Identification of metabolically stable 5′-phosphate analogs that support single-stranded siRNA activity

Article abstract of DOI:10.1093/nar/gkv162

The ss-siRNA activity in vivo requires a metabolically stable 5′-phosphate analog. In this report we used crystal structure of the 5′-phosphate binding pocket of Ago-2 bound with guide strand to design and synthesize ss-siRNAs containing various 5′-phosphate analogs. Our results indicate that the electronic and spatial orientation of the 5′-phosphate analog was critical for ss-siRNA activity. Chemically modified sssiRNA targeting human apoC III mRNA demonstrated good potency for inhibiting ApoC III mRNA and protein in transgenicmice. Moreover, ApoC III ss-siRNAs were able to reduce the triglyceride and LDL cholesterol in transgenic mice demonstrating pharmacological effect of ss-siRNA. Our study provides guidance to develop surrogate phosphate analog for ss-siRNA and demonstrates that ss-siRNA provides an alternative strategy for therapeutic gene silencing.

Full text of DOI:10.1093/nar/gkv162

Published online 09 March 2015
Nucleic Acids Research, 2015, Vol. 43, No. 6 2993–3011
doi: 10.1093/nar/gkv162
Identification of metabolically stable 5ꢀ-phosphate
analogs that support single-stranded siRNA activity
Thazha P. Prakash*, Walt F. Lima, Heather M. Murray, Wenyu Li, Garth A. Kinberger, Alfred
E. Chappell, Hans Gaus, Punit P. Seth, Balkrishen Bhat, Stanley T. Crooke and Eric
E. Swayze
Isis Pharmaceuticals Inc., 2855 Gazelle Ct, Carlsbad, CA 92010, USA
Received January 12, 2015; Revised February 16, 2015; Accepted February 19, 2015
ABSTRACT
gle stranded short interfering RNA (ss-siRNA) activity in
mice (9–11).
The ss-siRNA activity in vivo requires a metabolically
stable 5ꢀ-phosphate analog. In this report we used
crystal structure of the 5ꢀ-phosphate binding pocket
of Ago-2 bound with guide strand to design and syn-
thesize ss-siRNAs containing various 5ꢀ-phosphate
analogs. Our results indicate that the electronic and
spatial orientation of the 5ꢀ-phosphate analog was
critical for ss-siRNA activity. Chemically modified ss-
siRNA targeting human apoC III mRNA demonstrated
good potency for inhibiting ApoC III mRNA and pro-
tein in transgenic mice. Moreover, ApoC III ss-siRNAs
were able to reduce the triglyceride and LDL choles-
terol in transgenic mice demonstrating pharmaco-
logical effect of ss-siRNA. Our study provides guid-
ance to develop surrogate phosphate analog for ss-
siRNA and demonstrates that ss-siRNA provides an
alternative strategy for therapeutic gene silencing.
The critical determinants for ss-siRNA activity in vivo
were a configuration resistant to exonuclease and endonu-
clease degradation and a metabolically stable 5ꢀ-phosphate
(9). The 5ꢀ-phosphate was required for ss-siRNA but not
for double-stranded siRNA activity (9). The 5ꢀ-phosphate
is important for Ago-2 cleavage activity and binding (12–
15). In this study we utilized the crystal structure of the
5ꢀ-phosphate binding pocket of Ago-2 protein to design
chemical modifications to improve the metabolic stability
of 5ꢀ-phosphate while maintaining the activity of ss-siRNA
(12–15). This rational approach establishes stereoelectron-
ics for 5ꢀ-phosphate of ss-siRNA to elicit RNAi. Finally,
we show that a modified ss-siRNA targeting human ApoC
III mRNA potently reduced target mRNA level in vivo re-
sulting in reducing plasma triglyceride levels in a transgenic
mouse model.
MATERIALS AND METHODS
General method for the preparation of ss-siRNAs con-
taining 5ꢀ-deoxy-5ꢀ-methylenephosphonate and 5ꢀ-deoxy-5ꢀ-
vinylphosphonate using solid phase synthesis
INTRODUCTION
The demonstration that the reduction of mRNA expression
in cells using externally delivered duplex RNA (siRNA) by
activating the RISC mechanism enabled the development of
siRNA therapeutic (1,2). This approach has a potential to
treat a wide variety of human diseases through genetic mod-
ulation (3). However, broader utility of siRNA is limited
due to the requirement for complex lipid formulations or
conjugation strategy to deliver siRNA to peripheral tissues
(4–6). In contrast, single-strand antisense oligonucleotides
do not require special formulations to distribute broadly to
peripheral tissues (7). Moreover, it was shown that human
Dicer and Ago-2, the enzymes involved in the RNAi path-
way, bind short single-stranded RNAs with affinities com-
parable to siRNAs suggesting that single-stranded RNAs
are capable of activating the RNAi pathway (8). Consis-
tent with these observations we recently demonstrated sin-
Unless otherwise stated, all reagents and solutions used
for oligonucleotide synthesis were purchased from com-
mercial sources. The standard phosphoramidites and solid
supports were used for incorporation of A, U, G and
C residues. A 0.1-M solution of 2ꢀ-F, 2ꢀ-O-Me, 2ꢀ-O-
MOE, 5ꢀ-modified 2ꢀ-O-MOE phosphoramidites 9, 11, 30b-
32b, 36 and 2ꢀ-C16 U phosphoramidite 72 in anhydrous
acetonitrile (CH3CN) were used for the synthesis. Phos-
phoramidites containing 5ꢀ-methylenephosphonate and its
analogs 39, 43b, 46–47, 49, 53, 55–57 and 71 were dis-
solved in 30% dichloromethane (CH2Cl2) in anhydrous
CH3CN (0.1 M) and used for the solid phase synthe-
sis. The modified oligonucleotides were synthesized on VI-
MAD UnyLinkerTM solid support and the appropriate
amounts of solid supports were packed in the column for
synthesis. Dichloroacetic acid (6%) in toluene was used
*To whom correspondence should be addressed. Tel: +1 760 603 2590; Fax: +1 760 603 2600; Email: tprakash@isisph.com
ꢁ
C
The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which
permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.

2994 Nucleic Acids Research, 2015, Vol. 43, No. 6
as detritylating reagent. 4,5-dicyanoimidazole in the pres-
ence of N-methylimidazole or 1H-tetrazole in CH3CN was
used as activator during the coupling step. The synthesis
of modified oligonucleotides was performed either on an
AKTAOligopilot synthesizer (GE Healthcare Bioscience)
or an ABI 394 synthesizer on a 2–200-␮mol scale using the
procedures set forth below.
Source 30Q, 30 ␮m, 2.54 × 8 cm, A = 100-mM ammonium
acetate in 30% aqueous CH3CN, B = 1.5 M NaBr in A, 0–
40% of B in 60 min, flow 14 ml min−1). The residue was
desalted by HPLC on reverse phase column to yield the
ss-siRNAs in an isolated yield of 15–20% based on solid-
support loading. The oligonucleotides were characterized
by ion-pair-HPLC-MS analysis with Agilent 1100 MSD
system.
¨
A solid support preloaded with the UnylinkerTM was
loaded into a synthesis column after closing the col-
umn bottom outlet and acetonitrile (CH3CN) was added
to form slurry. The swelled support-bound UnylinkerTM
was treated with a detritylating reagent containing 6%
dichloroacetic acid in toluene to provide the free hydroxyl
groups. During the coupling step, four to fourteen equiv-
alents of phosphoramidite solutions were delivered and
the coupling was allowed to carry out for 10 min. All
other steps in the protocol supplied by the manufacturer
were used without modification. Phosphorothioate linkages
were introduced by sulfurization with a 0.05-M solution of
DDTT (3-((dimethylamino-methylidene)amino)-3H-1,2,4-
dithiazole-3-thione) in 1:1 pyridine/CH3CN for a contact
time of 3 min. Phosphate diester linkages were incorpo-
rated via oxidation of phosphite triesters using a solution
of tert-butyl hydroperoxide/CH3CN/water (10:87:3) for a
contact time of 12 min. After the desired sequence was
assembled, the solid-support bound oligonucleotide was
washed with CH2Cl2 and dried under high vacuum. Af-
ter 4 h, the dried solid support was suspended in a solu-
tion of iodotrimethylsilane (TMSI) and pyridine in CH2Cl2
to remove the 5ꢀ-phosphonate protecting group (ethyl or
methyl group). The deprotection solution was prepared
by dissolving 0.75-ml TMSI and 0.53-ml pyridine in 28.2-
ml CH2Cl2 (used 0.5 ml/␮mol of solid support). After
30 min at room temperature, the reaction was quenched
with 1-M 2-mercaptoethanol in 1:1 TEA/CH3CN (used
0.5 ml/␮mol of solid support). The supernatant was de-
canted and the solid support was washed with the same
2-mercaptoethanol solution mixture from above. This step
was repeated one more time, except after 45 min at room
temperature, the supernatant was decanted and the solid-
support-bound oligonucleotide was suspended in ammonia
(28–30 wt%) : 1-M 2-mercaptoethanol (used 0.75 ml/␮mol
of solid support) and heated at 55◦C for 2 h to complete
cleavage from support. The cleaved solution was allowed
to cool to ambient temperature over 24 h. The unbound
oligonucleotide was then filtered and the support was rinsed
and filtered with water:ethanol (1:1) followed by water. The
combined filtrate and washing were neutralized using acetic
acid, cooled at −20◦C for 3–4 h. The ss-siRNAs were pre-
cipitated and it was collected by centrifugation and decant-
ing the supernatant. It was red-dissolved in water and puri-
fied by HPCL on a reverse phase column (Waters X-Bridge
C-18 5 ␮m, 19 × 250 mm, A = 5-mM tributylammonium
acetate in 5% aqueous CH3CN, B = CH3CN, 0 to 90% B in
80 min, flow 7 ml min−1, ␭ = 260 nm). Fractions containing
full-length oligonucleotides were pooled together (assessed
by High Pressure Liquid Chromatography-Mass Spectrom-
etry (HPLC-MS) analysis >95%) and the tributylammo-
nium counter ion was exchanged to sodium by HPLC on a
strong anion exchange column (GE Healthcare Bioscience,
In vitro potency of ss-siRNA and siRNA in transfected HeLa
cells
HeLa cells were seeded in 96-well plates at 5000–10 000
cells/well 16 h prior to treatment with the exception of
liver hepatocytes which were immediately plated and trans-
fected 2 h post perfusion. Transfection was performed at
indicated concentrations using Opti-MEM medium (Life
Technologies) containing 4–6-␮g/ml Lipofectamine 2000
(Life Technologies) for 4 h at 37◦C. Growth medium, Dul-
becco’s modified Eagle’s medium for HeLa and Mouse Fi-
broblast (MEF) cell lines and Williams E for hepatocytes,
was replaced and cells were incubated overnight at 37◦C
in 5% CO2. Cells were lysed 16 h post transfection and
total RNA was purified using RNeasy 3000 Bio Robot
(Qiagen). Reduction of target mRNA was determined by
quantitative Reverse Transcriptase Polymerase Chain Reac-
tion (qRT-PCR) as previously described (16). The primer-
probe sequences used for detection of human PTEN were
forward AATGGCTAAGTGAAGATGACAATCAT, re-
verse TGCACATATCATTACACCAGTTCGT and probe
TTGCAGCAATTCACTGTAAAGCTGGAAAGG. Tar-
get mRNA levels were normalized to total RNA using Ri-
boGreen (Life Technologies). IC50 curves and values were
generated using Prism 4 software (GraphPad Prism regres-
sion analysis Software).
In vivo activity of ss-siRNA in mice
Animal experiments were conducted according to Ameri-
can Association for the Accreditation of Laboratory Ani-
mal Care guidelines and were approved by the Animal Wel-
fare Committee (Cold Spring Harbor Laboratory’s Institu-
tional Animal Care and Use Committee guidelines). Male
Balb/c mice (Charles River Laboratories), aged 6–8 weeks,
were maintained at a constant temperature of 23◦C and
were allowed to standard lab diet and water. Dosing so-
lutions were prepared in phosphate-buffered saline, sterile
filtered and quantified. Mice were dosed by single adminis-
tration (n = 4), intravenous or subcutaneous, injection with
the exception of subcutaneous doses above 50 mg/kg which
consisted of subdivided injections of 25 mg/kg twice a day
for indicated number of days. Mice were sacrificed 48 h post
treatment. Animals were anesthetized with isoflurane and
terminal bleed was performed as previously described (17).
Immediately following terminal blood draw, mice were sac-
rificed by cervical dislocation while under anesthesia. Liver,
kidney and spleen weights were taken and liver tissue was
homogenized in guanidine isothiocyanate (Life Technolo-
gies) containing 8% ␤-mercaptoethanol (Sigma) immedi-
ately following the sacrifice. Liver homogenate was loaded
onto Purelink PCR columns (Life Technologies) and total

Nucleic Acids Research, 2015, Vol. 43, No. 6 2995
RNA was purified according to manufacture instructions.
Reduction of target mRNA expression was determined by
qRT-PCR as previously described (16). Target mRNA lev-
els were normalized to cyclophilin levels and values were
confirmed by RiboGreen. RNA purification and qRT-PCR
was run as described above using the following hu apoc iii
primer-probe sequences: forward GCCGTGGCTGCCT-
GAG, reverse AGGAGCTCGCAGGATGGAT and probe
CCTCAATACCCCAAGTCCACCTGCC (18).
RESULTS
5ꢀ-phosphate is a critical determinant for ss-siRNA activity
in vivo
Our earlier structure-activity relationship (SAR) efforts
identified chemically modified ss-siRNAs which exhibited
excellent activity and metabolic stability in cell culture ex-
periments (Figure 1) (9). However, these ss-siRNAs (Fig-
ure 1, 2–3) showed no reduction in the Phosphatase and
tensin homolog (PTEN) mRNA levels when evaluated in
mice (9). Analysis of the livers of mice treated with ss-
siRNAs 2–3 showed no intact ss-siRNAs. The predomi-
nant metabolite observed for ss-siRNA 2 consisted of the 3ꢀ-
pole of the ss-siRNA containing the nine contiguous phos-
phorothioates. The predominant metabolite identified for
ss-siRNA 3 consisted of full length compound without 5ꢀ-
phosphate (9). The lack of in vivo activity observed for the
ss-siRNA 3 was consistent with our observations that the
5ꢀ-phosphate is required for ss-siRNA activity (9).
Determination of tissue concentrations and metabolites of ss-
RNAs using LC-MS
Tissues were minced and 50–200-mg samples were homog-
enized in 500-␮l homogenization buffer (0.5% NP40 sub-
stitute (Calbiochem) in Tris-buffered saline, pH8) with ho-
mogenization beads (Mo Bio Laboratories, Carlsbad, CA,
USA) on a Retsch shaker (Mo Bio). Standard curves of
each ss-siRNA were established in 500-␮l aliquots control
tissue homogenate (50–200-mg/ml homogenization buffer).
A 27-mer, fully PS, MOE/DNA oligonucleotide was added
as an internal standard (Int. Std.) to all standard curves
and study samples. Samples and curves were extracted
with phenol/chloroform followed by solid-phase extrac-
tion (SPE) of the resulting aqueous extract using phenyl-
functionalized silica sorbent (Biotage, Upsalla, Sweden).
Eluate from SPE was dried down using a warm forced-
air (argon) evaporator and reconstituted in 100–200-␮l 4-
M urea, 25-mM ethylenediaminetetraacetic acid. Samples
were analyzed by LC-MS using a modification of a pre-
viously described method (17). Briefly, separation was ac-
complished using an 1100 HPLCMS system (Agilent Tech-
nologies, Wilmington, DE, USA) consisting of a quaternary
pump, UV detector, a column oven, an autosampler and
a single quadrupole mass spectrometer. Samples were in-
jected on an X-bridge OST C18 column (2.1 x 50 mm, 2.5-
␮m particles; Waters, Milford, MA, USA) equipped with a
SecurityGuard C18 guard column (Phenomenex, Torrance,
CA, USA). The columns were maintained at 55◦C. Trib-
utylammonium acetate buffer (5 mM) and acetonitrile were
used as the mobile phase at a flow rate of 0.3 ml/min. Ace-
tonitrile was increased (gradient) from 20 to 70% over 11
min. Mass measurements were made online using a single
quadrupole mass spectrometer scanning 1000–2100 m/z in
the negative ionization mode. Molecular masses were deter-
mined using ChemStation analysis package (Agilent, Santa
Clara, CA, USA). Manual evaluation was performed by
comparing a table of calculated m/z values corresponding
to potential metabolites with the peaks present in a given
spectrum. Peak areas from extracted ion chromatograms
were determined for ss-siRNAs, 3ꢀ N-1 metabolites, and Int.
Std. and a trendline established using the calibration stan-
dards, plotting concentration of ssRNA against the ratio of
the peak areas ssRNA:Int. Std. Concentration of ssRNAs
and 3ꢀ N-1 metabolites in study samples were determined
using established trendlines and reported as ␮g/g tissue.
Approaches to study the effect of altering sterioelectronics of
5ꢀ-phosphate for ss-siRNA to activate RNAi
Our in vitro and mechanistic studies showed that ss-siRNA
activity requires a phosphate at the 5ꢀ-terminus (9). Given
that the modified ss-siRNA 3 extracted from liver was
rapidly dephosphorylated even after 6 h (9), we concluded
that the natural phosphate was not metabolically stable
for ss-siRNA to activate RNAi in animals (9,19). This
prompted us to search for 5ꢀ-phosphate analogs that are
stable in animals. We investigated two approaches to iden-
tify metabolically stable phosphate analogs for ss-siRNA.
In the first approach, we evaluated the effect of substi-
tution at the 5ꢀ-position (Figure 2, Approach A) on im-
proving metabolic stability of 5ꢀ-phosphate. In an alter-
nate approach, we replaced the bridging oxygen of the
phosphate with carbon (Figure 2, Approach B) to provide
5ꢀ-methylenephosphonate which is stable to phosphatase-
mediated cleavage.
We used our lead PTEN ss-siRNA 3 (Figure 1) for
our phosphate structure activity study. The approach
we utilized for this study comprises replacing 2ꢀ-O-(2-
methoxyethyl)thymidine-5ꢀ-phosphate at the 5ꢀ-end of the
ss-siRNA 3 with nucleotides containing 5ꢀ-modified phos-
phate analogs and evaluated in vitro potency in cell culture.
We also compared the activity of ss-siRNA with siRNA
generated by paring our ss-siRNAs with a complementary
unmodified RNA. The ss-siRNAs with activities compara-
ble to the control ss-siRNA 3 were then evaluated in animals
to assess their metabolic stability. Animals were sacrificed
at different time intervals and metabolites were determined
using LC-MS analysis.
Approach A: modification at the 5ꢀ-position of the 5ꢀ-terminal
nucleotide of ss-siRNA
It has been reported that introduction of a methyl group
(1:1 mixture of R- and S-isomers) at the 5ꢀ-position of the
furanose ring in DNA greatly increases stability toward nu-
clease degradation (20). It was apparent from the crystal
structure that the guide strand of siRNA bound to MID

2996 Nucleic Acids Research, 2015, Vol. 43, No. 6
Figure 1. In vitro activity of chemically modified PTEN ss-siRNA and siRNA.
Figure 2. Chemical approaches to improve metabolic stability of 5ꢀ-
phosphate of ss-siRNA.
Figure 3. Conformation of 5ꢀ-phosphate of a guide strand bound to MID
and PIWI domain of human Ago2; R: argine, K: lysine, Y: tyrosine, A:
alanine, N: asparagine (12).
domain of human Ago-2 (Figure 3) (12), a methyl group at
the 5ꢀ-position, would be tolerated.
In order to investigate this hypothesis we designed and
synthesized
(2ꢀ-O-(2-methoxyethyl)thymidine-3ꢀ-phosphoramidite
(Scheme 1; Supplementary data) and (S)-5ꢀ-methyl-5ꢀ-O-
(4,4ꢀ-dimethoxytrityl)-2ꢀ-O-(2-methoxyethyl)
thymidine
(R)-5ꢀ-methyl-5ꢀ-O-(4,4ꢀ-dimethoxytrityl)-
(S)-5ꢀ-methyl modified ss-siRNA 13, (IC50 0.6 nM; Figure
4) and 3-fold more potent than the parent siRNA 3 (IC50
= 2 nM; Figure 4). In contrast, the potency of siRNA
containing (R)-5ꢀ-methyl and (S)-5ꢀ-methyl ss-siRNA as
guide strand and a fully complementary RNA as passenger
strand were similar (Figure 4).
Previous studies have shown that introducing an R con-
figured 5ꢀ-Me group in locked nucleic acid neutralizes the
high affinity recognition of complementary RNA by chang-
ing the torsional preference around ␥ from the +sc into the
ap range (21). Interestingly, ␥ is also in the ap range for
the 5ꢀ-phosphate in the Ago-2 crystal structure (Figure 5A)
suggesting that the R-5ꢀ-Me group in 12 could pre-organize
9
3ꢀ-phosphoramidites 11 (Scheme 2; Supplementary data).
ss-siRNA containing the (R)-5ꢀ-methyl 12 (Figure 4) and
(S)-5ꢀ-methyl 13 (Figure 4) modifications at position 1 was
synthesized. ss-siRNAs 12–13 were transfected to HeLa
cells using Lipofectamine 2000. Reduction of target mRNA
was determined by qRT-PCR as previously described (9).
Target mRNA levels were normalized to total RNA using
RiboGreen. The ss-siRNA 12 (IC50 0.6 nM; Figure 4)
containing (R)-5ꢀ-methyl was 5-fold more potent than

Nucleic Acids Research, 2015, Vol. 43, No. 6 2997
Scheme 1. Synthesis of 5ꢀ-O-(4ꢀ,4ꢀ-dimethoxytrityl-(R)-5ꢀ-methyl-2ꢀ-O-(2-methoxyethyl)-thymidine-3ꢀ-phosphoramidite (9); Nap: 2-(methyl)naphthalene;
BOM: benzyloxymethyl; Bz: benzoyl; DMT: 4,4ꢀ-dimethoxytrityl; TBDMS: tert-butyldimethylsilyl.
the conformational preference around ␥ to mimic this ori-
entation and improve activity relative to the S-5ꢀ-Me ana-
log 13. Furthermore, a structural model of the R- and S-
5ꢀ-Me groups in the Ago2 binding pocket shows that the
bent trajectory of the neighboring phosphodiester linkage
could cause the S-5ꢀ-methyl group to experience tight con-
tacts with the 5ꢀ-methylene and one of the non-bridging
oxygen atoms of the phosphodiester linkage of the adja-
cent nucleotide (Figure 5B). The absence of any stereochem-
ical preference at the 5ꢀ-position of the guide strand of the
duplex siRNA suggests a differential loading process for
single- versus double-stranded nucleic acids into Ago-2 to
form activated RISC.
served for the ss-siRNA 12 and 13 consisted of the full-
length compound absents the 5ꢀ-phosphate (Figure 6B and
C). In fact, analysis of the ss-siRNA from studies with
shorter treatment times indicated that the compound was
completely dephosphorylated in as little as 6 h (data not
shown). Importantly, these results indicated that the 5ꢀ-
terminal 2ꢀ-O-MOE and alternating phosphorothioate (s)
and 2ꢀ-OMe substitutions at the 5ꢀ-pole significantly en-
hanced the metabolic stability of the ss-siRNA in vivo (Fig-
ure 6B and C). Finally, these data suggest that 5ꢀ-methyl
modification did not prevent 5ꢀ-de-phosphorylation of ss-
siRNA in animals.
Plasma stability of ss-siRNA containing (R)-5ꢀ-methyl and
(S)-5ꢀ-methyl-2ꢀ-O-MOE thymidine 5ꢀ-phosphate
Structure–activity relationship study to improve the
metabolic stability of ss-siRNA containing 5ꢀ-substitued
phosphate
To further assess the effect of 5ꢀ-alkyl modifications on
metabolic stability and activity of ss-siRNA, we synthesized
5ꢀ-methoxymethyl ss-siRNA (14; Figure 7) to increase steric
bulk, 5ꢀ-fluormethyl ss-siRNA (15; Figure 7) to increase hy-
drophobicity, 5ꢀ-aminomethyl ss-siRNA (16; Figure 7) to
introduce positive charge and 5ꢀ-carboxylate ss-siRNA (17;
Figure 7) to introduce negative charge.
To further assess the effect of 5ꢀ-methyl substitution on
metabolic stability of the 5ꢀ-phosphate in ss-siRNA, mice
were injected with ss-siRNA 12 and 13 25 mg kg−1 and sac-
rificed after 24 h. ss-siRNAs from the liver were extracted
and analyzed by LC-MS to determine the total liver con-
centrations of the compounds (Figure 6A) and to identify
any metabolites. Analysis of the ss-siRNAs extracted from
the mouse liver showed the predominant metabolite ob-

2998 Nucleic Acids Research, 2015, Vol. 43, No. 6
Scheme 2. Synthesis of 5ꢀ-O-(4ꢀ,4ꢀ-dimethoxytrityl)- (S)-5ꢀ-methyl-2ꢀ-O-
(2-methoxyethyl)-thymidine-3ꢀ-phosphoramidite (11).
Figure 5. (A) Conformation of 5ꢀ-phosphate observed in guide strand of
siRNA (12). (B) Overlaid structures of R-5ꢀ-methyl (golden) and S-5ꢀ-
methyl (pink) structures and Ago-2 binding pocket (12).
thymidine derivative 25 (Scheme 4; Supplementary data).
The synthesis of 5ꢀ-aminomethyl thymidine analog 26
was also synthesized from compound 23 (Supplementary
data). The thymidine analogs 24–26 were converted into
their corresponding 3ꢀ-phosphoramidites 30b, 31b and
32b according to Scheme 4 (Supplementary data). The
5ꢀ-methylcarboxylate-thymidine 3ꢀ-phosphoramidite 36
(Scheme 5) was used for the synthesis of 5ꢀ-carboxylate
ss-siRNA 17 (Figure 7). The synthesis of phosphoramidite
36 was achieved as described in Scheme 5 (Supplementary
data).
Figure 4. In vitro activity of 5ꢀ-modified PTEN ss-siRNA and siRNA in
HeLa cells.
Syntheses of ss-siRNAs 14–17 (Figure 7) were achieved
using the standard DNA synthesis procedure with appro-
priate modification based on the functional group present
(22). In brief, after the synthesis of ss-siRNA 16 was com-
pleted, solid support was first treated with 50% triethy-
lamine in acetonitrile containing 2-mercaptoethanol (1 M)
for 45 min to remove the cyanoethyl group from the inter-
nucleotide phosphodiesters and phosphorothioates. Then
deprotection was completed by heating the solid support
with aqueous ammonia containing 2-mercaptoethaol (1 M)
at 55◦C for 6 h. 2-mercaptoethanol was used to scavenge
acyl and acrylonitrile groups generated during deprotection
and to prevent the formation of acyl or cyanoethyl mod-
ified 5ꢀ-aminomethyl modified ss-siRNA. For the synthe-
First we synthesized of 5ꢀ-methoxymethyl, 5ꢀ-fluormethyl
and 5ꢀ-aminomethyl 2ꢀ-O-MOE-thymidine phospho-
ramidites 30b, 31b and 32b (Scheme 4). An orthogonally
protected 2ꢀ-O-(2-methoxyethyl)thymidine nucleoside
23 (Scheme 3) with 5ꢀ-hydroxymethyl substitution was
identified as a versatile synthon to prepare all modi-
fied phosphoramidites 30b, 31b and 32b. Synthesis of
compound 23 was accomplished according to Scheme 3
(Supplementary data). Compound 23 was converted to
5ꢀ-methoxymethyl derivative 24 (Scheme 4; Supplementary
data) with methyl iodide and NaH in DMF in good yield.
Treatment of compound 23 with diethylaminosulfur triflu-
oride (DAST) in dichloromethane yielded 5ꢀ-fluoromethyl

Nucleic Acids Research, 2015, Vol. 43, No. 6 2999
Figure 6. Identification of ss-siRNA metabolites extracted from mouse liver post-treatment using liquid chromatography-tandem mass spectrometry (LC-
MS) analysis. (A) Levels of ss-siRNAs 12 and 13 minus 5ꢀ-phosphate in mouse liver at 6 and 24 h post treatment. (B) The liquid chromatography profiles of
ss-siRNA 13 extracted from the liver after 24 h of dosing and shown is the relative abundance of the metabolites identified by mass spectrometry compared
to the internal standard (Std.). Numbered arrows indicate the position of degradation sites in the ss-siRNA in relationship to the corresponding peaks
from the liquid chromatography profile. (C) MS profile of the chromatographic peak corresponds to the peak 1 in (B). (D) Levels of ss-siRNAs 14–16
minus 5ꢀ-phosphate in the mouse liver at 6 and 24 h post treatment.
sis of ss-siRNA 17 the phosphoramidite 36 was used for
incorporation of 5ꢀ-carboxy-2ꢀ-O-MOE thymidine residue
at the 5ꢀ-end. A modified deprotection protocol was used
to prevent the formation of carboxamide upon ammonia
treatment. After the synthesis was completed, solid support
bearing ss-siRNA 17 was treated with 50% piperidine in wa-
ter and kept at room temperature for 12 h to convert 5ꢀ-
methylcarboxylate to 5ꢀ-carboxylate. This was followed by
treatment with 50% triethylamine in acetonitrile for 45 min
to remove the cyanoethyl group from the inter-nucleotide
phosphodiesters and phosphorothioates. The deprotection
was completed by heating the solid support with aqueous
ammonia at 55◦C for 6 h. High-resolution MS MS analy-
sis and isotopic distribution was used to confirm the pres-
ence of 5ꢀ-carboxylate functionality. The structural integrity
of ss-siRNAs (14–17) was confirmed with LC MS analysis
(Supplementary data).
We then tested these ss-siRNAs 14–17 in HeLa cells
to assess their activities. HeLa cells were transfected with
ss-siRNAs 14–17 using Lipofectamine 2000. Reduction
of target mRNA was determined by qRT-PCR as previ-
ously described (9). Similar potencies were observed for 5ꢀ-
methoxymethyl ss-siRNA 14 and fluoromethyl ss-siRNA
15 (Figure 7) and 5ꢀ-methyl ss-siRNA 12 (Figure 4). The
amino methyl ss-siRNA 16 and 5ꢀ-carboxymethyl ss-siRNA
17 were less potent compared to the unmodified ss-siRNA
3 (Figures 7) or 5ꢀ-methyl ss-siRNA 12 (Figure 4). Interest-
ingly, potency of the corresponding siRNAs was similar to
the parent siRNA (Figure 7). These data suggest that the
structure–activity relationship differs significantly between
ss-siRNA and siRNA.
Next we investigated the effect of these modifications
on the metabolic stability of ss-siRNA. Mice were dosed
with 20 mg/kg of ss-siRNAs 14–16 in saline and sacrificed
at 6 and 24 h after dosing. The ss-siRNA 17 was not in-
cluded in this study because it was significantly less active
in the cell culture experiments. Metabolites were extracted
from the livers of the animals treated with ss-siRNAs 14–
16 and analyzed by LC MS. The predominant metabolites
observed for ss-siRNAs 14–16 were the full-length com-
pound minus 5ꢀ-phosphate (Figure 6). The tissue levels of
ss-siRNA 14–16 minus the 5ꢀ-phosphate (Figure 6D) were
similar to parent ss-siRNA 3 (Figure 6A) with exception of
the 5ꢀ-aminomethyl ss-siRNA 16 that was significantly less
(8 ␮g/g for ss-siRNA 16 versus 17 ␮g/g at 6 h for ss-siRNA
3). Although we do not have a clear explanation for the ob-
served differences, these data suggest that small changes in
chemical structure could influence the distribution of the ss-
siRNA to the liver.

3000 Nucleic Acids Research, 2015, Vol. 43, No. 6
poration of 5ꢀ-CH2P-II at the 5ꢀ-end of ss-siRNA
38 (Figure 8) the 2ꢀ-O-(2-methoxyethyl)-5ꢀ-deoxy-5ꢀ-
(diethylphosphonate)thymidine-3ꢀ-phosphoramidite 43b
was used. The phosphoramidite 43b was synthesized
according to synthetic Scheme 6 (Supplementary data).
Syntheses of ss-siRNAs 37–38 were achieved using
standard DNA synthesis (22).
However, conventional deprotection condition (aqueous
ammonia at 55◦C) was not able to hydrolyze the ethyl
ester of the 5ꢀ-deoxy-5ꢀ-methylenephosphonate used as
a protecting group during ss-siRNA synthesis. In or-
der to hydrolyze the ethyl ester from the 5ꢀ-phosphonic
acid of ss-siRNAs 37 and 38 a post-synthetic method
was developed. On treatment of solid support bearing
ss-siRNAs 37–38 to a solution of iodotrimethylsilane in
dichloromethane containing pyridine for 30 min at room
temperature completely removed ethyl group from the
5ꢀ-deoxy-5ꢀ-methylenephophonic acid (25). The reaction
was quenched with a solution of 50% triethylamine in
acetonitrile containing 2-mercaptoethanol (1 M). The
supernatant was decanted and the solid-support-bound
ss-siRNAs were then treated with aqueous ammonia
(28–30 wt%) containing 2-mercaptoethanol (1 M) to
completely remove all the protecting groups. To our
knowledge, this is the first synthesis of oligonucleotides
containing 5ꢀ-deoxy-5ꢀ-methylenephosphonic acid using
5ꢀ-deoxy-5ꢀ-diethylmethylenephosphonate-nucleoside-3ꢀ-
phosphoramidite. The mass and purity of ss-siRNAs
(37–38) were confirmed by ion-pair LC MS analysis
(Supplementary data).
ss-siRNAs 37–38 were tested in HeLa cells to assess the
potency. ss-siRNAs 37–38 were 7–10-fold less active (Fig-
ure 8; IC50: ss-siRNA 37 15 nM, ss-siRNA 38 20 nM)
in HeLa cells relative to parent ss-siRNA 3. Conversely,
the activities of corresponding siRNAs were similar to the
parent siRNA (Figure 8). It is interesting to note that ss-
siRNA 38 with a bulky 2ꢀ-O-MOE modification and ss-
siRNA 37 with a 2ꢀ-OMe modification at position 1 showed
similar potency. These data are consistent with the observa-
tion that the 2ꢀ-hydoxyl of nucleotide 1 of the guide strand
does not appear to interact with human Ago-2 protein (16).
We recently reported result of testing ss-siRNA 38 with a
5ꢀ-deoxy-5ꢀ-methylenephosphonic acid (5ꢀ-CH2-P) modifi-
cation in mice (9). The ss-siRNA modestly inhibited the
PTEN mRNA in the liver (9). LC MS analysis of ss-siRNA
38 extracted from the liver of animals showed the com-
pound containing the 5ꢀ-CH2-P modification (9). These re-
sults demonstrated that ss-siRNA containing metabolically
stable phosphate analog inhibits gene expression in animals.
Figure 7. In vitro activity of 5ꢀ-modified PTEN ss-siRNA and siRNA in
HeLa cells.
Approach B: identification of methylenephosphonate analogs
as metabolically stable phosphate mimic for ss-siRNA
Phosphonic acid (Figure 2) is a close analog of phos-
phate and it has a carbon–phosphorus bond instead of
an oxygen–phosphorus bond of phosphate (23,24). The
carbon–phosphorous bond in phosphonic acid, unlike
phosphates, is not susceptible to the hydrolytic action of
phosphatases under physiological conditions (23,24) and
we envisaged that 5ꢀ-phosphonate on ss-siRNA would also
be metabolically stable. However, phosphonic acid is ex-
pected to have decreased acidity relative to phosphate (24)
due to the introduction of an electron–donating alkyl group
in place of an oxygen (24). In addition one would expect
a difference in the physical size and shape of phosphonic
acid relative to phosphate (24). To test this hypothesis, we
designed and synthesized ss-siRNAs 37 and 38 (Figure 8)
where the nucleotide at position 1 was replaced with 2ꢀ-O-
methyl-thymidine-5ꢀ-deoxy-5ꢀ-methylenephosphonate (5ꢀ-
CH2-P-I) and 2ꢀ-O-(2-methoxyethyl)-thymidine-5ꢀ-deoxy-
5ꢀ-methylenephosphonate (5ꢀ-CH2-P-II), respectively.
2ꢀ-O-methyl-5ꢀ-deoxy-5ꢀ-(diethylphosphonate)thymidine-
Identification of 5ꢀ-methylenephosphonic acid analogs with
conformation and electronics similar to 5ꢀ-natural phosphate
The in vitro potency of ss-siRNAs 38 containing 5ꢀ-CH2P
was significantly lower compared to ss-siRNA 3. We hy-
pothesized that this difference in potency could be a result
of the conformational and stereoelectronic differences be-
tween methylene phosphonate and phosphate. The crystal
structure of Ago-2 showed that side chains of amino acids
Y529, K533, N545 and K566 interact with 5ꢀ-phosphate
of the guide RNA (Figure 3) through formation of hy-
3ꢀ-phosphoramidite 39 (Figure
8
and Supplemen-
tary data) was used to incorporate 5ꢀ-CH2-P-I at
position 1 of ss-siRNA 37 (Figure 8). For incor-

Nucleic Acids Research, 2015, Vol. 43, No. 6 3001
Scheme 3. Synthesis of 5ꢀ-O-(benzyl)-(S)-5ꢀ-(hydroxymethyl)-2ꢀ-O-(2-methoxyethyl)-3ꢀ-O-(Nap)-thymidine (23); Bn: benzyl; TBDPS: tert-
butyldiphenylsilyl.
drogen bonds and salt bridges (12). It was possible that
conformational and stereoelectronic differences between
methylenephosphonate and phosphate may disrupt these
interactions and could contribute to the observed differ-
ences in the activity of ss-siRNAs. To address the stereoelec-
tronic limitations of 5ꢀ-CH2P modification we designed and
synthesized several ss-siRNAs containing 5ꢀ-CH2P analogs
with different electronic and conformational properties.
10 and Supplementary data) (28). Syntheses of ss-siRNAs
44–45 were achieved using the same procedure used for
the synthesis of ss-siRNA 38. The ss-siRNAs 44–45 were
characterized by ion-pair LC MS analysis (Supplementary
data).
ss-siRNAs 44–45 were transfected to HeLa cells using
Lipofectamine 2000. Reduction of target mRNA was deter-
mined by qRT-PCR as previously described. The ss-siRNA
44 containing 5ꢀ-CF2-P modification was less potent (Fig-
ure 9; IC50 > 50 nM) relative to parent ss-siRNA 3 as well
as 5ꢀ-CH2P ss-siRNA 38 (Figure 9; IC50 20 nM). Interest-
ingly, 5ꢀ-CHF-P ss-siRNA 45 was more potent (Figure 9;
IC50 7 nM) relative to 5ꢀ-CH2P ss-siRNA 38 (Figure 9; IC50
20 nM). These data suggest that shifting electronics of the
5ꢀ-CH2P closer to a phosphate by fluorination at ␣-position
improved the potency of ss-siRNA. Albeit, replacing oxy-
gen atom of the 5ꢀ-phophate with an isopolar CF2 group
significantly reduced activity of the ss-siRNA but the im-
pact on siRNA activity was only 5-fold.
5ꢀ-CH2P-analogs to probe the effect of altering electronic
properties
Previous work suggested that α-fluoro and α,α-
difluoromethyl phosphonates can serve as isos-
teric and isopolar analogs of phosphate esters
(26,27). ss-siRNA 44 (Figure 9; 5ꢀ-CF2-P) con-
taining
α,α-difluoromethylenephosphonate
and
ss-siRNA 45 (Figure 9, 5ꢀ-CHF-P) containing α-
fluoromethylenephosphonate at 5ꢀ-end were synthe-
sized to investigate the effect of altering electron-
ics.
To
introduceα,α-difluoromethylenephosphonate
5ꢀ-CH2P-analogs to investigate the effect of altering spatial
disposition
at the 5ꢀ-end of ss-siRNA we synthesized 5ꢀ-deoxy-
5ꢀ-α,α-difluoromethylenediethoxyphosphonate-2ꢀ-
O-methylthymidine-3ꢀ-phosphoramidite
46
(Figure
The crystal structure of guide strand of siRNA bound to
MID domain of human Ago-2 protein suggested that pre-
cise positioning of 5ꢀ-phosphate at the phosphate binding
pocket of the enzyme is critical for slicer activity (12). In
order to confirm, similar positioning of 5ꢀ-phosphate is
required for ss-siRNA activity, we designed 5ꢀ-O-CH2P ss-
siRNA 48 (Figure 9) where we introduce one oxygen atom
10 and Supplementary data) using a modified ver-
sion of the reported procedure (23). For the in-
corporation
of
α-fluoromethylenephosphonate
at
5ꢀ-end of ss-siRNA we synthesized 5ꢀ-deoxy-5ꢀ-
α-fluoromethylenediethoxyphosphonate-2ꢀ-O-(2-
methoxyethyl) thymidine-3ꢀ-phosphoramidite 47 (Figure

3002 Nucleic Acids Research, 2015, Vol. 43, No. 6
Scheme 4. Synthesis of phosphoramidites 30b–32b.
between methylenephosphonate at 5ꢀ-end of ss-siRNA. We
envisaged that extending the distance of methylenephos-
phonate from the 5ꢀ-end of ss-siRNA will perturb its
positioning in the 5ꢀ-binding pocket of Ago-2 and this
structural change would affect the slicer activity. The
2ꢀ-O-(2-methoxyethyl)-5ꢀ-O-(bis-(S-(pivaloyl-2-thioethyl)-
methylenephophonate-thymidine-3ꢀ-phosphoramidite 49
(Figure 10 and Supplementary data) was synthesized to
incorporate 5ꢀ-O-CH2P modification at the 5ꢀ-end of the
ss-siRNA (29).
thesis and it was conveniently removed during aqueous
ammonia treatment. In brief, after ss-siRNA 48 synthe-
sis was completed (22), the solid support was suspended
in aqueous ammonia containing 1-M 2-meraptoethaol and
heated at 55◦C for 6 h. The base labile group from the 5ꢀ-
O-CH2P was completely removed from the ss-siRNA. To
our knowledge, this is the first report of synthesis of 5ꢀ-
O-CH2P-modified oligonucleotides using base labile pro-
tecting group for the 5ꢀ-O-methylenephophonate. The ss-
siRNAs 48 was well characterized by ion-pair LC MS anal-
ysis (Supplementary data).
We used base labile S-(pivaloyl)-2-thioethyl (30) protect-
ing group for 5ꢀ-O-CH2P protection during ss-siRNA syn-

Nucleic Acids Research, 2015, Vol. 43, No. 6 3003
Scheme 5. Synthesis of 5ꢀ-O-(4ꢀ,4ꢀ-dimethoxytrityl)-(S)-5ꢀ-(methoxycarbonyl)-2ꢀ-O-(2-methoxyethyl)-thymidine-3ꢀ-phosphoramidite 36.
The activity of ss-siRNAs 48 was tested in HeLa cells
where it was found to be less potent (Figure 9; IC50 > 50
nM) relative to parent ss-siRNA 3 as well as 5ꢀ-CH2P ss-
siRNA 38 (Figure 8; IC50 20 nM). These data clearly sug-
gest that, like siRNA, precise positioning of 5ꢀ-phosphate at
the binding pocket is critical and any small changes in posi-
tioning have significant impact on the activity of ss-siRNA.
5ꢀ-CH2P-analogs to probe the effect of altering charge den-
sity, steric crowding and spatial positioning
The crystal structure of the full-length human Ago-2
bound to the guide strand of siRNA showed that the 5ꢀ-
phosphate forms electrostatic and hydrogen-bond interac-
tions with amino groups of lysines K533 and K566 (Fig-
ure 3) (12). We hypothesized that increased charge den-
sity around the 5ꢀ-CH2P moiety will enhance these in-
teractions and binding of the ss-siRNA to Ago-2 result-
ing in improved potency. In order to test this hypothesis
we designed and synthesized 5ꢀ-deoxy-5ꢀ-bisphosphonate
(5ꢀ-CHP2) ss-siRNA 50 (Figure 9). We first synthe-
sized 5ꢀ-deoxy-5ꢀ-(tetraethylbisphosphonate)methylene-2ꢀ-
O-(2-methoxyethyl)-thymidine-3ꢀ-phosphoramidite 53 ac-
cording to synthetic Scheme 7 (Supplementary data) (31).
Synthesis of 5ꢀ-deoxy-5ꢀ-bisphophonate ss-siRNA 50 was
accomplished using the synthesis procedure used for the
synthesis of ss-siRNA 38. The ss-siRNA was fully charac-
terized by LC MS analysis (Supplementary data). ss-siRNA
50 containing 5ꢀ-CHP2 modification was less potent (Figure
9; IC50 > 50 nM) relative to either the parent ss-siRNA 3
Figure 8. In vitro activity of 5ꢀ-modified PTEN ss-siRNA and siRNA.

3004 Nucleic Acids Research, 2015, Vol. 43, No. 6
Scheme 6. Synthesis of 5ꢀ-deoxy-5ꢀ-(diethylmethylenephosphonate)-2ꢀ-O-(2-methoxyethyl)-thymidine-3ꢀ-phosphoramidite 43b.
Figure 10. Structures of phosphoramidites 46–47 and 49.
Figure 9. In vitro activity of 5ꢀ-modified PTEN ss-siRNA and siRNA.
or 5ꢀ-CH2P ss-siRNA 38 (Figure 9; IC50 20 nM). The cor-
responding siRNA was also 10-fold less active (Figure 9).
These data clearly demonstrate that altering charge den-

Nucleic Acids Research, 2015, Vol. 43, No. 6 3005
Figure 11. Structure of 5ꢀ-phosphate (green), (E)-5ꢀ-vinyl phosphonate
(pink), (Z)-5ꢀ-vinylphosphonate (blue) and overlaid structures of 5ꢀ-
phosphate (green), (E)-5ꢀ-Vinyl phosphonate.
ꢀ
ꢀ
ꢀ
ꢀ
C4 -C5 -O5 -torsion angle structure of 5 -phosphate of the
guide strand of ss-siRNA is in a +sc conformation (Fig-
ure 5A) and exhibits rigid conformation due to 5ꢀ-O-4ꢀ-O
gauche effect. To mimic the stereoelectronic features of the
5ꢀ-phosphate moiety bound in the Ago-2 crystal structure,
we next evaluated the cis- and trans-unsaturated analogs
(Figure 11). Structural model of cis and trans vinyl phos-
phonate nucleoside showed that the trans vinylphospho-
nate can assume a conformation similar to that of the 5ꢀ-
phosphate in the Ago-2 crystal structure (Figure 11). Fur-
thermore, unsaturated moieties were previously shown to
serve as structural and functional mimics of oxygen in nu-
cleic acid structures (32,33). In addition, we also prepared
the fluorinated vinyl phosphonate analog as this modifica-
tion could also serve as an isopolar and isosteric phosphate
ester mimic for ss-siRNA.
Scheme 7. Synthesis of 5ꢀ-deoxy-5ꢀ-(tetraethyl methylenebis(phosphonat
e))-2ꢀ-O-(2-methoxyethyl)-thymidine-3ꢀ-phosphoramidite 53.
sity, steric crowding and positioning of 5ꢀ-phosphate signif-
icantly affects the activity of ss-siRNA.
Identification of conformationally rigid vinylphosphonate as
stereoelectronic substitute for 5ꢀ-phosphate of ss-siRNA with
high metabolic stability
Synthesis of 5ꢀ-deoxy-(E)-5ꢀ-vinyl(dimethylphosphonat
e)-2ꢀ-O-(2-methoxyethyl)-thymidine-3ꢀ-phosphoramidite
54 was accomplished according to Scheme 8 (Sup-
plementary data) (28). Similarly 5ꢀ-deoxy-5ꢀ-(Z)-
vinyl(dimethylphosphonate)-2ꢀ-O-(2-methoxyethyl)-
thymidine-3ꢀ-phosphoramidite 55 was also synthesized
(Figure 12 and Supplementary data) (28). We also synthe-
sized 5ꢀ-deoxy-(E)-5ꢀ-fluorovinyl(dimethylphosphonate)-
Results from the SAR studies with different substituted
methylenephosphonate analogs suggest that electronic and
spatial positioning of the phosphate is critical for ss-siRNA
activity. Rotation about the exocyclic C4ꢀ-C5ꢀ bond plays
a crucial role in positioning of 5ꢀ-phosphate in the cor-
ꢀ
rect alignment within the Ago2 binding pocket. The O4 -

3006 Nucleic Acids Research, 2015, Vol. 43, No. 6
Scheme 8. Synthesis of 5ꢀ-deoxy-(E)-5ꢀ-(dimethylvinylphosphonate)-2ꢀ-O-(2-methoxyethyl)-thymidine-3ꢀ-phosphoramidite 54.
5’-XSUSGUSCUSCUSGGSUCSCUSUSASCSUSUSASA-3’
ss-siRNA
No.
ss-siRNA
IC50 nM
siRNA
IC50 nM
X
5’-P
5’-CH2-P
(E)-5’-VP
(Z)-5’-VP
(E)-5’-F-VP
(Z)-5’-F-VP
2
0.4
2
0.2 0.1
0.2 0.1
0.2 0.1
0.6 0.1
0.2 0.1
>10
3
20
3
38
61
62
63
64
1
>50
7
40
1
5
Figure 12. Structures of phosphoramidites 55–57.
Figure 13. In vitro activity of 5ꢀ-modified PTEN ss-siRNA and siRNA.
2ꢀ-O-(2-methoxyethyl)-thymidine-3ꢀ-phosphoramidite
56 (Figure 12 and Supplementary data) (34,35) and
5ꢀ-deoxy-(Z)-5ꢀ-fluorovinyl(dimethylphosphonate)-2ꢀ-O-
(2-methyl)-thymidine-3ꢀ-phosphoramidite 57 (Figure 12
and Supplementary data) using reported methods (36,37).
The ss-siRNAs 61–64 (Figure 13) were synthesized us-
ing the synthetic procedure developed for the synthesis
of ss-siRNA 38. It is noteworthy that synthesis of ss-
siRNA 61 using ethyl protecting group for the (E)-5ꢀ-
vinylphosphonate gave poor yield after deprotection us-
ing TMSI/pyridine. However, significantly greater yields
were achieved using phosphoramidite 54 (Scheme 8) with
methyl protected (E)-5ꢀ-vinylphosphonate. ss-siRNAs were
well characterized by ion-pair HPLC coupled mass spec-
troscopy (Supporting Information).

Nucleic Acids Research, 2015, Vol. 43, No. 6 3007
The 3ꢀ-phosphoramidite 72 was also synthesized as shown
in Supplementary data. The ss-siRNAs 69 and 70 were syn-
thesized using the general procedure described for (E)-5ꢀ-VP
ss-siRNA.
ss-siRNAs and corresponding siRNAs 61–64 (Fig-
ure 13) were tested in HeLa cells to evaluate the ef-
fect of the 5ꢀ-vinylphosphate analogs on potency. The ss-
siRNA 61 containing the 5ꢀ-trans-vinylphosphonate ((E)-
5ꢀ-VP) modification exhibited a potency (IC50 3 nM; Fig-
ure 13) similar to parent ss-siRNA 3 (IC50 2 nM; Fig-
ure 13), whereas the potency of the ss-siRNA contain-
ing the 5ꢀ-cis-vinylphosphonate ((Z)-5ꢀ-VP) 62 (IC50 > 50
nM; Figure 13) was significantly lower. Similar effect of
stereoisomer on potency was observed with fluorinated 5ꢀ-
vinylphosphonate ss-siRNAs. The ss-siRNA 63 contain-
ing 5ꢀ-trans-fluorovinylphosphonate ((E)-5ꢀ-F-VP) modifi-
cation showed higher potency (IC50 7 nM; Figure 13) rela-
tive to 5ꢀ-cis-vinylphosphonate ((Z)-5ꢀ-VP) 64 (IC50 40 nM;
Figure 13). It is surprising that ss-siRNA 63 was 7-fold less
potent than ss-siRNA 61 given that fluorination of the al-
pha carbon of the 5ꢀ-VP modification (38,39) was expected
to be isoelectronic compared to the phosphate. These data
demonstrate that the factors other than electronics are con-
tributing to the activity of (E)-5ꢀ-VP ss-siRNA. Specifically
the steric resemblance of the (E)-5ꢀ-VP to phosphate esters
positioned within the phosphate binding pocket of Ago2
(Figure 3).
First, we determined the in vitro potency of ss-siRNAs 69
and 70 in ApoC III transgenic mouse primary hepatocytes
by transfecting with electroporation. Interestingly, potency
of (E)-5ꢀ-VP-C16 ss-siRNAs 69 (Figure 14; IC50 2 ␮M) was
4-fold lower than corresponding the (E)-5ꢀ-VP ss-siRNA 67
(Figure 14; IC50 0.45 ␮M). Additionally, the potency of (E)-
5ꢀ-VP-C16 ss-siRNA 70 (Figure 14; IC50 > 20 ␮M) was more
than 15-fold lower compared to the corresponding (E)-5ꢀ-
VP ss-siRNA 68 (Figure 14; IC50 1.3 ␮M). These data sug-
gest that the position of a bulky substitution influenced the
intrinsic potency of ss-siRNA and position 1 appears to be
more amenable for bulky 2ꢀ modification than internal po-
sition of ss-siRNA.
Next, we determined the in vivo potency of the ss-siRNA
67–70. The C16 ss-siRNAs 69 and 70 were dosed subcuta-
neous to human ApoC III transgenic mice (n = 4) at 3, 7, 14
and 44 mg/kg twice a week for 3 weeks. The ss-siRNAs 67
and 68 were dosed 100 mg/kg fractionated (25 mg/kg twice
a day for 1 day, then wait for 2 days and dose 25 mg/kg twice
a day for 1 day) for 3 weeks. The C16-ss-siRNAs 69 (ED50
10 mg/kg per week) and 70 (ED50 20 mg/kg per week)
showed remarkable potency in reducing ApoC III mRNA
(Figure 16A). Consistent with the in vitro potency, the ss-
siRNA 69 was more active in reducing ApoC III mRNA
than ss-siRNA 70. The increase in potency observed for
the C16 ss-siRNAs (69 and 70) is more remarkable given
that the in vitro potency of the ss-siRNAs 69 and 70 was
significantly lower (5–15-fold) compared to ss-siRNAs 67
and 68 (Figure 14). The ss-siRNAs 69 (ED50 10 mg/kg per
week) and 70 (ED50 10 mg/kg per week) efficiently reduced
the plasma ApoC III protein (Figure 16B). Furthermore,
the ss-siRNAs 69 (ED50 8 mg/kg per week) and 70 (ED50
15 mg/kg per week) reduced plasma triglycerides and low
density lipoprotein (LDL) level in a dose-dependent man-
ner (Figure 16C and D). Finally, throughout the course of
the in vivo studies the animals were monitored for signs of
ss-siRNA-associated toxicities. No adverse effects such as
elevated transaminase, bilirubin or increased organ weights
were observed.
(E)-5ꢀ-VP-ss-siRNA is active in animal and activity is general
for other targets
We recently reported the in vitro and in vivo activity of (E)-
5ꢀ-VP ss-siRNAs targeting PTEN, Factor VII and ApoC
III mRNAs (9). The potency of ApoC III ss-siRNA re-
ported was very modest. In order to identify more po-
tent ss-siRNAs we designed 320 new ss-siRNAs containing
5ꢀ-phosphate targeting human ApoC III mRNA (18). ss-
siRNAs were transfected to primary hepatocytes isolated
from transgenic mice by electroporation. The ApoC III
mRNA reduction was determined by qRT-PCR and IC50
curves and values were generated (data not shown). The ss-
siRNAs 65 (Figure 14; IC50 0.26 ␮M) and 66 (Figure 14;
IC50 0.22 ␮M) were identified as lead compounds for 5ꢀ-
VP modification and corresponding (E)-5ꢀ-VP ss-siRNAs
67 and 68 (Figure 14) were synthesized using the similar
procedure used for the synthesis of ss-siRNA 61. The po-
tency of ss-siRNA 67 (Figure 14; IC50 0.45 ␮M) and 68
(Figure 14; IC50 1.3 ␮M) was determined in hepatocytes.
Interestingly (E)-5ꢀ-VP ss-siRNA 67 was 2-fold less potent
than parent 5ꢀ-P ss-siRNA 65. The potency difference was
higher (6-fold) for (E)-5ꢀ-VP ss-siRNA 68 relative to parent
5ꢀ-P ss-siRNA 66 (Figure 14).
Previous studies have shown that ss-siRNA containing
C16 modification exhibited greater in vivo activity com-
pared to the unconjugated ss-siRNA (9). We synthesized
C16 analog of ss-siRNAs 67 (Figure 14; (E)-5ꢀ-VP-C16 ss-
siRNA 69) and 68 (Figure 14; (E)-5ꢀ-VP-C16 ss-siRNA
70) in order to improve their in vivo activity. It is worth-
while to note that ss-siRNA synthesis of ss-siRNA 69
needs a 3ꢀ-phosphoramidite containing 2ꢀ-O-C16-modified
thymidine-dimethyl vinylphosphonate 71 (Figure 15 and
Supplementary data). The synthesis of 3ꢀ-phosphoramidite
71 was accomplished (Supplementary data). Similarly for
the synthesis of ss-siRNA 70 needed 2ꢀ-O-C16-uridine-3ꢀ-
phosphoramidite 72 (Figure 15 and Supplementary data).
DISCUSSIONS
The siRNA therapeutics generally uses duplex RNA for
gene silencing using RNAi pathway (1,2). However, it was
shown that human Dicer and Ago-2, the enzymes involved
in the RNAi pathway, bind short single-stranded RNAs
with affinities comparable to siRNAs. This observation sug-
gests that single-stranded RNAs are capable of activating
the RNAi pathway (8). We recently demonstrated ss-siRNA
activity in mice (9,10). The critical determinants for ss-
siRNA activity in vivo were a configuration resistant to ex-
onuclease and endonuclease degradation and a metaboli-
cally stable 5ꢀ-phosphate (9). The 5ꢀ-phosphate is impor-
tant for Ago-2 cleavage activity and binding (12–15). In
this study we investigate the effect of chemical modifica-
tions on activity, metabolic stability of ss-siRNA and es-

3008 Nucleic Acids Research, 2015, Vol. 43, No. 6
Figure 14. In vitro activity of (E)-5ꢀ-VP modified ss-siRNA targeting ApoC III mRNA.
to experience tight contacts with the 5ꢀ-methylene and one
of the non-bridging oxygen atoms of the phosphodiester
linkage of the adjacent nucleotide (Figure 5B). ss-siRNA
with an R -5ꢀ-methyl substitution 12 is more active than
ss-siRNA 13 with S-5ꢀ–methyl substitution 13 (Figure 4)
consistent with our prediction. Interestingly correspond-
ing siRNAs showed similar potency. These data suggest
that, even though ss-siRNA and siRNA use RISC pathway
for gene silencing, a differential loading process exists. Our
plasma stability study using ss-siRNAs 12 and 13 suggests
that 5ꢀ-methyl substitution was not capable of stabilizing 5ꢀ-
phosphate of ss-siRNAs in mice. Nevertheless, this is the
first report of activity 5ꢀ-(R) and 5ꢀ-(S) methyl-substituted
ss-siRNAs and siRNAs.
We also demonstrate that increasing steric bulk or hy-
drophobicity at 5ꢀ-end did not reduce the ss-siRNA or
siRNA activity (Figure 7) in cell culture. Interestingly, the
introduction of cationic or anionic substitution reduces the
potency of ss-siRNA but not siRNA. The reduction of po-
tency was significant for 5ꢀ-carboxy ss-siRNA 17 (IC50 > 50
nM; Figure 7) relative to 5ꢀ-aminomethyl ss-siRNA 16 (IC50
7 nM; Figure 7). Literature suggests that the precise posi-
tioning of 5ꢀ-phosphate at the phosphate binding pocket
of the Ago-2 enzyme is critical for slicer activity (12). In
5ꢀ-carboxy ss-siRNA 17, it is possible to envisage that the
charge–charge repulsion between 5ꢀ-phosphate and carboxy
group may distort the positioning of phosphate in Ago-2
binding pocket and could explain the loss of potency. The
5ꢀ-phosphate of the guide strand forms hydrogen bonds and
salt bridges with basic amino acids of Ago-2 protein (12)
and it is conceivable that 5ꢀ-amino group of ss-siRNA 16
may be interfering this interaction and altering the gene
silencing activity. Importantly, our results suggest that ei-
ther steric bulk or cationic or anionic substitution at the
Figure 15. Structures of phosphoramidites 71–72.
tablished stereo-electronic requirements for 5ꢀ-phosphate of
ss-siRNA (12–15).
Previously methyl substitution at the 5ꢀ-position of the
furanose sugar has been used to change the torsional pref-
erence around ␥ from the +sc into the ap range in locked
nucleic acid (21). The ␥ of 5ꢀ-phosphate of guide strand
in the Ago-2 crystal structure (Figure 5A) is also in the ap
range and we theorized that R-5ꢀ-Me substitution could pre-
organize the conformational preference around ␥ to mimic
this orientation and improve activity relative to the S-5ꢀ-
Me substitution of ss-siRNA. Furthermore, a structural
model of the R- and S-5ꢀ-Me groups in the Ago2 binding
pocket shows that the bent trajectory of the neighboring
phosphodiester linkage could cause the S-5ꢀ-methyl group

Nucleic Acids Research, 2015, Vol. 43, No. 6 3009
Figure 16. In vivo activities of modified human ApoC III ss-siRNAs following multiple dose administration. (A) Dose-dependent reduction of human
ApoC III mRNA from the liver of transgenic mice (n = 4) treated with ss-siRNA 67–70 by subcutaneous administration. The ss-siRNAs 69 and 70 were
dosed 3, 7, 18 and 44 mg kg−1 two times a week for 3 weeks and the doses reported are for per week. ss-siRNAs 67 and 68 were dosed 100 mg kg−1
fractionated (25 mg kg−1 twice a day for 1 day, wait 2 days then dose 25 mg kg−1 twice a day for 1 day) for 3 weeks and doses reported are for per week. (B)
Dose-dependent reduction of ApoC III protein from the plasma of transgenic mice (n = 4) treated with ss-siRNA 67–70. (C) Dose-dependent reduction of
LDL levels from the plasma of transgenic mice (n = 4) treated with ss-siRNA 66–70. (D) Dose-dependent reduction of triglyceride levels from the plasma
of transgenic mice (n = 4) treated with ss-siRNA 66–70. Data are represented as mean SD.
5ꢀ-end of ss-siRNA could improve the metabolic stability
of 5ꢀ-phosphate in mice (Figure 6). These findings suggest
that the phosphatase activity on ss-siRNA is very aggressive
and 5ꢀ-phosphate is rapidly dephosphorylated. Our results
provide explanation for the observed lower activity of ss-
siRNA relative to siRNA (40).
designed and synthesized several ss-siRNAs containing 5ꢀ-
methylenephophonate analogs with different electronic and
conformational properties.
Fluorinated methylenephosphonates have suggested to
be an isosteric and isopolar analog of phosphate es-
ters (26,27). To our surprise this approach did not pro-
vide any enhanced activity to ss-siRNA relative to 5ꢀ-
methylenephophonate ss-siRNA. Even though mono flu-
orination provided slight improvement in potency (Fig-
ure 9) di-fluorination made it significantly less active. We
do not have a clear explanation why ss-siRNA contain-
ing 5ꢀ-difluoromethylenephosphonate is less active. From
these data one could postulate that more than electronic
factors special positioning of 5ꢀ-phosphate may be crit-
ical for RISC loading and subsequent slicer activity of
ss-siRNA. Our study with ss-siRNA containing two dis-
tinct 5ꢀ-methylenephosphonate analogs 5ꢀ-O-CH2-P and
5ꢀ-CHP2 (Figure 9) further confirms that spatial orien-
tation of 5ꢀ-phosphate is critical for ss-siRNA activity.
5ꢀ-O-CH2P analog has an extended oxygen atom and
is expected to have different spatial positioning relative
to 5ꢀ-methylenephosphonate. Our study shows that ss-
siRNA containing 5ꢀ-O-CH2P 48 was less active than
Phosphonic acid (Figure 2) is not susceptible to the hy-
drolytic action of phosphatases under physiological con-
ditions (23,24). Our results suggest that ss-siRNA con-
taining 5ꢀ-methylenephosphonate substitution was stable
in mice. Nevertheless, 5ꢀ-methylenephosphonate substitu-
tion reduces the potency of ss-siRNA but not siRNA (Fig-
ure 8) relative to its corresponding 5ꢀ-phosphate analogs.
The observed difference in potency could be a result of the
conformational and stereo-electronic differences between
methylenephosphonate and phosphate. It is known that
5ꢀ-phosphate makes critical contacts with several amino
acids in the Ago-2 binding pocket (Figure 3) and it is con-
ceivable that due to the difference in stereo-electronics 5ꢀ-
methylenephophonate ss-siRNA may disrupt these interac-
tions and could contribute to the observed differences in the
activity of ss-siRNAs. We addressed the stereo-electronic
limitations of 5ꢀ-methylenephosphonate modification and

3010 Nucleic Acids Research, 2015, Vol. 43, No. 6
parent ss-siRNA with 5ꢀ-phosphate 3 as well as 5ꢀ-
methylenephosphonate ss-siRNA 38 (Figure 9). These data
clearly suggest that precise positioning of 5ꢀ-phosphate is
critical for ss-siRNA activity and any perturbation could
have significant effect on gene silencing. Similar results
were obtained when we altered the charge density and
positioning as observed with ss-siRNA containing 5ꢀ-bis-
methylenephosphonate 50 (Figure 9). Our structural model
study of cis and trans vinylphosphonate nucleoside showed
that the trans vinylphosphonate can assume a conforma-
tion similar to that of the 5ꢀ-phosphate in the Ago-2 crys-
tal structure (Figure 11). Our study demonstrates, for the
first time, that ss-siRNAs containing trans vinylphospho-
nate and its fluorinated analogs were more potent than cor-
responding cis vinylphosphonates (Figure 13).
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online.
ACKNOWLEDGEMENTS
We thank Prof. Ian J. MacRae for providing Figure 3 and
Prof. David R. Corey for helpful discussions. We also thank
Andres Berdeja and Sam Lee for their contribution to this
work.
FUNDING
Funding for open access charge: Isis Pharmaceuticals.
Conflict of interest statement. None declared.
Our study clearly establishes the stereo-electronic re-
quirements for 5ꢀ-phosphate of ss-siRNA to elicit RNAi.
To our knowledge this is the first report where precise dis-
section of these factors has been examined for ss-siRNA.
We identified trans-5ꢀ-vinylphosphonate as a metaboli-
cally stable surrogate phosphate analog for ss-siRNA-
mediated gene slicing applications. In addition, we devel-
oped a convenient synthetic method to synthesize trans-
5ꢀ-vinylphosphonate containing ss-siRNAs. The ss-siRNA
therapeutics has several advantages over double-stranded
siRNAs. This approach eliminates the risk that the passen-
ger strand or its metabolites might cause and reduce the cost
of manufacture. ss-siRNAs achieve potent in vivo inhibition
of gene expression using simple saline dosing solutions.
REFERENCES
1. Elbashir,S.M., Lendeckel,W. and Tuschl,T. (2001) RNA interference
is mediated by 21- and 22-nucleotide RNAs. Genes Dev., 15, 188–200.
2. Elbashir,S.M., Harborth,J., Lendeckel,W., Yalcin,A., Weber,K. and
Tuschl,T. (2001) Duplexes of 21-nucleotide RNAs mediate RNA
interference in cultured mammalian cells. Nature, 411, 494–498.
3. Kubowicz,P., Zelaszczyk,D. and Pekala,E. (2013) RNAi in clinical
studies. Curr. Med. Chem., 20, 1801–1816.
4. DeVincenzo,J., Lambkin-Williams,R., Wilkinson,T., Cehelsky,J.,
Nochur,S., Walsh,E., Meyers,R., Gollob,J. and Vaishnaw,A. (2010) A
randomized, double-blind, placebo-controlled study of an
RNAi-based therapy directed against respiratory syncytial virus.
Proc. Natl. Acad. Sci. U.S.A., 107, 8800–8805.
5. Adams,D., Coelho,T., Suhr,O., Conceicao,I., Waddington-Cruz,M.,
Schmidt,H., Campistol,J., Pouget,J., Buades,J., Falzone,R. et al.
(2013) In: 2013 Biennial Meeting of the Peripheral Nerve Society. St.
Malo.
6. Tabernero,J., Shapiro,G.I., LoRusso,P.M., Cervantes,A.,
Schwartz,G.K., Weiss,G.J., Paz-Ares,L., Cho,D.C., Infante,J.R.,
Alsina,M. et al. (2013) First-in-humans trial of an RNA interference
therapeutic targeting VEGF and KSP in cancer patients with liver
involvement. Cancer Discov., 3, 406–417.
7. Bennett,C.F. and Swayze,E.E. (2010) RNA targeting therapeutics:
molecular mechanisms of antisense oligonucleotides as a therapeutic
platform. Annu. Rev. Pharmacol. Toxicol., 50, 259–293.
8. Lima,W.F., Murray,H., Nichols,J.G., Wu,H., Sun,H., Prakash,T.P.,
Berdeja,A.R., Gaus,H.J. and Crooke,S.T. (2009) Human Dicer binds
short single-strand and double-strand RNA with high affinity and
interacts with different regions of the nucleic acids. J. Biol. Chem.,
284, 2535–2548.
9. Lima,W.F., Prakash,T. P., Murray,H.M., Kinberger,G.A., Li,W.,
Chappell,A.E., Li,C.S., Murray,S.F., Gaus,H., Seth,P. P. et al. (2012)
Single-stranded siRNAs activate RNAi in animals. Cell, 150,
883–894.
10. Yu,D., Pendergraff,H., Liu,J., Kordasiewicz,H. B., Cleveland,D.W.,
Swayze,E.E., Lima,W.F., Crooke,S.T., Prakash,T.P. and Corey,D.R.
(2012) Single-stranded RNAs use RNAi to potently and
allele-selectively inhibit mutant huntingtin expression. Cell, 150,
895–908.
11. Prakash,T.P., Lima,W.F., Murray,H.M., Elbashir,S., Cantley,W.,
Foster,D., Jayaraman,M., Chappell,A.E., Manoharan,M.,
Swayze,E.E. et al. (2013) Lipid nanoparticles improve activity of
single-stranded siRNA and gapmer antisense oligonucleotides in
animals. ACS Chem. Biol., 8, 1402–1406.
12. Schirle,N.T. and MacRae,I.J. (2012) The crystal structure of human
Argonaute2. Science, 336, 1037–1040.
13. Nakanishi,K., Weinberg,D.E., Bartel,D.P. and Patel,D.J. (2012)
Structure of yeast Argonaute with guide RNA. Nature, 486, 368–374.
14. Wang,Y., Juranek,S., Li,H., Sheng,G., Tuschl,T. and Patel,D.J. (2008)
Structure of an argonaute silencing complex with a seed-containing
guide DNA and target RNA duplex. Nature, 456, 921–926.
15. Wang,Y., Juranek,S., Li,H., Sheng,G., Wardle,G.S., Tuschl,T. and
Patel,D.J. (2009) Nucleation, propagation and cleavage of target
RNAs in Ago silencing complexes. Nature, 461, 754–761.
CONCLUSIONS
In this report we describe the careful structure-based chem-
ical design to identify ss-siRNAs that function as potent
inhibitors of gene expression in animals. With the help of
known crystal structure of the Ago-2-bound guide strand
we designed and synthesized several ss-siRNAs containing
5ꢀ-phosphate analogs. Our study demonstrates that phos-
phatase activity on ss-siRNA was very robust and most
successful chemical approach to identify ss-siRNA func-
tion in animals was to utilize methylenephosphonate chem-
istry. We also demonstrate that electronic and spatial ori-
entation of the 5ꢀ-phosphate was critical for achieving the
best activity of ss-siRNA. Our study identified trans-5ꢀ-
vinylphosphonate as a surrogate phosphate analog for ss-
siRNA to activate RNAi in animals. Chemically modi-
fied ss-siRNA targeting human apoC III mRNA demon-
strated good potency in inhibiting apoC III mRNA and
protein in transgenic mice. Moreover, apoC III ss-siRNAs
were able to reduce the triglyceride and LDL cholesterol
in transgenic mice demonstrating the pharmacological ef-
fect of ss-siRNA. ss-siRNAs offer advantages over double-
stranded siRNAs such as eliminating the risk that the pas-
senger strand or its metabolites might cause undesirable
off-target effects and reduce the cost of manufacture. ss-
siRNAs achieve potent in vivo inhibition of gene expression
using simple saline dosing solutions. This study demon-
strates that ss-siRNA provides an alternative strategy for
gene silencing and further design optimization will enhance
their value as novel therapeutic agents.

Nucleic Acids Research, 2015, Vol. 43, No. 6 3011
16. Vickers,T.A., Lima,W.F., Wu,H., Nichols,J.G., Linsley,P.S. and
Crooke,S.T. (2009) Off-target and a portion of target-specific siRNA
mediated mRNA degradation is Ago2 ‘Slicer’ independent and can
be mediated by Ago1. Nucleic Acids Res., 37, 6927–6941.
17. Swayze,E.E., Siwkowski,A.M., Wancewicz,E.V., Migawa,M.T.,
Wyrzykiewicz,T.K., Hung,G., Monia,B.P. and Bennett,C.F. (2007)
Antisense oligonucleotides containing locked nucleic acid improve
potency but cause significant hepatotoxicity in animals. Nucleic Acids
Res., 35, 687–700.
18. Graham,M.J., Lee,R.G., Bell,T.A. III, Fu,W., Mullick,A.E.,
Alexander,V.J., Singleton,W., Viney,N., Geary,R., Su,J. et al. (2013)
Antisense oligonucleotide inhibition of apolipoprotein C-III reduces
plasma triglycerides in rodents, nonhuman primates, and humans.
Circ. Res., 112, 1479–1490.
19. Haringsma,H.J., Li,J.J., Soriano,F., Kenski,D.M., Flanagan,W.M.
and Willingham,A.T. (2012) mRNA knockdown by single strand
RNA is improved by chemical modifications. Nucleic Acids Res., 40,
4125–4136.
20. Saha,A.K., Waychunas,C., Caulfield,T.J., Upson,D.A., Hobbs,C. and
Yawman,A.M. (1995) 5ꢀ-methyl-DNA––a new oligonucleotide
analog: synthesis and biochemical properties. J. Org. Chem., 60,
788–789.
Synthesis of azole nucleoside 5ꢀ-monophosphate mimics (P1Ms) and
their inhibitory properties of IMP dehydrogenases. Nucleosides
Nucleotides Nucleic Acids, 23, 317–337.
30. Prakash,T.P., Prhavc,M., Eldrup,A.B., Cook,P.D., Carroll,S.S.,
Olsen,D.B., Stahlhut,M.W., Tomassini,J.E., MacCoss,M.,
Galloway,S.M. et al. (2005) Synthesis and evaluation of
S-acyl-2-thioethyl esters of modified nucleoside 5ꢀ-monophosphates
as inhibitors of hepatitis C virus RNA replication. J. Med. Chem., 48,
1199–1210.
31. Myers,T.C., Nakamura,K. and Danielzadeh,A.B. (1965) Phosphonic
acid analogs of nucleoside phosphates. III. The synthesis of
adenosine 5ꢀ-methylenediphosphonate, a phosphonic acid analog of
adenosine 5ꢀ-diphosphate. J. Org. Chem., 30, 1517–1520.
32. Wang,J., Verbeure,B., Luyten,I., Lescrinier,E., Froeyen,M.,
Hendrix,C., Rosemeyer,H., Seela,F., Van Aerschot,A. and
Herdewijn,P. (2000) Cyclohexene nucleic acids (CeNA): serum stable
oligonucleotides that activate RNase H and increase duplex stability
with complementary RNA. J. Am. Chem. Soc., 122, 8595–8602.
33. Seth,P.P., Allerson,C.R., Berdeja,A., Siwkowski,A., Pallan,P.S.,
Gaus,H., Prakash,T.P., Watt,A.T., Egli,M. and Swayze,E.E. (2010)
An exocyclic methylene group acts as a bioisostere of the 2ꢀ-oxygen
atom in LNA. J. Am. Chem. Soc., 132, 14942–14950.
21. Seth,P.P., Allerson,C.R., Siwkowski,A., Vasquez,G., Berdeja,A.,
Migawa,M.T., Gaus,H., Prakash,T.P., Bhat,B. and Swayze,E.E.
(2010) Configuration of the 5ꢀ-methyl group modulates the
biophysical and biological properties of locked nucleic acid (LNA)
oligonucleotides. J. Med. Chem., 53, 8309–8318.
22. Prakash,T.P., Allerson,C.R., Dande,P., Vickers,T.A., Sioufi,N.,
Jarres,R., Baker,B.F., Swayze,E.E., Griffey,R.H. and Bhat,B. (2005)
Positional effect of chemical modifications on short interference
RNA activity in Mammalian cells. J. Med. Chem., 48, 4247–4253.
23. Matulic-Adamic,J., Haeberli,P. and Usman,N. (1995) Synthesis of
5ꢀ-deoxy-5ꢀ-difluoromethyl phosphonate nucleotide analogs. J. Org.
Chem., 60, 2563–2569.
24. Engel,R. (1977) Phosphonates as analogues of natural phosphates.
Chem. Rev., 77, 349–367.
25. Blackburn,G.M. and Ingleson,D. (1980) The dealkylation of
phosphate and phosphonate esters by iodotrimethylsilane: a mild and
selective procedure. J. Chem. Soc. , 1, 1150–1153.
26. Blackburn,G.M. and Kent,D.E. (1986) Synthesis of ␣- and
␥-fluoroalkylphosphonates. J. Chem. Soc., 1, 913–917.
27. Wnuk,S.F. and Robins,M.J. (1996) Stannyl radical-mediated cleavage
of ␲-deficient heterocyclic sulfones. Synthesis of ␣-fluoro esters and
the first homonucleoside ␣-fluoromethylene phosphonate1. J. Am.
Chem. Soc., 118, 2519–2520.
28. Or,Y.S., Ying,L., Peng,X., Wang,C. and Qiu,Y.-L. (2009)
Application: US patent no. 2009-434146, 20090274686.
29. Wang,G., Sakthivel,K., Rajappan,V., Bruice,T.W., Tucker,K.,
Fagan,P., Brooks,J.L., Hurd,T., Leeds,J.M. and Cook,P.D. (2004)
34. Kumar,T.S., Zhou,S.-Y., Joshi,B.V., Balasubramanian,R., Yang,T.,
Liang,B.T. and Jacobson,K.A. (2010) Structure−activity relationship
of (N)-methanocarba phosphonate analogues of 5ꢀ-AMP as
cardioprotective agents acting through a cardiac P2X receptor. J.
Med. Chem., 53, 2562–2576.
35. Jung,K.-Y., Hohl,R.J., Wiemer,A.J. and Wiemer,D.F. (2000)
Synthesis of phosphonate derivatives of uridine, cytidine, and
cytosine arabinoside. Bioorg. Med. Chem., 8, 2501–2509.
36. Meurillon,M., Gallier,F., Peyrottes,S. and Pe´rigaud,C. (2009)
Developing an efficient route to the synthesis of nucleoside
1-alkynylphosphonates. Tetrahedron, 65, 6039–6046.
37. Gallier,F., Alexandre,J.A.C., El Amri,C., Deville-Bonne,D.,
Peyrottes,S. and Pe´rigaud,C. (2011) 5ꢀ,6ꢀ-nucleoside phosphonate
analogues architecture: synthesis and comparative evaluation toward
metabolic enzymes. ChemMedChem, 6, 1094–1106.
38. Blackburn,G.M., Kent,D.E. and Kolkmann,F. (1984) The synthesis
and metal binding characteristics of novel, isopolar phosphonate
analogs of nucleotidesIssue, J. Chem. Soc., 1, 1119–1125.
39. Halazy,S., Ehrhard,A. and Danzin,C. (1991)
9-(Difluorophosphonoalkyl)guanines as a new class of multisubstrate
analog inhibitors of purine nucleoside phosphorylase. J. Am. Chem.
Soc., 113, 315–317.
40. Martinez,J., Patkaniowska,A., Urlaub,H., Luhrmann,R. and
Tuschl,T. (2002) Single-stranded antisense siRNAs guide target RNA
cleavage in RNAi. Cell, 110, 563–574.