Supporting Information

b

ABSTRACT:

The crystal structure of LRH-1 ligand binding domain bound to our previously reported agonist 3-(E-oct-4-en-4-yl)-1-

phenylamino-2-phenyl-cis-bicyclo[3.3.0]oct-2-ene 5 is described. Two new classes of agonists in which the bridgehead anilino

group from our ﬁrst series was replaced with an alkoxy or 1-ethenyl group were designed, synthesized, and tested for activity in a

peptide recruitment assay. Both new classes gave very active compounds, particularly against SF-1. Structure-activity studies led to

excellent dual-LRH-1/SF-1 agonists (e.g., RJW100) as well as compounds selective for LRH-1 (RJW101) and SF-1 (RJW102 and

RJW103). The series based on 1-ethenyl substitution was acid stable, overcoming a signiﬁcant drawback of our original bridgehead

anilino-substituted series. Initial studies on the regulation of gene expression in human cell lines showed excellent, reproducible

activity at endogenous target genes.

’ INTRODUCTION

a process termed “reverse endocrinology”.⁶Attempts to “adopt”

(or deorphanize) orphan NRs have been successful for NR1H4

(farnesoid X receptor, FXR)⁷and peroxisome proliferator-

activated receptor family (PPARs, NR1Cs)⁸and have led to

useful therapeutics.

Here, we have undertaken an eﬀort to identify synthetic

ligands for subfamily V members, including steroidogenic fac-

tor-1 (SF-1, NR5A1),⁹and its close homologue, liver receptor

homologue-1 (LRH-1, NR5A2).¹⁰Both receptors are known to

play important roles during embryonic development and in adult

physiology.

The nuclear receptor (NR) superfamily in mammals com-

prises a highly conserved group of 49 receptors that act as

transcription factors to regulate development, homeostatic phy-

siology, and cellular metabolism.¹Nearly half of all NRs are

ligand regulated, responding to dietary or endocrine signals such

as steroid hormones, retinoids, vitamin D, fatty acids, and thyroid

hormone. As such, NRs are attractive targets for drug discovery,²

and indeed, 13% of current FDA-approved drugs regulate NRs.³

NRs without assigned natural ligands are referred to as orphan

NRs.⁴On the basis of structural analyses of nearly all NR

subfamilies, it is predicted that most orphan receptors might

accommodate ligands, thus providing novel targets for pharma-

ceuticals. Finding natural or synthetic regulatory ligands for these

orphan receptors is key to understanding their role in physiology,⁵

Received: November 8, 2010

Published: March 10, 2011

r

2011 American Chemical Society

2266

dx.doi.org/10.1021/jm1014296 J. Med. Chem. 2011, 54, 2266–2281

|

Journal of Medicinal Chemistry

ARTICLE

Figure 2. Synthetic compounds reported to modulate SF-1 or LRH-1

activity.

interaction with the atypical orphan receptors that lack a DBD,

including small/short heterodimer partner (SHP, NR0B1)³³and

DAX-1, Dosage-sensitive sex reversal, adrenal hypoplasia critical

region, on chromosome X, gene 1) (NR0B2).³⁴

Figure 1. Natural ligands for LRH-1 or SF-1.

X-ray crystallography coupled with mass spectroscopy

revealed the presence of Escherichia coli-derived phospholipids,

phosphatidylglycerides (1; Figure 1) and phosphatidylethanol-

amines (2a) in the ligand binding pockets of human LRH-1 and

SF-1.³⁵The majority of phospholipids bound to either SF-1 or

human LRH-1 LBD were identiﬁed as having C16 or 18 acyl

groups with some showing a cis-alkene in the Δ9 position.

Whether these phospholipids merely serve as structural ligands

or serve a regulatory role remains to be established. Support for

phospholipids as regulatory ligands includes increased coactiva-

tor peptide recruitment on binding of phospholipids to SF-1^35c

and a correlation between binding of phospholipid and LRH-1-

induced activation of gene expression.^35dThe exchange of

bacterially derived phosphatidyl glyceride (1) with phospholi-

pids such as 3^35band phosphatidycholine (2b) has been demons-

trated.³⁶In the latter case, the exchange had little eﬀect on

binding of coactivator peptides.³⁶Recently, Moore has claimed

in a patent that diundecanoyl (2b, R¹= R²= nC₉H₁₉) and

dilauroyl (2b, R¹= R²= nC₁₁H₂₃) phosphatidylcholine (PC) act

as agonists of the LRH-1 receptor and that administration of

these lipids to diabetic mice reduces blood glucose levels.³⁷Other

correlative data include the ﬁnding that SF-1 activation by a

tamoxifen analogue increases cellular levels of phosphatidylino-

sitol (3,4,5) triphosphate (3).^15cFinally sphingosine (4) is

reported to bind SF-1 and suppress expression of the SF-1 target

gene CYP17a1.³⁸Derivatives of (4) such as sphingosylpho-

sphorylcholine and N-Acyl-4 (ceramides) may also be natural

ligands.

We reported the ﬁrst synthetic small molecule agonist for

LRH-1 and SF-1, GSK8470 (5), and a structure-activity rela-

tionship (SAR) study on the series 6 leading to the more active

analogue 7 (Figure 2).³⁹Another small molecule known to activate

both SF-1 and LRH-1 is the herbicide atrazine,⁴⁰but the precise

mechanism leading to this increased receptor activity has yet to

be deﬁned.

Recently, p-heptyloxyphenol (8) was reported as a potent

(IC₅₀= 7.3 μM) inverse agonist for SF-1 but with no activity

against LRH-1.⁴¹Expression of several reported SF-1 target genes

was suppressed by 8 in cell-based assays. However, although 8

was reported to inhibit proliferation of adrenocortial carcinoma

cell line H295R, it had the same eﬀect with an SF-1 negative cell

line (SW-13).¹⁴Several isoquinoline-based inverse agonists of

SF-1 were discovered through high-throughput screening and

SF-1 (NR5A1) is a critical factor in vertebrate endocrine organ

development, including male sexual diﬀerentiation, and is an

important regulator of steroidogenic enzymes.¹¹Numerous

genetic mutations in the DNA binding domain (DBD) and

ligand binding domain (LBD) of SF-1 correlate with abnormal

testis development¹²and premature ovarian failure.¹³By con-

trast, ampliﬁcation of SF-1 is associated with adrenocortical tumors,

with inverse agonists reported to inhibit proliferation of primary

cultured tumor cells.¹⁴SF-1 has also been implicated in the

development of endometriosis and endometrial cancers.¹⁵

Finally, rodent models suggest that SF-1 expressed in the hypotha-

lamus inﬂuences anxiety, energy homeostasis, and appetite.¹⁶

LRH-1 plays a critical role in embryonic development of the

endoderm¹⁷and is highly expressed in the intestine, liver,

exocrine pancreas, and ovary.¹⁸LRH-1 regulates crucial enzymes

in hepatic bile acid biosynthesis¹⁹and cholesterol homeostasis¹⁰

and is a key controller in the hepatic acute phase response.²⁰

Thus, this receptor may be a target for the treatment of cardio-

vascular disease²¹and cholinostatic liver disease.²²LRH-1 and

SF-1 both regulate aromatase expression,²³and LRH-1 is expressed

in several human breast cancer cell lines, suggesting that antago-

nists in combination with traditional aromatase inhibitors might

be eﬀective in reducing local concentrations of estrogen in human

breast carcinomas.²⁴Finally, LRH-1 is expressed in human intest-

inal crypt cells where it controls cell proliferation and diﬀeren-

tiation.²⁵Its expression²⁶and potential role in gastric cancer²⁷

suggest that LRH-1 can inﬂuence tumor formation by accelerat-

ing the cell cycle and promoting inﬂammation.²⁸

Both SF-1 and LRH-1 have emerged as potential stem cell

factors because both can regulate expression of Oct-4, which is

one of the four factors found to induce pluripotency of mouse

embryonic ﬁbroblasts.^17,29Moreover, these two NRs can

completely replace Oct-4 to reprogram murine somatic cells to

induce pluripotent cells^30aand are also potent inducers in the

transition from an epiblast stem cell to ground state pluripotency

(iPS).^30bAs such, identifying eﬀective agonists to either SF-1 or

LRH-1 might help in achieving a pharmaceutical approach in

generating or maintaining pluripotent human stem cells.

LRH-1 and SF-1 bind to DNA as monomers and show

constitutive activity when expressed in a variety of cell types.^9,10

Receptor activity can be regulated by post-translational modiﬁ-

cations including phosphorylation³¹and sumoylation³²or through

2267

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

Figure 3. CR trace from the phospholipid^35b(magenta, orange, and

yellow) and 5 (white) bound conformations of LRH-1 were super-

imposed for comparison. The pocket contracts around the smaller 5,

with the biggest shifts occurring for residues 338-350 in helix 3 (yellow)

and residues 408-427 in the β-turn and helix 6 (orange), where the

phospholipid headgroup protrudes.

Figure 5. Two-dimensional compound interaction diagram depicting

adjacent residues and the π stacking interaction with His390. The crystal

structure is available from the RCSB with access code 3PLZ and is

further described in the Experimental Section.

other receptors and exhibiting strong cell toxicity, suggesting

transactivation assay artifacts (promiscuous inhibition of the

reporter system).

Although 5 and related compounds 6 have proven to be

excellent biological probes for LRH-1 and SF-1, they have a

number of limitations. Most important is that they are unstable to

acid, making handling diﬃcult and raising doubts about stability

during biological application. The series also shows little discri-

mination between LRH-1 and SF-1. The aim of this work was

thus ﬁrst to develop new series of compounds that were more

stable and easily handled than series 6, but with at least compar-

able binding and eﬃcacy, and second to ﬁnd compounds that

were selective for LRH-1 and/or SF-1.

’ COCRYSTAL STRUCTURE OF 5 WITH hLRH-1

As a basis for the design of improved analogues of 5, we solved

the cocrystal structure of compound 5 bound to the human LRH-

1 LBD (Figures 3 and 4). Although racemic 5 was used, the

1S,5R-bicyclo[3.3.0]oct-2-ene enantiomer cocrystallized with

LRH-1 LDB. Compound 5 occupied the same binding pocket

volume as the terminal 12 carbon atoms in both acyl chains of a

phospholipid bound in LRH-1.^35bThis smaller size permitted

LRH-1 to contract, narrowing the gap between the N-terminal

half of helix 3 (residues 338-350, yellow in the PL-bound

structure) and the β-turn/helix 6 region (residues 408-427, orange

in the PL-bound structure) where the phospholipid headgroup is

situated in the PL þ LRH-1 structure, and completely enclose

the ligand within the binding pocket. Making no polar interac-

tions with the protein, 5 was a compact, hydrophobic mass

complementing the inner surface of the binding pocket. There

was π stacking between the His390 and the aniline of 5 with a

centroid-centroid distance of 3.8 Å and a deviation from

coplanarity of around 10°.

Figure 4. Compound 5 is shown in the LRH-1 ligand binding pocket.

Contacting residues are indicated, along with the His390-aniline

distance. The surface of the pocket is shown, colored by the nearest

atom type. The region of the pocket adjacent to helix 5 and the β-turn

contain polar residues and several trapped water molecules.

further SAR studies, of which 9 was most active (IC₅₀

=

200 nM).^41,42At high levels (10 μM), 9 modestly suppressed

doxycycline (DOX) induced proliferation of H295R cell line

with little eﬀect on the SF-1 negative SW-13 cell line. Closely

related isoquinolines aﬀected both cell lines in a similar way,

suggesting a non-SF-1 mechanism. The SAR for these series

seems complex; for example, replacing the methoxy group in 9

with ethoxy gave a compound highly active against a range of

2268

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

The structure suggested some chemical strategies for improv-

ing compound properties. The acid-labile aniline nitrogen made

no polar interactions with the protein, suggesting that another

more stable linker might be tolerated. We thus designed com-

pounds with oxygen- and carbon-based linkages from the sub-

stituted bridgehead carbon. Additionally, His390, Arg393, and

Gln432 were within 5 Å of the compound. Polar moieties could

be incorporated to interact with these residues, which might

both improve binding and increase hydrophilicity of the ligand

(Figure 5).

Scheme 2. Preparation of Bridgehead 1-Alken-2-yl-Substi-

tuted Systems^a

’ CHEMISTRY

Alkoxy-Substituted Series. Racemic tertiary alcohol 11 was

synthesized as previously reported³⁹from hept-6-en-1-yn-

1-ylbenzene via Pauson-Khand cyclization to give the cyclo-

pentenone 10 and cerium trichloride-assisted 1,2-addition of

hexylmagnesium bromide (Scheme 1). Exposure of 11 to various

alcohols in the presence of catalytic amounts of camphorsulphonic

acid gave a series of racemic analogues 12 of 7 in which an alkoxy

group replaced the aniline substituent. Yields for the last step

were generally good (Table 1), the exception being when the

alcohol carried an R-branch. The products 12 were unstable to

silica, so were purified by column chromatography on basic grade

III alumina.

^aReagents and conditions: (a) (i) Cp₂ZrBu₂, THF, -78 °C, 0.5 h; (ii)

room temperature, 2 h. (b) R²CHX₂(X = Br for R²= nHex, nBu, nOct;

X = Cl for R²= H, SiMe₂Ph), LDA or LiTMP, -78 °C, 15 min. (c)

R³CtCLi (3 equiv), -78 to -60 °C over 0.5 h. (d) MeOH, NaHCO₃,

room temperature, 12-16 h.

“All Carbon” Series. A previously reported⁴³tandem reaction

sequence on zirconocene was used to construct “all carbon”

analogues 18 of 7. Thus, intramolecular cocyclization of 1,6-enyne

Table 2. Synthesis of 1-(2-Alkenyl)-bicyclo[3.3.0]oct-2-enes 18

Scheme 1. Preparation of Bridgehead-Alkoxy Series^a

R¹

R²

R³

yield (%)^a

18a

18b

18c

18d

18e

18f

Ph

nHex

H

Ph

86

78

72

62

70

78

51

60

54

75

65

56

75

70

82

88

86

80

61

58

71

73

45

3-MeOPh

4-MeOPh

4-MePh

4-EtPh

4-nBuPh

4-tBuPh

4-PhPh

nPr

18g

18h

18i

^aReagents and conditions: (a) Co₂(CO)₈, DMSO (10 equiv), THF,

reﬂux, 5 h, 80%. (b) nC₆H₁₃MgBr, CeCl_3,-10 °C to room temperature,

1 h, 90%. (c) ROH (10 equiv), camphorsulfonic acid (0.1 equiv),

20 °C, 3.5 h.

18j

nBu

18k

18l

nHex

nOct

Ph

18m

18n

18o

18p

18q

18r

18s

18t

3-MeOPh

4-EtPh

nPr

Ph

Table 1. Synthesis of 1-Alkoxy-3-hexyl-2-phenyl-cis-bicyclo-

[3.3.0]oct-2-enes 12a-j

nBu

Ph

nHex

cHex

(CH₂)₃OH

Ph

compound

R

yield (%)^a

Ph

12a

Me

Et

75

69

71

7

Ph

12b

Ph

12c

nPr

iPr

18u

18v

18w

Ph

nBu

Ph

12d

Ph

nOct

SiMe₂Ph

Ph

12e

nBu

68

64

62

65

12

69

Ph

^aIsolated yield of >95% pure material.

12f

CH₂CH(Me)(Et)

nPent

12g

12h

nHex

13 gave the zirconacyclopentenes 14 (Scheme 2). The addition

of a 1,1-dihaloalkyl compound followed by lithium diisopropy-

lamide (LDA) or lithium 2,2,6,6-tetramethylpiperidide (LiTMP)

generated a carbenoid R²X₂CLi in situ, which when inserted into

12i

cHex

12j

CH₂Ph

^aIsolated yield from 11.

2269

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

Scheme 3. Preparation of Cyclohexyl- and Pyrrolidine-Fused

Systems^a

Scheme 5. Preparation of 7-Oxygenated Systems^a

^aReagents and conditions: (a) (i) Cp₂ZrBu₂, THF, -78 °C, 0.5 h; (ii)

room temperature, 2 h; (iii) nHexCHBr₂, LDA, -78 °C, 15 min; (iv)

PhCtCLi (3 equiv), -78 to -60 °C over 0.5 h; (v) MeOH, NaHCO₃,

room temperature, 12-16 h.

Scheme 4. Preparation of 6-Oxygenated Systems^a

^aReagents and conditions: (a) (i) NaH, THF, -10 °C; (ii) N-tosyl

imidazole, -10 °C, 1 h. (b) PhCtCLi (2 equiv), THF, HMPA

(2 equiv), -10 to 0 °C over 1 h then room temperature, 40 h; (iii)

saturated NaHCO₃(aq). (c) Me₂tBuSiOTf, imidazole, DMAP, THF,

room temperature, 15 h. (d) (i) Cp₂ZrBu₂, -78 °C, 0.5 h then 3 h at

room temperature; (ii) nHexCHBr₂, LDA, -78 °C; (iii) PhCtCLi

(3 equiv), -78 °C to -60 °C over 45 min; (iv) MeOH/NaHCO₃(aq),

room temperature, 5 h. (e) TBAF (2 equiv), THF, room temperature,

20 h. (f) Pyridine, Ac₂O (75 equiv), DMAP (0.58 equiv), room

temperature, 17 h.

Using ethanol and in situ-generated Me₃SiI, acrolein was

converted into 1,1-diethoxy-3-iodopropane,⁴⁵which after rapid

puriﬁcation by chromatography on basic alumina (grade III) was

reacted with lithium phenylacetylide to give (5,5-diethoxypent-1-

yn-1-yl)benzene. Hydrolysis of the acetal to give an aldehyde was

followed by reaction with vinylmagnesium bromide to aﬀord the

alcohol 21. Protection of the hydroxyl group with tBuMe₂SiOTf

gave the desired cyclization precursor 22, which underwent the

zirconocene-induced cocyclization, carbenoid insertion, and phenyl

acetylide addition to give a 1.6:1 mixture of the exo and endo

isomers 23 after protonolysis. Tetrabutylammonium ﬂuoride

(TBAF) cleavage of the silyl group furnished the desired racemic

bicyclic alcohols 24. The exo and endo isomers were separated by

careful chromatography on silica, with the endo isomer eluting

ﬁrst. The relative stereochemistries of the exo and endo isomers

were clear from coupling patterns to the proton adjacent to the

hydroxyl group. In the endo isomer, it appears as a ddd, J = 9.1,

8.5, 5.5 Hz, and in the exo isomer, it appears as a broad singlet, the

patterns being in accord with expectations from molecular modeling

and the Karplus relationship of couplings to dihedral angles.⁴⁶

The separated diastereoisomers of 24 were acylated to aﬀord 25-

endo and 25-exo. A crystal structure of 25-endo conﬁrmed the

stereochemical assignment.⁴⁷The 7-oxygenated series was syn-

thesized as shown in Scheme 5.

^aReagents and conditions: (a) (i) NaI, Me₃SiCl, MeCN; (ii) EtOH,

0 °C to room temperature, 2 h. (b) PhCtCLi (1.5 equiv), THF, HMPA

(1.5 equiv), -78 °C, 1 h then room temperature, 14 h. (c) THF:H₂O

(4:1), HCl (2 M), room temperature, 3 h. (d) (i) CH₂CHMgBr, -78 to

-65 °C, 1 h; (ii) NH₄Cl(aq). (e) tBuMe₂SiOTf, imidazole, DMAP,

THF, room temperature, 18 h. (f) (i) Cp₂ZrBu₂, THF -78 °C, 0.5 h

then 3 h at room temperature; (ii) -78 °C, nHexCHBr₂, LDA, 15 min;

(iii) PhCtCLi (3.0 equiv), -78 °C to -60 °C over 45 min; (iv)

MeOH/NaHCO₃(aq), room temperature, 5 h. (g) TBAF (5 equiv),

THF, room temperature, 20 h. (h) Pyridine, Ac₂O (73 equiv), DMAP

(0.58 equiv), 13 h.

the alkyl-zirconium bond of 14 afforded the ring-expanded

zirconacyclohexene 15. The addition of a lithiated alkyne in-

duced a ring-closing rearrangement to the bicyclo[3.3.0]oct-1-

ene 16, which rearranged further to the zirconocene alkylidene-

ate complex 17, incorporating a second alkyne moiety. Aqueous

workup gave the racemic 1-(2-alkenyl)-bicyclo[3.3.0]oct-2-enes

18a-w in generally excellent yield (Table 2) for a single-pot,

three-component coupling. The yields were poorer when di-

chloromethane was the carbenoid precursor due to bis- and tris-

insertion of the derived carbenoid into the zirconacycle.

The tandem reaction sequence also worked for the forma-

tion of the racemic bicyclo[4.3.0]non-8-ene 19 and pyrroli-

dine fused systems 20a,b (Scheme 3). The low yield for

compound 19 reﬂected a diﬃcult separation from by-products

—the yield estimated from the partially puriﬁed product

was 46%.⁴⁴

A single-pot ring-closure/ring-opening procedure was used to

convert pent-4-ene-1,2-diol⁴⁸into alcohol 26.⁴⁹Thus, selective

tosylation of the primary alcohol was followed by in situ ring closure

to an epoxide and ring-opening with lithium phenylacetylide to

aﬀord the alcohol 26.⁵⁰The overall yield was poor despite

considerable optimization. tBuMe₂Si (TBDMS) protection of

26 gave 27, which underwent zirconocene-mediated cocycliza-

tion, dibromocarbenoid insertion, and phenylacetylide-driven

Compounds carrying oxygen substitution on the saturated

cyclopentane ring were required. The synthesis of the 6-oxyge-

nated compounds is shown in Scheme 4.

2270

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

Table 3. Correlation between Predicted and Observed Coupling Constants for 29

between

H⁷-H^8b

H⁷-H^8a

H⁷-H^6b

H⁷-H^6a

H^6b-H⁵

H^6a-H⁵

29-exo

47

dihedral angle (°)

calcd ³J (Hz)

observed ³J (Hz)

164

10.2

8.5

154

8.9

8.3

37

14

9.7

10

104

1.9

3.6

6.1

7.6

6.3

5.5

29-endo ax. conf.

dihedral angle (°)

calcd ³J (Hz)

38

5

80

33

87

18

101

1.6

1.3

5.9

1.3

9.4

29-endo eq. conf.

dihedral angle (°)

calcd ³J (Hz)

average calcd 29-endo eq. and -ax. conf. ³J (Hz)

observed ³J (Hz)

44

159

9.5

5.4

4.6

46

165

10.4

5.9

5

35

155

10.5

6.1

6

6.6

5.8

6.2

6.3

6.1

5.6

7.3

8.4

9.5

zirconate rearrangement to give a 1:1 mixture of the exo and

endo isomers 28. After TBAF cleavage of the silyl group, the

racemic exo and endo isomers of 29 were separated by careful

chromatography, with the endo isomer eluting ﬁrst. Acylation

of the separated diastereoisomers furnished 30-exo and 30-

endo.

ﬂuorescence resonance energy transfer (FRET)-based peptide

recruitment assay. Puriﬁed bacterial-expressed LBDs^35bof hu-

man LRH-1 or human SF-1 were labeled with biotin and incu-

bated with APC-labeled streptavidin (Molecular Probes). Pep-

tides derived from TIF-2 amino acids 737-757 (B-QEPVSPKK-

KENALLRYLLDKDDTKD-CONH2) for LRH-1 or from DAX-1

amino acids 1-23 (B-MAGENHQWQGSILYNMLMSAKQT-

CONH2) for SF-1 were labeled with biotin and incubated with

europium-labeled streptavidin (Perkin-Elmer, Wallac). The labeled

receptor and peptide were incubated in the presence of various

concentrations of test compound, and the associated complexes

were quantiﬁed by time-resolved ﬂuorescence energy transfer

(TR-FRET). The pEC₅₀values of the test compounds, which

serve as a measure of the binding aﬃnity for the receptor, were

estimated from a plot using the ratio of ﬂuorescence values

collected at 671 nm to ﬂuorescence values collected 618 nm

versus concentration of test compound added. Typically, 11

points over the concentration range 1 nm to 10 μM was used to

construct each dose-response curve, and the pEC₅₀was calcu-

lated using ActivityBase 5.4 software. Six and three repeats

were carried out for LRH-1 and SF-1, respectively. Test

compounds that increased the aﬃnity of the receptors for the

peptide yielded an increase in ﬂuorescent signal. The dose-

response curves were sigmoidal with a clear plateau at high

concentrations of test compound, the level of which we report as

the relative eﬃcacy (RE) of peptide recruitment. In the absence

of a known standard, the value of RE was normalized to 24-exo

for both LRH-1 and SF-1. The average standard deviations of the

pEC₅₀values for LRH-1 and SF-1 were 0.07 and 0.08, respec-

tively, hence, the retention of the ﬁrst decimal place. The average

standard deviations of the RE values for LRH-1 and SF-1 were

0.034 and 0.025, respectively, hence, the retention of the second

decimal place in the reported values but with an approximately

(0.03 95% conﬁdence limit.

The relative stereochemistries of 29-exo and 29-endo (and

hence 30-exo and 30-endo) were established by nuclear magnetic

resonance (NMR) studies combined with molecular modeling

(Table 3) using the MMFF94 force ﬁeld as implemented in

Spartan 06 (Wavefunction Inc.).⁵¹The proton next to the

hydroxyl group in one isomer appeared as a tt, J = 8.5, 5.9 Hz

(due to couplings of 8.5, 8.3, 6.3, and 5.5 Hz), consistent with 29-

exo or the equatorial conformer of 29-endo (29-endo eq. conf.),

but as a quintet (J = 5.5 Hz) in the other diastereoisomer, not

consistent with any minimum energy structure. Molecular mod-

eling showed that 29-exo had a well-deﬁned minimum energy

conformer, but for 29-endo, the “equatorial” and “axial” hydroxy

conformers (29-endo eq. and 29-endo ax.) were <1 kJ/mol

diﬀerent in energy. The expected coupling patterns for each

conformer of 29-endo were calculated using the Altona modi-

ﬁcation^46bof the Karplus relationship^46abetween dihedral angle

3

and J as implemented in the Mspin program⁵²from Mestrec.

The average showed a good correlation to the observed coupling

constants (Table 3).

Stability Tests. Compounds 18a, 24-exo, 24-endo, 28-exo, and

28-endo were stable after being kept in CDCl₃at room tempera-

ture in the presence of daylight for 2 weeks or being exposed to

1.0 equiv of (þ)-camphorsulfonic acid in CDCl₃at room

temperature for 1 week.

’ RESULTS AND DISCUSSION

The compounds 12a-j, 18a-w, 19, 20a,b, 24, 25, 29, and 30

were screened for activity against both hLRH-1 and hSF-1 using

2271

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

Table 4. LRH-1 and SF-1 Binding and Activation of Alkoxy-

Substituted Series 12

Table 6. Variation of 2-Substituent in Series 18 Compounds

pEC₅₀(RE)

compound

18a

R

LRH-1

SF-1

compound

R

LRH-1

SF-1

Ph

6.6 (0.24)

7.2 (0.78)

6.9 (0.42)

ia

5

6.2 (0.89)

7.5 (0.38)

ia

6.8 (0.36)

7.4 (0.70)

ia

18m

3-MeOPh

4-EtPh

nPr

6.6 (0.13)

7

18n

ia

12a

12b

12c

12d

12e

12f

12g

12h

12i

12j

Me

Et

18o

ia

6.4 (0.56)

6.6 (0.59)

ia

5.6 (0.17)

5.6 (0.21)

5.5 (0.19)

5.3 (0.39)

5.6 (0.18)

ia

6.3 (0.55)

6.7 (0.67)

6.4 (0.49)

6.6 (0.62)

6.7 (0.56)

6.4 (0.43)

ia

18p

nBu

ia

nPr

iPr

18q

nHex

ia

18r

cHex

5.9 (0.15)

6.1 (0.38)

6.7 (0.59)

ia

nBu

18s (RJW101)

(CH₂)₃OH

CH₂CH(Me)(Et)

nPent

nHex

ia

Table 7. Variation of 3-Substituent in Series 18 Compounds

cHex

6.1 (0.16)

7.0 (0.13)

7.1 (0.66)

ia

CH₂Ph

Table 5. Variation of Bridgehead Substituent in Series 18

Compounds

pEC₅₀(RE)

compound

R

LRH-1

SF-1

18a

18t

nHex

H

6.6 (0.24)

ia

7.2 (0.78)

ia

pEC₅₀(RE)

18u

18v

18w

nBu

6.7 (0.54)

5.8 (0.15)

6.8 (0.53)

7.4 (0.86)

6.8 (0.67)

7.2 (0.33)

nOct

SiMe₂Ph

compound

18a

R

LRH-1

SF-1

Ph

6.6 (0.24)

7.2 (0.78)

18b

3-MeOPh

4-MeOPh

4-MePh

4-EtPh

4-nBuPh

4-tBuPh

4-PhPh

nPr

6.5 (0.25)

7.2 (0.28)

20. Finally, Table 9 provides results from compounds 24, 25, 29,

and 30 with oxygen substitution on the cyclopentane ring.

We were pleased to ﬁnd that many of the alkoxy-substituted

analogues were active against both LRH-1 and SF-1, showing

that the nitrogen in the aniline series 6 (exempliﬁed by 5 and 7)

was not necessary. All of the compounds (except 12j) bound less

strongly to LRH-1 and induced less recruitment of peptide than

the aniline series, suggesting that an aromatic group is preferred

by LRH-1 in this region. Unfortunately, it was not possible to

make the OPh-substituted system as it was highly unstable, both

because phenoxide is a much better leaving group than alkoxides

but also because phenol will act as an acid catalyst for decom-

position. The compounds showed good selectivity for SF-1, with

binding approaching and eﬃcacy exceeding that of our currently

most used biological tool 5. For both LRH-1 and SF-1, there is a

clear SAR relating to the size of the R group with both small

groups (Me) and large groups giving inactive compounds. The

cutoﬀ for large chains is sharp, indicating a deﬁned pocket being

18c

ia

18d

5.7 (0.25)

6.8 (0.28)

18e

ia

18f

6.0 (0.14)

ia

18g

ia

18h

ia

18i

5.5 (0.23)

6.8 (0.66)

18j (RJW102)

nBu

5.6 (0.19)

6.7 (0.76)

18k

18l

nHex

ia

nOct

The screening data are presented in several tables. Table 4

shows the alkoxy-substituted series 12a-j, and Tables 5-7 show

the series 18 compounds with emphasis on variation at the 1-, 2-,

and 3-positions of the bicyclo[3.3.0]oct-2-ene skeleton, respec-

tively. Table 8 contains the alternative core structures of 19 and

2272

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

Table 8. Eﬀect of Variations in Skeleton on Biological

Activity

Table 9. Eﬀect of Oxygen Substitution on the Cyclopentane

Ring

pEC₅₀(RE)

compound

18a

LRH-1

SF-1

compound

18a

LRH-1

SF-1

6.6 (0.24)

6.6 (1.00)

6.4 (0.67)

6.4 (0.18)

6.6 (0.18)

6.0 (0.53)

5.8 (0.33)

ia

7.2 (0.78)

7.5 (1.00)

7.2 (0.77)

6.4 (0.25)

7.1 (0.24)

6.6 (0.49)

6.5 (0.95)

ia

6.6 (0.24)

6.6 (0.23)

5.9 (0.20)

6.5 (0.13)

7.2 (0.78)

7.2 (0.42)

6.5 (0.49)

ia

24-exo (RJW100)

24-endo

19

20a (RJW103)

25-exo

20b

25-endo

ﬁlled. For LRH-1, this is above four carbons long [cyclohexyl,

CH₂CH(Me)(Et), and n-butyl all ﬁt, while n-pentyl does not].

For SF-1, the pocket appears slightly larger with n-pentyl, but

not n-hexyl ﬁtting. These results are comparable to those

observed with aniline series 6, compounds where 3- or 4-sub-

stitution on the NAr ring gave reduced binding or inactive

compounds.³⁹An interesting exception was the benzyloxy deriv-

ative 12j, which displayed excellent binding to LRH-1, although

poor eﬃcacy, but was inactive against SF-1. It seems likely that π

stacking with His-390 as described above for compound 5 results

in the strong binding. Although the alkoxy-substituted series

provided candidates for some of our key aims including the SF-1

and LRH-1 selective compounds 12g and 12j, respectively, these

compounds proved as acid sensitive as the aniline series, as

evidenced by their decomposition on attempted chromatogra-

phy on silica or when stored in glassware that had not been

washed with base.

29-exo

29-endo

30-exo

30-endo

6.3 (0.13)

6.7 (0.34)

good SF-1 selective analogue in the FRET assay. The longer

chain compounds 18k (R = n-hexyl) and 18i (R = n-octyl) were

inactive.

Changing the 1,7-enyne starting material allowed the SAR due

to variation of the substituent on position 2 of the bicyclo-

[3.3.0]oct-2-ene to be probed (Table 6). The tight constraints

and preference for aryl groups of the LRH-1 binding site were

again apparent. Although a 3-methoxyphenyl group (18m) was

tolerated, 4-ethylphenyl (18n) was not, and surprisingly, neither

of R = nPr or nBu (18o,p), both similar sizes to a phenyl group,

gave active compounds. R = cyclohexyl (18r) gave modest

binding and poor eﬃcacy but conﬁrms the preference for cyclohexyl

over n-alkyl observed in the alkoxy series above (Table 4). SF-1

proved much more accommodating, consistent with the larger

ligand binding pocket, although compounds with 4-ethylphenyl

(18n) or n-hexyl (18q) substituents were not active. nPr-, nBu-,

and c-hexyl-substituted compounds (18o,p,r) all gave similar

binding and eﬃcacy with SF-1 but distinctly poorer than com-

pound 18a (R = Ph). Remarkably, the 3-hydroxypropyl sub-

stituent in 18s gave good binding and activation of LRH-1 but

was inactive against SF-1, providing the only example of a highly

LRH-1 selective compound. The hydroxyl group may be in a

position to form a hydrogen bond with a backbone carbonyl in

the N-terminal region of helix 3 of LRH-1. The inactivity of 18s

indicates this to be a very nonpolar area in SF-1.

Using alternative dihalocarbenoids in the formation of 18

allowed the biological eﬀect of variation in the 3-substituent

(Table 7) to be studied. The case R = H gave an inactive com-

pound against both receptors, indicating that the ligand binding

pocket needs to ﬁlled for binding and/or activity. Shortening the

n-hexyl (8a) substituent to n-butyl (18u) gave a substantial

increase in eﬃcacy for LRH-1 without aﬀecting SF-1 in the FRET

assay. The bulky SiMe₂Ph substituent gave a substantial increase

in eﬃcacy for LRH-1 and a modest decrease in both binding and

eﬃcacy for SF-1 (compare 18w with 18a). An n-octyl chain gave

some reduction in binding and eﬃcacy, particularly for LRH-1.

The acid instability of series 12 prompted us to test compound

18a with a similar cis-bicyclo[3.3.0]oct-2-ene structure but which

lacked the acid-sensitive bridgehead leaving group, and it was

found to exhibit good binding and activation of both LRH-1 and

SF-1 (Table 5).

Variation of the lithiated alkyne used in the multicomponent

synthesis of 18 allowed variation of the bridgehead substituent

(Table 5). As with the series 12 compounds, we observe a strict

cutoﬀ in the size of group R, which can be accommodated. Even

addition of a para-methyl group to the preferred phenyl sub-

stituent decreased binding (18d), and anything larger (18e-h)

gave inactive compounds. The potent binding, although poor

eﬃcacy, of 18f with LRH-1 is an anomaly and perhaps indicates

an approach to developing reverse agonists of LRH-1. Interest-

ingly, a 3-MeO group was well tolerated perhaps indicating some

stabilization via dipolar interactions or weak H-bonding, whereas

a 4-OMe substitution gave an inactive compound (18c). When R

is an alkyl group (18i-l), LRH-1 binds only the shortest tried

(R = nPr, nBu 18i,j) and then with low pEC₅₀and eﬃcacy. The

comparison of 18j (R = nBu) with the similarly sized but much

more active 18a (R = Ph) indicates a strong preference for an aryl

group correlating with aromatic stacking with His390 noted in

the crystal structure of LRH-1 and 5 above. SF-1 bound the R =

nBu compound 18j strongly and with good eﬃcacy, conﬁrming

the larger pocket noted in the SAR of series 12 and providing a

2273

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

Figure 7. Dose-dependent transcriptional activation of SF-1 by 24-exo

in living cells. Relative mRNA levels of SHP transcript are shown

in HEK293 cells stably expressing either empty vector (EV) or mouse

SF-1 (SF-1) following 24 h of treatment with the indicated dosage of 24-

exo (μM). Expression levels are shown relative to DMSO. *p < 0.05, and

***p < 0.001.

Figure 6. Diﬀerential binding to NR5A receptors. Migration of puriﬁed

mouse SF-1 LBD complexed with PIP2 (SF-1/PIP2) or with human

LRH-1 LBD (LRH-1 alone) in native PAGE after incubation with

increasing amounts of indicated compounds. The faster migrating lower

band of SF-1 LBD without compound (0) is the SF-1/PIP2 complex.

for SF-1, although the greater efficacy against SF-1, but still weak

binding and efficacy against LRH-1 favors 18j. The main

disadvantage of all of these is their very non-polar nature, which

may cause solubility problems in polar solvents, in which case

pyrrolidine 20a provides reasonable selectivity and may be pre-

ferred. Compound 18s was unique in providing LRH-1 selec-

tivity, although the activity was modest.

We also looked at variation in the core skeleton (Table 8). The

only eﬀect of changing the fused saturated ring from cyclopen-

tane (in 18a) to cyclohexane (in 19) was reduced eﬃcacy against

SF-1. The pyrrolidine-fused systems 20a,b oﬀered the potential

of improved solubility. The N-methyl compound 20a was active

against both receptors, although with reduced binding and

eﬃcacy, particularly against LRH-1. Given the improved solubi-

lity characteristic of 20a, c.f., the hydrocarbons 18, it is a useful

SF-1 selective compound. Compound 20b was LRH-1 selective

but with very poor eﬃcacy.

Finally, we examined some analogues with oxygen substitution

of the cyclopentane ring. The design was driven by the crystal

structure of compound 5 bound to LRH-1 described above, which

indicated a polar patch (Arg-393 and His-390) in the generally

hydrophobic ligand binding site (Figure 4).

We were delighted to ﬁnd that introduction of a 6-exo-hydroxy

substituent (24-exo) gave a substantial increase in both binding

and eﬃcacy against LRH-1 with more modest increases for SF-1.

The endo-epimer of 24 showed very similar binding and eﬃcacy

against both receptors as compound 18a lacking the oxygen

substitution. Examination of Figure 4 indicates that only the

exo alcohol is placed to interact with Arg-393 or His-390.

Acylation of the endo-alcohol (to give 25-endo) had little eﬀect

on binding to either receptor, although substantially reduced

eﬃcacy. Acylation of the exo-alcohol (to give 25-exo) substan-

tially reduced binding to SF-1 with little eﬀect on LRH-1,

although both showed greatly reduced eﬃcacy.

The 7-hydroxyl-substituted systems 29-exo and 29-endo showed

reduced binding as compared to the unsubstituted analogue 18a,

although eﬃcacies were reasonable. Acylation of the exo-alcohol

gave compound 30-exo, which was inactive against both LRH-1

and SF-1, indicating a size limitation of this part of the binding

pocket. Acylation of the endo alcohol to give 30-endo was well

tolerated.

Direct Binding to Purified NR5A Receptors. Several com-

pounds were tested for direct binding using a native gel assay,

which generally maintains native protein structure and binding

activities.⁵³We purified both mSF-1 LBD complexed with dipa-

lmitoyl phosphatidyl-inositol (4,5) bisphosphate (PIP2) and

hLRH-1 LBD alone (no lipid added) to homogeneity as pre-

viously described,³⁶then added either dimethylsulfoxide (DMSO)

vehicle (0) or the indicated doses of 24-exo, 20a, 18j, or 18s

compounds (Figure 6). These binding reactions were allowed to

equilibrate for 16 h, separated by native polyacrylamide gel

electrophoresis (PAGE), and SF-1 protein was visualized with

Coomassie stain. The lower band in SF-1/PIP2 lanes is PIP2-

dependent, while the upper band represents SF-1 no longer

bound by phospholipid. Compound 24-exo clearly displaces the

bound PIP2 phospholipid from SF-1 almost completely at 1 μM,

and similarly, 20a can also displace PIP2 from SF-1, however,

with reduced potency and efficacy (Figure 6, left panel). Com-

pounds 18j and 18s do not appear competent to displace PIP2

from SF-1 LBD in this in vitro assay, even up to 100 μM.

Using hLRH-1 LBD alone that had not been complexed with

any phospholipids (Figure 6, right panel), we observed a clear

dose-dependent shift in hLRH-1 LBD native PAGE migration

upon 24-exo binding, although 20a was nearly as eﬃcacious

binding to LRH-1, a similar shift was only observed at 100 μM.

Compound 18j does not appear competent to shift hLRH-1 LBD

migration in native gels. Although not very eﬃcacious, 18s can

consistently shift hLRH-1 LBD migration in this native gel assay,

albeit with reduced potency as compared to 24-exo.

Choice of Compounds as Biological Probes from the

Peptide Recruitment Assay. Compound 24-exo provides an

excellent replacement for compound 5 as a biological tool. It has

excellent stability, reasonable solubility in polar solvents, and

improved binding and efficacy against both LRH-1 and SF-1.

Little is lost in this FRET peptide recruitment assay by using the

1.6:1 mixture of 24-exo and 24-endo produced directly from the

zirconium-mediated reaction, thus avoiding a tricky separation.

Compounds 18o and 18p provide the most selective compounds

Transcriptional Activation of Endogenous NR5A Target

Genes. Given this direct binding data, we then asked if 24-exo

was capable of regulating the SF-1-mediated transcription of an

endogenous target gene in living human cells. Human embryonic

kidney 293 (HEK293) cells stably expressing either empty vector

or SF-1 were treated with either DMSO vehicle or the indicated

doses of 24-exo for 24 h; each sample was subjected to real-time

quantitative polymerase chain reaction (RT-qPCR) to evaluate

the relative mRNA expression of the endogenous SF-1 target

2274

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

Figure 8. Diﬀerential transcriptional activation of endogenous NR5A targets in living cells. Relative mRNA expression of endogenous NR5A target

genes in HEK293 cells stably expressing either mSF-1 or hLRH-1. For each gene assessed, expression levels are shown relative to DMSO following 24 h

of treatment with indicated compound (10 μM). *p < 0.05, and **p < 0.01.

gene SHP (Figure 7). Compound 24-exo induced a significant

dose-dependent increase in SHP transcripts beginning at 5 μM;

induction was dependent on the presence of SF-1 in these cells.

We next constructed a stable hLRH-1 HEK293 cell line in

addition to the SF-1 line and tested each compound for activation

of multiple endogenous target genes, which were previously

2275

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

identiﬁed using microarrays and gene proﬁling.⁵⁴SF-1 or LRH-1

cells were treated with 10 μM of indicated compounds for 24 h,

and the relative mRNA expression of each transcript was deter-

mined by RT-qPCR. SF-1 and LRH-1 protein levels were com-

parable in stably expressing cell lines, as determined by Western

blots (data not shown). We noted that cell viability and expres-

sion of housekeeping genes appeared unchanged following

treatment with compounds when compared to DMSO treatment.

Consistent with the phospholipid displacement assay, both

24-exo and 20a signiﬁcantly activate SF-1-mediated transcription

of the endogenous SHP, StAR, G0S2, and MeOX1 target genes,

while 18j and 18s do not (Figure 8, left panel). Also consistent

with the native gel assay, selective activation of all genes by LRH-

1 is observed in response to 10 μM 24-exo but not with similar

amounts of 18j and 18s (Figure 8, right panel). Interestingly, while

20a activated LRH-1 transcription of the StAR and G0S2 genes,

this compound failed to activate the SHP and MeOx1 genes,

suggesting that when bound to 20a, LRH-1's ability to recruit

needed cofactors at all genomic targets might be compromised.

Although 18j binds LRH-1 well, it exhibits poor eﬃcacy at these

particular target genes in the HEK293 cell line, raising the

possibility that a more relevant cellular or tissue context (such

as liver cells) might be required for 18j to fully activate LRH-1.

depending on the number of directly attached protons, this being

determined by DEPT experiments. Assignments in NMR are only given

where not easily derived from the 1D data, and systematic numbering is

used. Protons described as H-a and H-b are on the endo and exo faces of

the bicyclic molecules, respectively. High-resolution mass spectra (HRMS)

were recorded on a VG Analytical 70-250-SE double focusing mass

spectrometer using electron impact ionization (EI) (at 70 eV) or on a

Bruker Apex III spectrometer using positive ion electrospray ionization.

Low-resolution mass spectra (LRMS) were recorded on a VG Analytical

70-250-SE double focusing mass spectrometer (EI), a ThermoQuest

TraceMS gas chromatography mass spectrometry (GCMS) [EI and CI

(with ammonia as the reagent gas)], or on a VG platform quadrupole

spectrometer using positive ion electrospray ionization (ESI^þ). Values

of m/z are reported in atomic mass units (a.m.u.) followed in parenth-

eses by the peak intensity (relative to the base peak of 100%). IR spectra

were obtained for all compounds but are not included. All compounds

were >95% pure by gas chromatography performed on a Hewlett-

Packard HP 6890 series GC system, using a HP-5 30 m column, with a

film thickness of 0.25 μm and 0.32 mm internal diameter. The carrier gas

was helium, and the flow rate was 2.7 mL min^-1using 100:1 split

injection and an 80-275 at 25 °C/min (held at 275 °C for 4 min)

temperature program with a flame ionization detector.

All organometallic reactions were carried out with dry glassware

under an argon atmosphere using standard Schlenk and syringe techni-

ques. Merck silica gel 60 (0.040-0.063 mm) was used for puriﬁcation.

Unless given below, all materials were obtained from commercial

sources and, if necessary, dried and distilled before use. Petrol refers to

the fraction of petroleum ether that boils between 40 and 60 °C and was

distilled before use. Tetrahydrofuran (THF) and diethylether used in

reactions were freshly distilled from sodium/benzophenone. n-Butyl-

lithium (nBuLi) was used as a 2.5 M solution in hexanes (Aldrich) and

was stored at 4 °C.

’ CONCLUSION

A series of 1-alkoxy- and 1-alken-2-yl-substituted bicyclo-

[3.3.0]oct-2-enes and related bicycles were designed, synthe-

sized, and evaluated as agonists for the orphan NRs LRH-1 and

SF-1. The study achieved its main aims: a compound (in 24-exo,

RJW100) with similar activity to the best of our previous agonists

but with excellent stability; several compounds including 18j

(RJW102) and 20a (RJW103) with selectivity for SF-1, although

the former was inactive in in vivo studies, probably due to very

poor solubility in aqueous media; and a compound 18s (RJW101)

selective for LRH-1, although further work to improve potency is

needed. The precision and consistency of the SARs are notable

and probably due to the rigid bicyclic core used for all of the

compounds. Our preliminary cell-based studies have demon-

strated that the 24-exo is a consistently active agonist of SF-1 and

LRH-1 target gene expression in a variety of cell lines. While the

toxicity of 24-exo in animals remains to remains to be deter-

mined, we are currently assessing its utility in more complex

in vivo biological model systems such as in Caenorhabditis elegans

and zebraﬁsh, both of which express NR5A receptors. Further-

more, we expect that 24-exo will be a useful chemical tool to

probe the in vivo biological eﬀects of SF-1 and LRH-1 in mam-

malian systems. For instance, we speculate that 24-exo might

eventually replace the need to virally introduce Oct-4 in an iPS

assay and would thus provide one step toward achieving chemical

reprogramming.

Compounds 18b,h,k,m,o,r, 19, and 20b are reported elsewhere.⁴⁴

The synthesis of the enyne starting materials, 1-ethyl-4-(hept-6-en-1-yn-

1-yl)benzene, N-methyl-N-(phenylprop-2-ynyl)prop-2-en-1-amine, tert-

butyldimethyl((7-phenylhept-1-en-6-yn-3-yl)oxy)silane 22, and tert-

butyldimethyl((7-phenylhept-1-en-6-yn-4-yl)oxy)silane 27 as well as

compounds 12a,c-j, 18c-g,i,l,n,p,q,t-w, 25, 29, and 30 are given in

the Supporting Information.

rac-(1S,5R)-1-Ethoxy-3-hexyl-2-phenyl-bicyclo[3.3.0]oct-2-ene

(12b). To a stirred solution of rac-(3S,5R)-3-hexyl-2-phenyl-bicyclo-

[3.3.0]oct-1-en-3-ol³⁹(11) (142 mg, 0.50 mmol) in dry THF (4 mL) at

room temperature was added EtOH (0.29 mL, 5.0 mmol) followed by

addition of a solution of (þ)-camphorsulfonic acid (11.6 mg, 0.050 mmol)

in dry THF (1 mL). The stirring was continued at the same temperature

for 3.5 h after which the reaction mixture was poured onto saturated

aqueous solution of NaHCO₃(100 mL), and the products were extracted

with Et₂O (3 ꢀ 75 mL). The combined organic phases were washed

with H₂O (3 ꢀ 100 mL) and brine (100 mL). Drying over anhydrous

MgSO₄and filtration followed by concentration in vacuo and purifica-

tion of the crude material by column chromatography on Al₂O₃(basic,

grade III) with 2.5% Et₂O in petrol as the eluent gave the title compound

as a yellow oil (0.108 g, 69%). ¹H NMR (400 MHz, CDCl₃): δ 7.27-

7.13 (5H, m), 3.40 (1H, m), 3.26 (1H, m), 2.65 (1H, dd, J = 17.1, 8.3 Hz,

H-4b), 2.45-2.37 (1H, m, H-5), 2.14-2.08 (2H, m), 2.06-1.93

(2H, m), 1.66-1.49 (3H, m), 1.44-1.29 (3H, m), 1.24-1.10 (10H, m),

0.77 (3H, t, J = 6.8 Hz, CH₃). ¹³C NMR (100.5 MHz, CDCl₃): δ 145.51

(C), 137.28 (C), 136.09 (C), 129.21 (CH), 128.10 (CH), 126.59 (CH),

103.39 (C), 58.40 (CH₂), 42.99 (CH), 42.15 (CH₂), 37.89 (CH₂),

35.83 (CH₂), 31.81 (CH₂), 29.91 (CH₂), 29.43 (CH₂), 28.25 (CH₂),

25.40 (CH₂), 22.77 (CH₂), 15.98 (CH₃), 14.21 (CH₃). LRMS (EI) m/z

= 312 ([M]^þ, 93%), 283 (100%), 195 (59%). HRMS (EI) found, [M]^þ,

312.2458. C₂₂H₃₂O requires, 312.2453.

’ EXPERIMENTAL SECTION

Chemistry. General. NMR spectra were recorded on Bruker

AM300 or DPX400 spectrometers in CDCl₃or C₆D₆and referenced

to residual protonated solvent (¹H NMR) or the center peak of the

deuterated solvent triplet (¹³C NMR). Chemical shifts are reported in

parts per million downfield of TMS, and the following abbreviations

were used to denote coupling patterns: s, singlet; d, doublet; t, triplet; q,

quartet; m, multiplet (uninterpretable or unresolved); and fs, fine

splitting (resolved but unassigned small couplings). ¹³C NMR spectra

were proton decoupled and are reported as C, CH, CH₂, and CH₃,

2276

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

General Procedure. To a solution of Cp₂ZrCl₂(0.293 g, 1.0 mmol)

in dry THF (5 mL) cooled to -78 °C was added nBuLi (0.80 mL of a

2.5 M solution in hexanes, 2.0 mmol) dropwise (over ∼2 min). After

25 min, a solution of the appropriate enyne (1.0 mmol) in dry THF

(3 mL) was added dropwise. After 30 min at -78 °C, the reaction

mixture was allowed to warm to room temperature and continued to stir

for 2-3 h. After the reaction mixture was recooled to -78 °C, a solution

of the appropriate 1,1-dihalo alkane (1.1 mmol) in dry THF (1 mL) was

added followed by dropwise addition of LDA (0.64 mL of a 1.8 M

solution, 1.15 mmol). The reaction mixture was stirred at -78 °C for

15 min before dropwise addition of the corresponding lithium acetylide.

[Lithium acetylide was freshly prepared from alkyne (3.0 mmol) in dry

THF (3 mL) and nBuLi (1.2 mL of a 2.5 M solution in hexanes,

3.0 mmol) at -5 °C over 15 min]. The stirring was continued for 0.5-1

h during which the reaction mixture was allowed to warm to -55 °C

before addition of MeOH (10 mL) and saturated aqueous solution of

NaHCO₃(10 mL). The whole mixture was allowed to warm to room

temperature and left stirring for 12-16 h. The mixture then was poured

onto H₂O (100 mL), and the products were extracted with Et₂O (3 ꢀ

75 mL). The combined organic phases were washed with H₂O (3 ꢀ

100 mL) and brine (100 mL). Drying over anhydrous MgSO₄and

filtration followed by concentration in vacuo gave the crude products

mostly as yellow oils.

rac-(1R,5R)-3-Hexyl-2-phenyl-1-(1-phenylvinyl)-bicyclo[3.3.0]oc-

t-2-ene (18a). General procedure was used with 1-(hept-6-en-1-

ynyl)benzene, 1,1-dibromoheptane, and 1-ethynylbenzene as compo-

nents. Purification of the crude material by column chromatography on

SiO₂(230-400 mesh) with hexanes as the eluent gave the title com-

pound as a pale yellow oil (0.318 g, 86%). ¹H NMR (300 MHz, CDCl₃):

δ 7.35-7.24 (10H, m), 5.04 (1H, d, J = 1.6 Hz, CdCH₂), 5.02 (1H, d,

J = 1.6 Hz, CdCH₂), 2.43 (1H, tdd, J = 8.6, 3.2, 1.4 Hz, H-5), 2.34 (1H,

fs ddd, J = 16.2, 8.4, 1.0 Hz, H-4b), 2.12-1.97 (3H, m), 1.85 (1H, dtd,

J = 12.2, 9.7, 6.8 Hz), 1.68 (2H, m), 1.62-1.52 (3H, m), 1.43-1.21 (8H,

m), 0.88 (3H, t, J = 6.8 Hz, CH₃). ¹³C NMR (75 MHz, CDCl₃):

δ 155.39 (CdCH₂), 144.40 (C), 142.48 (C), 138.95 (C), 137.98 (C),

129.69 (2CH), 127.93 (2CH), 127.55 (2CH), 127.52 (2CH), 126.47

(CH), 126.33 (CH), 114.45 (CdCH₂), 70.16 (C-1), 45.71 (CH-5),

43.83 (CH₂), 36.33 (CH₂), 35.64 (CH₂), 31.70 (CH₂), 29.89 (CH₂),

29.41 (CH₂), 27.87 (CH₂), 25.60 (CH₂), 22.60 (CH₂), 14.06 (CH₃).

LRMS (EI) m/z: 370 ([M]^þ³, 100%), 299 (35%), 267 (85%). HRMS

(EI) found, [M]^þ, 370.2655. C₂₆H₃₄requires, 370.2661.

out on 2.0 mmol scale. Crude product from the three component

coupling was purified by flash column chromatography on silica, and

then, the TBDMS group was removed with TBAF [2.0 mL of a 1.0 M

solution in THF (2.0 mmol) in dry THF (8.0 mL) at room temperature

for 20 h]. Purification of the crude material by column chromatography

on SiO₂(230-400 mesh) with hexanes as the eluent gave the title

1

compound as a yellow oil (0.430 g, 61% over two steps). H NMR

(400 MHz, CDCl₃): δ 7.24-7.16 (5H, m), 5.15 (1H, d, J =

1.8 Hz, C=CH₂), 4.98 (1H, d, J = 1.8 Hz, CdCH₂), 3.65 (2H, q, J =

6.5 Hz, CH₂OH), 2.34 (1H, tt, J = 9.0, 2.0 Hz, H-5), 2.24 (1H, dd,

J = 16.0, 9.0 Hz, H-4b), 2.13-2.02 (4H, m), 1.87-1.61 (6H, m),

1.59-1.52 (1H, m), 1.48-1.38 (1H, m), 1.37-1.26 (10H, m), 0.91

(3H, t, J = 6.9 Hz, CH₃). ¹³C NMR (100.5 MHz, CDCl₃): δ 155.95

(CdCH₂), 144.36 (C), 139.80 (C), 136.21 (C), 127.83 (2CH), 127.37

(2CH), 126.33 (CH), 113.26 (CdCH₂), 70.38 (C-1), 63.62

(CH₂OH), 43.99 (CH-5), 43.80 (CH₂-4), 36.55 (CH₂), 36.05

(CH₂), 33.45 (CH₂), 31.84 (CH₂), 29.52 (CH₂), 29.27 (CH₂), 27.73

(CH₂), 25.34 (CH₂), 22.65 (CH₂), 22.54 (CH₂), 14.10 (CH₃). LRMS

(CI) m/z: 353 ([M þ H]^þ, 100%), 249 (37%). HRMS (EI) found,

[M]^þ, 352.2767. C₂₅H₃₆O requires, 352.2766.

rac-(1S,5R)-3-Hexyl-2-phenyl-1-(phenylvinyl)-7-methylaza-bicy-

clo[3.3.0]oct-2-ene (20a). General procedure was used with N-

methyl-N-(phenylprop-2-ynyl)prop-2-en-1-amine, 1,1-dibromoheptane, and

1-ethynylbenzene as components. Purification of the crude material by

column chromatography on Al₂O₃(basic, grade III) with 2.5% of Et₂O

in hexanes as the eluent gave the title compound as a pale yellow oil

(0.240 g, 62%). ¹H NMR (400 MHz, CDCl₃): δ 7.38-7.25 (10H, m),

5.10 (1H, d, J = 1.1 Hz, CdCH₂), 4.93 (1H, d, J = 1.1 Hz, CdCH₂),

2.69 (1H, d, J = 9.4 Hz, H-8), 2.68 (1H, dd, J = 8.4, 4.0 Hz, H-6), 2.63

(1H, d, J = 9.4 Hz, H-8), 2.63 (1H, tdd, J = 7.9, 4.0, 2.0 H-5), 2.50

(1H, fs dd, J = 16.8, 8.8, Hz, H-4b), 2.45 (1H, dd, J = 8.4, 4.0 Hz,

H-6), 2.31 (3H, s, N-CH₃), 2.15 (1H, dd, J = 16.8, 1.7, Hz, H-4a),

2.12-2.08 (2H, m, C-3-CH₂), 1.45-1.34 (2H, m), 1.32-1.22 (6H,

m,), 0.89 (3H, t, J = 7.0 Hz, CH₃). ¹³C NMR (100.5 MHz, CDCl₃):

δ 153.64 (CdCH₂), 143.66 (C), 141.53 (C), 139.52 (C), 137.54 (C),

129.89 (2CH), 127.73 (2CH), 127.65 (2CH), 127.57 (2CH), 126.71

(CH), 126.46 (CH), 114.98 (CdCH₂), 70.11 (C-1), 65.77 (2CH₂-6

þ 8), 46.35 (CH-5), 42.73 (N-CH₃), 41.98 (CH₂-4), 31.67 (CH₂),

29.81 (CH₂), 29.39 (C-3-CH₂), 27.72 (CH₂), 22.58 (CH₂), 14.06

(CH₃). LRMS (ESI^þ) m/z: 386 ([M þ H]^þ, 100%). HRMS (ESI^þ)

found, [M þ H]^þ, 386.2832. [C₂₈H₃₆N]^þrequires, 386.2842.

rac-(1R,5R)-1-(Hex-1-en-2-yl)-3-hexyl-2-phenyl-bicyclo[3.3.0]oct-

2-ene (18j). General procedure was used with 1-(hept-6-en-1-

ynyl)benzene, 1,1-dibromoheptane, and 1-hexyne as components. Pur-

ification of the crude material by column chromatography on SiO₂

(230-400 mesh) with hexanes as the eluent gave the title compound as

a pale yellow oil (0.263 g, 75%). ¹H NMR (300 MHz, CDCl₃): δ 7.29-

7.17 (3H, m), 7.06-7.02 (2H, m), 4.81 (1H, q, J = 1.4 Hz, CdCH₂),

4.79 (1H, q, J = 1.4 Hz, CdCH₂), 2.84 (1H, fs dd, J = 16.8, 8.4 Hz, H-

4b), 2.43 (1H, dddd, J = 9.7, 8.4, 3.2, 1.6 Hz, H-5), 2.21-2.01 (5H, m),

1.88 (1H, dtd, J = 12.0, 9.4, 7.0 Hz, H-6), 1.70 (1H, m), 1.60-1.48

(6H, m), 1.45-1.33 (4H, m), 1.30-1.21 (6H, m), 0.95 (3H, t, J = 7.2

Hz, CH₃), 0.86 (3H, t, J = 6.9 Hz, CH₃). ¹³C NMR (75 MHz, CDCl₃):

δ 154.57 (CdCH₂), 141.21 (C), 139.63 (C), 138.04 (C), 129.40

(2CH), 127.42 (2CH), 126.11 (CH), 107.27 (CdCH₂), 71.24 (C-

1), 45.53 (CH-5), 44.33 (CH₂), 36.67 (CH₂), 33.84 (CH₂), 32.05

(CH₂), 31.68 (CH₂), 30.75 (CH₂), 29.59 (CH₂), 29.13 (CH₂), 28.06

(CH₂), 25.70 (CH₂), 23.05 (CH₂), 22.61 (CH₂), 14.15 (CH₃), 14.04

(CH₃). LRMS (EI) m/z: 350 ([M]^þ³, 57%), 307 (26%), 293 (100%).

HRMS (EI) found, [M]^þ, 350.2979. C₂₆H₃₈requires, 350.2974.

r a c -(1R,5R)-3-Hexyl-1-(phenylvinyl)-2-(propan-3-ol)-bicyclo[3.-

3.0]oct-2-ene (18s). General procedure was used with tert-butyl(dec-

9-en-4-yn-1-yloxy)dimethylsilane, 1,1-dibromoheptane, and 1-ethynyl-

benzene as components with the exception that the reaction was carried

rac-(1R,5R,6R)-3-Hexyl-6-hydroxy-2-phenyl-1-(phenylvinyl)-bic-

yclo[3.3.0]oct-2-ene (24-exo) and rac-(1R,5R,6S)-3-Hexyl-6-hydro-

xy-2-phenyl-1-(phenylvinyl)-bicyclo[3.3.0]oct-2-ene (24-endo). To

a solution of Cp₂ZrCl₂(1.465 g, 5.0 mmol) in dry THF (25 mL) cooled

to -78 °C was added nBuLi (4.0 mL of a 2.5 M solution in hexanes,

10.0 mmol) dropwise. After 20 min, a solution of tert-butyl-

dimethyl((7-phenylhept-1-en-6-yn-3-yl)oxy)silane (1.50 g, 5.0 mmol)

in dry THF (15 mL) was added dropwise. After 30 min at -78 °C, the

reaction mixture was allowed to warm to room temperature and con-

tinued to stir for 3 h. After the reaction mixture was recooled to -

78 °C, a solution of 1,1-dibromoheptane (1.42 g, 5.5 mmol) in dry

THF (5 mL) was added followed by dropwise addition of LDA

(3.06 mL of a 1.8 M solution, 5.5 mmol). The reaction mixture was

stirred at -78 °C for 15 min before dropwise addition of lithium

phenylacetylide solution [freshly prepared from phenylacetylene

(1.65 mL, 15.0 mmol) in dry THF (15 mL) and nBuLi (6.0 mL of a

2.5 M solution in hexanes, 15.0 mmol) at -10 °C over 15 min]. The

stirring was continued for 45 min during which the reaction mixture

was allowed to warm to -55 °C before addition of MeOH (30 mL) and

saturated aqueous solution of NaHCO₃(30 mL). The mixture

was allowed to warm to room temperature and left stirring for 5 h

before pouring onto H₂O (200 mL) and extracting the products into

Et₂O (3 ꢀ 200 mL). The combined organic phases were washed with

2277

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

H₂O (3 ꢀ 300 mL) and brine (300 mL). Drying over anhydrous

MgSO₄and filtration followed by concentration in vacuo gave the

crude product as a yellow oil. Purification by flash chromatography on

SiO₂with 2.5% of Et₂O in hexanes furnished the TBDMS protected

alcohols 23 (1.6:1 exo:endo) as a yellow oil (2.20 g, 88%).

hStARr

GTTCCACTCCCCCATTGCT

GGCGGAGAAAGGAGAGTTCA

TCCTTGCGGGCTTTGCT

CAGAGAAACCGCTGACATCTAGAA

CAGCAAAACTCAATCCCAAACTC

hMEOX1f

hMEOX1r

hG0S2f

hG0S2r

The TBDMS-protected alcohols 23 (2.20 g, 4.40 mmol) were

dissolved in dry THF (44 mL) followed by addition of TBAF (17.60

of 1.0 M solution in THF), and the reaction mixture was stirred at room

temperature for 20 h. Then, the mixture was poured onto H₂O

(200 mL) and extracted with Et₂O (2 ꢀ 150 mL). The organic phases

were washed with H₂O (3 ꢀ 200 mL) and brine (1 ꢀ 200 mL) and dried

over MgSO₄. Concentration in vacuo, followed by separation by column

chromatography on Al₂O₃(basic, grade III) and 2.5% EtOAc in hexanes

as the eluent gave the partly separated isomers: 0.277 g of pure 24-endo

(14%), 0.650 g of mixed fractions (33%), and 0.556 g of pure 24-exo

(29%), for a combined yield of 1.483 g (76%). Further chromatography

of the mixed fractions allowed additional pure 24-exo and 24-endo to be

isolated. Compound 24-exo: ¹H NMR (300 MHz, CDCl₃): δ 7.37-7.19

(10H, m), 5.08 (1H, d, J = 1.5 Hz, CdCH₂), 5.00 (1H, d, J = 1.5 Hz,

CdCH₂), 3.96 (1H, br s, H-6), 2.39 (1H, fs dd, J = 16.2, 9.6 Hz, H-

4b), 2.30 (1H, fs d, J = 9.6 Hz, H-5), 2.15-2.0 (4H, m), 1.79-1.67

(3H, m), 1.38-1.20 (9H, m), 0.87 (3H, t, J = 6.8 Hz, CH₃). ¹³C NMR

(75 MHz, CDCl₃): δ 154.69 (CdCH₂), 144.21 (C), 141.19 (C), 139.17

(C), 137.43 (C), 129.73 (2CH), 127.78 (2CH), 127.72 (2CH), 127.62

(2CH), 126.66 (CH), 126.59 (CH), 114.99 (CdCH₂), 82.10 (CH-6),

69.40 (C-1), 55.92 (CH-5), 40.29 (CH₂), 34.04 (CH₂), 32.13 (CH₂),

31.66 (CH₂), 29.73 (CH₂), 29.37 (CH₂), 27.83 (CH₂), 22.58 (CH₂),

14.06 (CH₃). LRMS (EI) m/z: 386 ([M]^þ•, 36%), 283 (21%), 283

(100%). HRMS (EI) found, [M]^þ, 386.2611. C₂₈H₃₄O requires,

Protein Purification and PI(4,5)P2 Displacement. Details of the SF-1

LBD construct, purification, and PI(4,5)P2 exchange have been pre-

viously described.^35b,36For compound displacement assays, 2.0 μL of

serially diluted compounds in DMSO were dosed into 48.0 μL of

crystallography pure 1.0 μM mSF-1 LBD/PI(4,5)P2 complexes, in

20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)

(8.0) and 5 mM MgCl₂, for 2 h at 37 °C. This entire reaction was then

separated by native PAGE on precast 4-16% gradient Bis/Tris-buffered

gels (Invitrogen), which maintains SF-1LBD/PI(4,5,)P2 association.

Gels were then stained with Coomassie brilliant blue to visualize

compound-induced changes in the native gel migration pattern of SF-

1 LBD/PI(4,5)P2.

Crystallogaphy. Purification of human LRH-1 is as described previ-

ously.^35bEndogenous phospholipids were replaced with GR8470

(compound 5) using liposome-mediated exchange as described^35bwith

the exception that liposomes were composed of 1,2-ditetracosanoyl-sn-

glycero-3-phosphocholine (PC24) (Avanti Polar Lipids). Briefly, GR8470

in DMSO was added to PC24 in water to a final concentration of 0.8 mM

and was mixed with an equal volume of 8 mg/mL LRH-1, giving a final

ligand:protein ratio of 3. Exchange was monitored by purifying the LRH-

1/ligand complex on a PD10 size exclusion column and determining the

complex molecular weight by mass spectroscopy as described.^35bBy this

method, exchange did not improve beyond 5 days. Purified LRH-1 was

then mixed with TIF2 peptide in a 1:2 molar ratio and concentrated to

6-8 mg/mL for crystallization trials.

Crystals of the complex were obtained in 0.2 M ammonium sulfate,

0.1 M sodium acetate trihydrate, pH 4.6, and 25% w/v polyethylene

glycol 4000 and were quickly dunked into the same buﬀer with 12%

glycerol and 12% ethylene glycol prior to freezing in liquid nitrogen.

Data were collected at beamline 17ID (IMCA CAT) at the Advanced

Photon Source at Argonne National Laboratories using an ADSC Q210.

Images were integrated and scaled using HKL2000. The complex

crystallized in the space group P2₁with unit cell constants of A =

52.7, B = 89.0, C = 65.4, and β = 101.7, with two complexes per

asymmetric unit. The structure was solved by molecular replacement

using the apo LRH-1 structure (1YOK) as a search model. The model

was reﬁned against 1.75 Å data using Refmac5⁵⁵and rebuilt using

Coot.⁵⁶The model was reﬁned to a ﬁnal R = 18.7 and R_free= 21.4 and

contained two copies of LRH-1 LBD, two copies of TIF2 peptide, two

copies GR8470, one glycerol molecule, three ethylene glycol molecules,

and 305 water molecules. The bond length and angle root-mean-square

deviation from ideality are 0.007 Å and 1.098°, respectively.

1

386.2610. Compound 24-endo: H NMR (300 MHz, CDCl₃): δ 7.35-

7.21 (10H, m), 5.075 (1H, d, J = 1.5 Hz, CdCH₂), 4.96 (1H, d, J = 1.5

Hz, CdCH₂), 4.19 (1H, ddd, J = 9.1, 8.5, 5.5 Hz, H-6), 2.63 (1H, fs dd,

J = 17.2, 2.1 Hz, H-4a), 2.50 (1H, fs td, J = 8.5, 2.1 Hz, H-5), 2.17-

2.01 (3H, m), 1.86 (1H, ddt, J = 10.4, 5.5, 4.4 Hz, H-7b), 1.74-1.70

(2H, m), 1.57 (1H, ddd, J = 10.4, 9.1, 8.1 Hz, H-7a), 1.50-1.35 (2H, m),

1.29-1.24 (7H, m), 0.87 (3H, t, J = 6.8 Hz, CH₃). ¹³C NMR (75 MHz,

CDCl₃): δ 154.86 (CdCH₂), 144.00 (C), 143.28 (C), 139.37 (C),

137.06 (C), 129.82 (2CH), 127.78 (2CH), 127.70 (2CH), 127.61

(2CH), 126.70 (CH), 126.56 (CH), 114.88 (CdCH₂), 74.55 (CH-

6), 68.83 (C-1), 49.19 (CH-5), 33.77 (CH₂), 33.49 (CH₂), 31.83

(CH₂), 31.66 (CH₂), 29.89 (CH₂), 29.47 (CH₂), 27.93 (CH₂), 22.60

(CH₂), 14.06 (CH₃). LRMS(EI) m/z: 386([M]^þ•, 12%), 368 (17%), 283

(69%). HRMS (EI) found, [M]^þ, 386.2600. C₂₈H₃₄O requires, 386.2610.

Biology Experimental. Transcriptional Assays. Stable cell lines

expressing either N-terminal 3XFlag-tagged mouse SF-1 or human

LRH-1 were generated with the T-Rex Flip-In system in the HEK293

T-Rex cell line (Invitrogen). Expression and tetracycline (Tet) induci-

bility were verified by Western blot analysis using an anti-3XFlag M2

monoclonal antibody (Sigma). For all transcriptional assays, com-

pounds dissolved in DMSO were added for 16 h after initial addition

of 100 ng/mL Tet or EtOH vehicle control. Low levels of transduced SF-

1 and LRH-1 were observed in cell lines before the addition of Tet, most

likely due to stochastic “leakiness” of the TET-transcriptional repressor,

as often observed. Messenger RNA transcript abundance relative to the

cyclophilin housekeeping gene is shown, with DMSO control set equal

to 1. All transcripts were analyzed by quantitative PCR using the

following sets of validated primers:

’ ASSOCIATED CONTENT

S

Supporting Information. Details of the synthesis and

b

characterization of enyne cyclization precursors and compounds

12a,c-j, 18c-g,i,l,n,p,q,t-w, 25-exo, 25-endo, 29-exo, 29-endo,

30-exo, and 30-endo and statistical analysis of the peptide

recruitment assay results. This material is available free of charge

via the Internet at http://pubs.acs.org.

hCyclophilinf

hCyclophilinr

hSHPf

hSHPr

hStARf

TTTCATCTGCACTGCCAAGA

TTGCCAAACACCACATGCT

GCTTAGCCCCAAGGAATATGC

TTGGAGGCCTGGCACATC

CCCATGGAGAGGCTCTATGAA

Accession Codes

The X-ray coordinates of compound 5 bound to LRH-1 LBD

have been deposited in the Protein Data Bank with accession

number 3PLZ.

2278

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

’ AUTHOR INFORMATION

(6) Kliewer, S. A.; Lehmann, J. M.; Willson, T. M. Orphan nuclear

receptors: Shifting endocrinology into reverse. Science 1999, 284,

757–760.

(7) Parks, D. J.; Blanchard, S. G.; Bledsoe, R. K.; Chandra, G.;

Consler, T. G.; Kliewer, S. A.; Stimmel, J. B.; Willson, T. M.; Zavacki,

A. M.; Moore, D. D.; Lehmann, J. M. Bile acids: Natural ligands for an

orphan nuclear receptor. Science 1999, 284, 1365–1368.

(8) Lee, C. H.; Olson, P.; Evans, R. M. Minireview: Lipid metabo-

lism, metabolic diseases, and peroxisome proliferator-activated recep-

tors. Endocrinology 2003, 144, 2201–2207.

Corresponding Author

*Tel: 23 80592777. E-mail: rjw1@soton.ac.uk.

’ ACKNOWLEDGMENT

R.J.W., J.S., and S.D. thank GlaxoSmithKline for generous

funding.

(9) (a) Val, P.; Lefrancois-Martinez, A.-M.; Veyssiere, G.; Martinez,

A. SF-1 a key player in the development and diﬀerentiation of steroido-

genic tissues. Nucl. Recept. 2003, 1, 8. (b) Schimmer, B. P.; White, P. C.

Minireview: Steroidogenic fctor 1: Its roles in diﬀerentiation develop-

ment and disease. Mol. Endocrinol. 2010, 24, 1322–1337.

(10) Fayard, E.; Auwerx, J.; Schoonjans, K. LRH-1: An orphan

nuclear receptor involved in development, metabolism and steroidogen-

esis. Trends Cell Biol. 2004, 14, 250–260.

(11) Hoivik, E. A.; Lewis, A. E.; Aumo, L.; Bakke, M. Molecular

aspects of steroidogenic factor 1 (SF-1). Mol. Cell. Endocrinol. 2010, 315,

27–39.

(12) Lin, L.; Achermann, J. C. Steroidogenic Factor-1 (SF-1, Ad4BP,

NR5A1) and Disorders of Testis Development. Sex. Dev. 2008, 2,

200–209.

(13) (a) Husebye, E. S.; Lovas, K. Immunology of Addison's Disease

and Premature Ovarian Failure. Endocrinol. Metab. Clin. North Am. 2009,

38, 389–405. (b) Lourenco, D.; Brauner, R.; Lin, L.; De Perdigo, A.;

Weryha, G.; Muresan, M.; Boudjenah, R.; Guerra, G.; Maciel-Guerra,

A. T.; Achermann, J. C.; McElreavey, K.; Bashamboo, A. Mutations in

NR5A1 Associated with Ovarian Insuﬃciency. N. Engl. J. Med. 2009,

360, 1200–1210.

(14) Doghman, M.; Cazareth, J.; Douguet, D.; Madoux, F.; Hodder,

P.; Lalli, E. Inhibition of Adrenocortical Carcinoma Cell Proliferation by

Steroidogenic Factor-1 Inverse Agonists. J. Clin. Endocrinol. Metab.

2009, 94, 2178–2183.

(15) (a) Bulun, S. E.; Utsunomiya, H.; Lin, Z. H.; Yin, P.; Cheng,

Y. H.; Pavone, M. E.; Tokunaga, H.; Trukhacheva, E.; Attar, E.; Gurates,

B.; Milad, M. P.; Conﬁno, E.; Su, E.; Reierstad, S.; Xue, Q. Steroidogenic

factor-1 and endometriosis. Mol. Cell. Endocrinol. 2009, 300, 104–108.

(b) Dube, C.; Bergeron, F.; Vaillant, M. J.; Robert, N. M.; Brousseau, C.;

Tremblay, J. J. The nuclear receptors SF1 and LRH1 are expressed in

endometrial cancer cells and regulate steroidogenic gene transcription

by cooperating with AP-1 factors. Cancer Lett. 2009, 275, 127–138. (c)

Lin, B. C.; Suzawa, M.; Blind, R. D.; Tobias, S. C.; Bulun, S. E.; Scanlan,

T. S.; Ingraham, H. A. Stimulating the GPR30 Estrogen Receptor with a

Novel Tamoxifen Analogue Activates SF-1 and Promotes Endometrial

Cell Proliferation. Cancer Res. 2009, 69, 5415–5423.

(16) (a) Kim, K. W.; Zhao, L. P.; Parker, K. L. Central nervous

system-speciﬁc knockout of steroidogenic factor 1. Mol. Cell. Endocrinol.

2009, 300, 132–136. (b) Zhao, L.; Kim, K. W.; Ikeda, Y.; Anderson,

K. K.; Beck, L.; Chase, S.; Tobet, S. A.; Parker, K. L. Central nervous

system-speciﬁc knockout of steroidogenic factor 1 results in increased

anxiety-like behavior. Mol. Endocrinol. 2008, 22, 1403–1415.

(17) Gu, P.; Goodwin, B.; Chung, A. C. K.; Xu, X.; Wheeler, D. A.;

Price, R. R.; Galardi, C.; Li, P.; Latour, A. M.; Koller, B. H.; Gossen, J.;

Kliewer, S. A.; Cooney, A. J. Orphan nuclear receptor LRH-1 is required

to maintain Oct4 expression at the epiblast stage of embryonic devel-

opment. Mol. Cell. Biol. 2005, 25, 3492–3505.

’ ABBREVIATIONS USED

APC, allophycocyanin; NR, nuclear receptor; SF-1, steroidogenic

factor-1 (NR5A1); LRH-1, liver receptor homologue-1 (NR5A2);

DBD, DNA binding domain; LBD, ligand binding domain; SHP,

small/short heterodimer partner (NR01B); DAX-1, dosage-sensitive

sex reversal adrenal hypoplasia critical region on chromosome Xgene 1)

(NR0B2); FXR, farnesoid X receptor; PPAR, peroxisome pro-

liferator-activated receptor; PC, phosphatidylcholine; LDA,

lithium diisopropylamide; LiTMP, lithium 2,2,6,6-tetramethylpi-

peridide; TBAF, tetrabutylammonium ﬂuoride; TBDMS, tBu-

Me₂Si; HMPA, hexamethylphosphoramide; DMAP, 4-dimethy-

laminopyridine; TR, time-resolved; FRET, ﬂuorescence resonance

energy transfer; RT-qPCR, real-time quantitative polymerase

chainreaction;HEK293, humanembryonic kidney293; RE, relative

eﬃcacy; DMSO, dimethylsulfoxide; HEPES, 4-(2-hydroxyethyl)-1-

piperazineethanesulfonic acid; iPS, induced pluripotent stem

cell; PAGE, polyacrylamide gel electrophoresis; DOX, doxycy-

cline; Tet, tetracycline; PIP2, dipalmitoyl phosphatidyl-inositol

(4,5) bisphosphate; G0S2, G0/G1 switch regulatory protein

2; MeOX1, mesenchyme homeobox protein 1; StAR, steroido-

genic acute regulatory protein; HRMS, high-resolution mass

spectra; EI, electron impact ionization; CI, chemical ionization;

LRMS, low-resolution mass spectra; GC-MS, gas chromatogra-

phy-mass spectrometry; NMR, nuclear magnetic resonance;

THF, tetrahydrofuran; PC24, 1,2-ditetracosanoyl-sn-glycero-3-

phosphocholine; TIF-2, transcriptional intermediary factor 2

’ REFERENCES

(1) Russell, D. W.; Mangelsdorf, D. J. Nuclear Receptors, 1st ed.;

Academic Press Inc.: London, 2003; Vol. 363.

(2) (a) Schweitzer, A.; Knauer, S. K.; Stauber, R. H. Therapeutic

potential of nuclear receptors. Expert Opin. Ther. Pat. 2008, 18, 861–888.

(b) Moore, J. T.; Collins, J. L.; Pearce, K. H. The nuclear receptor

superfamily and drug discovery. ChemMedChem 2006, 1, 504–523. (c)

Shi, Y. H. Orphan nuclear receptors in drug discovery. Drug Discovery

Today 2007, 12, 440–445. (d) Mukherjee, S.; Mani, S. Orphan nuclear

receptors as targets for drug development. Pharm. Res. 2010, 27,

1439–1468.

(3) Overington, J. P.; Al-Lazikani, B.; Hopkins, A. L. Opinion - How

many drug targets are there?. Nature Rev. Drug Discovery 2006, 5,

993–996.

(4) Benoit, G.; Cooney, A.; Giguere, V.; Ingraham, H.; Lazar, M.;

Muscat, G.; Perlmann, T.; Renaud, J. P.; Schwabe, J.; Sladek, F.; Tsai,

M. J.; Laudet, V. International Union of Pharmacology. LXVI. Orphan

nuclear receptors. Pharmacol. Rev. 2006, 58, 798–836.

(18) Lee, Y.-K.; Moore, D. D. Liver receptor homolog-1, an emer-

ging metabolic modulator. Front. Biosci. 2008, 13, 5950–5958.

(19) Lee, Y. K.; Schmidt, D. R.; Cummins, C. L.; Choi, M.; Peng, L.;

Zhang, Y.; Goodwin, B.; Hammer, R. E.; Mangelsdorf, D. J.; Kliewer,

S. A. Liver receptor homolog-1 regulates bile acid homeostasis but is not

essential for feedback regulation of bile acid synthesis. Mol. Endocrinol.

2008, 22, 1345–1356.

(20) Venteclef, N.; Smith, J. C.; Goodwin, B.; Delerive, P. Liver

receptor homolog 1 is a negative regulator of the hepatic acute-phase

response. Mol. Cell. Biol. 2006, 26, 6799–6807.

(5) (a) Willson, T. M.; Jones, S. A.; Moore, J. T.; Kliewer, S. A.

Chemical genomics: Functional analysis of orphan nuclear receptors in

the regulation of bile acid metabolism. Med. Res. Rev. 2001, 21, 513–522.

(b) Hummasti, S.; Tontonoz, P. Adopting new orphans into the family

of metabolic regulators. Mol. Endocrinol. 2008, 22, 1743–1753. (c)

Schulman, I. G.; Heyman, R. A. The ﬂip side: Identifying small molecule

regulators of nuclear receptors. Chem. Biol. 2004, 11, 639–646.

2279

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

(21) Goodwin, B. J.; Stewart, E. L.; Brown, P. J.; Delerive, P. Liver

receptor homolog-1 (LRH1) activators as medicaments for diseases or

conditions caused by low plasma apoA-1 levels. WO 2005082344, 2005.

(22) Zollner, G.; Trauner, M. Nuclear receptors as therapeutic

targets in cholestatic liver diseases. Br. J. Pharmacol. 2009, 156, 7–27.

(23) Santen, R. J.; Brodie, H.; Simpson, E. R.; Siiteri, P. K.; Brodie, A.

History of Aromatase: Saga of an Important Biological Mediator and

Therapeutic Target. Endocr. Rev. 2009, 30, 343–375.

(32) (a) Chalkiadaki, A.; Talianidis, I. SUMO-dependent compart-

mentalization in promyelocytic leukemia protein nuclear bodies pre-

vents the access of LRH-1 to chromatin. Mol. Cell. Biol. 2005,

25, 5095–5105. (b) Lee, M. B.; Lebedeva, L. A.; Suzawa, M.; Wadekar,

S. A.; Desclozeaux, M.; Ingraham, H. A. The DEAD-Box protein DP103

(Ddx20 or gemin-3) represses orphan nuclear receptor activity via

SUMO modiﬁcation. Mol. Cell. Biol. 2005, 25, 1879–1890.

(33) (a) Bavner, A.; Matthews, J.; Sanyal, S.; Gustafsson, J. A.;

Treuter, E. EID3 is a novel EID family member and an inhibitor of

CBP-dependent co-activation. Nucleic Acids Res. 2005, 33, 3561–3569.

(b) Bavner, A.; Sanyal, S.; Gustafsson, J. A.; Treuter, E. Transcriptional

corepression by SHP: Molecular mechanisms and physiological con-

sequences. Trends Endocrinol. Metab. 2005, 16, 478–488.

(34) (a) Iyer, A. K.; McCabe, E. R. B. Molecular mechanisms of

DAX1 action. Mol. Genet. Metab. 2004, 83, 60–73. (b) Sablin, E. P.;

Woods, A.; Krylova, I. N.; Hwang, P.; Ingraham, H. A.; Fletterick, R. J.

The structure of corepressor Dax-1 bound to its target nuclear receptor

LRH-1. Proc. Natl. Acad. Sci. U.S.A. 2008, 105, 18390–18395.

(35) (a) Ingraham, H. A.; Redinbo, M. R. Orphan nuclear receptors

adopted by crystallography. Curr. Opin. Struct. Biol. 2005, 15, 708–715.

(b) Krylova, I. N.; Sablin, E. P.; Moore, J.; Xu, R. X.; Waitt, G. M.;

MacKay, J. A.; Juzumiene, D.; Bynum, J. M.; Madauss, K.; Montana, V.;

Lebedeva, L.; Suzawa, M.; Williams, J. D.; Williams, S. P.; Guy, R. K.;

Thornton, J. W.; Fletterick, R. J.; Willson, T. M.; Ingraham, H. A.

Structural analyses reveal phosphatidyl inositols as ligands for the NR5

orphan receptors SF-1 and LRH-1. Cell 2005, 120, 343–355. (c) Li, Y.;

Choi, M.; Cavey, G.; Daugherty, J.; Suino, K.; Kovach, A.; Bingham,

N. C.; Kliewer, S. A.; Xu, H. E. Crystallographic identiﬁcation and

functional characterization of phospholipids as ligands for the orphan

nuclear receptor steroidogenic factor-1. Mol. Cell 2005, 17, 491–502. (d)

Ortlund, E. A.; Lee, Y.; Solomon, I. H.; Hager, J. M.; Saﬁ, R.; Choi, Y.;

Guan, Z. Q.; Tripathy, A.; Raetz, C. R. H.; McDonnell, D. P.; Moore,

D. D.; Redinbo, M. R. Modulation of human nuclear receptor LRH-1

activity by phospholipids and SHP. Nat. Struct. Mol. Biol. 2005,

12, 357–363.

(24) (a) Zhou, J.; Suzuki, T.; Kovacic, A.; Saito, R.; Miki, Y.; Ishida,

T.; Moriya, T.; Simpson, E. R.; Sasano, H.; Clyne, C. D. Interactions

between prostaglandin E-2, liver receptor homologue-1, and aromatase

in breast cancer. Cancer Res. 2005, 65, 657–663. (b) Annicotte, J. S.;

Chavey, C.; Servant, N.; Teyssier, J.; Bardin, A.; Licznar, A.; Badia, E.;

Pujol, P.; Vignon, F.; Maudelonde, T.; Lazennec, G.; Cavailles, V.; Fajas,

L. The nuclear receptor liver receptor homolog-1 is an estrogen receptor

target gene. Oncogene 2005, 24, 8167–8175. (c) Chen, D.; Reierstad, S.;

Lu, M. L.; Lin, Z. H.; Ishikawa, H.; Bulun, S. E. Regulation of breast

cancer-associated aromatase promoters. Cancer Lett. 2009, 273, 15–27.

(d) Simpson, E. R.; McDonnell, D. P.; Kovacic, A.; Clyne, C. D.; Saﬁ, R.

Regulation of aromatase expression in the breast by LRH-1: A new

potential target for breast cancer therapy. Breast Cancer Res. Treat. 2005,

94, S236–S236. (e) Miki, Y.; Clyne, C. D.; Suzuki, T.; Moriya, T.;

Shibuya, R.; Nakamura, Y.; Ishida, T.; Yabuki, N.; Kitada, K.; Hayashi, S.-

i.; Sasano, H. Immunolocalization of liver receptor homologue-1 (LRH-

1) in human breast carcinoma: Possible regulator of in situ steroidogen-

esis. Cancer Lett. 2006, 244, 24–33. (f) Saﬁ, R.; Kovacic, A.; Gaillard,

S.; Murata, Y.; Simpson, E. R.; McDonnell, D. P.; Clyne, C. D.

Coactivation of Liver Receptor Homologue-1 by Peroxisome Prolifera-

tor-Activated Receptor gamma Coactivator-1.alpha. on Aromatase Pro-

moter II and Its Inhibition by Activated Retinoid X Receptor Suggest a

Novel Target for Breast-Speciﬁc Antiestrogen Therapy. Cancer Res. 2005,

65, 11762–11770.(g) Thiruchelvam, P. T.; Lai, C. F.; Hua, H.; Thomas,

R. S.; Hurtado, A.; Hudson, W.; Bayly, A. R.; Kyle, F. J.; Periyasamy, M.;

Photiou, A.; Spivey, A. C.; Ortlund, E. A.; Whitby, R. J.; Carroll, J. S.;

Coombes, R. C.; Buluwela, L.; Ali, S. The liver receptor homolog-1

regulates estrogen receptor expression in breast cancer cells. Breast

Cancer Res. Treat. 2010, DOI: 10.1007/s10549-010-0994-9.

(36) Sablin, E. P.; Blind, R. D.; Krylova, I. N.; Ingraham, J. G.; Cai, F.;

Williams, J. D.; Fletterick, R. J.; Ingraham, H. A. Structure of SF-1 Bound

by Diﬀerent Phospholipids: Evidence for Regulatory Ligands. Mol.

Endocrinol. 2009, 23, 25–34.

(37) Moore, D. D.; Lee, J. M. Phospholipid LRH-1 receptor agonist

compositions and use for the treatment of metabolic disorders and

inﬂammatory bowel disease and lowering of blood glucose levels. WO

2009067182, 2009.

(25) Botrugno, O. A.; Fayard, E.; Annicotte, J. S.; Haby, C.; Brennan,

T.; Wendling, O.; Tanaka, T.; Kodama, T.; Thomas, W.; Auwerx, J.;

Schoonjans, K. Synergy between LRH-1 and beta-catenin induces G(1)

cyclin-mediated cell proliferation. Mol. Cell 2004, 15, 499–509.

(26) Wang, S.-L.; Zheng, D.-Z.; Lan, F.-H.; Deng, X.-J.; Zeng, J.; Li,

C.-J.; Wang, R.; Zhu, Z.-Y. Increased expression of hLRH-1 in human

gastric cancer and its implication in tumorigenesis. Mol. Cell. Biochem.

2008, 308, 93–100.

(38) (a) Urs, A. N.; Dammer, E.; Kelly, S.; Wang, E.; Merrill, A. H.;

Sewer, M. B. Steroidogenic factor-1 is a sphingolipid binding protein.

Mol. Cell. Endocrinol. 2007, 265, 174–178. (b) Urs, A. N.; Dammer, E.;

Sewer, M. B. Sphingosine regulates the transcription of CYP17 by

binding to steroidogenic factor-1. Endocrinology 2006, 147, 5249–5258.

(c) Dammer, E. B.; Leon, A.; Sewer, M. B. Coregulator exchange and

sphingosine-sensitive cooperativity of steroidogenic factor-1, general

control nonderepressed 5, p54, and p160 coactivators regulate cyclic

adenosine 3⁰,5⁰-monophosphate-dependent cytochrome P450c17 tran-

scription rate. Mol. Endocrinol. 2007, 21, 415–438.

(39) Whitby, R. J.; Dixon, S.; Maloney, P. R.; Delerive, P.; Goodwin,

B. J.; Parks, D. J.; Willson, T. M. Identiﬁcation of Small Molecule

Agonists of the Orphan Nuclear Receptors Liver Receptor Homolog-1

and Steroidogenic Factor-1. J. Med. Chem. 2006, 49, 6652–6655.

(40) (a) Fan, W.; Yanase, T.; Morinaga, H.; Gondo, S.; Okabe, T.;

Nomura, M.; Hayes, T. B.; Takayanagi, R.; Nawata, H. Herbicide

atrazine activates SF-1 by direct aﬃnity and concomitant co-activators

recruitments to induce aromatase expression via promoter II. Biochem.

Biophys. Res. Commun. 2007, 355, 1012–1018. (b) Fan, W. Q.; Yanase,

T.; Morinaga, H.; Ondo, S.; Okabe, T.; Nomura, M.; Komatsu, T.;

Morohashi, K. I.; Hayes, T. B.; Takayanagi, R.; Nawata, H. Atrazine-

induced aromatase expression is SF-1 dependent: Implications for endo-

crine disruption in wildlife and reproductive cancers in humans. Environ.

Health Perspect. 2007, 115, 720–727. (c) Suzawa, M.; Ingraham, H. A. The

herbicide atrazine activates endocrine gene networks via non-steroidal

(27) D'Errico, I.; Moschetta, A. Nuclear receptors, intestinal archi-

tecture and colon cancer: An intriguing link. Cell. Mol. Life Sci. 2008,

65, 1523–1543.

(28) Schoonjans, K.; Dubuquoy, L.; Mebis, J.; Fayard, E.; Wendling,

O.; Haby, C.; Geboes, K.; Auwerx, J. Liver receptor homolog 1 con-

tributes to intestinal tumor formation through eﬀects on cell cycle and

inﬂammation. Proc. Natl. Acad. Sci. U.S.A. 2005, 102, 2058–2062.

(29) (a) Mullen, E. M.; Gu, P.; Cooney, A. J. Nuclear receptors in

regulation of mouse ES cell pluripotency and diﬀerentiation. PPAR Res.

2007, 2007, article ID 61563. (b) Yang, H.-M.; Do, H.-J.; Kim, D.-K.;

Park, J.-K.; Chang, W.-K.; Chung, H.-M.; Choi, S.-Y.; Kim, J.-H.

Transcriptional regulation of human Oct4 by steroidogenic factor-1.

J. Cell. Biochem. 2007, 101, 1198–1209.

(30) (a) Heng, J. C. D.; Feng, B.; Han, J. Y.; Jiang, J. M.; Kraus, P.;

Ng, J. H.; Orlov, Y. L.; Huss, M.; Yang, L.; Lufkin, T.; Lim, B.; Ng, H. H.

The Nuclear Receptor NR5A2 Can Replace Oct4 in the Reprogramming

of Murine Somatic Cells to Pluripotent Cells. Cell Stem Cell 2010,

6, 167–174. (b) Guo, G.; Smith, A. A genome-wide screen in EpiSCs

identiﬁes NR5A nuclear receptors as potent inducers of ground state

pluripotency. Development 2010, 137, 3185–3192.

(31) Lee, Y. K.; Choi, Y. H.; Chua, S.; Park, Y. J.; Moore, D. M.

Phosphorylation of the hinge domain of the nuclear hormone receptor

LRH-1 stimulates transactivation. J. Biol. Chem. 2006, 281, 7850–7855.

2280

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Journal of Medicinal Chemistry

ARTICLE

NR5A nuclear receptors in ﬁsh and mammalian cells. PLoS One 2008,

3, e2117.

(41) Madoux, F.; Li, X.; Chase, P.; Zastrow, G.; Cameron, M. D.;

Conkright, J. J.; Griﬃn, P. R.; Thacher, S.; Hodder, P. Potent, selective

and cell penetrant inhibitors of SF-1 by functional ultra-high-throughput

screening. Mol. Pharmacol. 2008, 73, 1776–1784.

(42) Roth, J.; Madoux, F.; Hodder, P.; Roush, W. R. Synthesis of

small molecule inhibitors of the orphan nuclear receptor steroidogenic

factor-1 (NR5A1) based on isoquinolinone scaﬀolds. Bioorg. Med. Chem.

Lett. 2008, 18, 2628–2632.

(43) Thomas, E.; Dixon, S.; Whitby, R. J. A rearrangement to a

zirconium-alkenylidene in the insertion of dihalocarbenoids and acet-

ylides into zirconacycles. Ange. Chem. Int. Ed. 2006, 45, 7070–7072.

(44) Stec, J.; Dixon, S.; Thomas, E. V.; Whitby, R. J. Tandem

insertion of halocarbenoids and lithium acetylides into zirconacycles.

A novel rearrangement to zirconium-alkenylidenates via β-addition to an

alkynyl-zirconocene. Chem.—Eur. J. 2011, in press.

(45) (a) Abad, A.; Agullo, C.; Arno, M.; Cantin, A.; Cunat, A. C.;

Meseguer, B.; Zaragoza, R. J. Stereoselective synthesis of (-)-metase-

quoic acid B. J. Chem. Soc. Perkin Trans. 1 1997, 1837–1843. (b) Larson,

G. L.; Klesse, R. An Improved Synthesis of the Ethylene Acetal of

3-Iodopropanal and the Ethylene Ketal of 4-Iodo-2-Butanone. J. Org.

Chem. 1985, 50, 3627–3627.

(46) (a) Karplus, M. Vicinal Proton Coupling in Nuclear Magnetic

Resonance. J. Am. Chem. Soc. 1963, 85, 2870–2871. (b) Haasnoot,

C. A. G.; Deleeuw, F. A. A. M.; Altona, C. The Relationship between

Proton-Proton Nmr Coupling-Constants and Substituent Electronega-

tivities. 1. An Empirical Generalization of the Karplus Equation. Tetra-

hedron 1980, 36, 2783–2792.

(47) Light, M. E.; Stec, J.; Whitby, R. J. Private communication to the

Cambridge Structural Database, deposition number CCDC 746929,

2009.

(48) Diaz, Y.; Bravo, F.; Castillon, S. Synthesis of purine and pyrim-

idine isodideoxynucleosides from (S)-glycydol using iodoetheriﬁcation

as key step. Synthesis of (S,S)-iso-ddA. J. Org. Chem. 1999, 64,

6508–6511.

(49) Cink, R. D.; Forsyth, C. J. Facile one-pot epoxidation-nucleo-

philic opening sequence for vicinal diols. J. Org. Chem. 1995,

60, 8122–8123.

(50) Wang, L.; Maddess, M. L.; Lautens, M. Convenient access to

functionalized vinylcyclopentenols from alkynyloxiranes. J. Org. Chem.

2007, 72, 1822–1825.

(51) Halgren, T. A. Merck molecular force ﬁeld. 1. Basis, form,

scope, parameterization, and performance of MMFF94. J. Comput.

Chem. 1996, 17, 490–519.

(52) Navarro-Vazquez, A.; Cobas, J. C.; Sardina, F. J.; Casanueva,

J.; Diez, E. A graphical tool for the prediction of vicinal proton-proton

(3)J(HH) coupling constants. J. Chem. Inf. Comput. Sci. 2004,

44, 1680–1685.

(53) (a) Wittig, I.; Braun, H. P.; Schagger, H. Blue native PAGE. Nat.

Protoc. 2006, 1, 418–428. (b) Wittig, I.; Schagger, H. Advantages and

limitation of clear-native PAGE. Proteomics 2005, 5, 4338–4346.

(54) Ingraham, H. A. Unpublished results.

(55) Winn, M. D.; Murshudov, G. N.; Papiz, M. Z. Macromolecular

TLS reﬁnement in REFMAC at moderate resolutions. Methods Enzymol.

2003, 374, 300–321.

(56) Emsley, P.; Lohkamp, B.; Scott, W. G.; Cowtan, K. Features and

development of Coot. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2010,

66, 486–501.

2281

dx.doi.org/10.1021/jm1014296 |J. Med. Chem. 2011, 54, 2266–2281

Article Doi

Small molecule agonists of the orphan nuclear receptors steroidogenic factor-1 (SF-1, NR5A1) and liver receptor homologue-1 (LRH-1, NR5A2)

DOI: 10.1021/jm1014296

Source and publish data:

Authors:

Article abstract of DOI:10.1021/jm1014296

Full text of DOI:10.1021/jm1014296

Products guided by the article

R&D Labs maybe for 1276664-34-6

Relevant to this article

Hot Product