Isolation and characterization of a thermostable F420:NADPH oxidoreductase from Thermobifida fusca

Article abstract of DOI:10.1074/jbc.M117.787754

F₄₂₀H₂-dependent enzymes reduce a wide range of substrates that are otherwise recalcitrant to enzyme-catalyzed reduction, and their potential for applications in biocatalysis has attracted increasing attention. Thermobifida fusca is a moderately thermophilic bacterium and holds high biocatalytic potential as a source for several highly thermostable enzymes.Wereport here on the isolation and characterization of a thermostable F₄₂₀: NADPHoxidoreductase (Tfu-FNO) from T. fusca, the first F₄₂₀- dependent enzyme described from this bacterium. Tfu-FNO was heterologously expressed in Escherichia coli, yielding up to 200 mg of recombinant enzyme per liter of culture. We found that Tfu-FNO is highly thermostable, reaching its highest activity at 65 °C and that Tfu-FNO is likely to act in vivo as an F₄₂₀ reductase at the expense of NADPH,similar to its counterpart in Streptomyces griseus. We obtained the crystal structure of FNO in complex with NADP⁺ at 1.8 ? resolution, providing the first bacterial FNO structure. The overall architecture and NADP⁺-binding site of Tfu-FNO were highly similar to those of the Archaeoglobus fulgidus FNO(Af-FNO). The active site is located in a hydrophobic pocket between an N-terminal dinucleotide binding domain and a smaller C-terminal domain. Residues interacting with the 2'-phosphate of NADP⁺ were probed by targeted mutagenesis, indicating that Thr-28, Ser-50, Arg-51, and Arg-55 are important for discriminating between NADP⁺ and NAD⁺. Interestingly, a T28A mutant increased the kinetic efficiency >3-fold as compared with the wild-type enzyme when NADH is the substrate. The biochemical and structural data presented here provide crucial insights into the molecular recognition of the two cofactors, F₄₂₀ and NAD(P)H by FNO.

Full text of DOI:10.1074/jbc.M117.787754

JBC Papers in Press. Published on April 14, 2017 as Manuscript M117.787754
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M117.787754
F420:NADPH oxidoreductase from T. fusca
Isolation and characterization of a thermostable
F420:NADPH oxidoreductase from Thermobifida fusca
Hemant Kumar,1,# Quoc-Thai Nguyen,1,2,3,# Claudia Binda,4 Andrea Mattevi,4
and Marco W. Fraaije1
1 Molecular Enzymology Group, Groningen Biomolecular Sciences and Biotechnology Institute, University of Gro-
ningen, Nijenborgh 4,ꢀ9747 AG Groningen, The Netherlands.
2 Scuola Universitaria Superiore IUSS Pavia, Piazza della Vittoria 15, 27100 Pavia, Italy
3
Faculty of Pharmacy, University of Medicine and Pharmacy, Ho Chi Minh City, 41 Dinh Tien Hoang Street, Ben
Nghe Ward, District 1, Ho Chi Minh City, Vietnam
4 Department of Biology and Biotechnology, University of Pavia, Via Ferrata 1,ꢀ27100 Pavia, Italy
# These authors contributed equally to this work
To whom correspondence should be addressed: Prof. dr. M.W. Fraije, Molecular Enzymology Group, Groningen Bi-
omolecular Sciences and Biotechnology Institute, University of Groningen, Nijenborgh 4,ꢀ9747 AG Groningen, The
Netherlands. Tel: +31503634345. Email: m.w.fraaije@rug.nl.
Keywords: Thermobifida fusca, F420, deazaflavoenzymes, oxidoreductase, nicotinamide adenine dinucleo-
tide phosphate
Running title: F420:NADPH oxidoreductase from T. fusca
Abbreviations used: FNO, F420:NADPH oxidoreductase; Tfu, Thermobifida fusca; Af, Archaeoglobus ful-
gidus; NAD(P)+, nicotinamide adenine dinucleotide (phosphate)
domain. Residues interacting with the 2′-phosphate
Abstract
of NADP+ were probed by targeted mutagenesis, in-
F420H2-dependent enzymes reduce a wide range of
dicating that Thr28, Ser50, Arg51, and Arg55 are im-
portant for discriminating between NADP+ and
substrates that are otherwise recalcitrant to enzyme-
NAD+. Interestingly, a T28A mutant increased the
catalyzed reduction, and their potential for applica-
tions in biocatalysis has attracted increasingly at-
kinetic efficiency more than three-fold as compared
tention. Thermobifida fusca is a moderately ther-
with the wild-type enzyme when NADH is the sub-
mophilic bacterium and holds high biocatalytic po-
strate. The biochemical and structural data pre-
tential as a source for several highly thermostable
sented here provide crucial insights into the molec-
enzymes. We report here on the isolation and char-
ular recognition of the two cofactors, F420 and
acterization of a thermostable F420:NADPH oxidore-
NAD(P)H by FNO.
ductase (Tfu-FNO) from T. fusca, being the first
F420-dependent enzyme described from this bacte-
Introduction
rium. Tfu-FNO was heterologously expressed in
Escherichia coli, yielding up to 200 mg recombi-
nant enzyme per liter of culture. We found that Tfu-
FNO is highly thermostable, reaching its highest ac-
tivity at 65 °C and that Tfu-FNO is likely to act in
vivo as an F420 reductase at the expense of NADPH,
similar to its counterpart in Streptomyces griseus.
We obtained the crystal structure of FNO in com-
plex with NADP+ at 1.8 Å resolution, providing the
first bacterial FNO structure. The overall architec-
ture and NADP+-binding site of Tfu-FNO were
highly similar to those of the Archaeoglobus fulgi-
dus FNO (Af-FNO). The active site is located in a
hydrophobic pocket between an N-terminal dinu-
cleotide-binding domain and a smaller C-terminal
Flavins can arguably be regarded as the most exten-
sively studied redox cofactors. One natural flavin
analogue is cofactor F420 which was first isolated
and characterized from methanogenic archaea in
1972 (1). Since then, F420 has been found in mem-
bers of methanogens, actinomycetes, cyanobacte-
ria, and some betaproteobacteria (2). Replacement
of the 5′ nitrogen of flavins with a carbon in F420,
resulting in a so-called deazaflavin, renders the co-
factor nearly unreactive towards molecular oxygen.
Hence, F420 is an obligate hydride-transfer cofactor
similar to the nicotinamide cofactors (Fig. 1). Be-
sides, the 8′-OH group on the isoalloxazine ring in
1
Copyright 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

F420:NADPH oxidoreductase from T. fusca
F420 has been suggested to slow down the autooxi-
dation of the reduced cofactor (F420H2) in air, thus
the reduced species is much more stable than that
of flavins (3).
Results
Purification of Tfu-FNO
A BLAST search for Af-FNO homologs in T. fusca
resulted in the identification of the Tfu_0907 gene
(TFU_RS04835). The encoded protein shares 40%
and 70% sequence identity to FNOs from A. fulgi-
dus and S. griseus, respectively (Fig. 2). The Tfu-
fno gene, with a high GC content (67%), was am-
plified from the genomic DNAof T. fusca and trans-
formed into E. coli TOP10 as a pBAD-fno con-
struct. Purification of the respective protein, Tfu-
FNO, was achieved through ammonium sulfate pre-
cipitation followed by anion exchange chromatog-
raphy. DNase I treatment during the first steps of
protein purification was found to be essential to re-
move residual DNA. Tfu-FNO was obtained in pure
form with a relatively high yield: 120–200 mg/L
culture. It is worth noting that the amount of puri-
fied Tfu-FNO obtained in our system is signifi-
cantly higher than that of Af-FNO when heterolo-
gously expressed in E. coli [2 mg/L culture (16)].
Many F420(H2)-dependent enzymes have been
characterized recently and their potential for appli-
cations in biocatalysis has attracted increasing at-
tention (4,5). F420-dependent enzymes studied so far
have been shown to be capable of reducing a wide
range of substrates which are otherwise recalcitrant
to enzyme-catalyzed reduction (4,5). However, the
commercial unavailability of cofactor F420 remains
a bottleneck for studying and applying the respec-
tive enzymes. Therefore, it would be attractive to
have access to an efficient F420H2 cofactor recycling
system. In this context, F420:NADPH oxidoreductases
(FNOs, E.C. 1.5.1.40, Fig. 1) could become very val-
uable as NADPH-driven F420H2-recycling systems.
FNOs catalyze the reduction of NADP+ using
F420H2 and have been found in a number of archaea
(6–10) and bacteria (11) (Fig. 1). It has been argued
that in methanogens, FNO catalyzes mainly the re-
duction of NADP+ using F420H2 while bacterial
FNOs are supposed to catalyze the reverse reaction
(11).
Effects of pH and temperature on activity
FNOs are known to catalyze the reduction of
NADP+ at higher pH, while at lower pH it catalyzes
the reverse reaction. Figure 3 shows the effect of pH
on Tfu-FNO activity. The reduction rate of NADP+
is highest at pH 8.5–9.0 while the reverse reaction
is optimal between pH 4.0–6.0. From the kobs values
of both the forward and backward reactions, it can
be concluded that FNO catalyzes NADP+ reduction
more efficiently (Fig. 3). This is in line with the re-
dox potential of F420 (−340 mV) being lower when
compared with that of NADP+ (−320 mV) (3).
Thermobifida fusca is a moderately thermo-
philic soil bacterium with high G+C content. This
actinomycete holds high biocatalytic potential as it
has already served as a source for several highly
thermostable enzymes, e.g., catalase, Baeyer–Vil-
liger monooxygenase, and glycoside hydrolases
(12–14). Interestingly, a recent bioinformatic study
predicted that the T. fusca genome contains 16
genes encoding for F420-dependent enzymes (15).
Nevertheless, there has been so far no biochemical
evidence for such enzymes. Here, we describe the
identification and characterization of a dimeric
thermostable F420:NADPH oxidoreductase from T.
fusca (Tfu-FNO), confirming the presence of F420-
dependent enzymes in this mesophilic bacterium.
Despite the high GC content (67%) of the gene se-
quence, Tfu-FNO is readily expressed in E. coli.
Notably, Tfu-FNO is a thermostable enzyme and
shows a clear substrate preference towards
NADP(H) instead of NAD(H). By solving the
three-dimensional crystal structure of Tfu-FNO, we
set out site-directed mutagenesis to corroborate the
role of residues that interact with the phosphate
moiety at 2′ position of NADP+.
Since FNO originates from the mesophilic or-
ganism T. fusca, the enzyme is expected to be stable
at relatively high temperatures. Measuring the ac-
tivities at temperatures between 25 and 90 °C re-
vealed that the enzyme displays highest activity be-
tween 60–70 °C (Fig. 4). The activity at 65 °C is
almost 4-time higher than that at 25 °C. The appar-
ent melting temperature of Tfu-FNO was found to
be 75 °C, as measured by the Thermofluor®
method (17). All the generated Tfu-FNO mutants
had melting temperatures similar to the wild-type
enzyme (data not shown). This indicates that FNO
is remarkably thermostable and is most active at el-
evated temperatures.
2

F420:NADPH oxidoreductase from T. fusca
Steady-state kinetics
As mentioned above, NADP+ binds to the N-
terminal part of Tfu-FNO in a highly similar man-
ner to that of Af-FNO which is characteristic for
members of the dinucleotide binding protein family
(20,21). The hydrogen bonding network between
NADP+ and the residues that form the active site are
illustrated in Fig. 6. In particular, the nicotinamide
ring directly docks to the protein by hydrogen bond-
ing the cofactor amide group to the peptide nitrogen
of Ala155 (corresponding to Ala137 in Af-FNO).
This conserved interaction is believed to be crucial
in conferring the trans conformation of the amide
group. With this conformation, the pyridine ring of
NADP+ is maintained planar which in turn facili-
tates the hydride transfer between the C4 of the
NADP and C5 of F420 by shortening the distance of
the two atoms (20).
The steady-state kinetic parameters were measured
for NADPH and F420 as substrates by following ab-
sorbance of these two cofactors at either 340 nm or
400 nm, respectively. The concentration of one sub-
strate was varied while keeping the other substrate
at a constant, saturated concentration. The kinetic
data fitted well to the Michaelis–Menten kinetic
model when the observed rates (kobs) were plotted
against substrate concentrations. Tfu-FNO has a Km
value of 7.3 µM and 2.0 µM for NADPH and F420,
respectively at pH 6.0 and 25 °C (Table 1). Thus,
Tfu-FNO has a significantly lower Km for NADPH
(2.0 µM) compared to the values featured by Af-
FNO (40 µM) and FNO from S. griseus (19.5 µM)
(8,11). The kcat (3.3 s−1) of Tfu-FNO is somewhat
lower when compared with that of Af-FNO (5.27
s−1) (18).
NADP+ binding site
The overall structure of Tfu-FNO
The residues involved in binding the ADP moiety
are also conserved in Tfu-FNO (Fig. 6). Analogous
to Af-FNO, the negatively charged group of the ri-
bose 2′-phosphate interacts with the side chains of
Thr28, Ser50, Arg51, and Arg55 (corresponding to
Thr9, Ser31, Arg32, and Lys36 in Af-FNO). These
residues are highly conserved in other known FNOs
(Fig. 2). These residues therefore appear to be cru-
cial for substrate recognition and help to discrimi-
nate between NADP+ and NAD+ (20). To get more
insights into the role of these residues, they were
mutated into amino acids with different charge
and/or size, and tested for the cofactor specificity
towards the two nicotinamide cofactors. Table 1
shows the kinetic parameters for both NADH and
NADPH as substrate. For wild-type Tfu-FNO, the
Km value for NADH (14 mM) is several orders of
magnitude higher than that for NADPH (7.3 µM),
clearly confirming that the enzyme prefers
NADP(H) over NAD(H). For all mutants, the Km
value for NADPH significantly increased (from
2.6- to >68-fold) compared to that of the wild-type
enzyme, which verified the crucial role of these res-
idues in binding NADP(H). Intriguingly, recogni-
tion of NADH remained the same or improved in
all mutants (Table 3), with a Km value ranging from
0.23- to 2.3-times of that from the wild-type. No-
ticeably, R55N and R55S variants have a signifi-
cantly improved affinity towards NADH. In case of
mutant R55N, Km, NADPH increased more than 100
fold while the Km, NADH decreased almost 4 fold. The
S50E mutant was the best among the tested mutants
with a Km, NADH of almost 5-time lower and a Km,
Crystallization of Tfu-FNO was successful which
allowed the elucidation of its crystal structure. This
revealed that NADP+ had been co-purified with the
native enzyme as it was found to be bound in the
active site (Fig. 5–6). All crystal soaking attempts
to obtain the F420 cofactor bound in the enzyme ac-
tive site failed, which can be explained by the tight
molecular packing found in Tfu-FNO crystals that
would hamper cofactor binding in the same position
as found in Af-FNO (Fig. 5A). It is known that, de-
pending on the bacterial species, the number of glu-
tamate moieties of F420 can vary from two to nine,
with five to six being the predominant species in
mycobacteria (19). Given the crystal arrangement
of Tfu-FNO molecules, an oligoglutamate tail of
F
420 of any length would clash against another sub-
unit interacting through crystal packing (Fig. 5A).
Nevertheless, the architecture of the active site is
highly conserved, and NADP+ adopts a virtually
identical position with respect to that observed in
Af-FNO (Fig. 5B). Therefore, F420 was tentatively
modelled in Tfu-FNO upon superposition of the ar-
chaeal enzyme (Fig. 5C). The modelled F420 fits
very well into the Tfu-FNO active site without any
clashes. Similarly to Af-FNO, F420 would bind in
Tfu-FNO at the C-terminal domain with its
deazaisoalloxazine ring burying deep inside the cat-
alytic pocket and the highly polar oligoglutamyl tail
directed towards the exterior of the dimer (Fig.
5B,C).
3

F420:NADPH oxidoreductase from T. fusca
of approximately 100-fold higher as com-
F420, which is different from the FNO from S.
griseus (11) and more similar to the archaeal FNOs
(7,8). This can partly be explained by the experi-
mental condition (24 °C) differing from the opti-
mum temperature at which the bacteria grow (55
°C) and the intercellular environment (e.g., cofactor
concentrations, salt concentrations). Several lines
of evidence suggest that in other actinomycetes,
such as Rhodococcus opacus and Nocardioides
simplex, FNO is also the main source of F420H2. In
these bacteria, the fno gene was embedded in the
same operon with genes encoding for the F420H2-
dependent reductases, which are involved in the
metabolism of picrate and 2,4-dinitrophenols (23–
25). FNO-catalyzed regeneration of F420H2 was also
proposed to be crucial for the reductive steps in the
biosynthesis of tetracycline by Streptomyces (26).
NADPH
pared to wild-type Tfu-FNO. Interestingly, the
T28A mutant showed an increased activity towards
both NADPH and NADH, with a 4-fold increase in
catalytic rate (kcat = 14 s−1) for NADPH and a 2.8-
fold decrease in Km value (5 mM) for NADH when
compared with the wild-type enzyme. This resulted
in significantly improved kcat/Km values for both
NADPH and NADH, respectively. Unfortunately,
combinations of the mutations did not show signif-
icant additive effects (Table 1).
Discussion
F420-dependent enzymes are interesting candidates
for biotechnological applications (5). Recent stud-
ies have suggested a widespread occurrence of such
deazaflavin-dependent enzymes in actinobacteria
(15). Some specific lineages seem especially rich in
F420-dependent enzymes, such as Mycobacterium
tuberculosis. This makes members of this super-
family of deazaflavoproteins potential drug targets
due to their absence in the human proteome and the
human gut flora. The work of Selengut et al. also
predicted the presence of at least 16 F420 related
genes in T. fusca, including all genes required for
Structure and NADP(H) binding site of Tfu-FNO
FNO is believed to be the only F420-dependent en-
zyme known so far that is conserved between ar-
chaea and bacteria (4). Except for a 19 amino acid
extension loop at the N-terminus, Tfu-FNO largely
shares the overall topology and cofactor binding
site with that from A. fulgidus (Fig. 2 and 5B). The
residues that interact directly with the 2′-phosphate
group of NADP(H) are also highly conserved (Fig.
6), and have proven to be essential for binding this
cofactor. Upon disrupting the hydrogen bonding
network by mutagenesis, all the mutants lost virtu-
ally all ability to recognize NADPH (Table 1). In-
triguingly, the affinity of these variants towards
NADH improved, with the T28A mutant being the
best in terms of specificity for NADH (3.3-fold
higher kcat/Km than that of WT). Yet, an efficient
NADH-dependent FNO has still to be engineered.
For this, a newly developed tool could be explored
which can guide structure-inspired switching of co-
enzyme specificity (27).
F
420 biosynthesis (15). Through our study, we have
experimentally confirmed the presence of an F420-
dependent enzyme in this actinomycete by cloning
and characterization of a thermostable F420:NADPH
oxidoreductase (Tfu-FNO), which catalyzes the re-
duction of NADP+ using reduced F420 and the re-
verse reaction.
The role of FNO in generating reduced F420
F420 cofactor provides microorganism alternative
redox pathways. The deazaflavin cofactor seems
especially equipped for reduction reactions as it dis-
plays a redox potential which is lower when com-
pared with the nicotinamide cofactor. Two enzymes
have been identified in previous studies that serve a
role in reducing F420—FNO and F420-dependent
glucose-6-phosphate dehydrogenase (FGD) (4).
Using T. fusca cell-free extract and heterologously
expressed Tfu_1669 (a putative M. tuberculosis
FGD homolog), we could not detect any FGD ac-
tivity (unpublished data). This suggests that the T.
fusca proteome indeed does not include an FGD. In
fact, it has been shown before that not all actinomy-
cetes have an FGD (22). Therefore, FNO may be
the primary enzyme in actinomycetes for providing
the cells with F420H2. Nevertheless, at physiological
pH (7.0–8.0, Fig. 3) Tfu-FNO performs reduction
of NADP+ slightly better than reduction of cofactor
Potential applications in biocatalysis
Tfu-FNO represents a highly attractive candidate
for the biocatalytic reduction of F420. The enzyme is
very thermostable, remains active over a wide range
of pH (Fig. 3,4), and can be easily expressed in E.
coli (120–200 mg/ L culture). Tfu-FNO is also a rel-
atively fast enzyme, especially with the T28A mu-
tant displaying a kcat of 14 s−1 for NADPH (Table
1). Whereas the majority of current enzymatic
F420H2 regeneration protocols employ FGDs
(28,29), the cost of the expensive, non-recyclable
cosubstrate glucose-6-phosphate remains the main
bottleneck for the use of such enzyme in large-scale
4

F420:NADPH oxidoreductase from T. fusca
applications. Therefore, an F420H2-generating sys-
tem whose cosubstrate could be recycled, such as
T28A TfuFNO would be highly promising. Availa-
ble, robust NAD(P)H regeneration machineries,
such as glucose dehydrogenase or other dehydro-
genases, have been thoroughly investigated and
widely applied in industry (30). Therefore, by com-
bining Tfu-FNO with an appropriate NAD(P)H re-
cycler, F420H2-reductases can be exploited for bio-
catalytic purposes.
the OD600 reached 0.4–0.6, the protein expression
was induced by addition of 0.02% (w/v) arabinose
followed by incubation at 30 °C, 130 rpm for 12 h.
Cells were harvested by centrifugation at 6000 × g
for 15 min (JLA 10.500 rotor, 4 °C) and resus-
pended in 10 ml of 50 mM KPi pH 7.0 supple-
mented with 1 µg/ml of DNase I. Cells were soni-
cated for 7 min (10 sec on, 15 sec off cycle, 70%
amplitude) at 4 °C using a VCX130 Vibra-Cell son-
icator (Sonics & Materials, Inc., Newton, USA),
and then centrifuged at 15000 × g (JA 17 rotor) for
45 min to obtain the cell-free extract. Tfu-FNO was
precipitated by adding 50% saturated ammonium
sulfate followed by anion exchange chromatog-
raphy with a HiTrap™ Q HP 5ml (GE Healthcare)
column pre-equilibrated with the same resuspen-
sion buffer. Tfu-FNO was eluted by using a linear
gradient of 0–1 M NaCl in the same buffer. At
around 250 mM NaCl, Tfu-FNO started eluting.
Excess salt was removed by using PD-10 desalting
column and the protein was stored in 50 mM KPi
buffer. (GE Healthcare). Protein concentration was
estimated using Bradford assay (30).
Experimental procedures
Cloning, expression, and purification of Tfu-FNO
Thermobifida fusca YX was grown at 55 °C in
Hägerdahl medium and its genomic DNA was ex-
tracted using the GeneElute Bacterial Genomic
DNA kit (Sigma–Aldrich). The gene Tfu-fno
(Tfu_0970, TFU_RS04835) was PCR amplified
from genomic DNA of T. fusca using the pair of pri-
mers listed in Table 2 with the NdeI and HindIII re-
striction sites introduced at the 5′ and 3′ positions
of the gene, respectively. The purified PCR product
and the pBADN/Myc-HisA vector were digested
with the restriction enzymes NdeI and HindIII, pu-
rified, and ligated [vector to insert ratio ca. 1 to 5
(mol/mol)] using T4 DNA ligase (Promega) with
quick ligation buffer. The pBADN/Myc-HisA vec-
tor is a variant of the commercial pBAD/Myc-HisA
(Invitrogen) where the unique NcoI site at the trans-
lation start is replaced with NdeI. The ligation prod-
uct was transformed into chemically competent E.
coli TOP10 cells using the heat shock method. Cor-
rect transformants were confirmed by sequencing
the recombinant plasmid pBAD-fno.
Temperature, pH optima, and thermostability of
Tfu-FNO
F420 was isolated from Mycobacterium smegmatis
mc2 4517 as previously published protocol (32).
F
F
420H2 was prepared by biocatalytic reduction of
420 using a recombinant F420-dependent glucose-6-
phosphate dehydrogenase from Rhodococcus jostii
RHA1 (29) as previously described (28).
The apparent melting temperature, Tm, was de-
termined using the Thermoflour® technique (17)
with a Bio-Rad C1000 Touch Thermal Cycler (Bio-
rad Laboratories, Inc.). The reaction volume was 25
µL, containing 10 µM of enzyme and 5 µL of 5 ×
SYPRO Orange (Invitrogen). To determine the tem-
perature for optimal activity of Tfu-FNO, the en-
zyme activity was measured using 1.25 mM
NADPH and 20 µM F420 in 50 mM KPi pH 6.0 in a
100 µL reaction volume. The cuvette containing the
substrates in preheated buffer was heated to the
tested temperature (25–90 °C) and the reaction was
started by adding 10 nM enzyme. The pH optimum
was determined for both the forward and backward
reactions of Tfu-FNO. F420 depletion at 400 nm (ε400
= 25 mM−1 cm−1) (33,34) or NADH formation at
340 nm (ε340 = 6.22 mM−1 cm−1) was followed using
a V-660 spectrophotometer from Jasco (IJsselstein,
The Netherlands). In this experiment, the reaction
(100 µL) contained 250 µM NADPH and 20 µM
Site-directed mutagenesis was carried out by
using the pBAD-fno vector as template and the
QuikChange® mutagenesis method with the corre-
sponding pairs of primers listed in Table 2. The pri-
mers (200 nM) were used in a 10 µL reaction mix-
ture. In case of the double mutants, plasmids with a
single mutation were used as template. The remain-
ing parent template vector was digested by incubat-
ing with DpnI (New England Biolab) at 37°C for 2
h. DpnI was then inactivated at 80 °C for 10 min
and the mutant plasmid was transformed into chem-
ically competent E. coli TOP10 cells. Mutations
were confirmed by sequencing.
E. coli TOP10 cells with pBAD-fno were
grown overnight at 37 °C, 130 rpm in a 5 ml lyso-
genic broth (LB) containing 50 µg/ml ampicillin.
This pre-culture was used to inoculate 500 ml of the
same medium and grown at 37 °C, 130 rpm. When
F
420 (F420 reduction); or 250 µM NADP+ and 20 µM
5

F420:NADPH oxidoreductase from T. fusca
F420H2 (NADP+reduction) in 50 mM buffer. Sodium
acetate, KPi and Tricine-KOH based buffers were
used for pH 4.5–5.5, 6.0–7.5 and 8.0–9.5, respec-
tively.
(40). Figures were generated by using UCSF Chi-
mera (41). Atomic coordinates and structure factors
were deposited in the Protein Data Bank under the
accession code 5N2I. Detailed data processing and
refinement statistics are available in Table 3.
Steady-state kinetic analyses
To determine the kinetic parameters of the enzyme,
initial F420 reduction rates were measured using a
SynergyMX microplate reader (BioTek) using 96-
well F-bottom plates (Greiner Bio-One GmbH) at
25 °C. The reaction was performed in 50 mM KPi
pH 6.0 and was started by adding 25–50 nM en-
zyme in the final volume of 200 µL. The concentra-
tion of one of the substrates was kept constant (250
µM for NADPH and 20 µM for F420, respectively)
while varying the concentration of the other sub-
strate. All the measurements were performed in du-
plicate. A decrease of absorption either at 400 nm
(F420 reduction, ε400 = 25.7 mmol−1 cm−1) or at 340
nm (NADPH oxidation, ε340 = 6.22 mmol−1 cm−1)
was followed to determine the observed rates, kobs
(s−1). Km and kcat values for NADP+, NADPH, F420
and F420H2 were calculated by fitting the data into
the Michaelis–Menten kinetic model using nonlin-
ear regression with GraphPad Prism 6.00
(GraphPad Software, La Jolla, CA, USA).
Acknowledgements
This work was supported by an Erasmus Mundus
action 2 “Svaagata” program from the European
Commission via a PhD scholarship provided to HK
and a Ubbo Emmius scholarship from the Univer-
sity of Groningen, the Netherlands, awarded to
QTN. We thank the European Synchrotron Radia-
tion Facility (ESRF) for providing beamtime and
assistance. We are grateful to Dr. G. Bashiri at the
Structural Biology Laboratory, School of Biologi-
cal Sciences and Maurice Wilkins Centre for Mo-
lecular Biodiscovery, the University of Auckland,
New Zealand for generously providing a culture of
M. smegmatis mc2 4517 and the plasmid
pYUBDuet-FbiABC. A. Giusti, S. Rovida and F.
Forneris are acknowledged for their experimental
support.
Conflict of interest
The authors declare that they have no conflicts of
interest with the contents of this article.
Crystallization, X-ray data collection, and structure
determination of Tfu-FNO
Author contributions
Native Tfu-FNO was crystallized using the sitting-
drop vapour diffusion technique at 20 °C by mixing
equal volumes of 9.0 mg/mL protein in 10 mM
Tris/HCl pH 7.5, 100 mM NaCl and of the reservoir
solution containing 5% (w/v) PEG 3000, 30% (v/v)
PEG 400, 10% (v/v) glycerol, 0.1 M HEPES pH
7.5. Prior to data collection, crystals were cryo-pro-
tected in the mother liquor and flash-cooled by
plunging them into liquid nitrogen. X-ray diffrac-
tion data to 1.8 Å were collected at the ID30B
beamline of the European Synchrotron Radiation
Facility in Grenoble, France (ESRF). Image index-
ing, integration, and data scaling were processed
with XDS package (35,36) and programs of the
CCP4 suite (37). The Tfu-FNO structure was ini-
tially solved by molecular replacement method with
Phaser (38) using the coordinates of FNO from A.
fulgidus [PDB ID code 1JAY (20)] which shares
40% sequence identity with Tfu-FNO as a starting
model devoid of all ligands and water molecules.
Manual model correction and structure analysis was
carried out with Coot (39) whereas alternating cy-
cles of refinement was performed with Refmac5
HK and MWF conceived the study and designed the
experiments. HK performed the cloning, expres-
sion, purification, and biochemical characterization
of the Tfu-FNO wild-type and variants. QTN per-
formed the crystallization and solved the structure
of Tfu-FNO. AM and CB supervised this part of the
study. HK and QTN drafted the manuscript. All au-
thors contributed to analyzing the data and writing
the paper.
References
1. Cheeseman, P., Toms–Wood, A., and Wolfe, R.S. (1972)
Isolation and properties of a fluorescent compound, factor
420, from Methanobacterium strain M.o.H. J. Bacteriol.
112, 527–531
2. Daniels, L., Bakhiet, N., and Harmon, K. (1985) Wide-
spread distribution of a 5-deazaflavin cofactor in Actino-
myces and related bacteria. Syst. Appl. Microbiol. 6, 12–
17
3. Jacobson, F., and Walsh, C. (1984) Properties of 7,8-dide-
methyl-8-hydroxy-5-deazaflavins relevant to redox coen-
zyme function in methanogen metabolism. Biochemistry
(N.Y.) 23, 979–988
6

F420:NADPH oxidoreductase from T. fusca
4. Greening, C., Ahmed, F.H., Mohamed, A.E., Lee, B.M.,
Pandey, G., Warden, A.C., Scott, C., Oakeshott, J.G., Tay-
lor, M.C., and Jackson, C.J. (2016) Physiology, biochem-
istry, and applications of F420- and Fo-dependent redox re-
actions. Microbiol. Mol. Biol. Rev. 80, 451–493
18. Hossain, M.S., Le, C.Q., Joseph, E., Nguyen, T.Q., John-
son–Winters, K., and Foss, F.W. (2015) Convenient syn-
thesis of deazaflavin cofactor FO and its activity in F420
-
dependent NADP reductase. Org. Biomol. Chem. 13,
5082–5085
5. Taylor, M., Scott, C., and Grogan, G. (2013) F420-depend-
ent enzymes—potential for applications in biotechnol-
ogy. Trends Biotechnol. 31, 63–64
19. Bair, T.B., Isabelle, D.W., and Daniels, L. (2001) Struc-
tures of coenzyme F420 in Mycobacterium species. Arch.
Microbiol. 176, 37–43
6. Eirich, L.D., and Dugger, R.S. (1984) Purification and
properties of an F420-dependent NADP reductase from
Methanobacterium thermoautotrophicum. Biochim. Bio-
phys. Acta (BBA)–General Subjects. 802, 454–458
20. Warkentin, E., Mamat, B., Sordel–Klippert, M., Wicke,
M., Thauer, R.K., Iwata, M., Iwata, S., Ermler, U., and
Shima, S. (2001) Structures of F420H2:NADP+ oxidore-
ductase with and without its substrates bound. EMBO J.
20, 6561–6569
7. de Wit, L., and Eker, A. (1987) 8-Hydroxy-5-deazaflavin-
dependent electron transfer in the extreme halophile Ha-
lobacterium cutirubrum. FEMS Microbiol. Lett. 48, 121–
125
21. Carugo, O., and Argos, P. (1997) NADP-dependent en-
zymes. II: Evolution of the mono-and dinucleotide bind-
ing domains. Proteins: Struct. Funct. Genet. 28, 29–40
8. Kunow, J., Schwörer, B., Stetter, K.O., and Thauer, R.K.
(1993) A F420-dependent NADP reductase in the ex-
tremely thermophilic sulfate-reducing Archaeoglobus
fulgidus. Arch. Microbiol. 160, 199–205
22. Purwantini, E., Gillis, T.P., and Daniels, L. (1997) Pres-
ence of F420-dependent glucose-6-phosphate dehydrogen-
ase in Mycobacterium and Nocardia species, but absence
from Streptomyces and Corynebacterium species and
methanogenic archaea. FEMS Microbiol. Lett. 146, 129–
134
9. Berk, H., and Thauer, R.K. (1997) Function of coenzyme
F420-dependent NADP reductase in methanogenic ar-
chaea containing an NADP-dependent alcohol dehydro-
genase. Arch. Microbiol. 168, 396–402
23. Heiss, G., Hofmann, K.W., Trachtmann, N., Walters,
D.M., Rouvière, P., and Knackmuss, H. (2002) npd gene
functions of Rhodococcus (opacus) erythropolis HL PM-
1 in the initial steps of 2,4,6-trinitrophenol degradation.
Microbiology. 148, 799–806
10. Elias, D.A., Juck, D.F., Berry, K.A., and Sparling, R.
(2000) Purification of the NADP+:F420 oxidoreductase of
Methanosphaera stadtmanae. Can. J. Microbiol. 46,
998–1003
24. Ebert, S., Fischer, P., and Knackmuss, H. (2001) Con-
verging catabolism of 2,4,6-trinitrophenol (picric acid)
and 2,4-dinitrophenol by Nocardioides simplex FJ2-1A.
Biodegradation. 12, 367–376
11. Eker, A., Hessels, J., and Meerwaldt, R. (1989) Charac-
terization of an 8-hydroxy-5-deazaflavin: NADPH oxi-
doreductase from Streptomyces griseus. Biochim. Bio-
phys. Acta (BBA)–General Subjects. 990, 80–86
25. Ebert, S., Rieger, P.G., and Knackmuss, H.J. (1999) Func-
tion of coenzyme F420 in aerobic catabolism of 2,4,6-tri-
nitrophenol and 2,4-dinitrophenol by Nocardioides sim-
plex FJ2–1A. J. Bacteriol. 181, 2669–2674
12. Wilson, D.B. (2004) Studies of Thermobifida fusca plant
cell wall degrading enzymes. Chem. Rec. 4, 72–82
13. Fraaije, M.W., Wu, J., Heuts, D.P., van Hellemond, E.W.,
Spelberg, J.H.L., and Janssen, D.B. (2005) Discovery of
a thermostable Baeyer–Villiger monooxygenase by ge-
nome mining. Appl. Microbiol. Biotechnol. 66, 393–400
26. Novotná, J., Neužil, J., and Hošťálek, Z. (1989) Spectro-
photometric identification of 8-hydroxy-5-deazafla-
vin:NADPH oxidoreductase activity in streptomycetes
producing tetracyclines. FEMS Microbiol. Lett. 59, 241–
245
14. Lončar, N., and Fraaije, M.W. (2015) Not so monofunc-
tional—a case of thermostable Thermobifida fusca cata-
lase with peroxidase activity. Appl. Microbiol. Biotech-
nol. 99, 2225–2232
27. Cahn, J.K., Werlang, C.A., Baumschlager, A., Brink-
mann-Chen, S., Mayo, S.L., and Arnold, F.H. (2017) A
General Tool for Engineering the NAD/NADP Cofactor
Preference of Oxidoreductases. ACS Synth. Biol. 6, 326–
333
15. Selengut, J.D., and Haft, D.H. (2010) Unexpected abun-
dance of coenzyme F420-dependent enzymes in Mycobac-
terium tuberculosis and other actinobacteria. J. Bacteriol.
192, 5788–5798
28. Manjunatha, U.H., Boshoff, H., Dowd, C.S., Zhang, L.,
Albert, T.J., Norton, J.E., Daniels, L., Dick, T., Pang, S.S.,
and Barry, C.E.,3rd (2006) Identification of a nitroimid-
azo-oxazine-specific protein involved in PA-824 re-
sistance in Mycobacterium tuberculosis. Proc. Natl.
Acad. Sci. U.S.A. 103, 431–436
16. Le, C.Q., Joseph, E., Nguyen, T., and Johnson-Winters,
K. (2015) Optimization of expression and purification of
recombinant Archeoglobus fulgidus F420H2:NADP+ oxi-
doreductase, an F420 cofactor dependent enzyme. Protein
J. 34, 391–397
29. Nguyen, Q.-T., Trinco, G., Binda, C., Mattevi, A., and
Fraaije, M.W. (2016) Discovery and characterization of
an F420-dependent glucose-6-phosphate dehydrogenase
(Rh-FGD1) from Rhodococcus jostii RHA1. Appl. Mi-
crobiol. Biotechnol. 10.1007/s00253-016-8038-y
17. Pantoliano, M.W., Petrella, E.C., Kwasnoski, J.D.,
Lobanov, V.S., Myslik, J., Graf, E., Carver, T., Asel, E.,
Springer, B.A., Lane, P., and Salemme, F.R. (2001) High–
density miniaturized thermal shift assays as a general
strategy for drug discovery. J. Biomol. Screen. 6, 429–
440
7

F420:NADPH oxidoreductase from T. fusca
30. Wichmann, R., and Vasic–Racki, D. (2005) Cofactor re-
generation at the lab scale. Adv. Biochem. Eng. Biotech-
nol. 92, 225–260
37. Winn, M.D., Ballard, C.C., Cowtan, K.D., Dodson, E.J.,
Emsley, P., Evans, P.R., Keegan, R.M., Krissinel, E.B.,
Leslie, A.G., McCoy, A., McNicholas, S.J., Murshudov,
G.N., Pannu, N.S., Potterton, E.A., Powell, H.R., Read,
R.J., Vagin, A., and Wilson, K.S. (2011) Overview of the
CCP4 suite and current developments. Acta Crystallogr.
Sect. D: Biol. Crystallogr. 67, 235–242
31. Bradford, M.M. (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein utiliz-
ing the principle of protein–dye binding. Anal. Biochem.
72, 248–254
38. McCoy, A.J., Grosse-Kunstleve, R.W., Adams, P.D.,
Winn, M.D., Storoni, L.C., and Read, R.J. (2007) Phaser
crystallographic software. J. Appl. Crystallogr. 40, 658–
674
32. Isabelle, D., Simpson, D.R., and Daniels, L. (2002)
Large-scale production of coenzyme F420-5,6 by using
Mycobacterium smegmatis. Appl. Environ. Microbiol. 68,
5750–5755
39. Emsley, P., and Cowtan, K. (2004) Coot: model-building
tools for molecular graphics. Acta Crystallogr. Sect. D:
Biol.Crystallogr. 60, 2126–2132
33. Jacobson, F.S., Daniels, L., Fox, J.A., Walsh, C.T., and
Orme–Johnson, W.H. (1982) Purification and properties
of an 8-hydroxy-5-deazaflavin-reducing hydrogenase
from Methanobacterium thermoautotrophicum. J. Biol.
Chem. 257, 3385–3388
40. Murshudov, G.N., Vagin, A.A., and Dodson, E.J. (1997)
Refinement of macromolecular structures by the maxi-
mum–likelihood method. Acta Crystallogr. Sect. D:
Biol.Crystallogr. 53, 240–255
34. DiMarco, A.A., Bobik, T.A., and Wolfe, R.S. (1990) Un-
usual coenzymes of methanogenesis. Annu. Rev. Bio-
chem. 59, 355–394
41. Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S.,
Greenblatt, D.M., Meng, E.C., and Ferrin, T.E. (2004)
UCSF Chimera—a visualization system for exploratory
research and analysis. J. Comput. Chem. 25, 1605–1612
35. Kabsch, W. (2010) Xds. Acta Crystallographica Section
D: Biological Crystallography. 66, 125–132
36. Kabsch, W. (2010) Integration, scaling, space-group as-
signment and post-refinement. Acta. Crystallogr. Sect. D:
Biol. Crystallogr. 66, 133–144
8

F420:NADPH oxidoreductase from T. fusca
Table 1 Steady-state kinetic parameters for wild-type and mutant Tfu-FNOs using NADH and NADPH as substrate.
n.d., not determined.
Tfu-FNO variant
NADH
NADPH
Km (µM) kcat (s−1)
7.3 ± 1.0 3.3 ± 0.1
kcat/Km, NADPH
kcat/Km, NADH
/
kcat/Km
(M−1 s−1)
160
kcat/Km
(mM−1 s−1)
450
Km (mM) kcat (s−1)
Wild-type
R51A
R51V
R55A
R55N
R55S
R55V
S50E
S50Q
14 ± 4.2 2.2 ± 0.4
8.6 ± 0.9 3.2 ± 0.2
8.7 ± 1.1 3.4 ± 0.2
7.0 ± 0.8 3.0 ± 0.2
6.3 ± 3.6 2.8 ± 0.7
4.4 ± 1.3 3.5 ± 0.4
9.6 ± 1.4 3.2 ± 0.2
3.2 ± 1.0 2.7 ± 0.3
8.2 ± 2.7 4.2 ± 0.6
5.0 ± 0.6 2.6 ± 0.1
10 ± 2.7 1.6 ± 0.2
6.5 ± 1.3 2.7 ± 0.2
32 ± 1.9 4.9 ± 0.2
10 ± 1.4 2.8 ± 0.2
20 ± 9.2 2.3 ± 0.7
9.8 ± 2.3 1.8 ± 0.2
12 ± 2.2 2.7 ± 0.3
5.4 ± 1.5 2.5 ± 0.3
2800
17
32
370
290
420
440
790
330
840
510
520
160
420
150
280
120
180
230
>180
>180
>1.6
>1.3
6.2
9.3
300
29 ± 4.0 8.8 ± 0.3
>500 n.d.
170 ± 38 6.9 ± 0.7
710
41
52
49 ± 7.2
>500
>500
n.d.
n.d.
n.d.
T28A
19 ± 2.6 14 ± 0.5
720
1400
R51ER55A
R51ER55N
R51ER55S
R51VR55V
S50ER55A
S50ER55V
T28AR51V
T28AR55A
>500
>500
>500
>500
>500
>500
>500
n.d.
n.d.
n.d.
n.d.
n.d.
n.d.
n.d.
460
280
93 ± 29 3.3 ± 0.4
>500 n.d.
3.5
8
T28AR51VR55V 12 ± 2.2 3.3 ± 0.3
9

F420:NADPH oxidoreductase from T. fusca
Table 2 Primers used in this study. Sites of mutations are marked with oligonucleotides in bold, whereas restriction
sites are in bold, italic.
fno genes
FNO WT
Forward primers (5′–3′)
TGCCATATGTCGATTGCCGTGCTG TCG
Reverse primers (5′–3′)
AAGCTTTAGATGTCGGTGATGCGGATAC
FNO_R51M TGATTCTCGGTTCGATGAGCGCGGAGCGGG
CCCGCTCCGCGCTCATCGAACCGAGAATCA
FNO_S50Q GCACGAGGTGATTCTCGGTCAGCGGAGCGCG CGCGCTCCGCTGACCGAGAATCACCTCGTGC
FNO_S50E
FNO_R55S
GCACGAGGTGATTCTCGGTGAGCGGAGCGCG CGCGCTCCGCTCACCGAGAATCACCTCGTGC
GGAGCGCGGAGAGCGCCCAGGCGGT
ACCGCCTGGGCGCTCTCCGCGCTCC
CAACCGCCTGGGCGTTCTCCGCGCTCCGC
CCTGATCACCCGCGCCCCCCAGCAC
CCGCTCCGCGCTCGCCGAACCGAGAATC
CCGCTCCGCGCTCACCGAACCGAGAATC
CCGCTCCGCGCTCTCCGAACCGAGAATC
CCGCCTGGGCCGCCTCCGCGCTCC
CCGCCTGGGCCACCTCCGCGCTCC
CCGCCTGGGCCTCCTCCGCGCTCC
CGCTCCGCGCACCGAGAATCACCTCGT
FNO_R55N GCGGAGCGCGGAGAACGCCCAGGCGGTTG
FNO_T28A GTGCTGGGGGGCGCGGGTGATCAGG
FNO_R51A GATTCTCGGTTCGGCGAGCGCGGAGCGG
FNO_R51V GATTCTCGGTTCGGTGAGCGCGGAGCGG
FNO_R51E GATTCTCGGTTCGGAGAGCGCGGAGCGG
FNO_R55A GGAGCGCGGAGGCGGCCCAGGCGG
FNO_R55V GGAGCGCGGAGGTGGCCCAGGCGG
FNO_R55E GGAGCGCGGAGGAGGCCCAGGCGG
FNO_S50A ACGAGGTGATTCTCGGTGCGCGGAGCG
10

F420:NADPH oxidoreductase from T. fusca
Table 3 Data collection and refinement statistics
PDB ID Code
Space group
Resolution (Å)
a, b, c (Å)
5N2I
P212121
1.80
82.4, 86.1,136.8
11.2 (99.1)
98.6 (90.2)
89383
Rsyma,b (%)
Completenessb (%)
Unique reflections
Multiplicityb
I/σb
4.5 (2.8)
7.9 (0.9)
b
CC1/2
99.4 (24.7)
Number of atoms:
protein
6594
NADP+/glycerol/water
4 × 48/7 × 6/600
Average B value for all atoms (Å2) 25.0
Rcrystb,c (%)
16.5 (34.1)
Rfreeb,c (%)
21.4 (35.7)
0.019
2.02
Rms bond length (Å)
Rms bond angles (°)
Ramachandran outliers
0
a Rsym = ∑|Ii − <I>|/∑Ii, where Ii is the intensity of ith observation and <I> is the mean intensity of the reflection.
b Values in parentheses are for reflections in the highest resolution shell.
c Rcryst = ∑|Fobs – Fcalc|/∑|Fobs| where Fobs and Fcalc are the observed and calculated structure factor amplitudes, respectively. Rcryst and Rfree
were calculated using the working and test sets, respectively.
11

F420:NADPH oxidoreductase from T. fusca
Figure 1 The reversible reaction catalyzed by F420:NADPH oxidoreductase. The number of glutamate residues at-
tached to the phospholactyl moiety may vary (n = 2–8 in case of Mycobacterium smegmatis).
12

F420:NADPH oxidoreductase from T. fusca
Figure 2 Multiple sequence alignment of selected FNOs from Thermobifida fusca (Tfu_FNO), Archaeoglobus fulgidus
(Af_FNO), Methanothermobacter marburgensis (Mma_FNO), Methanobrevibacter smithii (Msm_FNO), Methanosphaera
stadtmanae (Mst_FNO), and Streptomyces griseus (Sgr_FNO). The figure was generated with Clustal X2.1. Residues in-
volved in binding the 2′-phosphate group of NADP+ are indicated with an arrow.
13

F420:NADPH oxidoreductase from T. fusca
Figure 3 pH optimum for the Tfu-FNO-catalyzed F420 reduction using NADPH (dots) or the NADP+ reduction using
F420H2 (squares) at 24 °C. kobs (s−1) for the NADP+ reduction (pH optima 8–10) is almost 3-time higher than that for
the F420 reduction (pH optimum 4–6).
14

F420:NADPH oxidoreductase from T. fusca
Figure 4 Effect of temperature on Tfu-FNO activity. Reaction mixture of 100 µL contained 1.25 mM NADH, 20 µM
F420 in 50 mM KPi pH 6.0. The reaction was started by adding 50 nM FNO. The error bars represent standard deviation
from two measurements.
15

F420:NADPH oxidoreductase from T. fusca
A
B
C
Figure 5 Crystal structure of FNO from Thermobifida fusca (A) The asymmetric unit of Tfu-FNO crystals contain
two dimers AB and CD, colored in coral (monomer A), orchid (monomer B), deep sky blue (monomer C), and green
(monomer D), respectively. (B) Superposition of the Tfu-FNO monomer C onto the homologous NADP+- and F420
-
bound Af-FNO monomer [carbon atoms in white, 40% sequence identity, PDB ID 1JAY (20)]. The two structures
largely share the same overall topology and the binding pocket architecture, with the nicotinamide rings adopting a
similar position in the active site. (C) Close-up view of Tfu-FNO binding pocket with a modelled F420 molecule (in
16

F420:NADPH oxidoreductase from T. fusca
shaded colors with carbon atoms in yellow) as a result of superposition as in B. The NADP(H) carbon atoms are
shown in yellow, oxygen atoms in red, nitrogen atoms in blue, and phosphorous atoms in orange.
17

F420:NADPH oxidoreductase from T. fusca
Figure 6 Active site of Tfu-FNO in complex with NADP+. Unbiased 2Fo − Fc electron density map calculated at 1.8
Å and contoured at 1.0 σ are drawn as grey chicken-wire. Potential hydrogen bonds are depicted with dashed lines
and water molecules as red spheres. Residues in direct contact with NADP+ are labeled. The orientation of the mole-
cule is approximately 180° clockwise rotated along an axis perpendicular to the plane of the paper with respect to that
in Figure 5. Color coding for atoms is as in Figure 5.
18

Isolation and characterization of a thermostable F420:NADPH oxidoreductase from
Thermobifida fusca
Hemant Kumar, Quoc-Thai Nguyen, Claudia Binda, Andrea Mattevi and Marco W. Fraaije
J. Biol. Chem. published online April 14, 2017
Access the most updated version of this article at doi: 10.1074/jbc.M117.787754
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
This article cites 0 references, 0 of which can be accessed free at
http://www.jbc.org/content/early/2017/04/14/jbc.M117.787754.full.html#ref-list-1