6-Biphenylmethyl-3-hydroxypyrimidine-2,4-diones potently and selectively inhibited HIV reverse transcriptase-associated RNase H

Article abstract of DOI:10.1016/j.ejmech.2018.07.035

Human immunodeficiency virus (HIV) reverse transcriptase (RT)-associated ribonuclease H (RNase H) remains an unvalidated drug target. Reported HIV RNase H inhibitors generally lack significant antiviral activity. We report herein the design, synthesis, biochemical and antiviral evaluations of a new 6-biphenylmethyl subtype of the 3-hydroxypyrimidine-2,4-dione (HPD) chemotype. In biochemical assays, analogues of this new subtype potently inhibited RT RNase H in low nanomolar range without inhibiting RT polymerase (pol) or integrase strand transfer (INST) at the highest concentrations tested. In cell-based assays, a few analogues inhibited HIV in low micromolar range without cytotoxicity at concentrations up to 100 μM.

Full text of DOI:10.1016/j.ejmech.2018.07.035

European Journal of Medicinal Chemistry 156 (2018) 680e691
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Research paper
6-Biphenylmethyl-3-hydroxypyrimidine-2,4-diones potently and
selectively inhibited HIV reverse transcriptase-associated RNase H
,
d
Lei Wang a, Jing Tang a, Andrew D. Huber b, Mary C. Casey c, Karen A. Kirby c
,
Daniel J. Wilson a, Jayakanth Kankanala a, Michael A. Parniak e, Stefan G. Sarafianos c
,
, d, f
,
*
Zhengqiang Wang a
a Center for Drug Design, Academic Health Center, University of Minnesota, Minneapolis, MN 55455, USA
b Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri, Christopher S. Bond Life Sciences Center, Columbia, MO
65211, USA
c Department of Molecular Microbiology and Immunology, University of Missouri School of Medicine, Christopher S. Bond Life Sciences Center, Columbia,
MO 65211, USA
d Laboratory of Biochemical Pharmacology, Department of Pediatrics, Emory University School of Medicine, Atlanta, GA 30322, USA
e Department of Microbiology & Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, PA 15219, USA
f Department of Biochemistry, University of Missouri, Columbia, MO 65211, USA
a r t i c l e i n f o
a b s t r a c t
Article history:
Human immunodeficiency virus (HIV) reverse transcriptase (RT)-associated ribonuclease H (RNase H)
remains an unvalidated drug target. Reported HIV RNase H inhibitors generally lack significant antiviral
activity. We report herein the design, synthesis, biochemical and antiviral evaluations of a new 6-
biphenylmethyl subtype of the 3-hydroxypyrimidine-2,4-dione (HPD) chemotype. In biochemical as-
says, analogues of this new subtype potently inhibited RT RNase H in low nanomolar range without
inhibiting RT polymerase (pol) or integrase strand transfer (INST) at the highest concentrations tested. In
cell-based assays, a few analogues inhibited HIV in low micromolar range without cytotoxicity at con-
Received 18 May 2018
Received in revised form
11 July 2018
Accepted 14 July 2018
Available online 17 July 2018
Keywords:
centrations up to 100 mM.
3-Hydroxypyrimidine-2,4-dione (HPD)
Human immunodeficiency virus (HIV)
RNase H
© 2018 Elsevier Masson SAS. All rights reserved.
Inhibitors
Structure-activity-relationship (SAR)
1. Introduction
(NNRTIs) [4]; and an RNase H domain [2,5] required to degrade the
RNA strand from the RNA/DNA heteroduplex reverse transcription
intermediate. Significantly, attenuated RNase H enzymatic activity
was found to correlate well with reduced HIV replication in cell
culture [6], suggesting that RNase H enzymatic activity is required
for HIV replication and that selectively inhibiting RNase H with
small molecules should confer a similar antiviral phenotype.
However, medicinal chemistry efforts targeting HIV RNase H have
yet to deliver the first in-class antiviral candidate in the develop-
ment pipeline at any stage. As such, HIV RT-associated RNase H
remains unvalidated as a drug target.
Treatment of HIV infection relies on a large repertoire of FDA-
approved single agents and fixed dose combinations consisting
primarily of inhibitors of three virally encoded enzymes: RT, IN and
protease (PR) [1]. However, as current drugs do not cure HIV, their
long term use can be plagued by the selection of resistant viral
strains. Combating drug-resistant HIV necessitates the discovery of
antivirals with a novel molecular target and a distinct antiviral
mechanism of action. HIV RT-associated RNase H represents such a
novel target. RT comprises two distinct domains [2]: a pol domain
responsible for both RNA-dependent and DNA-dependent viral
DNA polymerization and targeted by all currently known nucleo-
side RT inhibitors (NRTIs) [3] and non-nucleoside RT inhibitors
Major HIV RNase H inhibitor types (Fig. 1, A) [7] reported by
others include 2-hydroxyisoquinolinedione (HID, 1) [8],
b-thuja-
plicinol (2) [9], dihydroxycoumarin (3) [10], diketoacid (DKA) 4 [11],
pyrimidinol carboxylic acid 5 [12], hydroxynaphthyridine 6 [13]
and pyridopyrimidone 7 (Fig. 1, A) [14]. Key to these chemotypes is
a chelating triad (magenta) capable of binding two divalent metal
ions, a structural moiety also featured in inhibitors of HIV INST
* Corresponding author.
E-mail address: wangx472@umn.edu (Z. Wang).
https://doi.org/10.1016/j.ejmech.2018.07.035
0223-5234/© 2018 Elsevier Masson SAS. All rights reserved.

L. Wang et al. / European Journal of Medicinal Chemistry 156 (2018) 680e691
681
Fig. 1. Major active site RNase H inhibitors. (A) RNase H inhibitor types reported by others. All chemotypes contain a chelating triad (magenta); scaffolds 4e7 also feature an aryl or
biaryl moiety (cyan) connected through a methylene or amino linker; (B) our previously reported RNase H inhibitor chemotypes 8e10. (For interpretation of the references to colour
in this figure legend, the reader is referred to the Web version of this article.)
which shares a similar active site fold and a divalent metal
dependence for catalytic activity [15]. Importantly, inhibitor types
4e7, which contain an additional hydrophobic aromatic moiety
(cyan), exhibited more potent and selective RNase H inhibition,
indicating that the chelating triad and the hydrophobic aromatic
moiety may represent the minimal pharmacophore requirements
for RNase H inhibitors. A similar pharmacophore model was
observed with canonical INSTIs [16,17]. Nevertheless, reported
RNase H inhibitors generally lack antiviral activity in cell culture,
presumably due to the biochemical barrier of small molecules
competing against much larger RNA/DNA substrates [14,18]. In
addition, many of these RNase H inhibitors also lack a selective
inhibitory profile biochemically over the inhibition of RT pol and
INST. Therefore, there is a need to continue to identify novel che-
motypes with potent and selective biochemical RNase H inhibition
that could confer antiviral activity. Toward this end, we have
discovered three distinct chemotypes (8e10, Fig. 1, B) based on the
afore-mentioned pharmacophore model, including the redesigned
HID subtype 8 [19], the hydroxypyridonecarboxylic acid (HPCA)
chemotype 9 [20], and the redesigned HPD subtype 10 [21]. We
describe herein the evolution of another HPD subtype 17 from the
original HPD subtypes 11 and 12 (Fig. 2) which were synthesized as
INST and RT pol dual inhibitors [22,23], and later found to inhibit
HIV RNase H in our primary screening assay. Brief structure-
activity-relationship (SAR) analysis on 11 and 12 concerning the
N-3 substitution (subtype 13) and the C5 and C6 sites (subtype 14)
led to subtype 15 with a biaryl moiety at C-6 (Fig. 2, A). Further
structural modifications on 15 aimed to minimize the peripheral
binding interactions important for RT pol binding (Fig. 2, B) [24,25].
As such the sequential removal of the C5 alkyl group (subtype 16)
and the N-1 substituent resulted in the design of subtype 17 which
demonstrated highly potent and selective RNase H inhibition, with
some analogues also inhibiting HIV in cell culture without cyto-
2. Results and discussion
2.1. Chemistry
All compounds of the original HPD subtypes 11e12 were syn-
thesized according reported procedures [22,23]. Subtype 13 was
synthesized from a previously synthesized intermediate 18 [23]
according to Scheme 1. Direct methylation of 18 afforded com-
pound 13a, whereas 13b was prepared via a two-step synthetic
sequence: an N-3 hydroxylation and the subsequent methylation of
intermediate 19.
Analogues of subtype 14 were synthesized based on procedures
described in Scheme 2. The synthesis involved key
and 23) which were synthesized as reported [23]. Cyclization of
ketoesters with thiourea followed by the conversion of thio-
carbonyl into carbonyl produced pyrimidine-2,4-diones 21 and 24.
The N-1 ether linkage was introduced via a highly regioselective
reaction between a bissilylated pyrimidine-2,4-dione and a chlor-
omethyl alkyl ether, an activated alkylating agent, to yield advanced
intermediates 22 and 25. Finally, N-3 hydroxylation with mCPBA
under basic condition furnished desired compounds 14a and 14b.
The synthesis of subtype 15 critically featured a brominated
pyrimidine-2,4-dione intermediate (30) which was prepared from
b-ketoesters (20
b
-
b-ketoester 27 based on a similar procedure used for the synthesis
of subtype 14 (Scheme 3). Suzuki coupling [26] of 30 with an aryl
boronic acid yielded intermediate 31 which was subjected to N-3
hydroxylation to complete the synthesis of 15. It is noteworthy that
b
-ketoesters involved in the synthesis of HPD core are typically
prepared from a Blaise reaction [27] between an appropriate cyano
compound and a bromoester. However, in this synthesis
b
-
ketoester 27 was prepared using a different reaction [28] from
much cheaper carboxylic acid 26 and diethyl methylmalonate.
Subtype 17, the major subtype for this study, was synthesized as
described in Scheme 4. The synthetic approach utilized was
adapted from a known synthesis of pyrimidine-2,4-dione ana-
logues [29]. The synthesis began with a Blaise reaction to prepare
toxicity. Interestingly, subtype 17 is
a drastically improved
congener of HPD subtype 10 which did not demonstrate significant
HIV inhibition in cell culture [21]. We report herein the synthesis,
biochemical and antiviral studies, and molecular modeling of 17.
the key
b-ketoesters 33 which were subsequently converted to

682
L. Wang et al. / European Journal of Medicinal Chemistry 156 (2018) 680e691
Fig. 2. Evolution from original HPD chemotypes 11 and 12 to selective active site RNase H inhibitor type 17. SAR of 11 comprises (a) N-3 site; (b) C5 and C6; and (c) aromatic moiety.
Peripheral structural simplification of 15 through (d) removal of the C5 alkyl and (e) deletion of the N-1 side chain led to potent and selective inhibitor type 17.
coupling reaction to yield chemotype 16. With various phenyl
boronic acids, this reaction introduced the structural diversity
required for probing SAR around the biphenyl moiety. Removal of
the N-1 side chain of 16 was effected under TFA-mediated hydro-
lysis to produce final compounds 17 in moderate to good yields
(Scheme 4).
2.2. Biology
Analogues of previously reported HPD subtypes 11 and 12, and
all final compounds of subtypes 13e17 were evaluated in a
biochemical assay measuring the catalytic activity of RT-associated
RNase H for SAR development. Analogues of the optimized subtype
17 were also tested in biochemical assays against RT pol and INST,
as well as in a cell-based MAGI assay for antiviral activity against
HIV-1 and cytotoxicity.
Inhibition of RT-associated RNase H in biochemical assays. Due to
the active site similarity between HIV RNase H and IN and their
shared dependence on two divalent metal ions for catalysis, the
original HPD subtypes 11e12, previously reported as IN/RT pol dual
inhibitors [22,23], were screened in our RT RNase H biochemical
assay. The results are summarized in Table 1. In general both sub-
Scheme 1. Synthesis of HPD subtype 13a.
Reagents and conditions: (a) Cs2CO3, MeI, THF, 63%; (b) NaH, m-CPBA, THF, rt; (c)
a
types inhibited RNase H in low micromolar range, with 11 showing
slightly better potency M) than 12
(IC50 ¼ 0.9e6.8
(IC50 ¼ 0.9e15 M). An interesting SAR was that a para-F substitu-
Cs2CO3, MeI, THF, 53%.
m
m
advanced intermediate 36 via a three step synthetic sequence. After
the N-3 hydroxylation via a base-mediated mCPBA oxidation, the
resulting HPD intermediates 37 were deprotected at N-1 under the
influence of TFA. At this stage the second phenyl ring of the
biphenyl moiety at C-6 was chemically attached via a Suzuki
ent on the aromatic ring of 11 caused substantial reduction in po-
tency (11b vs. 11a; 11e vs. 11d), whereas similar fluorine effect was
not observed with subtype 12 (12a vs. 12b). Nevertheless, these
initial screening results suggest that the original HPD subtypes can
be exploited as RNase H inhibitor types.

L. Wang et al. / European Journal of Medicinal Chemistry 156 (2018) 680e691
683
Scheme 2. Synthesis of HPD subtype 14a.
aReagents and conditions: (a) thiourea, MeONa, reflux; (b) ClCH2COOH, Acetic acid/H2O; (c) CH3C(OTMS) ¼ NTMS (BSA), 4-F-PhCH2OH, (HCHO)n, TMSCl, TBAI (cat.); (d) NaH, m-
CPBA, THF, rt.
Scheme 3. Synthesis of HPD subtype 15a.
a
Reagents and conditions: (a) diethyl methylmalonate, KOH/MgCl2/Et3N, CDI/CH3CN, 73%; (b) thiourea, MeONa, reflux; (c) ClCH2COOH, Acetic acid/H2O; (d) CH3C(OTMS) ¼ NTMS
(BSA), chloromethyl ether, (HCHO)n, TMSCl, TBAI (cat.); (e) Pd(Ph3P)4/Na2CO3/MW/Toluene/MeOH; (f) NaH, m-CPBA, THF, rt.
We then conducted a brief SAR with the synthesis of subtypes
13e17 (Table 2). Not surprisingly, replacing the N-3 OH group (11d,
inhibition since both are critical to RT pol inhibition. While these
initial analogues did not exhibit improved RNase H inhibition, an-
alogues devoid of C5 alkyl group (16b and 16i) did inhibit RNase H
with much improved potency. The most important SAR was that
removing both the C5 alkyl group and the N-1 substituent yielded a
new subtype (17) with drastically improved potency (>313 fold for
17a over 16a) inhibiting RNase H.
IC50 ¼ 2.1
m
M) of the chelating triad with a Me group (13a,
M) resulted in sig-
IC50 ¼ 7.0
mM) or a OMe group (13b, IC50 ¼ 11
m
nificant loss in inhibitory activity, corroborating that the chelating
triad is important in providing active site binding. A larger degree of
activity drop was observed when the C6 benzyl group was repo-
sitioned at C5 (14a, IC50 ¼ 15
m
M), or the C6 benzyl was changed to a
The superb inhibitory activity of 17a prompted us to synthesize
a total of 20 analogues to confirm the activity and explore the SAR
around the biaryl moiety (Table 3). Importantly, all these analogues
potently inhibited RNase H in nanomolar range (IC50 ¼ 7.6e85 nM).
To gauge selectivity in biochemical inhibition, all analogues of
subtype 17 were also tested in two additional biochemical assays
measuring the activity of RT pol and INST (Table 3). From these
phenyl (14b, IC50 ¼ 17 M). The remaining SAR all concerned
m
compounds with a biaryl methyl moiety in lieu of the benzyl group
at C6. Introducing a biaryl methyl moiety at C6 of HPD is consistent
with the RNase H inhibitor pharmacophore model mentioned
above. The initial series of compounds (15a-c) contain smaller
groups at both C5 and N1, a design intended to mitigate RT pol

684
L. Wang et al. / European Journal of Medicinal Chemistry 156 (2018) 680e691
Scheme 4. Synthesis of HPD subtype 17a.
aReagents and conditions: (a) ethyl bromoacetate, Zn, I2, THF, Ar, reflux, 81e89%; (b) thiourea, MeONa, reflux, 5 h, 78e79%; (c) ClCH2COOH, H2O, reflux, overnight, 60e71%; (d) BSA,
chloromethyl ethyl ether, DCM, rt, 5 h, 59e70%; (e) NaH, m-CPBA, THF, rt, overnight, 29e65%; (f) arylboronic acid, Pd(PPh3)4, K2CO3, MeOH/H2O, microwave, 120 ꢀC, 30e50 min,
51e75%; (g) TFA, microwave, 120 ꢀC, 60 min, 30e61%.
counter assays inhibitory activity was not observed with any of
these analogues against either RT (IC50 > 10 M) or INST
(IC50 > 100 M), indicating a highly selective RNase H inhibitory
profile for subtype 17. Although the high potency against RNase H
did not vary significantly with mono substitution on the phenyl
C¼O chelating triad) and the two metal cofactors (Mg2þ) which
are coordinated to the active site acidic residues D443, E478, D498
and D549. The molecular model also reveals a potential interaction
between the keto group at the 2-position (2-C¼O) of 17h and the
imidazole ring of the highly conserved H539, which would stabilize
inhibitor positioning near the active site metal-chelating residues
D443, E478, D498, and D549, all of which are crucial for RT-RNase H
activity. In addition, the biaryl moiety is positioned to possibly
interact with other protein residues of p51 subunit or nucleic acid
substrate. This predicted binding mode conforms to the general
pharmacophore of active site-directed RNase H inhibitors, hence
corroborating the active site inhibition mechanism (Fig. 3).
m
m
ring, disubstituted analogues 17h (IC50 ¼ 0.009
(IC50 ¼ 0.009 M), 17k (IC50 ¼ 0.008 M), 17s (IC50 ¼ 0.008
17t (IC50 ¼ 0.009 M) showed improved potency in general. A
notable exception is the bistrifluoromethyl substituted analogue
M) which exhibited much less potent inhibitory
m
M), 17i
m
m
mM) and
m
(17f, IC50 ¼ 0.085
m
activity than other disubstituted analogues. Most importantly,
when compared to previously reported congener 10 [21], analogues
of the new subtype 17 showed much improved potency and
selectivity inhibiting RT-associated RNase H (17a vs. 10a, 17p vs.
10b).
3. Conclusions
Inhibition of HIV-1 in cell culture. Selected analogues of subtype
17 were evaluated for antiviral activity. In a MAGI antiviral assay, 14
of the 20 subtype 17 analogues displayed apparent antiviral EC50 in
A new HPD subtype 17 featuring a C-6 biarymethyl moiety
evolved from the original HPD subtypes 11e12 was synthesized as
inhibitors of HIV RT associated RNase H domain. In biochemical
assays all analogues of subtype 17 inhibited RNase H in nanomolar
range (IC50 ¼ 7.6e85 nM) without significantly inhibiting RT pol at
low
m
M range (EC50 ¼ 5.6e20
mM, Table 4). However, these ana-
logues appeared to be cytotoxic at antiviral concentrations, except
for 17b, 17h and 17r with which no cytotoxicity was observed at
10
observed with six analogues in low
cytotoxicity. Molecular modeling predicted
m
M or INST at 100
m
M. Antiviral activity against HIV-1 was also
M range with no or modest
binding model
concentrations up to 100
(EC50 ¼ 11 M, CC50 ¼ 49 M), 17p (EC50 ¼ 7.6
and 17q (EC50 ¼ 11 M, CC50 ¼ 62 M), inhibited HIV-1 with mod-
mM. Another three analogues, 17k
m
m
m
m
M, CC50 ¼ 27 M)
m
a
m
m
consistent with RT RNase H active site binding. The potent and
selective biochemical inhibitory profile as well as the observed
antiviral phenotype render our new HPD subtype 17 a drastically
improved scaffold for HIV RT RNase H inhibitor discovery over our
recently reported subtype 10.
erate (4e6 fold) selectivity (CC50/EC50). The antiviral activity of
these six analogues represents another major improvement for
subtype 17 over recently reported subtype 10 with which no ana-
logues showed antiviral activity [21].
2.3. Molecular modeling
4. Experimental
Docking analysis was performed with Glide XP (version 6.4)
[30,31] using two metal sites as a constraint within the active site of
RNase H. The predicted binding mode of compound 17h within the
active site of RNase H (PDB code: 5J1E [20]) suggests potential
chelating interactions between the HPD core (the 2-C¼O-3-OH-4-
4.1. Chemistry
4.1.1. General procedures
All commercial chemicals were used as supplied unless other-
wise indicated. Flash chromatography was performed on
a

L. Wang et al. / European Journal of Medicinal Chemistry 156 (2018) 680e691
685
Table 1
RT RNase H inhibition of original HPD analogues 11 and 12.
Table 2
SAR on RT RNase H inhibition.
a
Compound
Ar
R
RT RNase H IC50 (mM)
a
Compound
R
Ar(R0)
RT RNase H IC50 (mM)
11a
Me
6.8
13a
13b
14a
Me
OMe
e
e
Et
7.0
11
15
11b
11c
11d
11e
11f
Me
>25
2.5
2.1
6.2
2.8
1.8
14b
15a
15b
Et
e
e
17
6.2
6.7
15c
16a
16b
16i
e
e
e
e
5.2
11g
>5
2.1 1a
0.43 0.03
11h
11i
0.90
1.8
17a
e
0.016 0.0001
12a
12b
12c
12d
10
15
13
6.6
a
Concentration of a compound inhibiting the enzymatic function by 50%.
MeI (27 mg, 0.19 mmol) in 2 mL anhydrous THF, was added Cs2CO3
(61 mg, 0.19 mmol) in seal tube, the reaction mixture was heated at
40 ꢀC, for 3 h, removed the solvent, and the residue was purified by
Combiflash to yield the desired compound 13a as solid: Yield 63%.
1H NMR (600 MHz, CDCl3)
d
7.25 (t, J ¼ 7.5 Hz, 2H), 7.22e7.19 (m,
3H), 6.99 (d, J ¼ 7.5 Hz, 2H), 6.94 (t, J ¼ 8.6 Hz, 2H), 5.15 (s, 2H), 4.54
12e
12f
3.8
(s, 2H), 4.09 (m, 1H), 3.29 (s, 3H), 1.20 (s, 3H), 1.19 (s, 3H).; 13C NMR
(151 MHz, CDCl3)
d 163.3, 161.8, 152.6, 146.0, 135.4, 133.2, 129.5,
0.90
129.2, 127.2, 118.9, 115.4, 115.2, 73.7, 71.0, 33.4, 27.9, 20.4. HRMS-
ESI(ꢃ) m/z calcd for C23H25FN2O3 [M ꢃ H]ꢃ 395.1777, found
395.1781.
a
Concentration of a compound inhibiting the enzymatic function by 50%.
4.1.3. Synthesis of 6-benzyl-1-(((4-fluorobenzyl)oxy)methyl)-5-
isopropyl-3-methoxypyrimidine-2,4(1H,3H)-dione (13b)
Teledyne Combiflash RF-200 with RediSep columns (silica). All
moisture sensitive reactions were performed under an inert at-
mosphere of ultra-pure argon with oven-dried glassware. 1H and
13C NMR spectra were recorded on a Varian 600 MHz spectrometer.
Mass data were acquired using an Agilent 6230 TOF LC/MS spec-
trometer. Analysis of sample purity was performed on a Varian
This compound was synthesized as solid following the synthetic
procedure of 13a except that compound 19 was used as the starting
material: Yield 53%. 1H NMR (600 MHz, CDCl3)
d
7.26 (t, J ¼ 7.5 Hz,
2H), 7.24e7.19 (m, 3H), 6.98 (d, J ¼ 7.5 Hz, 2H), 6.95 (t, J ¼ 8.7 Hz,
2H), 5.14 (s, 2H), 4.56 (s, 2H), 4.08 (s, 2H), 3.95 (s, 3H), 1.22, (s, 3H),
1.19 (s, 3H). HRMS-ESI(ꢃ) m/z calcd for C23H25FN2O4 [M ꢃ H]ꢃ
411.1726, found 411.1730.
Prepstar SD-1 HPLC system with a Phenomenex Gemini, 5 mm C18
column (250 mm ꢁ 4.6 mm). HPLC conditions: solvent A: H2O with
0.1% TFA; solvent B: MeCN; flow rate 1.0 mL/min; compounds were
eluted with a gradient of 20% MeCN/H2O with 0.1% TFA to 100%
MeCN for 20 min. All tested compounds have a purity ꢂ95%.
4.1.4. Synthesis of 5-benzyl-6-ethyl-1-(((4-fluorobenzyl)oxy)
methyl)-3-hydroxypyrimidine-2,4(1H,3H)-dione (14a)
To a solution 22 (62 mg, 0.16 mmol) in 5 mL anhydrous THF at
0 ꢀC, was added NaH (60% in mineral oil, 64 mg, 1.6 mmol), the
reaction mixture was stirred at rt for 1 h, then m-CPBA (222 mg,
1.29 mmol) was added at 0 ꢀC carefully. This reaction mixture was
allowed to warm to room temperature and stirred overnight. After
the reaction was quenched by adding 10 mL of H2O, the aqueous
4.1.2. Synthesis of 6-benzyl-1-(((4-fluorobenzyl)oxy)methyl)-5-
isopropyl-3-methylpyrimidine-2,4(1H,3H)-dione (13a)
To a solution of 6-benzyl-1-(((4-fluorobenzyl)oxy)methyl)-5-
isopropylpyrimidine-2,4(1H,3H)-dione 18 (60 mg, 0.16 mmol) and

686
L. Wang et al. / European Journal of Medicinal Chemistry 156 (2018) 680e691
Table 3
Biochemical studies of caemotype 17 against HIV RNase H and pol of RT, and INST.
a
Compound
Ar
RT RNase H IC50
(m
M)
RT pol IC50
(m
M)
INST IC50 (mM)
17a
0.016 0.0001
>10
>100
17b
17c
0.047 0.007
0.025 0.003
>10
>10
>100
>100
17d
17e
17f
17g
17h
17i
0.028 0.015
0.016 0.001
0.085 0.01
>10
>10
>10
>10
>10
>10
>10
>100
>100
>100
>100
>100
>100
>100
0.015 0.0002
0.0092 0.0008
0.0094 0.0003
0.015 0.002
17j
17k
17l
0.0076 0.0003
0.011 0.002
>10
>10
>100
>100
17m
17n
0.016 0.003
0.037 0.009
>10
>10
>100
>100
17o
0.018 0.0006
>10
>100
17p
17q
0.012 0.002
0.020 0.002
>10
>100
>100
~10
17r
0.038 0.01
>10
>100
17s
17t
38a
0.0077 0.00001
0.0088 0.0003
0.011 0.0008
>10
>10
>10
>100
>100
>100

L. Wang et al. / European Journal of Medicinal Chemistry 156 (2018) 680e691
687
Table 3 (continued )
Compound
38b
a
Ar
RT RNase H IC50
(
mM)
RT pol IC50
(
mM)
INST IC50 (mM)
0.013 0.001
>10
>100
10a
10b
0.25
0.22
2.0
NT
NT
0.99
a
Concentration of a compound inhibiting the enzymatic function by 50%, expressed as the mean þ standard deviation from at least two independent experiments.
Table 4
Antiviral activity of chemotype 17 analogues against HIV-1 in the MAGI assay.
Compd
Antiviral Profile
a
b
EC50
(mM)
CC50
(mM)
16a
17a
17b
17c
17d
17e
17f
>20
10 0.06
16
>20
12 0.2
>20
>20
>100
11 0.2
>100
>100
24 0.5
>100
3
>100
17g
17h
17i
5.6 0.3
13 0.8
15 0.06
>20
11
>100
59
>100
1
3
17j
17k
17l
11 0.6
>20
49
>100
2
17m
17n
17o
17p
17q
17r
17s
17t
38a
38b
9.6 0.2
>20
9.9 0.05
7.6 0.4
11 0.6
20 0.2
16 0.3
>100
14 0.6
27 0.5
62
>100
9
12
12
1
1
20
2
37 0.7
>20
>20
64
1
63 0.3
Fig. 3. Molecular modeling of compound 17h within the RNase H active site. Predicted
binding mode of 17h (magenta) within the active site of RNase H (PDB code: 5J1E [20]).
The p66 and p51 subunits of RT are shown in orange and gray cartoon, respectively.
Active site residues are highlighted in yellow sticks with metal ions (Mg2þ) as green
spheres. Chelating and H-bond interactions are depicted as black dotted lines. (For
interpretation of the references to colour in this figure legend, the reader is referred to
the Web version of this article.)
a
Concentration of a compound inhibiting HIV-1 replication by 50%, expressed as
the mean þ standard deviation from at least two independent experiments.
b
Concentration of a compound resulting in 50% cell death, expressed as the
mean þ standard deviation from at least two independent experiments.
phase was acidified with 1 N HCl to pH ¼ 7, and then extracted with
ethyl acetate (10 mL x 3). The combined organic extracts were dried
over Na2SO4 and concentrated under reduced pressure. The residue
was subjected to combiflash (Hexane/EtOAc, 1:1) to give the
desired compound 14a as solid: Yield 60%. 1H NMR (600 MHz,
4.1.6.1. 6-([1,10-biphenyl]-4-ylmethyl)-1-(ethoxymethyl)-3-hydroxy-
5-methylpyrimidine-2,4(1H,3H)-dione (15a). Yield 58%. 1H NMR
(600 MHz, CDCl3)
d
7.56 (d, J ¼ 7.8 Hz, 4H), 7.45 (t, J ¼ 7.8 Hz, 2H),
7.37 (t, J ¼ 7.8 Hz, 1H), 7.17 (t, J ¼ 7.8 Hz, 2H), 5.27 (s, 2H), 4.22 (s,
2H), 3.67 (q, J ¼ 6.6 Hz, 2H), 2.13 (s, 3H), 1.20 (t, J ¼ 6.6 Hz, 3H);
HRMS-ESI(ꢃ) m/z calcd for C21H20N2O4 [M ꢃ H]ꢃ 365.1508, found
365.1512.
CDCl3)
d
7.16e7.10 (m, 2H), 7.09 (d, J ¼ 23.2 Hz, 2H), 6.84 (s, 2H), 5.28
(s, 2H), 4.48 (s, 2H), 3.67 (s, 2H), 2.54 (s, 2H),1.18 (s, 2H), 0.87 (s, 4H).
HRMS-ESI(ꢃ) m/z calcd for C21H21FN2O4 [M ꢃ H]ꢃ 383.1413, found
383.1410.
4.1.6.2. 6-((30,50-dimethoxy-[1,10-biphenyl]-4-yl)methyl)-1-(ethox-
4.1.5. Synthesis of 5-ethyl-1-(((4-fluorobenzyl)oxy)methyl)-6-(4-
fluorophenyl)-3-hydroxypyrimidine-2,4(1H,3H)-dione (14b)
This compound was synthesized as solid following the synthetic
procedure of 14a except that compound 25 was used as the starting
ymethyl)-3-hydroxy-5-methylpyrimidine-2,4(1H,3H)-dione
(15b).
7.59e7.50 (d, J ¼ 7.9 Hz, 2H),
Yield 52%. 1H NMR (600 MHz, CDCl3)
d
7.15 (d, J ¼ 7.9 Hz, 2H), 6.69 (m, 2H), 6.47 (s, 1H), 5.26 (s, 2H), 4.21 (s,
2H), 3.64 (q, J ¼ 6.6 Hz, 2H), 2.12 (s, 3H), 1.21 (t, J ¼ 6.6 Hz, 3H).
HRMS-ESI(ꢃ) m/z calcd for C23H26N2O6 [M ꢃ H]ꢃ 425.1719, found
425.1721.
material: Yield 55%. 1H NMR (600 MHz, CDCl3)
d 7.18e7.11 (m, 4H),
7.09 (t, J ¼ 8.2 Hz, 2H), 6.91 (t, J ¼ 8.4 Hz, 2H), 4.92 (s, 2H), 4.44 (s,
2H), 2.05e1.96 (m, 1H), 0.83 (t, J ¼ 7.2 Hz, 2H). HRMS-ESI(ꢃ) m/z
calcd for C20H18F2N2O4 [M ꢃ H]ꢃ 387.1163, found 387.1167.
4.1.6.3. 4'-((3-(ethoxymethyl)-1-hydroxy-5-methyl-2,6-dioxo-
1,2,3,6-tetrahydropyrimidin-4-yl)methyl)-[1,10-biphenyl]-4-
4.1.6. Synthesis of 15
These compounds were synthesized as solid following the
synthetic procedure of 14a except that compound 31 were used as
the starting material.
carbonitrile (15c). Yield 58%. 1H NMR (600 MHz, CDCl3)
d 7.73 (d,
J ¼ 7.8 Hz, 2H), 7.67 (m, 2H), 7.57 (m, 2H), 7.25 (m, 2H), 5.30 (s, 2H),
4.24 (s, 2H), 3.65 (q, J ¼ 6.6 Hz, 2H), 2.11 (s, 3H), 1.27 (t, J ¼ 6.6 Hz,

688
L. Wang et al. / European Journal of Medicinal Chemistry 156 (2018) 680e691
3H); HRMS-ESI(ꢃ) m/z calcd for C22H21N3O6 [M ꢃ H]ꢃ 390.1460,
4.1.10.3. 6-([1,10-biphenyl]-4-ylmethyl)-3-hydroxypyrimidine-
found 390.1465.
2,4(1H,3H)-dione (17a). Yield 42%. 1H NMR (600 MHz, DMSO‑d6)
d
11.38 (s, 1H), 10.29 (s, 1H), 7.64e7.61 (m, 4H), 7.45e7.43 (m, 2H),
7.40 (d, J ¼ 8.0 Hz, 2H), 7.34 (t, J ¼ 7.4 Hz, 1H), 5.44 (s, 1H), 3.67 (s,
2H); 13C NMR (150 MHz, DMSO‑d6)
160.7, 152.9, 150.2, 140.2,
4.1.7. Synthesis of 6-([1,10-biphenyl]-4-ylmethyl)-1-
d
(ethoxymethyl)-3-hydroxypyrimidine-2,4(1H,3H)-dione (16a)
To a microwave reaction vessel were added compound 37a
(36 mg, 0.1 mmol), phenylboronic acid (2 equiv), Pd(PPh3)4 (5 mol
%), K2CO3 (2 equiv) and MeOH/H2O (9/1, 2 mL). The reaction
mixture was irradiated under argon at 120 ꢀC for the appropriate
time. The reaction mixture was then concentrated and the residue
was extract with DCM, washed by H2O and dried over Na2SO4. The
organic layer was concentrated and the residue was purified by
Combiflash (MeOH/DCM, 1%e3%) to give product 16a as solid: Yield
139.4,135.9, 130.0,129.4, 127.9, 127.3, 127.1, 98.9, 37.3; HRMS-ESI(ꢃ)
m/z calcd for C17H14N2O3 [M ꢃ H]ꢃ 293.0932, found 293.0939.
4.1.10.4. 3-Hydroxy-6-((4'-(trifluoromethyl)-[1,10-biphenyl]-4-yl)
methyl)pyrimidine-2,4(1H,3H)-dione (17b). Yield 31%. 1H NMR
(600 MHz, DMSO‑d6)
d
11.41 (s, 1H), 10.30 (s, 1H), 7.88 (d, J ¼ 8.2 Hz,
2H), 7.80 (d, J ¼ 8.3 Hz, 2H), 7.71 (d, J ¼ 8.0 Hz, 2H), 7.46 (d,
J ¼ 8.0 Hz, 2H), 5.45 (s, 1H), 3.70 (s, 2H); HRMS-ESI(ꢃ) m/z calcd for
18H13F3N2O3 [M ꢃ H]ꢃ 361.0806, found 361.0809.
53%. 1H NMR (600 MHz, CDCl3)
d 7.58e7.54 (m, 4H), 7.46e7.44 (m,
C
2H), 7.36 (t, J ¼ 7.2 Hz, 1H), 7.25 (d, J ¼ 7.8 Hz, 2H), 5.63 (s, 1H), 5.36
(s, 2H), 4.04 (s, 2H), 3.67 (q, J ¼ 7.1 Hz, 2H), 1.23 (t, J ¼ 7.1 Hz, 3H);
HRMS-ESI(ꢃ) m/z calcd for C20H20N2O4 [M ꢃ H]ꢃ 351.1350, found
351.1342.
4.1.10.5. 3-Hydroxy-6-((3'-(trifluoromethyl)-[1,10-biphenyl]-4-yl)
methyl)pyrimidine-2,4(1H,3H)-dione (17c). Yield 35%. 1H NMR
(600 MHz, CD3OD)
d 7.89e7.88 (m, 2H), 7.67e7.63 (m, 4H), 7.42 (d,
J ¼ 8.1 Hz, 2H), 5.49 (s, 1H), 3.79 (s, 2H); HRMS-ESI(ꢃ) m/z calcd for
C
18H13F3N2O3 [M ꢃ H]ꢃ 361.0806, found 361.0806.
4.1.8. Synthesis of 1-(ethoxymethyl)-3-hydroxy-6-((4'-
(trifluoromethyl)-[1,10-biphenyl]-4-yl)methyl)pyrimidine-
2,4(1H,3H)-dione (16b)
4.1.10.6. 6-((30-fluoro-[1,10-biphenyl]-4-yl)methyl)-3-
hydroxypyrimidine-2,4(1H,3H)-dione (17d). Yield 49%. 1H NMR
This compound was synthesized following the synthetic pro-
cedure of 16a: Yield 56%. 1H NMR (600 MHz, CDCl3)
d 7.71 (d,
(600 MHz, CD3OD)
7.29e7.25 (m, 3H), 6.99e6.95 (m, 1H), 5.38 (s, 1H), 3.68 (s, 2H); 13
NMR (150 MHz, CD3OD)
150.3, 142.9 (d, JCF ¼ 7.7 Hz), 138.9 (d, JCF ¼ 2.1 Hz), 135.0, 130.2 (d,
JCF ¼ 8.5 Hz), 129.3, 127.1, 122.3 (d, JCF ¼ 2.3 Hz), 113.6 (d,
JCF ¼ 21.4 Hz), 113.1 (d, JCF ¼ 21.8 Hz), 98.7, 37.2; HRMS-ESI(ꢃ) m/z
calcd for C17H13FN2O3 [M ꢃ H]ꢃ 311.0837, found 311.0835.
d
7.53 (d, J ¼ 8.2 Hz, 2H), 7.35e7.34 (m, 2H),
C
J ¼ 8.5 Hz, 2H), 7.67 (d, J ¼ 8.3 Hz, 2H), 7.59 (d, J ¼ 8.1 Hz, 2H), 7.29
(d, J ¼ 8.1 Hz, 2H), 5.62 (s, 1H), 5.37 (s, 2H), 4.07 (s, 2H), 3.68 (q,
J ¼ 7.0 Hz, 2H), 1.23 (t, J ¼ 7.0 Hz, 3H); 13C NMR (150 MHz, CDCl3)
d
163.3 (d, JCF ¼ 244.3 Hz), 161.8, 153.4,
d
158.2, 153.1, 148.7, 143.8, 139.4, 134.2, 129.5, 128.1, 127.3, 125.8 (q,
JCF ¼ 3.8 Hz), 124.2 (d, JCF ¼ 272.4 Hz), 101.9, 73.5, 65.5, 37.2, 15.0;
HRMS-ESI(ꢃ) m/z calcd for C21H19F3N2O4 [M ꢃ H]ꢃ 419.1224, found
419.1226.
4.1.10.7. 6-((30-chloro-[1,10-biphenyl]-4-yl)methyl)-3-
hydroxypyrimidine-2,4(1H,3H)-dione (17e). Yield 60%. 1H NMR
4.1.9. Synthesis of 6-((40-chloro-30-fluoro-[1,10-biphenyl]-4-yl)
methyl)-1-(ethoxymethyl)-3-hydroxypyrimidine-2,4(1H,3H)-dione
(16i)
(600 MHz, DMSO‑d6)
d 11.40 (s, 1H), 10.29 (s, 1H), 7.70 (s, 1H), 7.66
(d, J ¼ 8.0 Hz, 2H), 7.62 (d, J ¼ 7.7 Hz, 1H), 7.47 (t, J ¼ 7.8 Hz, 1H),
7.42e7.40 (m, 3H), 5.44 (s, 1H), 3.68 (s, 2H); 13C NMR (150 MHz,
This compound was synthesized following the synthetic pro-
DMSO‑d6) d 160.7, 152.8, 150.2, 142.4, 137.8, 136.7, 134.2, 131.2, 130.1,
cedure of 16a: Yield 73%. 1H NMR (600 MHz, CDCl3)
d 7.54 (d,
127.7, 127.5, 126.8, 125.8, 98.9, 37.3; HRMS-ESI(ꢃ) m/z calcd for
J ¼ 8.2 Hz, 2H), 7.47 (t, J ¼ 7.9 Hz, 1H), 7.35 (d, J ¼ 8.2 Hz, 1H),
7.31e7.27 (m, 3H), 5.63 (s, 1H), 5.37 (s, 2H), 4.07 (s, 2H), 3.69 (q,
J ¼ 7.0 Hz, 2H), 1.24 (t, J ¼ 7.0 Hz, 3H); HRMS-ESI(ꢃ) m/z calcd for
C
17H13ClN2O3 [M ꢃ H]ꢃ 327.0542, found 327.0548.
4.1.10.8. 6-((20,40-bis(trifluoromethyl)-[1,10-biphenyl]-4-yl)methyl)-
3-hydroxypyrimidine-2,4(1H,3H)-dione (17f). Yield 32%. 1H NMR
C
20H18ClFN2O4 [M ꢃ H]ꢃ 403.0866, found 403.0862.
(600 MHz, CD3OD)
d
8.05 (s, 1H), 7.98 (d, J ¼ 8.0 Hz, 1H), 7.61 (d,
4.1.10. General procedure for synthesis of 38 and 17
J ¼ 8.0 Hz, 1H), 7.40 (d, J ¼ 8.1 Hz, 2H), 7.36 (d, J ¼ 8.0 Hz, 2H), 5.49
(s, 1H), 3.82 (s, 2H); HRMS-ESI(ꢃ) m/z calcd for C19H12F6N2O3 [M ꢃ
H]ꢃ 429.0679, found 429.0675.
To a microwave reaction vessel were added compound 37 or 16
(25 mg) and TFA (2e3 mL). The reaction vessel was irradiated at
120 ꢀC for the appropriate time. The reaction was monitored by TLC
and MS. The reaction mixture was then concentrated under vacuo
and the crude product was purified by Combiflash (MeOH/DCM,
1%e5%) or trituration with MeOH, ethyl acetate, and DCM to yield
desired compounds as solid.
4.1.10.9. 6-((20,40-difluoro-[1,10-biphenyl]-4-yl)methyl)-3-
hydroxypyrimidine-2,4(1H,3H)-dione (17g). Yield 30%. 1H NMR
(600 MHz, CD3OD)
d
7.51e7.48 (m, 3H), 7.38 (d, J ¼ 7.9 Hz, 2H),
7.05e7.02 (m, 2H), 5.48 (s, 1H), 3.78 (s, 2H); HRMS-ESI(ꢃ) m/z calcd
for C17H12F2N2O3 [M ꢃ H]ꢃ 329.0743, found 329.0744.
4.1.10.1. 6-(4-Bromobenzyl)-3-hydroxypyrimidine-2,4(1H,3H)-dione
(38a). Yield 42%. 1H NMR (600 MHz, CD3OD)
d
7.50 (d, J ¼ 8.1 Hz,
4.1.10.10. 6-((20,40-dichloro-[1,10-biphenyl]-4-yl)methyl)-3-
2H), 7.21 (d, J ¼ 8.1 Hz, 2H), 5.43 (s, 1H), 3.70 (s, 2H). 13C NMR
hydroxypyrimidine-2,4(1H,3H)-dione (17h). Yield 49%. 1H NMR
(150 MHz, CD3OD)
d 161.7, 152.9, 150.2, 134.5, 131.6, 130.7, 120.9,
(600 MHz, CD3OD)
(m, 4H), 5.49 (s, 1H), 3.79 (s, 2H); 13C NMR (150 MHz, CD3OD)
161.8, 153.3, 150.3, 138.73, 137.4, 135.1, 133.6, 132.9, 132.1, 129.5,
d
7.56 (s, 1H), 7.42 (d, J ¼ 8.2 Hz, 2H), 7.38e7.35
98.8, 36.9; HRMS-ESI(ꢃ) m/z calcd for C11H9BrN2O3 [M ꢃ H]ꢃ
294.9724, found 294.9720.
d
129.1, 128.6, 127.1, 98.8, 37.3; HRMS-ESI(ꢃ) m/z calcd for
4.1.10.2. 6-(3-Bromobenzyl)-3-hydroxypyrimidine-2,4(1H,3H)-dione
C
17H12Cl2N2O3 [M ꢃ H]ꢃ 361.0152, found 361.0157.
(38b). Yield 51%. 1H NMR (600 MHz, CD3OD)
d
7.49e7.45 (m, 2H),
7.29e7.27 (m, 2H), 5.46 (s, 1H), 3.72 (s, 2H); 13C NMR (150 MHz,
4.1.10.11. 6-((40-chloro-30-fluoro-[1,10-biphenyl]-4-yl)methyl)-3-
hydroxypyrimidine-2,4(1H,3H)-dione (17i). Yield 41%. 1H NMR
CD3OD)
d 161.7, 152.8, 150.2, 137.8, 131.7, 130.3, 130.2, 127.5, 122.3,
98.8, 37.0; HRMS-ESI(ꢃ) m/z calcd for C11H9BrN2O3 [M ꢃ H]ꢃ
(600 MHz, CD3OD)
(d, J ¼ 8.5 Hz, 1H), 7.39 (d, J ¼ 8.0 Hz, 2H), 5.47 (s, 1H), 3.78 (s, 2H);
d
7.63 (d, J ¼ 8.0 Hz, 2H), 7.54e7.51 (m, 2H), 7.45
294.9724, found 294.9726.

L. Wang et al. / European Journal of Medicinal Chemistry 156 (2018) 680e691
689
13C NMR (150 MHz, CD3OD)
d
161.8, 158.2 (d, JCF ¼ 247.2 Hz), 153.3,
DMSO‑d6) d 160.7,152.9,150.2,139.5,139.1,137.5,132.9,129.8,129.4,
150.3, 141.5 (d, JCF ¼ 7.0 Hz), 137.8 (d, JCF ¼ 1.8 Hz), 135.4, 130.6,
129.5, 127.0, 123.2 (d, JCF ¼ 3.2 Hz), 119.3 (d, JCF ¼ 17.6 Hz), 114.5 (d,
JCF ¼ 22.0 Hz), 98.7, 37.2; HRMS-ESI(ꢃ) m/z calcd for C17H12ClFN2O3
[M ꢃ H]ꢃ 345.0448, found 345.0448.
128.9, 128.8, 128.0, 125.8, 98.9, 37.8; HRMS-ESI(ꢃ) m/z calcd for
C
17H13ClN2O3 [M ꢃ H]ꢃ 327.0542, found 327.0543.
4.1.10.19. 6-((30-chloro-[1,10-biphenyl]-3-yl)methyl)-3-
hydroxypyrimidine-2,4(1H,3H)-dione (17q). Yield 48%. 1H NMR
4.1.10.12. 6-((30-chloro-5'-(trifluoromethyl)-[1,10-biphenyl]-4-yl)
methyl)-3-hydroxypyrimidine-2,4(1H,3H)-dione (17j). Yield 55%. 1H
(600 MHz, CD3OD)
2H), 7.35 (d, J ¼ 7.9 Hz, 1H), 7.31 (d, J ¼ 7.5 Hz, 1H), 5.50 (s, 1H), 3.80
(s, 2H); 13C NMR (150 MHz, CD3OD)
161.8, 153.5, 150.3, 142.6,
d 7.63 (s, 1H), 7.56e7.54 (m, 3H), 7.47e7.41 (m,
NMR (600 MHz, CD3OD)
d 7.92 (s, 1H), 7.83 (s, 1H), 7.68e7.67 (m,
d
3H), 7.43 (d, J ¼ 7.8 Hz, 2H), 5.49 (s, 1H), 3.80 (s, 2H); 13C NMR
140.2,136.1,134.4,130.0,129.2,128.2,127.5,127.1,126.6,125.8,125.1,
98.7, 37.6; HRMS-ESI(ꢃ) m/z calcd for C17H13ClN2O3 [M ꢃ H]ꢃ
327.0542, found 327.0548.
(150 MHz, CD3OD)
d 161.8, 153.1, 150.3, 143.6, 137.2, 136.1, 135.3,
132.4 (q, JCF ¼ 32.8 Hz), 130.2, 129.6, 127.3, 123.7, 123.4 (q,
JCF ¼ 272.1 Hz), 121.7 (q, JCF ¼ 3.8 Hz), 98.8, 37.2; HRMS-ESI(ꢃ) m/z
calcd for C18H12ClF3N2O3 [M ꢃ H]ꢃ 395.0416, found 395.0414.
4.1.10.20. 6-((30-chloro-5'-(trifluoromethyl)-[1,10-biphenyl]-3-yl)
methyl)-3-hydroxypyrimidine-2,4(1H,3H)-dione (17r). Yield 52%. 1H
4.1.10.13. 6-((30-fluoro-40-methoxy-[1,10-biphenyl]-4-yl)methyl)-3-
hydroxypyrimidine-2,4(1H,3H)-dione (17k). Yield 40%. 1H NMR
NMR (600 MHz, CD3OD)
7.53e7.51 (m, 2H), 7.41 (t, J ¼ 7.7 Hz,1H), 7.28 (d, J ¼ 7.6 Hz,1H), 5.42
(s,1H), 3.73 (s, 2H); 13C NMR (150 MHz, CD3OD)
161.8,153.3,150.3,
d 7.83 (s, 1H), 7.75 (s, 1H), 7.59 (s, 1H),
(600 MHz, CD3OD)
(d, J ¼ 8.0 Hz, 2H), 7.15 (t, J ¼ 8.5 Hz, 1H), 5.46 (s, 1H), 3.90 (s, 3H),
3.75 (s, 2H); 13C NMR (150 MHz, CD3OD)
161.8, 153.5, 152.5 (d,
d
7.57 (d, J ¼ 8.0 Hz, 2H), 7.38e7.36 (m, 2H), 7.34
d
143.7, 138.7, 136.4, 135.3, 132.4 (q, JCF ¼ 32.9 Hz), 130.4, 129.5, 129.0,
127.8, 126.0, 123.8, 123.4 (q, JCF ¼ 272.70 Hz), 121.8 (q, JCF ¼ 3.7 Hz),
98.7, 37.5; HRMS-ESI(ꢃ) m/z calcd for C18H12ClF3N2O3 [M ꢃ H]ꢃ
395.0416, found 395.0415.
d
J ¼ 244.7 Hz), 150.3, 147.2 (d, J ¼ 10.9 Hz), 138.8 (d, J ¼ 1.5 Hz), 134.1,
133.6 (d, J ¼ 6.4 Hz), 129.3, 126.6, 122.3, 113.9 (d, J ¼ 21.7 Hz), 113.6,
98.7, 55.3, 37.2; HRMS-ESI(ꢃ) m/z calcd for C18H15FN2O4 [M ꢃ H]ꢃ
341.0943, found 341.0948.
4.1.10.21. 6-((30-fluoro-40-methoxy-[1,10-biphenyl]-3-yl)methyl)-3-
hydroxypyrimidine-2,4(1H,3H)-dione (17s). Yield 35%. 1H NMR
4.1.10.14. 6-((40-fluoro-30-methyl-[1,10-biphenyl]-4-yl)methyl)-3-
hydroxypyrimidine-2,4(1H,3H)-dione (17l). Yield 39%. 1H NMR
(600 MHz, CD3OD)
J ¼ 7.6 Hz, 1H), 7.16 (t, J ¼ 8.5 Hz, 1H), 5.48 (s, 1H), 3.90 (s, 3H), 3.79
(s, 2H); 13C NMR (150 MHz, CD3OD)
161.8, 153.6, 152.5 (d,
d 7.52e7.51 (m, 2H), 7.43e7.37 (m, 3H), 7.24 (d,
(600 MHz, CD3OD)
(d, J ¼ 8.0 Hz, 2H), 7.07 (t, J ¼ 9.0 Hz, 1H), 5.47 (s, 1H), 3.76 (s, 2H),
2.32 (s, 3H); 13C NMR (150 MHz, CD3OD)
161.8, 161.0 (d,
d
7.57 (d, J ¼ 8.0 Hz, 2H), 7.48e7.40 (s, 2H), 7.34
d
JCF ¼ 245.0 Hz), 150.3, 147.3 (d, JCF ¼ 10.9 Hz), 140.3, 135.9, 133.7 (d,
JCF ¼ 6.5 Hz), 129.1, 127.5, 127.0, 125.3, 122.4, 114.0 (d, JCF ¼ 18.7 Hz),
113.6, 98.7, 55.3, 37.6; HRMS-ESI(ꢃ) m/z calcd for C18H15FN2O4 [M ꢃ
H]ꢃ 341.0943, found 341.0947.
d
JCF ¼ 243.5 Hz), 153.6, 150.3, 139.5, 136.5 (d, JCF ¼ 3.6 Hz), 134.1,
129.7 (d, JCF ¼ 4.9 Hz), 129.2, 126.9, 125.6 (d, JCF ¼ 8.1 Hz), 124.8 (d,
JCF ¼ 17.6 Hz), 114.7 (d, JCF ¼ 22.7 Hz), 98.6, 37.2, 13.1; HRMS-ESI(ꢃ)
m/z calcd for C18H15FN2O3 [M ꢃ H]ꢃ 325.0994, found 325.0996.
4.1.10.22. 6-((40-fluoro-30-methyl-[1,10-biphenyl]-3-yl)methyl)-3-
hydroxypyrimidine-2,4(1H,3H)-dione (17t). Yield 40%. 1H NMR
4.1.10.15. 6-([1,10-biphenyl]-3-ylmethyl)-3-hydroxypyrimidine-
2,4(1H,3H)-dione (17m). Yield 51%. 1H NMR (600 MHz, CD3OD)
(600 MHz, CD3OD)
7.43e7.41 (m, 2H), 7.25 (d, J ¼ 7.6 Hz, 1H), 7.10e7.07 (m, 1H), 5.48 (s,
1H), 3.79 (s, 2H), 2.32 (s, 3H); 13C NMR (150 MHz, CD3OD)
161.8,
d
7.52e7.51 (m, 2H), 7.48 (d, J ¼ 7.3 Hz, 1H),
d
7.60 (d, J ¼ 7.6 Hz, 2H), 7.56e7.54 (m, 2H), 7.45e7.42 (m, 3H), 7.33
(t, J ¼ 7.4 Hz,1H), 7.27 (d, J ¼ 7.5 Hz,1H), 5.50 (s,1H), 3.80 (s, 2H); 13
C
d
161.1 (d, JCF ¼ 244.1 Hz), 153.6, 150.3, 140.9, 136.6 (d, JCF ¼ 3.5 Hz),
135.8, 129.8 (d, JCF ¼ 2.6 Hz), 129.0, 127.5, 127.4, 125.7 (d,
JCF ¼ 8.2 Hz), 125.7, 124.8 (d, JCF ¼ 17.4 Hz), 114.8 (d, JCF ¼ 22.7 Hz),
98.6, 37.6, 13.1; HRMS-ESI(ꢃ) m/z calcd for C18H15FN2O3 [M ꢃ H]ꢃ
325.0994, found 325.0999.
NMR (150 MHz, CD3OD)
d 161.9, 153.6, 150.4, 141.8, 140.6, 135.8,
129.0,128.5,127.5,127.4,127.1,126.6,125.8, 98.6, 37.6; HRMS-ESI(ꢃ)
m/z calcd for C17H14N2O3 [M ꢃ H]ꢃ 293.0932, found 293.0940.
4.1.10.16. 3-Hydroxy-6-((3'-(trifluoromethyl)-[1,10-biphenyl]-3-yl)
methyl)pyrimidine-2,4(1H,3H)-dione (17n). Yield 39%. 1H NMR
4.2. Biology
(600 MHz, CD3OD)
d 7.89 (s, 2H), 7.65e7.60 (m, 4H), 7.49 (t,
J ¼ 7.9 Hz, 1H), 7.34 (d, J ¼ 7.6 Hz, 1H), 5.51 (s, 1H), 3.82 (s, 2H);
HRMS-ESI(ꢃ) m/z calcd for C18H13F3N2O3 [M ꢃ H]ꢃ 361.0806, found
361.0804.
4.2.1. Reagents
Biologicals. Recombinant HIV-1 reverse transcriptase (RT) was
expressed and purified as previously described [32]. P4R5 HIV
infection indicator cells were obtained from the NIH AIDS Reagent
Program, Division of AIDS, NIAID, NIH (p4R5.MAGI from Dr.
Nathaniel Landau). These cells express CD4, CXCR4 and CCR5 as
4.1.10.17. 6-((30-fluoro-[1,10-biphenyl]-3-yl)methyl)-3-
hydroxypyrimidine-2,4(1H,3H)-dione (17o). Yield 43%. 1H NMR
(600 MHz, CD3OD)
J ¼ 7.6 Hz, 1H), 7.30 (d, J ¼ 7.6 Hz, 1H), 7.09e7.06 (m, 1H), 5.49 (s,
1H), 3.80 (s, 2H); 13C NMR (150 MHz, CD3OD)
163.2 (d,
d 7.57e7.56 (m, 2H), 7.47e7.44 (m, 3H), 7.36 (d,
well as a b-galactosidase reporter gene under the control of an HIV
LTR promoter.
d
Chemicals. DNA and RNA oligonucleotides for the preparation of
RNA/DNA duplexes for assay of RNase H activity were purchased
from Trilink (San Diego, CA).
JCF ¼ 244.4 Hz), 161.8, 153.5, 150.3, 143.0 (d, JCF ¼ 7.6 Hz), 140.4,
136.0, 130.2 (d, JCF ¼ 8.3 Hz), 129.2, 128.2, 127.5, 125.8, 122.5, 113.7
(d, JCF ¼ 21.2 Hz), 113.26 (d, JCF ¼ 22.6 Hz), 98.7, 37.6; HRMS-ESI(ꢃ)
m/z calcd for C17H13FN2O3 [M ꢃ H]ꢃ 311.0837, found 311.0843.
4.2.2. RNase H assay
4.1.10.18. 6-((40-chloro-[1,10-biphenyl]-3-yl)methyl)-3-
RNase H activity was measured essentially as previously
hydroxypyrimidine-2,4(1H,3H)-dione (17p). Yield 47%. 1H NMR
described [33]. RNA/DNA duplex substrate HTS-1 (RNA 50-gaucu-
gagccugggagcu -30-fluorescein annealed to DNA 30-CTA-
GACTCGGACCCTCGA -50-Dabcyl) is a high sensitivity duplex that
assesses non-specific internal cleavage.
(600 MHz, DMSO‑d6) d 11.38 (s,1H), 10.29 (s,1H), 7.69e7.66 (m, 3H),
7.57 (d, J ¼ 7.6 Hz, 1H), 7.52 (d, J ¼ 8.5 Hz, 2H), 7.43 (t, J ¼ 7.6 Hz, 1H),
7.33 (d, J ¼ 7.4 Hz, 1H), 5.47 (s, 1H), 3.70 (s, 2H); 13C NMR (150 MHz,

690
L. Wang et al. / European Journal of Medicinal Chemistry 156 (2018) 680e691
4.2.3. RT polymerase assay
4.2.6. Cytotoxicity
RT pol assays [34e37] were carried out in 96-well plates by
measuring the extension of an 18 nucleotide DNA primer (50-
GTCACTGTTCGAGCACCA-30) annealed to a 100 nucleotide DNA
template (50-ATGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGA-
GATCCCTCAGACCCTTTTAGTCAGTGTGGAATATCTCA-
For cytotoxicity assays, P4R5 cells were cultured in 96-well
microplates with 4 ꢁ 103 cells per well and maintained in DMEM/
10% FBS supplemented with puromycin (1 mg/mL). Cells were
incubated with either 1% DMSO or varying concentrations of
compounds for 72 h and then assessed with the Cell Proliferation
Kit II (XTT) (Roche) according to the manufacturer's instructions.
TAGCTTGGTGCTCGAACAGTGAC-30). Reactions containing 20 nM RT,
40 nM template/primer, and 10 mM deoxynucleotide triphosphates
(dNTPs) in a buffer containing 50 mM Tris (pH 7.8) and 50 mM NaCl
were initiated by the addition of 6 mM MgCl2. Reactions contained
1% DMSO and increasing concentrations of compounds. DNA syn-
thesis was carried out for 30 min at 37 ꢀC, and reactions were
arrested by the addition of 100 mM EDTA. The QuantiFluor dsDNA
System (Promega) was used to quantify the amount of formed
double-stranded DNA. Reactions were read at ex/em 504/531 nm in
4.2.7. Molecular modeling and docking analysis
€
Molecular modeling was performed using the Schrodinger small
molecule drug discovery suite 2014-3. The crystal structure of a
hydroxypyridone carboxylic acid active-site RNase H inhibitor in
complex with HIV Reverse Transcriptase was extracted from the
Protein Data Bank (PDB code 5J1E) as reported by Kankanala et al.
[20] Analysis on the above structure revealed that the native ligand,
hydroxypyridone carboxylic acid, is bound to the active site of
RNase H. This model was subjected to Protein Preparation Wizard
a
PerkinElmer EnSpire Multilabel plate reader. Results were
analyzed using Prism software (GraphPad Software, San Diego, CA)
for nonlinear regression to fit dose-response data to logistic curve
models.
€
(Schrodinger Inc.) [41,42] in which missing hydrogens atoms were
added, zero-order bonds to metals were created followed by the
generation of metal binding states. The structure of protein was
minimized using OPLS 2005 force field [43] to optimize hydrogen
bonding network and converge heavy atoms to an rmsd of 0.3 Å.
The processed model indicates that the interaction between the
hydroxypyridone carboxylic acid and RNase H is mediated by two
metal cations (Mg2þ) coordinated by the active site residues D443,
E478, D498, and D549. The receptor grid generation tool in Maestro
4.2.4. HIV IN assay
HIV integrase was expressed and purified as previously reported
[38]. Inhibition assays were performed using a modified protocol of
our reported method [38]. Briefly, 2.1 mL of compound suspended in
DMSO was placed in duplicate into a Black 96 well non-binding
plate (corning 3991). Compounds were plated in duplicate to a
final concentration of 0.13e100
186.9 L of reaction mixture without DNA substrate was added
(10 mM HEPES pH 7.5, 10% glycerol w/v, 10 mM MnCl2, 1 mM DTT,
M integrase). The enzyme was incubated with inhibitor for
10 min at 25 ꢀC after which the reaction was initiated by the addi-
mM. To each well of the plate
€
m
(Schrodinger Inc.) was used to define an active site around the
native ligand to cover all the residues within 14 Å from it with both
the metal cofactors (Mg2þ) as a constraint to identify the chelating
triad during docking.
Compound 17h was drawn using Maestro and subjected to Lig
Prep [44] to generate conformers, possible protonation at pH of
1
m
tion of 21
m
L of 500 nM oligo (50 biotin ATGTGGAAAATCTCTAGCA
annealed with ACTGCTAGAGATTTTCCACAT 30 Cy5). Reactions were
incubated at 37 ꢀC for 30 min and then quenched by the addition of
7
3, and metal binding states that serve as an input for docking
5.2
m
L 500 mM EDTA. Each reaction was moved (200
m
L) to a
process. All dockings were performed using Glide XP (Glide, version
6.4) [30,31] with both the Mg2þ metal cofactors as a constraint. The
van der Waals radii of nonpolar atoms for each of the ligands were
scaled by a factor of 0.8. The predicted binding mode of compound
17h features the critical interaction between the chelating triad and
to the divalent metal cofactors. The ligand within the active site of
RNase H was further refined post docking by minimizing under
implicit solvent to account for the local protein flexibility.
MultiScreen HTS PCR plate (Millipore MSSLBPC10) containing 20
mL
streptavidin agarose beads (Life Technologies S951) and incubated
with shaking for 30 min. A vacuum manifold was used to remove
the reaction mixture and the beads were similarly washed 3 times
with wash buffer (0.05% SDS, 1 mM EDTA in PBS). The plates were
further washed 3 times with 200 mL 50 mM NaOH to denature DNA
not covalently linked to the biotin modification. For each denatur-
ation step the plate was incubated with shaking at 25 ꢀC for 5 min
and the NaOH was removed by centrifugation at 1000g for 1 min.
The reaction products were eluted from the beads by the addition
Acknowledgements
of 150 m
L formamide. The plate was incubated at 25 ꢀC for 10 min
and read directly at 635/675 in a SpectraMax i3 plate reader (Mo-
lecular Devices).
This research was supported by the National Institutes of Health
(AI100890 to SGS, MAP and ZW) and partially by the Center for
Drug Design, University of Minnesota.
4.2.5. Antiviral assays
Antiviral MAGI assays were carried out using P4R5 indicator
cells essentially as previously described [39]. P4R5 cells were
cultured in 96-well microplates 4 ꢁ 103 cells per well and main-
Abbreviations
tained in DMEM/10% FBS supplemented with puromycin (1
mg/mL).
HIV
RT
human immunodeficiency virus
reverse transcriptase
Cells were incubated with either 1% DMSO or varying concentra-
tions of the drugs for 24 h and then exposed to HIV-1 (MOI of 1.25)
followed by an additional incubation period of 48 h. The extent of
RNase H ribonuclease H
HPD
pol
3-hydroxypyrimidine-2,4-dione
polymerase
infection was assessed using a fluorescence-based
b-galactosidase
detection assay, as previously described with minor modifications
[40]. After the 48 h incubation period, cells were lysed and 4-
methylumbelliferylgalactoside (MUG) substrate was added. The
INST
PR
NRTIs
NNRTIs
HID
integrase strand transfer
protease
nucleoside RT inhibitors
nonnucleoside RT inhibitors
2-hydroxyisoquinolinedione
diketoacid; HPCA, hydroxypyridonecarboxylic acid;
SAR, structure-activity-relationship
b-galactosidase produced during infection acts on the MUG sub-
strate and yields a fluorescent product, 4-methylumbelliferone (4-
MU), that could be detected fluorimetrically with excitation
wavelength 365 nm and emission wavelength 446 nm.
DKA

L. Wang et al. / European Journal of Medicinal Chemistry 156 (2018) 680e691
associated RNase H, J. Med. Chem. 59 (2016) 5051e5062.
691
Appendix A. Supplementary data
[21] J. Tang, F. Liu, E. Nagy, L. Miller, K.A. Kirby, D.J. Wilson, B.L. Wu, S.G. Sarafianos,
M.A. Parniak, Z. Wang, 3-Hydroxypyrimidine-2,4-diones as selective active
site inhibitors of HIV reverse transcriptase-associated RNase H: design, syn-
thesis, and biochemical evaluations, J. Med. Chem. 59 (2016) 2648e2659.
[22] J. Tang, K. Maddali, C.D. Dreis, Y.Y. Sham, R. Vince, Y. Pommier, Z. Wang, N-3
hydroxylation of pyrimidine-2,4-diones yields dual inhibitors of HIV reverse
transcriptase and integrase, ACS Med. Chem. Lett. 2 (2011) 63e67.
[23] J. Tang, K. Maddali, M. Metifiot, Y.Y. Sham, R. Vince, Y. Pommier, Z.Q. Wang, 3-
Hydroxypyrimidine-2,4-diones as an inhibitor scaffold of HIV integrase,
J. Med. Chem. 54 (2011) 2282e2292.
Supplementary data related to this article can be found at
https://doi.org/10.1016/j.ejmech.2018.07.035.
References
[1] T. Cihlar, M. Fordyce, Current status and prospects of HIV treatment, Curr.
Opin. Virol. 18 (2016) 50e56.
[2] S.G. Sarafianos, B. Marchand, K. Das, D.M. Himmel, M.A. Parniak, S.H. Hughes,
E. Arnold, Structure and function of HIV-1 reverse transcriptase: molecular
mechanisms of polymerization and inhibition, J. Mol. Biol. 385 (2009)
693e713.
[24] A.L. Hopkins, J.S. Ren, H. Tanaka, M. Baba, M. Okamato, D.I. Stuart,
D.K. Stammers, Design of MKC-442 (emivirine) analogues with improved
activity against drug-resistant HIV mutants, J. Med. Chem. 42 (1999)
4500e4505.
[3] T. Cihlar, A.S. Ray, Nucleoside and nucleotide HIV reverse transcriptase in-
hibitors: 25 years after zidovudine, Antivir. Res. 85 (2010) 39e58.
[4] M.P. de Bethune, Non-nucleoside reverse transcriptase inhibitors (NNRTIs),
their discovery, development, and use in the treatment of HIV-1 infection: a
review of the last 20 years (1989-2009), Antivir. Res. 85 (2010) 75e90.
[5] G.L. Beilhartz, M. Gotte, HIV-1 ribonuclease H: structure, catalytic mechanism
and inhibitors, Viruses 2 (2010) 900e926.
[25] D.B. Kireev, J.R. Chretien, D.S. Grierson, C. Monneret, A 3D QSAR study of a
series of HEPT analogues: the influence of conformational mobility on HIV-1
reverse transcriptase inhibition, J. Med. Chem. 40 (1997) 4257e4264.
[26] N. Miyaura, A. Suzuki, Palladium-catalyzed cross-coupling reactions of orga-
noboron compounds, Chem. Rev. 95 (1995) 2457e2483.
[27] J. Cason, K.L. Rinehart, S.D. Thornton, The preparation of beta-keto esters from
nitriles and alpha-bromoesters, J. Org. Chem. 18 (1953) 1594e1600.
[28] R.J. Clay, T.A. Collom, G.L. Karrick, J. Wemple, A safe, economical method for
the preparation of beta-oxo esters, Synthesis (1993) 290e292.
[6] M. Tisdale, T. Schulze, B.A. Larder, K. Moelling, Mutations within the RNase H
domain of human immunodeficiency virus type
abolish virus infectivity, J. Gen. Virol. 72 (1991) 59e66.
[7] L. Cao, W. Song, E. De Clercq, P. Zhan, X. Liu, Recent progress in the research of
1 reverse transcriptase
[29] K. Danel, E. Larsen, E.B. Pedersen, Easy synthesis of 5,6-disubstituted acy-
clouridine derivatives, Synthesis (1995) 934e936.
€
small molecule HIV-1 RNase
H inhibitors, Curr. Med. Chem. 21 (2014)
[30] Small-Molecule Drug Discovery Suite 2014-3, Glide, Version 6.4, Schrodinger,
1956e1967.
LLC, New York, 2014.
[8] K. Klumpp, J.Q. Hang, S. Rajendran, Y.L. Yang, A. Derosier, P.W.K. In,
H. Overton, K.E.B. Parkes, N. Cammack, J.A. Martin, Two-metal ion mechanism
of RNA cleavage by HIV RNase H and mechanism-based design of selective
HIV RNase H inhibitors, Nucleic Acids Res. 31 (2003) 6852e6859.
[31] R.A. Friesner, R.B. Murphy, M.P. Repasky, L.L. Frye, J.R. Greenwood,
T.A. Halgren, P.C. Sanschagrin, D.T. Mainz, Extra precision glide: docking and
scoring incorporating a model of hydrophobic enclosure for protein-ligand
complexes, J. Med. Chem. 49 (2006) 6177e6196.
[9] D.M. Himmel, K.A. Maegley, T.A. Pauly, J.D. Bauman, K. Das, C. Dharia,
A.D. Clark Jr., K. Ryan, M.J. Hickey, R.A. Love, S.H. Hughes, S. Bergqvist,
E. Arnold, Structure of HIV-1 reverse transcriptase with the inhibitor beta-
[32] R.S. Fletcher, G. Holleschak, E. Nagy, D. Arion, G. Borkow, Z. Gu,
M.A. Wainberg, M.A. Parniak, Single-step purification of recombinant wild-
type and mutant HIV-1 reverse transcriptase, Protein Expr. Purif. 7 (1996)
27e32.
Thujaplicinol bound at the RNase
H active site, Structure 17 (2009)
1625e1635.
[33] M.A. Parniak, K.L. Min, S.R. Budihas, S.F. Le Grice, J.A. Beutler, A fluorescence-
based high-throughput screening assay for inhibitors of human immunode-
ficiency virus-1 reverse transcriptase-associated ribonuclease H activity, Anal.
Biochem. 322 (2003) 33e39.
[10] D.M. Himmel, N.S. Myshakina, T. Ilina, A. Van Ry, W.C. Ho, M.A. Parniak,
E. Arnold, Structure of a dihydroxycoumarin active-site inhibitor in complex
with the RNase H domain of HIV-1 reverse transcriptase and structure-
activity analysis of inhibitor analogs, J. Mol. Biol. 426 (2014) 2617e2631.
[11] C.A. Shaw-Reid, V. Munshi, P. Graham, A. Wolfe, M. Witmer, R. Danzeisen,
D.B. Olsen, S.S. Carroll, M. Embrey, J.S. Wai, M.D. Miller, J.L. Cole, D.J. Hazuda,
Inhibition of HIV-1 ribonuclease H by a novel diketo acid, 4-[5-(benzoyla-
mino)thien-2-yl]-2,4-dioxobutanoic acid, J. Biol. Chem. 278 (2003)
2777e2780.
[12] T.A. Kirschberg, M. Balakrishnan, N.H. Squires, T. Barnes, K.M. Brendza,
X. Chen, E.J. Eisenberg, W. Jin, N. Kutty, S. Leavitt, A. Liclican, Q. Liu, X. Liu,
J. Mak, J.K. Perry, M. Wang, W.J. Watkins, E.B. Lansdon, RNase H active site
inhibitors of human immunodeficiency virus type 1 reverse transcriptase:
design, biochemical activity, and structural information, J. Med. Chem. 52
(2009) 5781e5784.
[34] B.M.
Kamalendra
Singh,
K.
Rai
Devendra,
Bechan
Sharma,
Eleftherios Michailidis, M. Emily, K.B.M. Ryan, D. Leslie Maxwell, Ariel
N. Hagedorn, Zhe Li, Pieter R. Norden, M.A.P. Atsuko Hachiya, Xu Hong-Tao,
Mark A. Wainberg, Stefan G. Sarafianos, Biochemical mechanism of HIV-1
resistance to rilpivirine, J. Biol. Chem. 287 (2012) 38110e38123.
[35] J. Kankanala, K.A. Kirby, A.D. Huber, M.C. Casey, D.J. Wilson, S.G. Sarafianos,
Z. Wang, Design, synthesis and biological evaluations of N-Hydroxy thieno-
pyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated
RNase H, Eur. J. Med. Chem. 141 (2017) 149e161.
[36] J. Tang, K.A. Kirby, A.D. Huber, M.C. Casey, J. Ji, D.J. Wilson, S.G. Sarafianos,
Z. Wang, 6-Cyclohexylmethyl-3-hydroxypyrimidine-2,4-dione as an inhibitor
scaffold of HIV reverse transcriptase: impacts of the 3-OH on inhibiting RNase
H and polymerase, Eur. J. Med. Chem. 128 (2017) 168e179.
[37] S.K.V. Vernekar, J. Tang, B. Wu, A.D. Huber, M.C. Casey, N. Myshakina,
D.J. Wilson, J. Kankanala, K.A. Kirby, M.A. Parniak, S.G. Sarafianos, Z. Wang,
Double-winged 3-Hydroxypyrimidine-2,4-diones: potent and selective inhi-
bition against HIV-1 RNase H with significant antiviral activity, J. Med. Chem.
60 (2017) 5045e5056.
[38] Z. Wang, E.M. Bennett, D.J. Wilson, C. Salomon, R. Vince, Rationally designed
dual inhibitors of HIV reverse transcriptase and integrase, J. Med. Chem. 50
(2007) 3416e3419.
[13] P.D. Williams, D.D. Staas, S. Venkatraman, H.M. Loughran, R.D. Ruzek,
T.M. Booth, T.A. Lyle, J.S. Wai, J.P. Vacca, B.P. Feuston, L.T. Ecto, J.A. Flynn,
D.J. DiStefano, D.J. Hazuda, C.M. Bahnck, A.L. Himmelberger, G. Dornadula,
R.C. Hrin, K.A. Stillmock, M.V. Witmer, M.D. Miller, J.A. Grobler, Potent and
selective HIV-1 ribonuclease
naphthyridin-2(1H)-one scaffold, Bioorg. Med. Chem. Lett 20 (2010)
6754e6757.
H inhibitors based on a 1-hydroxy-1,8-
[14] G.L. Beilhartz, M. Ngure, B.A. Johns, F. Deanda, P. Gerondelis, M. Gotte, Inhi-
bition of the ribonuclease
H activity of HIV-1 reverse transcriptase by
GSK5750 correlates with slow enzyme-inhibitor dissociation, J. Biol. Chem.
289 (2014) 16270e16277.
[15] M. Nowotny, Retroviral integrase superfamily: the structural perspective,
EMBO Rep. 10 (2009) 144e151.
[16] Y. Li, S. Xuan, Y. Feng, A. Yan, Targeting HIV-1 integrase with strand transfer
inhibitors, Drug Discov. Today. 20 (2015) 435e449.
[17] D.J. McColl, X. Chen, Strand transfer inhibitors of HIV-1 integrase: bringing IN
a new era of antiretroviral therapy, Antivir. Res. 85 (2010) 101e118.
[18] A.G. Schwaid, I. Cornella-Taracido, Causes and significance of increased
compound potency in cellular or physiological contexts, J. Med. Chem. 61
(2018) 1767e1773.
[19] S.K. Vernekar, Z. Liu, E. Nagy, L. Miller, K.A. Kirby, D.J. Wilson, J. Kankanala,
S.G. Sarafianos, M.A. Parniak, Z. Wang, Design, synthesis, biochemical, and
antiviral evaluations of C6 benzyl and C6 biarylmethyl substituted 2-
hydroxylisoquinoline-1,3-diones: dual inhibition against HIV reverse
transcriptase-associated RNase H and polymerase with antiviral activities,
J. Med. Chem. 58 (2015) 651e664.
[39] V.R. Sirivolu, S.K.V. Vernekar, T. Ilina, N.S. Myshakina, M.A. Parniak, Z.Q. Wang,
Clicking 3 '-azidothymidine into novel potent inhibitors of human immuno-
deficiency virus, J. Med. Chem. 56 (2013) 8765e8780.
[40] M.E. Abram, M.A. Parniak, Virion instability of human immunodeficiency virus
type 1 reverse transcriptase (RT) mutated in the protease cleavage site be-
tween RT p51 and the RT RNase H domain, J. Virol. 79 (2005) 11952e11961.
[41] G.M. Sastry, M. Adzhigirey, T. Day, R. Annabhimoju, W. Sherman, Protein and
ligand preparation: parameters, protocols, and influence on virtual screening
enrichments, J. Comput. Aided Mol. Des. 27 (2013) 221e234.
€
€
[42] Schrodinger Release 2014-3, Schrodinger Suite 2014-3 Protein Preparation
€
Wizard; Epik Version 2.9, Schrodinger, LLC, New York, NY, 2014. Impact
€
version 6.4, Schrodinger, LLC, New York, NY, 2014; Prime version 3.7,
€
Schrodinger, LLC, New York, NY, 2014.
[43] W.L. Jorgensen, D.S. Maxwell, J. TiradoRives, Development and testing of the
OPLS all-atom force field on conformational energetics and properties of
organic liquids, J. Am. Chem. Soc. 118 (1996) 11225e11236.
€
€
[44] Schrodinger Release 2014-3, LigPrep, Version 3.1, Schrodinger, LLC, New York,
NY, 2014.
[20] J. Kankanala, K.A. Kirby, F. Liu, L. Miller, E. Nagy, D.J. Wilson, M.A. Parniak,
S.G. Sarafianos, Z.Q. Wang, Design, synthesis, and biological evaluations of
hydroxypyridonecarboxylic acids as inhibitors of HIV reverse transcriptase