Ethionamide boosters. 2. Combining bioisosteric replacement and structure-based drug design to solve pharmacokinetic issues in a series of potent 1,2,4-oxadiazole EthR inhibitors

Article abstract of DOI:10.1021/jm200825u

Mycobacterial transcriptional repressor EthR controls the expression of EthA, the bacterial monooxygenase activating ethionamide, and is thus largely responsible for the low sensitivity of the human pathogen Mycobacterium tuberculosis to this antibiotic.

Full text of DOI:10.1021/jm200825u

Article
pubs.acs.org/jmc
Ethionamide Boosters. 2. Combining Bioisosteric Replacement and
Structure-Based Drug Design To Solve Pharmacokinetic Issues in a
Series of Potent 1,2,4-Oxadiazole EthR Inhibitors†
Marion Flipo,‡,§,∥,⊥,#,¶ Matthieu Desroses,‡,§,∥,⊥,#,¶ Nathalie Lecat-Guillet,‡,∞,×,●,⊥,# Baptiste Villemagne,‡,§,∥,⊥,#
Nicolas Blondiaux,‡,∞,×,●,⊥,#,¶ Florence Leroux,‡,§,∥,⊥,# Catherine Piveteau,‡,§,∥,⊥,# Vanessa Mathys,△
Marie-Pierre Flament,‡,£,# Juergen Siepmann,‡,£,# Vincent Villeret,‡,◇ Alexandre Wohlkonig,⊗ Rene Wintjens,◆,◇
́
̈
Sameh H. Soror,⊗ Thierry Christophe,▽,+ Hee Kyoung Jeon,▽ Camille Locht,‡,∞,×,●,⊥
Priscille Brodin,‡,∞,×,●,⊥,▽ Benoit Deprez,*,‡,§,∥,⊥,# Alain R. Baulard,‡,∞,×,●,⊥,#,¶ and Nicolas Willand‡,§,∥,⊥,#,¶
́
‡Universite
́
Lille Nord de France, F-59000 Lille, France
§Biostructures and Drug Discovery, INSERM U761, F-59000 Lille, France
∥UDSL, F-59000 Lille, France
⊥IPL, F-59019 Lille, France
#PRIM, F-59000 Lille, France
∞INSERM U1019, F-59000 Lille, France
×CNRS UMR8204, F-59021 Lille, France
●Center for Infection and Immunity of Lille, F-59019 Lille, France
◇IRI, USR 3078 CNRS, F-59658 Villeneuve d’Ascq, France
▽Biology of Intracellular Pathogens, Inserm Avenir, Institut Pasteur of Korea, 463-400 Gyeonggi-do, South Korea
△Tuberculosis and Mycobacteria, Communicable and Infectious Diseases, Scientific Institute of Public Health (WIV-ISP), 1050
Brussel, Belgium
£INSERM U1008, F-59000 Lille, France
⊗Structural Biology Brussels and Molecular and Cellular Interactions, VIB, 1050 Brussel, Belgium
◆Laboratoire de Chimie Gen
́ ́ ́
erale, Institut de Pharmacie, Universite Libre de Bruxelles, 1050 Brussel, Belgium
S
* Supporting Information
ABSTRACT: Mycobacterial transcriptional repressor EthR controls the expression of EthA, the bacterial monooxygenase
activating ethionamide, and is thus largely responsible for the low sensitivity of the human pathogen Mycobacterium tuberculosis to
this antibiotic. We recently reported structure−activity relationships of a series of 1,2,4-oxadiazole EthR inhibitors leading to the
discovery of potent ethionamide boosters. Despite high metabolic stability, pharmacokinetic evaluation revealed poor mice
exposure; therefore, a second phase of optimization was required. Herein a structure−property relationship study is reported
according to the replacement of the two aromatic heterocycles: 2-thienyl and 1,2,4-oxadiazolyl moieties. This work was done
using a combination of structure-based drug design and in vitro/ex vivo evaluations of ethionamide boosters on the targeted
protein EthR and on the human pathogen Mycobacterium tuberculosis. Thanks to this process, we identified compound 42
(BDM41906), which displays improved efficacy in addition to high exposure to mice after oral administration.
Received: June 24, 2011
Published: November 20, 2011
© 2011 American Chemical Society
68
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
INTRODUCTION
■
By killing more than 1.8 million people per year, tuberculosis
(TB) represents 2.5% of all preventable deaths globally. This
makes it the leading cause of mortality resulting from a bacterial
infection.1 The major obstacles to the global control of this
infectious disease include difficulties detecting and curing a
sufficient number of cases to interrupt transmission.2 Moreover,
current estimates suggest that one-third of the world’s popu-
lation is infected with the latent form of the pathogen and most
of the cases of TB are the result of reactivated latent infection.3
The introduction of the first-line drugs regimen to treat TB in
the 1960s led to optimism that the disease could be under
control. The efficacy of the drugs, coupled with increasing stan-
dards of health care, tended to rapidly decrease incidence of TB
in industrialized countries, which unfortunately countermined
the effort of development of new drugs. However, since the
1980s, the global TB incidence has stopped decreasing, partly
because of the co-infection with AIDS.4 Concomitant with
this picture, one now observes the development of multidrug-
resistant (MDR-TB) and extensively drug-resistant (XDR-TB)
strains that more than ever strengthened the need for new
drugs.5 However, drug-resistant tuberculosis is difficult to fight,
as patients must be treated for 2−4 years with a cocktail of 4−5
second-line drugs.6 These drugs are often associated with serious
side effects, which reduce patient compliance and thus lead to
high rates of recurrence and mortality.7 As such, there is a con-
certed effort in the search for alternative molecules that are active
against yet unexploited targets8 and for new strategies that can
improve the efficacy of drugs already used in the clinic.9,10
Figure 1. Structures of known EthR inhibitors.15,16
between the amide function of the ligands and side chain of
Asn179 located in the middle of the ligand binding domain. This
work led to the discovery of two potent EthR inhibitors (com-
pounds 2 and 3, Figure 1) that boost antibacterial activity of
ethionamide in the nanomolar range. Pharmacodynamic improve-
ments were achieved by introducing a 4,4,4-trifluorobutyryl terminal
chain (compound 3) and microsomal stability by replacing central
1,4-piperidyl with a (R)-1,3-pyrrolidyl scaffold (compound 2). In
spite of this improved microsomal stability, compound 2 displayed
poor mice exposure (AUC = 0.1 μg·mL−1·h, Table 3).
To improve pharmacokinetic properties of this series while
keeping high potency, we continued to explore further structure−
activity and structure−property relationships by modifying the
two aromatic heterocycles: 2-thienyl (compounds 4−33) and
1,2,4-oxadiazolyl rings (compounds 34−40). Structural mod-
ifications were assessed in the N-(4,4,4-trifluorobutyryl)-
piperidine series in order to avoid the stereogenic center. The
efficacy of analogues was compared using previously described ex
vivo phenotypic and in vitro functional assays.16−19 Physicochemical
and pharmacokinetic properties of the most active compounds were
determined in order to select a candidate for further in vivo
evaluation, and cocrystallization with EthR was performed with
key compound 5 to assess its binding mode. Finally, structure-
based optimization of the length of the trifluoroalkyl chain led to
the discovery of compound 42 (BDM41906), which presents an
8-fold increased activity profile, improved physicochemical
properties, and microsomal stability, eventually leading to
optimized mice exposure after oral administration (Figure 2).
TB-DRUG BOOSTING STRATEGY
■
Ethionamide is a drug widely used for the treatment of MDR-TB.
The efficacy of ethionamide in combination with amikacin,
pyrazinamide, and moxifloxacin has been reconfirmed in mice.11
As recalled by Lounis et al., this regimen is currently the most
potent one against MDR-TB in this in vivo model. Conse-
quently, as the number of MDR and XDR cases is growing
worldwide, the importance of ethionamide is steadily increas-
ing. Nevertheless, the prolonged use of ethionamide (750 mg/
day for 18−24 months) generally causes serious adverse effects,
such as gastrointestinal disorders, hepatitis, and various mental
disturbances which may drastically reduce patient compliance
and thus lead to high rates of recurrence and mortality.12
As with many anti-TB drugs, ethionamide is a prodrug that
needs to be transformed inside the mycobacteria to show its
antibacterial activity. Bioactivation of ethionamide is catalyzed
by the flavin monooxygenase EthA which is under the control
of the transcriptional repressor EthR, a member of the TetR
family of repressors.13,14
CHEMISTRY
■
As 2-thienyl derivatives previously optimized are susceptible to
forming reactive metabolites20 such as epoxides or sulfoxides,21,22
we explored modification or replacement of the 2-thienyl ring by
aromatic, heteroaromatic, or aliphatic rings (compounds 4−33).
The synthesis of compounds 4−33 proceeded in four steps
from commercial or synthesized carbonitriles (Scheme 1).
Thiazole-2-carbonitrile and thiazole-5-carbonitrile leading to
compounds 5 and 6 were synthesized in two steps from 1,3-
thiazole-2-carbaldehyde and 1,3-thiazole-5-carbaldehyde, re-
spectively.23 Amidoximes, obtained using hydroxylamine hydro-
chloride, reacted with Boc-isonipecotic acid and HBTU as activat-
ing agent. The acylated products were isolated by precipitation in
water prior to cyclization in DMF at 120 °C to yield the desired
1,2,4-oxadiazole ring (compounds 4b−33b).24 Deprotection of
the Boc-protecting group in acidic conditions was followed by
acylation with 4,4,4-trifluorobutyric acid using EDCI and HOBt
as coupling agents to yield compounds 4−33.
In order to improve the therapeutic index of ethionamide, we
developed a new concept based on the use of EthR inhibitors
that boost the bioactivation of the prodrug. In a previous work,
we designed the first inhibitors and validated EthR as a drugg-
able target. We showed that the sensitivity of M. tuberculosis to
ethionamide can be substantially increased in vitro and in vivo
by a pharmacological inhibition of EthR. Compound 1
(BDM31343, Figure 1) was able to triple the activity of
ethionamide in a M. tuberculosis infected mice model.15 We
recently reported the optimization of compound 1 by exploring
the replacement of its piperidine core and cyanoacetyl group.16
EthR and 1,2,4-oxadiazole inhibitors were cocrystallized, and
X-ray structures revealed the formation of a hydrogen bond
Further optimization was performed with the replacement of
the 1,2,4-oxadiazole ring by isomeric or isosteric aromatic
heterocycles according to the chemistry described in Scheme 2
(compounds 34−40). Thiazole derivatives (compounds 34 and
37) were obtained in three steps. Condensation of 2-bromo-1-
thiophen-2-ylethanone or 2-bromoacetophenone with 4-thio-
carbamoylpiperidine-1-carboxylic acid tert-butyl ester was achieved
69
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
Figure 2. Optimization process of EthR inhibitors that led to the discovery of compound 42.
a
Scheme 1. Synthesis of 1,2,4-Oxadiazole Derivatives for SAR Studies
a
Reagents and reaction conditions: (a) 1.5 equiv of NH2OH.HCl, 1.6 equiv of DIEA, EtOH, reflux; (b) 1 equiv of Boc-isonipecotic acid, 1.1 equiv of
HBTU, 3 equiv of DIEA, DMF, RT, 2 h to overnight; (c) DMF, 120 °C, 4−24 h; (d) 5 equiv of 4 N HCl dioxane, RT, 4 h to overnight; (e) 1.3
equiv of 4,4,4-trifluorobutyric acid, 1.3 equiv of EDCI, 0.3 equiv of HOBt, 4 equiv of DIEA, DMF, RT, overnight.
in THF, followed by piperidine deprotection in acidic conditions
and finally acylation with 4,4,4-trifluorobutyric acid using EDCI as
coupling agent. The reverse 1,2,4-oxadiazole derivative (com-
pound 35) was synthesized from 4-cyanopiperidine-1-carboxylic
acid tert-butyl ester. The corresponding amidoxime obtained
using hydroxylamine hydrochloride was acylated with thiophene-
2-carboxylic acid using HBTU and then cyclized in DMF.
Deprotection and acylation of piperidine yielded the desired
compound. Compounds 36 and 38 were obtained in one step by
acylation of commercially available 4-(5-(2-thienyl)-1H-pyrazol-3-
yl)piperidine and 4-(5-phenyl-1,3,4-oxadiazol-2-yl)piperidine as
described previously. Oxazole analogue (compound 39) was
obtained by the condensation of benzaldehyde oxime with 4-
ethynylpiperidine-1-carboxylic acid tert-butyl ester, synthesized
from 4-formylpiperidine-1-carboxylic acid tert-butyl ester and
diazo(diethoxyphosphoryl)acetic acid methyl ester as already
described in the literature.25 To replace 1,2,4-oxadiazole by a
pyrazolone ring (compound 40), ethyl benzoylacetate and 4-
hydrazinopiperidine dihydrochloride were heated in ethanol
under microwave irradiation followed by free piperidine acylation
with 4,4,4-trifluorobutyric acid.
two heteroaromatic rings led to a compound 10 times less active
(compound 4). Introduction of a 2-thiazolyl ring (compound 5,
EC50 = 0.5 μM) led to a slight decrease of activity. Fusion of the
thiazol ring with a methoxy substituted benzene ring (compound
7, EC50 = 0.2 μM) restored activity. 5-Thiazolyl was less favorable
(compound 6, EC50 = 2.5 μM), as it led to a compound 25 times
less active than reference compound 3. The bioisosteric replace-
ment of a 2-thienyl ring by phenyl slightly reduced activity
(compound 8, EC50 = 0.5 μM). Introduction of basic six-member
nitrogen rings, pyrazine (compound 9, EC50 > 10 μM), pyrimidine
(compound 10, EC50 = 9.0 μM), and pyridine (compounds 11−13),
strongly affected activity. Substitutions of the phenyl ring in ortho,
meta, and para positions with fluorine and chlorine were also
strongly detrimental for activity except compounds 15 and 19
for which activity was only slightly reduced (compound 15,
EC50 = 1.0 μM and compound 19, EC50 = 1.1 μM). Substitution
with an electron-donating group such as methoxy was also detri-
mental for activity (compounds 23−25), whereas introduction
of a methyl group was more tolerated (compounds 20−22).
Substitution with large electron-withdrawing group such as
trifluoromethyl group (compounds 26−28) destroyed activity
except in the para position but led to a compound 5 times less
active than a nonsubstituted phenyl derivative (compound 8).
Hydrogen-bond donor or acceptor functions such as hydroxyl
(compound 29) or dimethylamino (compound 30) introduced
in the para position of the phenyl ring strongly reduced activity.
The same result was obtained with a bulky tert-butyl group (com-
pound 31). Replacements by five- and six-member aliphatic rings
were also tested. Cyclopentyl group led to submicromolar active
compound 32 (EC50 = 0.8 μM), whereas higher homologation
strongly reduced activity (compound 33, EC50 = 4.0 μM).
RESULTS AND DISCUSSION
■
In this study, we explored SAR by replacing either the thio-
phene (compounds 4−33) or the oxadiazole (compounds 34−
40) in N-(4,4,4-trifluorobutyryl)piperidine series. Compounds
4−40 were screened as previously described on M. tuberculosis
infected macrophages in the presence of subactive concen-
tration of ethionamide.16 The concentration of ligand that
allows a dose of 0.1 μg/mL ethionamide (MIC99/10) to inhibit
50% of M. tuberculosis growth in macrophages was determined
and expressed as EC50.
This first structure−activity relationship study revealed the
importance of 2-thienyl moiety for intracellular activities. Replace-
ment by a nonsubstituted phenyl ring was tolerated as well as by
First, we investigated the replacement of a 2-thienyl ring (com-
pound 3) by five-member or six-member aromatic or aliphatic
rings (Table 1). Introduction of a methylene spacer between the
70
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
a
EC50 > 5.0 μM). In the phenyl series, neither introduction of
1,3,4-oxadiazole (compound 38, EC50 > 5 μM), isoxazole (com-
pound 39, EC50 = 4 μM), nor pyrazolone rings (compound 40,
EC50 > 5 μM) led to more active compounds.
Scheme 2. Synthesis of Compounds 34−40
In conclusion, in the 1,2,4-oxadiazole series the 2-thienyl motif
may be substituted by 2-thiazolyl, 6-methoxy-2-benzothiazolyl,
phenyl, or cyclopentyl. Moreover, the presence of 1,2,4-oxadiazole
ring appears to be essential for activity and in particular the posi-
tion of the oxygen atom in the heterocyclic ring seems critical.
Only 1,3-thiazolyl motif introduction maintained submicromolar
activity; however, the activity was 8 times reduced in comparison
with that of the 1,2,4-oxadiazole reference compound 3. Structure−
activity relationships are summarized in Figure 3.
Figure 3. Summary of SAR study.
In order to confirm that the boosting activity of submicro-
molar compounds 5, 7, and 8 (EC50 ≤ 0.5 μM) is specifically
linked to the inhibition of EthR, we tested their capacity to
inhibit the binding of EthR to its DNA operator, using the pre-
viously described functional surface plasmon resonance (SPR)
assay.16 All tested compounds inhibited binding of EthR to its
promoter in a dose dependent manner with IC50 in the micro-
molar range (Table 3).
Compounds displaying IC50 < 3 μM were further evaluated
for their solubility and microsomal stability. Whereas all com-
pounds are compliant with Lipinski and Veber’s rules26,27 (data
not shown), they present significantly different physicochemical
and pharmacokinetic properties. The most lipophilic compound
(compound 7, clogP = 3.22) was also the less soluble (solubility =
6 μg/mL). Conversely, the less lipophilic derivative (compound
5, clogP = 1.61) appeared to be the most soluble analogue in the
1,2,4-oxadiazole series (solubility = 300 μg/mL). As previously
described, compound 3 (t1/2 = 5 min) was far less stable than the
(R)-1,3-pyrrolidine derivative in mouse microsomes (compound
2, t1/2 = 298 min).16 Replacement of 2-thienyl by 2-thiazolyl
enhanced microsomal stability (compound 5, t1/2 = 34 min,
Clint = 37 μL·min−1·mg−1). On the basis of this observation, we
decided to synthesize compound 41 which combine 2-thiazolyl
and (R)-1,3-pyrrolidine as key modifications. Unfortunately,
this compound was 10 times less active than the two parent
compounds, which disqualified it for further ADME studies.
Conversely, compound 7, which had promising activities, was
unfortunately poorly soluble (6 μg/mL) and stable on micro-
somes (t1/2 = 6 min). The in vivo pharmacokinetic parameters
of the most stable compounds 2 and 5 were then evaluated in
mice by oral administration at 20 mg/kg using DMSO as
vehicle. Area under the concentration−time curve (AUC) for
a
Reagents and reaction conditions: (a) THF, 70 °C, overnight; (b) 4 N
HCl, dioxane, RT, overnight; (c) 2 equiv of 4,4,4-trifluorobutyric acid,
2 equiv of EDCI, 4 equiv of TEA, DCM, RT, overnight; (d) 1.5 equiv of
H2NOH·HCl, 1.6 equiv of DIEA, EtOH, reflux, 5 h; (e) 1 equiv of
HBTU, 2.5 equiv of DIEA, DMF, RT, overnight, then 110 °C, 5 h; (f)
diazo(diethoxyphosphoryl)acetic acid methyl ester, 2 equiv of K2CO3,
MeOH, RT, overnight; (g) NaOCl, DCM, 0 °C, then RT, overnight;
(h) EtOH, microwave 50 W, 45 min.
2-thiazolyl or 6-methoxy-2-benzothiazolyl heterocycles and cyclo-
pentyl group.
The second part of the lead optimization process explored
the use of five-member heterocycles as an alternative to the 1,2,4-
oxadiazole linking motif in the 2-thienyl and phenyl series (Table 2).
Replacement of oxadiazole by a 1,3-thiazole ring in both series
led to poorly soluble (data not shown) and less active compounds
(compounds 34 and 37). Decrease in activity was equivalent for
2-thienyl and phenyl series. Interchanging adjacent oxygen and
nitrogen atoms of 1,2,4-oxadiazole ring (compound 35, EC50
1.0 μM) slightly reduced activity, whereas exchanging 1,2,4-
oxadiazole by pyrazole strongly affected activity (compound 36,
=
71
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
Table 1. Intracellular Activities of Compounds 3−33
a
EC50 represents the concentration of ligand that allows ethionamide at 0.1 μg/mL (normal MIC/10) to inhibit 50% of M. tuberculosis growth in
macrophages. EC50 values are the mean of two experiments. SD was <10% in most cases.
compounds 2 and 5 were respectively 0.1 and 73.5 μg·mL−1·h
(Table 3). Despite its good microsomal stability, compound 2
displays a poor in vivo exposure maybe due to low absorption
after oral administration. Therefore its plasma concentration is
above its EC50 value (0.5 μM) for only 30 min (see Supporting
Information). At this stage, compound 5 presented the best
compromise in terms of activity, solubility, microsomal stability,
and mouse exposure. In order to reduce potential toxicity inherent
to repeated in vivo administration of DMSO, we further evaluated
a more convenient aqueous hydroxypropyl-β-cyclodextrin-based
formulation and AUC for compound 5 reached 100.5 μg·mL−1·h
(Table 3). The plasma concentration of this compound was
above 30 times its EC50 value (0.5 μM) for more than 4 h (see
Supporting Information).
To gain insight in the interactions between compound 5 and
EthR, cocrystals were produced (Figure 4). X-ray diffraction
data revealed that the oxadiazole and the piperidine are facing,
respectively, Trp103 and Trp207, while the 4,4,4-trifluorobutyryl
72
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
Asn179 identical to the one observed with compound 5 (Figure 5).
However, the ligand has been forced to move up which abol-
ished hydrogen bond interaction between 1,2,4-oxadiazole ring
and Thr149. But the improved functional activity of compound
42 is probably due to better van der Waals interactions along
the surface, especially between the trifluoroaliphatic chain and
the hydrophobic bottom pocket composed of Trp145, Trp138,
Phe184, and Glu180.
Table 2. Intracellular Activities of Compounds 3, 8, and 34−40
CONCLUSION
■
In this study, we have extensively explored the structure−
activity and structure−property relationships of 1,2,4-oxadia-
zole derivatives and bioisosteric analogues as EthR inhibitors
and ethionamide boosters. The challenge of this work was to
improve microsomal stability and mice exposure of this series
while keeping pharmacological potency. On the basis of a pre-
vious SAR study,16 we first explored replacement of a 2-thienyl
heterocycle by five or six-member heteroaromatic, aromatic, or
alicyclic rings. The best compromise was obtained with a bio-
isosteric 1,3-thiazol-2-yl ring (compound 5). This first modification
did not improve activity but did enhance solubility and microsomal
stability. In the second step, we demonstrated that both the
nature and the position of the oxygen and nitrogen atoms of
the 1,2,4-oxadiazole heterocycle are optimal to ensure efficient
inhibition of EthR. Finally, exploring X-ray crystal structure of
compound 5, liganded to EthR, we optimized ligand−receptor
interactions by lengthening the 4,4,4-trifluorobutyryl chain to a
5,5,5-trifluoropentenyl chain in order to optimize hydrophobic
contacts. This modification led to the discovery of compound
42 (BDM41906) that revealed optimal physicochemical and
pharmacokinetic properties and at the same time that was able
to boost 10-fold ethionamide activity on M. tuberculosis infected
macrophages at nanomolar concentration (EC50 = 60 nM).
Notably, this compound revealed good systemic exposure fol-
lowing oral administration at 20 mg/kg (AUC = 98.6 μg·mL−1·h).
Encouraged by pharmacodynamic and pharmacokinetic properties,
we intend to evaluate compound 42 in a mouse model of
M. tuberculosis infection. Results will be reported in due course.
a
EC50 represents the concentration of ligand that allows ethionamide
at 0.1 μg/mL (normal MIC/10) to inhibit 50% of M. tuberculosis
growth in macrophages. EC50 values are the mean of two experiments.
SD was <10% in most cases.
chain points toward Trp138 and Phe184. As previously observed
for other ligands, amide function is hydrogen bonded to the side
chain of Asn179. Importantly, a second hydrogen bond seems to
connect the oxygen atom of the 1,2,4-oxadiazole with Thr149.
This observation is in agreement with our SAR study revealing
that the oxygen atom in this heterocycle is crucial for activity.
This cocrystal structure also suggests that the bottom of the
hydrophobic pocket of EthR may advantageously accept ana-
logues with an extended flexible hydrophobic chain. Thus, extension
of the 4,4,4-trifluorobutyryl chain length by one supplementary
methylene spacer (compound 42) was achieved according to
Scheme 1 by coupling the free piperidine 5c with 5,5,5-trifluo-
ropentanoic acid. Excitingly, this key modification led to a com-
pound 8-fold more active than 5, reaching the best activities in
this series with IC50 and EC50 equal to 400 and 60 nM, respec-
tively. Compound 42 also proved to have the best physico-
chemical and pharmacokinetic properties including high solubility
in PBS aqueous buffers (410 μg/mL) and fairly good stability in
mouse liver microsomes with an intrinsic clearance equal to
15 μL·min−1·mg−1 (Table 3). Since it turned out to be one of
the most promising compounds of this series, compound 42
was formulated in hydroxypropyl-β-cyclodextrin aqueous solu-
tion and administered to mice as a single oral dose of 20 mg/kg.
The AUC for this compound reached a reasonable value of
98.6 μg·mL−1·h, and the plasma concentration was above 30 times
its EC50 (0.06 μM) for more than 4 h (see Supporting
Information). The crystal structure of EthR in complex with
compound 42 showed a network of hydrogen bond involving
EXPERIMENTAL SECTION
■
Biology. EthR-DNA Binding Assay. SPR analysis of the
molecular interactions between EthR and the ethA promoter region
was performed using “research grade streptavidin-coated sensor chips
(sensor chip SA, Biacore Inc.)” on a BIAcore3000 instrument (Biacore,
Uppsala, Sweden). The 106-bp biotinylated DNA fragment overlapping
the ethA/ethR intergenic region was obtained by polymerase chain
reaction (PCR), purified by agarose gel electrophoresis, and
immobilized onto the SA sensor chip. The biotinylated DNA fragment
was injected into one channel of the chip at 150 ng/mL to obtain a
75 resonance unit (RU) stable fixation to immobilize streptavidin.
Another channel of the chip was loaded with a biotinylated double
stranded 113-bp long irrelevant DNA fragment (+14 to +127 fragment
of the E. coli bla gene PCR amplified using oligonucleotides O-343
(TTTCCGTGTCGCCCTTATTCC) and O-344 (CCACTCGTG-
CACCCAACTGAT) and pUC18 as substrate). Binding of EthR to
the immobilized DNA was performed at 25 °C in 10 mM Tris-HCl
(pH 7.5), 200 mM NaCl, 0.1 mM EDTA, 1 mM DTT, and 1% DMSO
at a flow rate of 20 μL/min for 3 min. Specific interaction (SI)
between EthR and the 106-bp DNA fragment was defined as the signal
difference between both channels. For dose response curves estab-
lishment, the test compounds were serially diluted in the binding
buffer containing 590 nM EthR, incubated for 5 min at 37 °C, and
then injected in the BIAcore at a flow rate of 20 μL/min for 3 min. SI
values were measured at the end of the injection period and used to
73
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
Table 3. Biological Activities, Physicochemical Properties, Mouse Microsomal Stability, and PK Parameters of Compounds 2, 3,
i
5, 7, 8, 41, and 42
a
EC50 represents the concentration of ligand that allows ethionamide at 0.1 μg/mL (normal MIC/10) to inhibit 50% of M. tuberculosis growth in
b
c
macrophages. IC50 represents the concentration of ligand that inhibits 50% of the interaction of EthR with its promoter. clogP was calculated using
d
e
Pipeline Pilot software from Accelrys. Solubilities were determined at pH 7.4. Propranolol, known as a high hepatic clearance drug in rodents, was
f
used as reference for microsomal incubations (t1/2 = 13 min, CLint = 121 μL·min−1·mg−1). All the compounds have been tested in the same
conditions at one concentration (1 μM). The values given here should not be read as bona fide clearance values but as indicators to rank compounds
g
h
according to metabolic stability. Dose: 20 mg/kg. Vehicle: 100% DMSO. Dose: 20 mg/kg. Vehicle: aqueous solution of 100 mM hydroxypropyl-β-
i
cyclodextrin-based formulation. See Experimental Section for details on all assays.
Figure 4. (A) X-ray structure representation of the ligand-binding pocket of mycobacterial transcriptional repressor EthR filled with compound 5
(PDB code 3SDG) surrounded by its omit Fo − Fc map at 3.0σ contour level. The Fo − Fc map was calculated prior to adding the ligand to the
model. (B) X-ray structure representation of the homodimeric conformation of EthR filled in both monomers with compound 5. Surface of ligand
binding domain is highlighted, and hydrogen bonds with Asn179 and Thr149 are represented with dotted line. Colors represent the following: blue
(compound 5) or green (EthR) = carbon, dark blue = nitrogen, red = oxygen, yellow = sulfur, white = fluorine. Images were generated with Pymol.
calculate the inhibition of protein−DNA interaction. IC50 values were
determined using GraphPad Prism software.
of M. tuberculosis H37Rv-GFP colonized macrophages were dispensed
with the Wellmate (Matrix) into 384-well Evotec plates preplated with
10 μL of compound mixture diluted in cell medium and incubated for
5 days at 37 °C, 5% CO2. Macrophages were then stained with SYTO
60 (Invitrogen, S11342) for 1 h followed by plate sealing. Confocal
images were recorded on an automated fluorescent ultrahigh-through-
put microscope, Opera (Evotec). This microscope is based on an
inverted microscope architecture that allows imaging of cells cultivated
Intracellular Assay. Raw264.7 macrophages (108 cells) were
infected with H37Rv-GFP suspension at a MOI of 1:1 in 300 mL for
2 h at 37 °C with shaking (100 rpm). After two washes by centrifuga-
tion at 1100 rpm for 5 min, the remaining extracellular bacilli from
the infected cells suspension were killed by a 1 h Amykacin (20 μM,
Sigma, A2324-5G) treatment. After a final centrifugation step, 40 μL
74
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
Figure 5. (A) X-ray structure representation of the ligand-binding pocket of mycobacterial transcriptional repressor EthR filled with compound 42
(PDB code 3SFI) surrounded by its initial omit Fo − Fc map at 3.0σ contour level. The Fo − Fc map was calculated prior to adding the ligand to the
model. (B) X-ray structure representation of the homodimeric conformation of EthR filled in both monomers with compound 42. Surface of ligand
binding domain is highlighted, and the hydrogen bond with Asn179 is represented with dotted line. Colors represent the following: blue (compound
42) or green (EthR) = carbon, dark blue = nitrogen, red = oxygen, yellow = sulfur, white = fluorine. Images were generated with Pymol.
in 96- or 384-well microplates (Evotec). Images were acquired with a
20× water immersion objective (NA 0.70). A double laser excitation
(488 and 635 nm) and dedicated dichroic mirrors were used to record
green fluorescence of mycobacteria and red fluorescence of the macro-
phages on two different cameras, respectively. A series of four pictures
at the center of each well were taken, and each image was then pro-
cessed using dedicated image analysis.17,18 The percent of infected
cells and the number of cells are the two parameters extracted from
images analysis as previously reported.18 Data are the average of two
replicates.
Potency Assay of Test Compounds on M. tuberculosis
(Ethionamide Concentration Fixed at 0.1 μg/mL, Serial Dilution
of Test Compounds). Ethionamide (Sigma E6005-5G) is diluted
into DMSO to 10 mg/mL, and aliquots are stored frozen at −20 °C.
Test compounds are suspended in pure DMSO at 40 mg/mL in
Matrix tubes and then diluted by a 10-fold dilution to 4 mg/mL in
Eppendorf tubes. Ten 2-fold serial dilutions of compounds are per-
formed in DMSO in Greiner 384-well V-shape polypropylene plates
(Greiner, no. 781280). Equal volumes (5 μL) of diluted compounds
and of ethionamide are transferred to a 384-well low volume polypro-
pylene plate (Corning, no. 3672). Two independent replicates were
done for each setting. On the day of the experiment, 0.5 μL of
compound-plate is transferred by EVOBird platform (Evotec) to cell
assay plates preplated with 10 μL of assay medium.
adding ice-cold acetonitrile containing 1 μM internal standard (four
volumes). We centrifuged the samples for 10 min at 10000g and 4 °C
to pellet precipitated microsomal proteins, and we subjected the
supernatant to liquid chromatography−tandem mass spectrometry
(LC−MS/MS) analysis. We performed control incubations with dena-
turated microsomes with acetonitrile containing 1 μM internal stan-
dard, and we took samples at the start of the incubation and 40 min
later (to evaluate the chemical stability of the compounds in the experi-
mental conditions). For LC−MS/MS, we used a Varian HPLC−MS/
MS system 1200L triple−quadrupole mass spectrometer equipped with
an electrospray ionization source. Analytes were separated in incubation
mixtures by HPLC with a Luna C18, 5 μm, 50 mm × 2.1 mm column
(Phenomenex). The mobile phase solvents used were 0.1% formic acid
in water (A) or 0.1% formic acid in acetonitrile (B). We applied the
following mobile phase gradient: 2−98% B for 2.30 min; hold at 98% B
for 1.00 min; 98−2% B for 0.10 min; 2% B hold for 1.50 min. The
injection volume was 10 μL, and the flow rate was 0.6 mL·min−1. We
quantified each compound by converting the corresponding analyte/
internal standard peak area ratios to percentage drug remaining,
using the initial ratio values in control incubations as 100%. We used
propranolol, known as a high hepatic clearance drug in rodents, as a
quality-control compound for the microsomal incubations. Intrinsic
clearance was determined based on the following equation,
ADME Studies. Solubility/Metabolic Stability. These experi-
ments were analyzed using a LC−MS−MS triple−quadrupole system
(Varian 1200ws) under SIM or MRM detection with optimized mass
parameters (declustering potential, collision energy, and drying gas
temperature).
Solubility. The 10 mM solution (40 μL) in DMSO of the sample
was added to 1.960 mL of MeOH or PBS at pH 7.4. The samples were
gently shaken for 24 h at room temperature, then centrifuged for
5 min, and filtered over 0.45 μm filters. An amount equal to 20 μL
of each solution was added to 180 μL of MeOH and analyzed by
LC−MS. The solubility was determined by the ratio of mass signal
areas PBS/MeOH.
Metabolic Stability. We purchased mouse (CD-1) liver micro-
somes from BD Gentest. We performed all incubations in duplicate
in a shaking water bath at 37 °C. The incubation mixtures contained
1 μM compound with 1% methanol used as a vehicle, mouse liver
microsomes (0.6 mg of microsomal protein per mL), 5 mM MgCl2,
1 mM NADP, 5 mM glucose 6-phosphate, 0.4 U·mL−1 glucose
6-phosphate dehydrogenase, and 50 mM potassium phosphate buffer
(pH 7.4) in a final volume of 1.5 mL. We took samples at 5, 10, 20, 30,
and 40 min after microsome addition, and we stopped the reactions by
Cl = (dose/AUC)/concentration of microsomes
int
and is expressed as μL·min−1·mg−1 proteins.
Formulation. Compounds were dissolved in an aqueous hydrox-
ypropyl-β-cyclodextrin (100 mM) solution to reach a final con-
centration of 3 mg/mL (upon horizontal shaking in flasks at 37 °C
overnight) or were dissolved in 100% DMSO to reach a final
concentration of 14.5 mg/mL.
Pharmacokinetic Experiments (DMSO Formulation). Com-
pounds were administered at 20 mg per kg body weight by oral route
to Swiss mice (22−24 g) (WIV-ISP breeding). Three mice per time
point were anesthetized with ketamine−xyalzine and were bled at
10 min, 20 min, 30 min, 1 h, 2 h, and 4 h after administration of a
single dose of ligands. Blood was collected from the brachial region on
lithium heparinated tubes in order to prevent coagulation. The blood
samples were centrifuged (5000g, 15 min) for plasma separation.
Pharmacokinetic Experiments (Aqueous Hydroxypropyl-β-
cyclodextrin Formulation). Compounds solubilized in aqueous
hydroxypropyl-β-cyclodextrin solution (100 mM) were orally
administered in single dose (20 mg/kg) to CD1 female mice (25−
30 g) (Charles River Laboratories). After 10 min, 20 min, 30 min, 1 h,
75
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
2 h, and 4 h, mice were anesthetized with an intraperitoneal
coadministration of ketamine (80 mg/kg) and Domitor (0.8 mg/kg)
and blood was sampled from the inferior vena cava. Mice were
immediately sacrificed by cervical dislocation. Three mice were dosed
per kinetics time point. The blood samples collected on lithium
heparinated tubes in order to prevent coagulation were centrifuged
(5000g, 15 min, 4 °C) for plasma separation.
Plasma Samples Preparation. Plasma samples were thawed on
ice. Aliquots of 50 μL were precipitated with 450 μL of ice cold acetonitrile
containing 2-cyclopentyl-1-[4-(3-thiophen-2-yl[1,2,4]oxadiazol-5-yl)-
piperidin-1-yl]ethanone16 (1 μM) used as internal standard. The
samples were vigorously mixed with a Vortex and centrifuged at 10 000
and scaling and merging were performed using the CCP4 package
(Collaborative Computational Project Number 4, 1994).30 Both
structures were refined with the macromolecular refinement program
REFMAC5. Initially ligands were fitted into the density using findligand
(CCP4) and then manually positioned using Coot.31 The final R (Rfree
)
factors are 25.1% and 27.3% for compounds 5 and 42, respectively. Both
structures have been deposited with the Protein Data Bank (PDB)
under the accession codes 3SDG and 3SFI.
Chemistry. General Information. NMR spectra were recorded
on a Bruker DRX-300 spectrometer. Chemical shifts are in parts per
million (ppm). The assignments were made using one-dimensional
(1D) 1H and 13C spectra and two-dimensional (2D) HSQC and COSY
spectra. Mass spectra were recorded with a LC−MS−MS triple−
quadrupole system (Varian 1200ws) or a LCMS (Waters Alliance
Micromass ZQ 2000). LCMS analysis was performed using a C18
TSK-GEL Super ODS 2 μm particle size column, dimensions 50 mm
× 4.6 mm. A gradient starting from 100% H2O/0.1% formic acid and
reaching 20% H2O/80% CH3CN/0.08% formic acid within 10 min at
a flow rate of 1 mL/min was used. Preparative HPLC were performed
using a Varian PRoStar system using an OmniSphere 10 column C18
250 mm × 41.4 mm Dynamax from Varian, Inc. A gradient starting
from 20% CH3CN/80% H2O/0.1% formic acid and reaching 100%
CH3CN/0.1% formic acid at a flow rate of 80 mL/min or 20%
MeOH/80% H2O/0.1% formic acid reaching 100% MeOH/0.1%
formic acid was used. Purity (%) was determined by reversed phase
HPLC, using UV detection (215 nm), and all compounds showed
Table 4. Optimum Mass Spectrometer Conditions and
Fragmentations of Compounds 2, 5, and 42
precursor ions,
predominant
product ion, m/z
capillary CE
drying
compd
m/z [M + H]+
(V)
(V) gas (°C)
2
346.1
361.1
375.1
222.1
237.1
237.1
56
60
70
20
30
35
400
400
400
5
42
rpm at 4 °C for 10 min, and the supernatants were transferred into
Matrix tubes for LC−MS−MS analysis (Table 4). Spiked standard
solutions (10, 50, 100, 500, 1000, 5000, 10 000, and 50 000 nM) were
prepared the same way. For LC−MS/MS analysis, we used a Varian
HPLC−MS/MS system 1200L triple−quadrupole mass spectro-
meter equipped with an electrospray ionization source. Analytes were
separated in incubation mixtures by HPLC with a Luna C18, 5 μm,
50 mm × 2.1 mm column (Phenomenex). The mobile phase solvents
used were 0.1% formic acid in water (A) or 0.1% formic acid in
acetonitrile (B). We applied the following mobile phase gradient:
2−98% B for 2.30 min; hold at 98% B for 1.00 min; 98−2% B for
0.10 min; hold at 2% B for 1.50 min. The injection volume was 10 μL,
and the flow rate was 0.6 mL·min−1.
Crystal Structure Determination of EthR Ligand Com-
plexes. EthR crystals were produced by the vapor diffusion method
as described previously.28 The crystallization buffer contained 1.4−
1.65 M ammonium sulfate (using 0.05 M increment), 15% glycerol,
and 0.1 M MES, pH 6.7. The EthR ligand complexes were prepared by
mixing 1 μL of ligand (33 mM in 100% DMS0) and 9 μL of the purified
protein (9 mg/mL) and equilibrated for 30 min at room temperature.
The X-ray diffraction data were collected on a Mar CCD Mosaic3
detector using synchrotron radiation on PX beamlines (SLS, PSI,
Switzerland). EthR crystals belonged to the space group P41212, with
one monomer in the asymmetric unit. Data collection statistics are
summarized in Table 5. Indexing was performed using iMOSFLM,29
purity greater than 95%. Melting points were determined on a Buchi
̈
B-540 apparatus and are uncorrected. All commercial reagents and
solvents were used without further purification.
General Procedure for Synthesis of Amidoximes (4a, 7a, 8a,
10a, 11a, 14a−33a). Carbonitrile (1 equiv), hydroxylamine chloride
(1.5 equiv), and DIEA (1.6 equiv) were mixed in absolute EtOH (1 M).
The reaction mixture was refluxed until all the nitrile was consumed
(TLC or LCMS control), and then the solvent was evaporated under
reduced pressure. The residue was dissolved in AcOEt, washed twice
with water and once with brine. The organic layer was dried over
MgSO4 and then evaporated under reduced pressure.
Synthesis of 1,3-Thiazole-2-amidoxime (5a). Hydroxylamine
hydrochloride (9.03 g, 130 mmol) was added to a solution of 1,3-
thiazole-2-carbaldehyde (14.71 g, 130 mmol) and pyridine (10.5 mL,
130 mmol) in DCM (100 mL). The reaction mixture was stirred over-
night at room temperature and then washed twice with water. The
organic layer was dried over MgSO4 and then evaporated under
reduced pressure to give 15.26 g of 1,3-thiazole-2-carbaldehyde oxime
(yield 92%). 1,3-Thiazole-2-carbaldehyde oxime (15.23 g, 119 mmol,
1 equiv) was dissolved in 80 mL of dioxane, and then TEA (41.4 mL,
2.5 equiv) was added. The reaction mixture was cooled to 0 °C, and
then trifluoroacetic anhydride (18.3 mL, 1.1 equiv) was added dropwise
Table 5. Data Collection Statistics
5
42
beamline
PXIII, SLS, PSI, Switzerland
PX, SLS, PSI, Switzerland
crystal data
Matthews coefficient, VM (Å3 Da−1
)
2.98
2.86
solvent content (%)
unit cell data
58.41
56.66
space group
a, b, c (Å)
P41212
P41212
121.8, 121.8, 33.61
90, 90, 90
1.0000
120.76, 120.76, 33.57
90, 90, 90
α, β, γ (deg)
wavelength (Å)
temp (K)
1.0000
100
100
resolution range (Å)
no. of unique reflections
multiplicity
33.79−1.87 (1.97−1.87)
20446 (3079)
7.5 (6.7)
32.30−2.34 (2.37−2.31)
10878 (2639)
5.5 (5.6)
completeness (%)
⟨I/σ(I)⟩
100 (100)
14 (3.0)
99.6 (99.7)
7.8 (2.3)
Rmerge
9.0 (56.4)
15.8 (75.6)
76
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
to the mixture. The solution was stirred overnight at room temperature
and then evaporated. The residue was dissolved in DCM and then
washed twice with water. The organic layer was dried over MgSO4 and
then evaporated under reduced pressure to give 1,3-thiazole-2-car-
bonitrile. This compound was used in the next step without further
purification. 1,3-Thiazole-2-carbonitrile (13.11 g, 119 mmol, 1 equiv),
hydroxylamine hydrochloride (12.4 g, 1.5 equiv), and DIEA (33 mL, 1.6
equiv) were mixed in absolute EtOH (150 mL). The reaction mixture
was refluxed 4 h, and then the solvent was evaporated under reduced
pressure. The residue was dissolved in AcOEt, washed twice with water
and once with brine. The organic layer was dried over MgSO4 and then
evaporated under reduced pressure to give 15.86 g of 1,3-thiazole-2-
amidoxime (yield, 93% over two steps).
4-[3-Thiophen-2-ylmethyl[1,2,4]-oxadiazol-5-yl]piperidine
(4c). 1H NMR (CDCl3) δ 7.19 (dd, J = 5.0 Hz, J = 1.4 Hz, 1H),
6.92−6.97 (m, 2H), 4.25 (s, 2H), 3.19−3.26 (m, 2H), 3.06−3.15 (m,
1H), 2.79−2.88 (m, 2H), 2.11−2.17 (m, 2H), 1.86−1.98 (m, 2H). MS
[M + H]+ m/z 250.
4-(3-Thiazol-2-yl[1,2,4]oxadiazol-5-yl)piperidine Hydro-
chloride (5c). White powder. 1H NMR (D2O) δ 7.96 (d, J =
3.2 Hz, 1H), 7.81 (d, J = 3.2 Hz, 1H), 3.45−3.53 (m, 3H), 3.11−
3.20 (m, 2H), 2.34−2.40 (m, 2H), 2.00−2.14 (m, 2H). MS [M + H]+
m/z 237.
4-(3-Thiazol-5-yl[1,2,4]oxadiazol-5-yl)piperidine Hydro-
chloride (6c). White powder. 1H NMR (DMSO-d6) δ 9.30 (s,
1H), 8.52 (s, 1H), 3.44−3.53 (m, 1H), 3.31−3.36 (m, 2H), 3.00−3.10
(m, 2H), 2.23−2.29 (m, 2H), 1.91−2.05 (m, 2H). MS [M + H]+ m/z
237.
Synthesis of 1,3-Thiazole-5-amidoxime (6a). Hydroxylamine
hydrochloride (3.07 g, 44 mmol) was added to a solution of 1,3-
thiazole-5-carbaldehyde (5 g, 44 mmol) and pyridine (3.7 mL) in
DCM (25 mL). The reaction mixture was stirred overnight at room
temperature and then washed once with water. The product was
recovered by filtration to give 5.23 g of 1,3-thiazole-5-carbaldehyde
oxime (yield 92%). 1,3-Thiazole-5-carbaldehyde oxime (2.5 g, 19.5
mmol, 1 equiv) was dissolved in 12 mL of dioxane, and then TEA
(6.8 mL, 2.5 equiv) was added. The reaction mixture was cooled to
0 °C, and then trifluoroacetic anhydride (3.0 mL, 1.1 equiv) was added
dropwise to the reaction. The solution was stirred overnight at room
temperature and then 1.1 equiv of trifluoroacetic anhydride was added
to complete the reaction. The solution was stirred overnight at room
temperature and then evaporated. The residue was dissolved in DCM
and then washed five times with water. The organic layer was dried
over MgSO4 and then evaporated under reduced pressure to give 1.25 g
of 1,3-thiazole-5-carbonitrile (yield, 58%). 1,3-Thiazole-5-carbonitrile
(1 g, 9.08 mmol, 1 equiv), hydroxylamine hydrochloride (0.95 g, 1.5
equiv), and DIEA (2.5 mL, 1.6 equiv) were mixed in absolute EtOH
(30 mL). The reaction mixture was refluxed for 5 h, and then the sol-
vent was evapored under reduced pressure. The residue was dissolved
in AcOEt, washed twice with water and once with brine. The organic
layer was dried over MgSO4 and then evaporated under reduced pres-
sure to give 940 mg of 1,3-thiazole-5-amidoxime (yield, 72%).
General Procedure for Synthesis of 1,2,4-Oxadiazole (4b−8b,
10b, 11b, 14b−33b). 1-Boc-piperidine-4-carboxylic acid (10 mmol, 1
equiv), HBTU (1.1 equiv), and DIEA (3 equiv) were dissolved in
DMF (15 mL). The solution was stirred for 5 min, and then the
amidoxime (4a−8a, 10a, 11a, 14a−33a) (1 equiv) was added. The
reaction mixture was stirred at room temperature for 2 h to overnight
and then poured in 50 mL of water. The reaction mixture became a
thick crystalline slurry. The product was recovered by filtration and
washed with water. Compounds 4b, 6b, and 29b did not precipitate in
water. The product was extracted 3 times with AcOEt, and then the
organic layers were joined, washed twice with saturated aqueous
NaHCO3 and once with brine, then dried over MgSO4 and evaporated
under reduced pressure. The solid obtained was dissolved in DMF
(15 mL), and then the reaction mixture was heated at 120 °C for 4−24 h.
The solvent was removed under vacuum, and the residue was dissolved
in AcOEt. The organic layer was washed twice with 1 N HCl, twice
with saturated aqueous NaHCO3, and once with brine, then dried over
MgSO4 and evaporated under reduced pressure.
4-[3-(6-Methoxybenzothiazol-2-yl)-1,2,4-oxadiazol-5-yl]-
1
piperidine Hydrochloride (7c). White powder. H NMR (D2O) δ
7.57 (d, J = 9.0 Hz, 1H), 7.06 (s, 1H), 6.82 (d, J = 9.0 Hz, 1H), 3.67
(s, 3H), 3.50−3.70 (m, 3H), 3.24−3.31 (m, 2H), 2.43−2.48 (m, 2H),
2.08−2.20 (m, 2H). MS [M + H]+ m/z 317.
4-(3-Phenyl[1,2,4]oxadiazol-5-yl)piperidine Hydrochloride
1
(8c). White powder. H NMR (MeOD) δ 8.02 (m, 2H), 7.46 (m,
3H), 3.48 (m, 3H), 3.17 (m, 2H), 2.39 (m, 2H), 2.10 (m, 2H). MS
[M + H]+ m/z 230.
4-(3-Pyrimidin-2-yl-1,2,4-oxadiazol-5-yl)piperidine Hydro-
1
chloride (10c). White powder. H NMR (DMSO-d6) δ 9.42−9.61
(m, 2H), 9.04 (d, J = 4.8 Hz, 2H), 7.73 (t, J = 4.8 Hz, 1H), 3.52−3.61
(m, 1H), 3.30−3.34 (m, 2H), 3.01−3.13 (m, 2H), 2.25−2.30 (m, 2H),
2.02−2.16 (m, 2H). MS [M + H]+ m/z 232.
2-(5-Piperidin-4-yl[1,2,4]oxadiazol-3-yl)pyridine Hydro-
1
chloride (11c). White powder. H NMR (MeOD) δ 8.93 (m, 1H),
8.68 (m, 2H), 8.19 (m, 1H), 3.64 (m, 1H), 3.52 (m, 2H), 3.24 (m,
2H), 2.47 (m, 2H), 2.21 (m, 2H). MS [M + H]+ m/z 231.
4-[3-(2-Fluorophenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (14c). White powder. 1H NMR (DMSO-d6) δ 9.28
(brs, 2H), 8.01 (td, J = 7.5 Hz, J = 1.7 Hz, 1H), 7.62−7.69 (m, 1H),
7.38−7.47 (m, 2H), 3.49−3.59 (m, 1H), 3.30−3.36 (m, 2H), 3.02−
3.11 (m, 2H), 2.23−2.29 (m, 2H), 1.99−2.12 (m, 2H). MS [M + H]+
m/z 248.
4-[3-(3-Fluorophenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (15c). White powder. 1H NMR (DMSO-d6) δ 9.28
(brs, 1H), 9.15 (brs, 1H), 7.85 (dt, J = 7.8 Hz, J = 1.1 Hz, 1H),
7.71−7.76 (m, 1H), 7.60−7.67 (m, 1H), 7.46 (td, J = 8.6 Hz, J = 2.7
Hz, 1H), 3.48−3.57 (m, 1H), 3.31−3.39 (m, 2H), 3.01−3.12 (m, 2H),
2.23−2.29 (m, 2H), 1.98−2.12 (m, 2H). MS [M + H]+ m/z 248.
4-[3-(4-Fluorophenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (16c). White powder. 1H NMR (DMSO-d6) δ 9.32
(brs, 2H), 8.05 (dd, J = 5.5 Hz, J = 8.9 Hz, 2H), 7.40 (dd, J = 8.8 Hz,
J = 8.9 Hz, 2H), 3.51 (m, 1H), 3.31 (m, 2H), 3.05 (m, 2H), 2.25 (m,
2H), 2.05 (m, 2H). MS [M + H]+ m/z 248.
4-[3-(2-Chlorophenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (17c). White powder. 1H NMR (DMSO-d6) δ 9.33
(brs, 1H), 9.21 (brs, 1H), 7.90 (dd, J = 7.6 Hz, J = 1.8 Hz, 1H), 7.68
(dd, J = 7.6 Hz, J = 1.6 Hz, 1H), 7.61 (td, J = 7.6 Hz, J = 1.8 Hz, 1H),
7.53 (td, J = 7.6 Hz, J = 1.6 Hz, 1H), 3.55 (m, 1H), 3.32 (m, 2H), 3.06
(m, 2H), 2.27 (m, 2H), 2.05 (m, 2H). MS [M + H]+ m/z 264.
4-[3-(3-Chlorophenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (18c). White powder. 1H NMR (DMSO-d6) δ 9.33
(brs, 1H), 9.21 (brs, 1H), 7.95−7.98 (m, 2H), 7.68 (dt, J = 8.0 Hz, J =
1.8 Hz, 1H), 7.60 (t, J = 8.0 Hz, 1H), 3.48−3.58 (m, 1H), 3.30−3.38
(m, 2H), 3.01−3.12 (m, 2H), 2.23−2.29 (m, 2H), 1.99−2.12 (m, 2H).
MS [M + H]+ m/z 264.
4-[3-(4-Chlorophenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (19c). White powder. 1H NMR (DMSO-d6) δ 9.32
(brs, 1H), 9.22 (brs, 1H), 8.01 (d, J = 8.7 Hz, 2H), 7.64 (d, J = 8.7 Hz,
2H), 3.47−3.57 (m, 1H), 3.30−3.34 (m, 2H), 3.01−3.11 (m, 2H),
2.23−2.28 (m, 2H), 1.98−2.12 (m, 2H). MS [M + H]+ m/z 264.
4-[3-(2-Methylphenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (20c). Beige powder. 1H NMR (DMSO-d6) δ 9.40
(brs, 1H), 9.27 (brs, 1H), 7.90 (d, J = 7.6 Hz, 1H), 7.34−7.49 (m,
3H), 3.47−3.57 (m, 1H), 3.30−3.39 (m, 2H), 3.01−3.11 (m, 2H),
General Procedure for Deprotection Step (4c−8c, 10c, 11c,
14c−33c). Boc intermediates (4b−8b, 10b, 11b, 14b−33b) were
dissolved in dioxane (1 M), and 4 N HCl solution in dioxane (5 equiv)
was added. The reaction mixture was stirred at room temperature for
4 h to overnight. The product was recovered by filtration and then
washed with petroleum ether.
Compounds 4c, 32c and 33c did not precipitate. The dioxane was
removed under reduced pressure, and then the residue was dissolved
in water and washed twice with AcOEt. The pH of the aqueous phase
was adjusted to 10 with saturated aqueous K2CO3, and then the
product was extracted 3 times with AcOEt. The organic phases were
joined, washed once with brine, then dried over MgSO4 and evaporated
under reduced pressure.
Compounds 9c, 12c and 13c were purchased from Peakdale.
77
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
2.54 (s, 3H), 2.23−2.29 (m, 2H), 1.99−2.13 (m, 2H). MS [M + H]+
m/z 244.
General Procedure for Coupling (4−33). 4,4,4-Trifluorobutyric
acid (1.3 equiv), EDCI (1.3 equiv), HOBt (0.3 equiv), and DIEA (4
equiv) were mixed in DMF (2 mL) for 5 min. Piperidine intermediate
(0.8 mmol, 1 equiv) was added with 3 mL of DMF. The reaction mix-
ture was stirred overnight at room temperature and then evaporated
under reduced pressure and purified by preparative HPLC.
4-[3-(3-Methylphenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (21c). White powder. 1H NMR (DMSO-d6) δ 9.34
(brs, 1H), 9.24 (brs, 1H), 7.78−7.81 (m, 2H), 7.38−7.47 (m, 2H),
3.43−3.56 (m, 1H), 3.30−3.34 (m, 2H), 3.00−3.11 (m, 2H), 2.39 (s,
3H), 2.23−2.28 (m, 2H), 1.98−2.12 (m, 2H). MS [M + H]+ m/z 244.
4-[3-(4-Methylphenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (22c). White powder. 1H NMR (DMSO-d6) δ 9.23
(brs, 2H), 7.89 (d, J = 8.1 Hz, 2H), 7.37 (d, J = 8.1 Hz, 2H), 3.45−
3.55 (m, 1H), 3.30−3.35 (m, 2H), 3.01−3.10 (m, 2H), 2.38 (s, 3H),
2.22−2.28 (m, 2H), 1.97−2.11 (m, 2H). MS [M + H]+ m/z 244.
4-[3-(2-Methoxyphenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (23c). White powder. 1H NMR (DMSO-d6) δ 9.25
(brs, 2H), 7.82 (dd, J = 7.5 Hz, J = 1.6 Hz, 1H), 7.55 (ddd, J = 7.5 Hz,
J = 8.2 Hz, J = 1.6 Hz, 1H), 7.22 (dd, J = 8.2 Hz, J = 1.0 Hz, 1H), 7.10
(td, J = 7.5 Hz, J = 1.0 Hz, 1H), 3.86 (s, 3H), 3.49 (m, 1H), 3.31 (m,
2H), 3.05 (m, 2H), 2.24 (m, 2H), 2.03 (m, 2H). MS [M + H]+ m/z
260.
4,4,4-Trifluoro-1-[4-(3-thiophen-2-ylmethyl-1,2,4-oxadiazol-
1
5-yl)piperidin-1-yl]butan-1-one (4). Colorless oil. Yield 46%. H
NMR (CDCl3) δ 7.19 (dd, J = 4.9 Hz, J = 1.5 Hz, 1H), 6.92−6.97 (m,
2H), 4.41−4.46 (m, 1H), 4.25 (s, 2H), 3.83−3.87 (m, 1H), 3.14−3.25
(m, 2H), 2.92−2.99 (m, 1H), 2.41−2.60 (m, 4H), 2.08−2.18 (m, 2H),
1.84−1.96 (m, 2H). 13C NMR (CDCl3) δ 180.91, 168.75, 168.08,
136.78, 127.05 (q, J = 275 Hz), 127.04, 126.72, 125.02, 44.37, 40.97,
34.18, 29.56 (q, J = 29 Hz), 29.35, 28.78, 26.72, 25.89. tR,LCMS = 5.9
min. Purity 99%. MS [M + H]+ m/z 374.
4,4,4-Trifluoro-1-[4-(3-thiazol-2-yl-1,2,4-oxadiazol-5-yl)-
piperidin-1-yl]-butan-1-one (5). White powder. Yield 55%. 1H
NMR (CDCl3) δ 8.07 (d, J = 3.3 Hz, 1H), 7.60 (d, J = 3.3 Hz, 1H),
4.49−4.54 (m, 1H), 3.91−3.96 (m, 1H), 3.27−3.38 (m, 2H), 2.98−
3.07 (m, 1H), 2.50−2.64 (m, 4H), 2.11−2.28 (m, 2H), 1.87−2.09 (m,
2H). 13C NMR (CDCl3) δ 181.78, 168.10, 164.03, 153.75, 145.01,
127.04 (q, J = 275 Hz), 122.56, 44.39, 40.99, 34.30, 29.59 (q, J = 30
Hz), 29.33, 28.80, 25.93 (q, J = 2.8 Hz). tR,LCMS = 4.8 min. Purity >99%.
MS [M + H]+ m/z 361. HRMS calcd for C14H15F3N4O2S [M + H]+,
361.0946; found, 361.0931.
4-[3-(3-Methoxyphenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (24c). White powder. 1H NMR (DMSO-d6) δ 9.22
(brs, 2H), 7.58 (dt, J = 7.7 Hz, J = 1.2 Hz, 1H), 7.46−7.51 (m, 2H),
7.17 (ddd, J = 8.2 Hz, J = 2.6 Hz, J = 1.0 Hz, 1H), 3.83 (s, 3H), 3.46−
3.56 (m, 1H), 3.31−3.35 (m, 2H), 3.01−3.09 (m, 2H), 2.23−2.29 (m,
2H), 1.98−2.11 (m, 2H). MS [M + H]+ m/z 260.
4-[3-(4-Methoxyphenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (25c). White powder. 1H NMR (DMSO-d6) δ 9.29
(brs, 1H), 9.15 (brs, 1H), 7.93 (d, J = 8.8 Hz, 2H), 7.10 (d, J = 8.8 Hz,
2H), 3.83 (s, 3H), 3.53−3.56 (m, 1H), 3.30−3.34 (m, 2H), 3.01−3.10
(m, 2H), 2.22−2.27 (m, 2H), 1.96−2.10 (m, 2H). MS [M + H]+ m/z
260.
4-[3-(2-Trifluoromethylphenyl)[1,2,4]oxadiazol-5-yl]-
piperidine Hydrochloride (26c). White powder. 1H NMR
(DMSO-d6) δ 9.27 (brs, 1H), 9.10 (brs, 1H), 7.95−7.99 (m, 1H),
7.80−7.88 (m, 3H), 3.52−3.61 (m, 1H), 3.29−3.35 (m, 2H), 3.01−
3.12 (m, 2H), 2.23−2.29 (m, 2H), 1.96−2.09 (m, 2H). MS [M + H]+
m/z 298.
4,4,4-Trifluoro-1-[4-(3-thiazol-5-yl-1,2,4-oxadiazol-5-yl)-
piperidin-1-yl]butan-1-one (6). White powder. Yield 61%. 1H
NMR (CD2Cl2) δ 8.98 (d, J = 0.6 Hz, 1H), 8.54 (d, J = 0.6 Hz, 1H),
4.50−4.55 (m, 1H), 3.91−3.96 (m, 1H), 3.25−3.37 (m, 2H), 2.94−
3.03 (m, 1H), 2.46−2.67 (m, 4H), 2.17−2.26 (m, 2H), 1.81−2.02 (m,
2H). 13C NMR (CD2Cl2) δ 181.55, 167.81, 162.71, 155.81, 145.24,
127.35 (q, J = 275 Hz), 124.02, 44.31, 40.85, 34.28, 29.43 (q, J = 29
Hz), 29.36, 28.82, 25.78. tR,LCMS = 5.1 min. Purity >99%. MS [M + H]+
m/z 361.
4,4,4-Trifluoro-1-{4-[3-(6-methoxybenzothiazol-2-yl)-1,2,4-
oxadiazol-5-yl]piperidin-1-yl}butan-1-one (7). White powder.
1
Yield 47%. H NMR (CDCl3) δ 8.13 (d, J = 9.0 Hz, 1H), 7.40 (d,
4-[3-(3-Trifluoromethylphenyl)[1,2,4]oxadiazol-5-yl]-
piperidine Hydrochloride (27c). White powder. 1H NMR
(DMSO-d6) δ 9.34 (brs, 1H), 9.22 (brs, 1H), 8.30 (d, J = 7.9 Hz,
1H), 8.21 (s, 1H), 7.99 (d, J = 7.9 Hz, 1H), 7.83 (t, J = 7.9 Hz, 1H),
3.55 (m, 1H), 3.32 (m, 2H), 3.06 (m, 2H), 2.27 (m, 2H), 2.07 (m,
2H). MS [M + H]+ m/z 298.
4-[3-(4-Trifluoromethylphenyl)[1,2,4]oxadiazol-5-yl]-
piperidine Hydrochloride (28c). White powder. 1H NMR
(DMSO-d6) δ 9.37 (brs, 2H), 8.21 (d, J = 8.5 Hz, 2H), 7.94 (d, J =
8.5 Hz, 2H), 3.55 (m, 1H), 3.31 (m, 2H), 3.07 (m, 2H), 2.27 (m, 2H),
2.07 (m, 2H). MS [M + H]+ m/z 298.
4-[3-(4-Hydroxyphenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (29c). Beige powder. 1H NMR (DMSO-d6) δ 9.17
(brs, 2H), 7.81 (d, J = 8.7 Hz, 2H), 6.93 (d, J = 8.7 Hz, 2H), 3.42−
3.51 (m, 1H), 3.29−3.33 (m, 2H), 3.01−3.08 (m, 2H), 2.21−2.25 (m,
2H), 1.97−2.07 (m, 2H). MS [M + H]+ m/z 246.
J = 2.4 Hz, 1H), 7.17 (dd, J = 9.0 Hz, J = 2.4 Hz, 1H), 4.52−4.57 (m,
1H), 3.93−4.00 (m, 1H), 3.93 (s, 3H), 3.25−3.40 (m, 2H), 2.97−3.05
(m, 1H), 2.45−2.65 (m, 4H), 2.19−2.28 (m, 2H), 1.94−2.07 (m, 2H).
13C NMR (CDCl3) δ 181.96, 168.11, 164.57, 159.22, 150.82, 148.04,
137.15, 127.03 (q, J = 275 Hz), 125.40, 117.11, 103.62, 55.88, 44.45,
41.06, 34.45, 29.60 (q, J = 29 Hz), 29.38, 28.85, 25.95 (q, J = 2.8 Hz).
tR,LCMS = 6.3 min. Purity >99%. MS [M + H]+ m/z 441.
4,4,4-Trifluoro-1-[4-(3-phenyl-1,2,4-oxadiazol-5-yl)-
piperidin-1-yl]butan-1-one (8). White powder. Yield 43%. 1H
NMR (CDCl3) δ 8.08 (dd, J = 7.8 Hz, J = 1.8 Hz, 2H), 7.46−7.53 (m,
3H), 4.48−4.53 (m, 1H), 3.90−3.95 (m, 1H), 3.27−3.35 (m, 2H),
3.00−3.09 (m, 1H), 2.51−2.63 (m, 4H), 2.18−2.23 (m, 2H), 1.91−
2.02 (m, 2H). 13C NMR (CDCl3) δ 180.65, 168.34, 168.08, 131.29,
128.90, 127.43, 126.65, 127.08 (q, J = 275 Hz), 44.43, 41.02, 34.22,
29.61 (q, J = 29 Hz), 29.49, 28.90, 25.95 (q, J = 2.9 Hz). tR,LCMS = 6.3
min. Purity >99%. MS [M + H]+ m/z 354.
4-[3-(4-Dimethylaminophenyl)[1,2,4]oxadiazol-5-yl]-
piperidine Hydrochloride (30c). Beige powder. 1H NMR (DMSO-
d6) δ 9.45 (brs, 1H), 9.33 (brs, 1H), 7.84 (d, J = 8.8 Hz, 2H), 7.00 (d,
J = 8.8 Hz, 2H), 3.42−3.50 (m, 1H), 3.28−3.32 (m, 2H), 3.01−3.09
(m, 2H), 3.01 (s, 6H), 2.21−2.26 (m, 2H), 1.98−2.11 (m, 2H). MS
[M + H]+ m/z 273.
4-[3-(4-tert-Butylphenyl)[1,2,4]oxadiazol-5-yl]piperidine Hy-
drochloride (31c). Beige powder. 1H NMR (DMSO-d6) δ 9.25 (brs,
2H), 7.92 (d, J = 8.5 Hz, 2H), 7.58 (d, J = 8.5 Hz, 2H), 3.50 (m, 1H),
3.36 (m, 2H), 3.08 (m, 2H), 2.26 (m, 2H), 1.99 (m, 2H), 1.31 (s, 9H).
MS [M + H]+ m/z 286.
4,4,4-Trifluoro-1-[4-(3-pyrazin-2-yl-1,2,4-oxadiazol-5-yl)-
piperidin-1-yl]butan-1-one (9). Colorless oil. Yield 37%. 1H NMR
(acetone) δ 9.26 (d, J = 1.1 Hz, 1H), 8.80−8.83 (m, 2H), 4.49−4.54
(m, 1H), 4.09−4.14 (m, 1H), 3.48−3.58 (m, 1H), 3.37−3.46 (m, 1H),
2.97−3.06 (m, 1H), 2.71−2.78 (m, 2H), 2.49−2.60 (m, 2H), 2.21−
2.31 (m, 2H), 1.93−2.02 (m, 1H), 1.84−1.89 (m, 1H). 13C NMR
(acetone) δ 183.49, 168.56, 167.29, 147.68, 145.93, 144.91, 143.37,
128.61 (q, J = 275 Hz), 44.93, 41.46, 34.97, 30.25, 29.98 (q, J = 29
Hz), 29.71, 26.16 (q, J = 2.8 Hz). tR,LCMS = 4.8 min. Purity >99%. MS
[M + H]+ m/z 356.
4,4,4-Trifluoro-1-[4-(3-pyrimidin-2-yl-1,2,4-oxadiazol-5-yl)-
piperidin-1-yl]butan-1-one (10). White powder. Yield 55%. 1H
NMR (CD2Cl2) δ 8.95 (d, J = 4.8 Hz, 2H), 7.48 (t, J = 4.8 Hz, 1H),
4.51−4.56 (m, 1H), 3.91−3.96 (m, 1H), 3.25−3.40 (m, 2H), 2.93−
3.02 (m, 1H), 2.50−2.66 (m, 4H), 2.22−2.29 (m, 2H), 1.96−2.02 (m,
2H). tR,LCMS = 4.4 min. Purity >99%. MS [M + H]+ m/z 356.
4,4,4-Trifluoro-1-[4-(3-pyridin-2-yl-1,2,4-oxadiazol-5-yl)-
piperidin-1-yl]butan-1-one (11). White powder. Yield 35%. 1H
4-(3-Cyclopentyl[1,2,4]oxadiazol-5-yl)piperidine (32c). Yel-
1
low oil; H NMR (DMSO-d6) δ 2.89−3.19 (m, 4H), 2.55−2.73 (m,
2H), 1.89−2.01 (m, 4H), 1.53−1.76 (m, 8H). MS [M + H]+ m/z 222.
4-(3-Cyclohexyl[1,2,4]oxadiazol-5-yl)piperidine (33c). Yellow
1
oil; H NMR (DMSO-d6) δ 3.11−3.53 (m, 3H), 2.70−2.98 (m, 3H),
1.90−2.07 (m, 4H), 1.63−1.78 (m, 5H), 1.16−1.52 (m, 5H). MS
[M + H]+ m/z 236.
78
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
NMR (CD2Cl2) δ 8.77 (ddd, J = 4.8 Hz, J = 1.8 Hz, J = 0.9 Hz, 1H),
8.12 (ddd, J = 8.1 Hz, J = 1.2 Hz, J = 0.9 Hz, 1H), 7.88 (td, J = 7.8 Hz,
J = 1.8 Hz, 1H), 7.46 (ddd, J = 7.5 Hz, J = 4.8 Hz, J = 1.2 Hz, 1H),
4.49−4.53 (m, 1H), 3.91−3.95 (m, 1H), 3.26−3.39 (m, 2H), 2.94−
3.04 (m, 1H), 2.45−2.66 (m, 4H), 2.19−2.28 (m, 2H), 1.83−2.04 (m,
2H). tR,LCMS = 4.7 min. Purity >99%. MS [M + H]+ m/z 355.
4,4,4-Trifluoro-1-[4-(3-pyridin-3-yl-1,2,4-oxadiazol-5-yl)-
piperidin-1-yl]butan-1-one (12). White powder. Yield 40%. 1H
NMR (CDCl3) δ 9.29 (d, J = 1.5 Hz, 1H), 8.74 (dd, J = 4.8 Hz, J = 1.5
Hz, 1H), 8.33 (dt, J = 8.0 Hz, J = 1.8 Hz, 1H), 7.42 (ddd, J = 8.0 Hz,
J = 4.8 Hz, J = 0.8 Hz, 1H), 4.48−4.53 (m, 1H), 3.89−3.95 (m, 1H),
3.26−3.35 (m, 2H), 2.97−3.06 (m, 1H), 2.47−2.64 (m, 4H), 2.17−
2.26 (m, 2H), 1.87−2.04 (m, 2H). tR,LCMS = 4.7 min. Purity >99%. MS
[M + H]+ m/z 355.
4,4,4-Trifluoro-1-[4-(3-pyridin-4-yl-1,2,4-oxadiazol-5-yl)-
piperidin-1-yl]butan-1-one (13). White powder. Yield 59%. 1H
NMR (CD2Cl2) δ 8.74 (dd, J = 4.4 Hz, J = 1.7 Hz, 2H), 7.90 (dd, J =
4.4 Hz, J = 1.7 Hz, 2H), 4.48−4.52 (m, 1H), 3.85−3.91 (m, 1H),
3.21−3.35 (m, 2H), 2.91−3.00 (m, 1H), 2.41−2.63 (m, 4H), 2.14−
2.23 (m, 2H), 1.78−1.98 (m, 2H). tR,LCMS = 4.7 min. Purity >99%. MS
[M + H]+ m/z 355.
4,4,4-Trifluoro-1-[4-(3-o-tolyl-1,2,4-oxadiazol-5-yl)piperidin-
1-yl]butan-1-one (20). Colorless oil. Yield 64%. 1H NMR (CDCl3)
δ 7.97−8.00 (m, 1H), 7.29−7.43 (m, 3H), 4.46−4.53 (m, 1H), 3.89−
3.95 (m, 1H), 3.26−3.37 (m, 2H), 3.02−3.11 (m, 1H), 2.63 (s, 3H),
2.47−2.66 (m, 4H), 2.19−2.26 (m, 2H), 1.87−2.06 (m, 2H). 13C
NMR (CDCl3) δ 179.61, 168.82, 168.01, 138.15, 131.39, 130.61,
129.99, 127.10 (q, J = 275 Hz), 125.96, 44.33, 40.95, 34.02, 29.56 (q,
J = 29 Hz), 29.45, 28.85, 25.86, 22.08. tR,LCMS = 6.6 min. Purity >99%.
MS [M + H]+ m/z 368.
4,4,4-Trifluoro-1-[4-(3-m-tolyl-1,2,4-oxadiazol-5-yl)-
piperidin-1-yl]butan-1-one (21). Colorless oil. Yield 78%. 1H
NMR (CDCl3) δ 7.86−7.89 (m, 2H), 7.31−7.40 (m, 2H), 4.48−
4.53 (m, 1H), 3.90−3.95 (m, 1H), 3.25−3.36 (m, 2H), 3.00−3.09 (m,
1H), 2.49−2.66 (m, 4H), 2.44 (s, 3H), 2.17−2.26 (m, 2H), 1.86−2.05
(m, 2H). 13C NMR (CDCl3) δ 180.62, 168.31, 168.02, 138.66, 132.00,
128.75, 127.88, 127.09 (q, J = 275 Hz), 126.51, 124.46, 44.34, 40.95,
34.14, 29.53 (q, J = 29 Hz), 29.41, 28.81, 25.82, 21.23. tR,LCMS = 6.8
min. Purity >99%. MS [M + H]+ m/z 368.
4,4,4-Trifluoro-1-[4-(3-p-tolyl-1,2,4-oxadiazol-5-yl)piperidin-
1-yl]butan-1-one (22). White powder. Yield 75%. 1H NMR
(CDCl3) δ 7.96 (d, J = 8.1 Hz, 2H), 7.29 (d, J = 8.1 Hz, 2H),
4.47−4.52 (m, 1H), 3.90−3.94 (m, 1H), 3.24−3.35 (m, 2H), 3.00−
3.09 (m, 1H), 2.49−2.65 (m, 4H), 2.43 (s, 3H), 2.17−2.25 (m, 2H),
1.85−2.04 (m, 2H). 13C NMR (CDCl3) δ 180.51, 168.23, 167.97,
141.58, 129.57, 127.30, 127.10 (q, J = 275 Hz), 123.85, 44.33, 40.94,
34.13, 29.54 (q, J = 29 Hz), 29.42, 28.82, 25.84, 21.44. tR,LCMS = 6.8
min. Purity >99%. MS [M + H]+ m/z 368.
4,4,4-Trifluoro-1-{4-[3-(2-methoxyphenyl)-1,2,4-oxadiazol-
5-yl]piperidin-1-yl}butan-1-one (23). Colorless oil. Yield 53%. 1H
NMR (CD2Cl2) δ 7.92 (dd, J = 7.8 Hz, J = 1.8 Hz, 1H), 7.44−7.50 (m,
1H), 7.02−7.08 (m, 2H), 4.41−4.48 (m, 1H), 3.91 (s, 3H), 3.85−3.91
(m, 1H), 3.21−3.31 (m, 2H), 2.91−3.00 (m, 1H), 2.43−2.61 (m, 4H),
2.12−2.21 (m, 2H), 1.77−1.97 (m, 2H). tR,LCMS = 5.7 min. Purity
>99%. MS [M + H]+ m/z 384.
4,4,4-Trifluoro-1-{4-[3-(3-methoxyphenyl)-1,2,4-oxadiazol-
5-yl]piperidin-1-yl}butan-1-one (24). Colorless oil. Yield 69%. 1H
NMR (CDCl3) δ 7.68 (dt, J = 7.6 Hz, J = 1.1 Hz, 1H), 7.61 (dd, J =
2.5 Hz, J = 1.5 Hz, 1H), 7.41 (t, J = 8.0 Hz, 1H), 7.07 (ddd, J = 8.3 Hz,
J = 2.5 Hz, J = 1.0 Hz, 1H), 4.48−4.55 (m, 1H), 3.90−3.98 (m, 1H),
3.90 (s, 3H), 3.26−3.36 (m, 2H), 3.00−3.09 (m, 1H), 2.48−2.66 (m,
4H), 2.18−2.27 (m, 2H), 1.87−2.06 (m, 2H). tR,LCMS = 6.3 min. Purity
>99%. MS [M + H]+ m/z 384.
4,4,4-Trifluoro-1-{4-[3-(4-methoxyphenyl)-1,2,4-oxadiazol-
5-yl]piperidin-1-yl}butan-1-one (25). White powder. Yield 82%.
1H NMR (CDCl3) δ 8.02 (d, J = 9.0 Hz, 2H), 7.00 (d, J = 9.0 Hz, 2H),
4.47−4.54 (m, 1H), 3.89−3.96 (m, 1H), 3.89 (s, 3H), 3.24−3.36 (m,
2H), 3.00−3.09 (m, 1H), 2.48−2.67 (m, 4H), 2.17−2.26 (m, 2H),
1.86−2.05 (m, 2H). tR,LCMS = 6.3 min. Purity >99%. MS [M + H]+ m/
z 384.
4,4,4-Trifluoro-1-{4-[3-(2-fluorophenyl)-1,2,4-oxadiazol-5-
1
yl]piperidin-1-yl}butan-1-one (14). White powder. Yield 78%. H
NMR (CDCl3) δ 8.06 (td, J = 7.5 Hz, J = 1.7 Hz, 1H), 7.48−7.56 (m,
1H), 7.22−7.33 (m, 2H), 4.50−4.55 (m, 1H), 3.92−3.96 (m, 1H),
3.28−3.37 (m, 2H), 3.00−3.09 (m, 1H), 2.48−2.67 (m, 4H), 2.06−
2.28 (m, 2H), 1.67−1.87 (m, 2H). 13C NMR (CDCl3) δ 180.33,
167.99, 165.04 (d, J = 5.1 Hz), 160.57 (d, J = 257 Hz), 132.78 (d, J =
8.6 Hz), 130.67, 127.08 (q, J = 275 Hz), 124.42, 116.60 (d, J = 21 Hz),
114.91 (d, J = 12 Hz), 44.31, 40.91, 34.05, 29.50 (q, J = 29 Hz), 29.39,
28.80, 25.80. tR,LCMS = 5.7 min. Purity >99%. MS [M + H]+ m/z 372.
4,4,4-Trifluoro-1-{4-[3-(3-fluorophenyl)-1,2,4-oxadiazol-5-
1
yl]piperidin-1-yl}butan-1-one (15). White powder. Yield 68%. H
NMR (CDCl3) δ 7.87−7.90 (m, 1H), 7.77−7.81 (m, 1H), 7.44−7.52
(m, 1H), 7.19−7.26 (m, 1H), 4.48−4.56 (m, 1H), 3.91−3.98 (m, 1H),
3.26−3.37 (m, 2H), 3.00−3.09 (m, 1H), 2.49−2.67 (m, 4H), 2.18−
2.28 (m, 2H), 1.86−2.06 (m, 2H). 13C NMR (CDCl3) δ 180.98,
168.06, 167.43, 162.84 (d, J = 246 Hz), 130.60 (d, J = 7.9 Hz), 128.71
(d, J = 8.3 Hz), 127.06 (q, J = 275 Hz), 123.12, 118.22 (d, J = 21 Hz),
114.44 (d, J = 23 Hz), 44.36, 40.96, 34.18, 29.56 (q, J = 29 Hz), 29.42,
28.83, 25.89. tR,LCMS = 6.5 min. Purity >99%. MS [M + H]+ m/z 372.
4,4,4-Trifluoro-1-{4-[3-(4-fluorophenyl)-1,2,4-oxadiazol-5-
1
yl]piperidin-1-yl}butan-1-one (16). White powder. Yield 84%. H
NMR (CDCl3) δ 8.06−8.11 (m, 2H), 7.16−7.21 (m, 2H), 4.50−4.54
(m, 1H), 3.91−3.96 (m, 1H), 3.26−3.37 (m, 2H), 3.00−3.09 (m, 1H),
2.48−2.66 (m, 4H), 2.19−2.27 (m, 2H), 1.85−2.05 (m, 2H). 13C
NMR (CDCl3) δ 180.82, 167.97, 167.39, 164.50 (d, J = 251 Hz),
129.51 (d, J = 8.3 Hz), 127.09 (q, J = 275 Hz), 122.94, 115.96 (d, J =
22 Hz), 44.30, 40.91, 34.11, 29.50 (q, J = 29 Hz), 29.39, 28.79, 25.81.
tR,LCMS = 6.5 min. Purity >99%. MS [M + H]+ m/z 372.
4,4,4-Trifluoro-1-{4-[3-(2-trifluoromethylphenyl)-1,2,4-oxa-
diazol-5-yl]piperidin-1-yl}butan-1-one (26). Colorless oil. Yield
1
1-{4-[3-(2-Chlorophenyl)-1,2,4-oxadiazol-5-yl]piperidin-1-
58%. H NMR (CDCl3) δ 7.78−7.87 (m, 2H), 7.62−7.70 (m, 2H),
1
yl}-4,4,4-trifluorobutan-1-one (17). White powder. Yield 30%. H
4.40−4.44 (m, 1H), 3.88−3.92 (m, 1H), 3.29−3.39 (m, 2H), 3.07−
3.16 (m, 1H), 2.47−2.65 (m, 4H), 2.18−2.27 (m, 2H), 1.87−2.06 (m,
2H). tR,LCMS = 6.6 min. Purity 99%. MS [M + H]+ m/z 422.
4,4,4-Trifluoro-1-{4-[3-(3-trifluoromethylphenyl)-1,2,4-oxa-
diazol-5-yl]piperidin-1-yl}butan-1-one (27). White powder. Yield
51%. 1H NMR (CDCl3) δ 8.34 (s, 1H), 8.26 (d, J = 7.8 Hz, 1H), 7.76
(d, J = 7.8 Hz, 1H), 7.62 (t, J = 7.8 Hz, 1H), 4.48−4.54 (m, 1H),
3.89−3.95 (m, 1H), 3.26−3.35 (m, 2H), 2.98−3.07 (m, 1H), 2.44−
2.65 (m, 4H), 2.17−2.26 (m, 2H), 1.85−2.05 (m, 2H). tR,LCMS = 6.5
min. Purity >99%. MS [M + H]+ m/z 422.
NMR (CD2Cl2) δ 7.92−7.96 (m, 1H), 7.56−7.59 (m, 1H), 7.41−7.52
(m, 2H), 4.47−4.51 (m, 1H), 3.90−3.95 (m, 1H), 3.26−3.39 (m, 2H),
2.97−3.06 (m, 1H), 2.47−2.66 (m, 4H), 2.18−2.23 (m, 2H), 1.83−
2.02 (m, 2H). tR,LCMS = 6.4 min. Purity >99%. MS [M + H]+ m/z 388.
1-{4-[3-(3-Chlorophenyl)-1,2,4-oxadiazol-5-yl]piperidin-1-
yl}-4,4,4-trifluoro-butan-1-one (18). White powder. Yield 80%. 1H
NMR (CDCl3) δ 8.09 (t, J = 1.7 Hz, 1H), 7.98 (dt, J = 7.5 Hz, J = 1.4
Hz, 1H), 7.51 (ddd, J = 8.0 Hz, J = 1.5 Hz, J = 1.4 Hz, 1H), 7.44 (dd,
J = 8.0 Hz, J = 7.5 Hz, 1H), 4.48−4.55 (m, 1H), 3.90−3.98 (m, 1H),
3.26−3.37 (m, 2H), 3.00−3.09 (m, 1H), 2.49−2.67 (m, 4H), 2.18−
2.28 (m, 2H), 1.86−2.06 (m, 2H). tR,LCMS = 7.0 min. Purity >99%. MS
[M + H]+ m/z 388.
4,4,4-Trifluoro-1-{4-[3-(4-trifluoromethylphenyl)-1,2,4-oxa-
diazol-5-yl]piperidin-1-yl}butan-1-one (28). White powder. Yield
1
30%. H NMR (MeOD) δ 8.26 (d, J = 8.1 Hz, 2H), 7.84 (d, J = 8.1
1-{4-[3-(4-Chlorophenyl)-1,2,4-oxadiazol-5-yl]piperidin-1-
Hz, 2H), 4.45−4.50 (m, 1H), 4.01−4.06 (m, 1H), 3.36−3.49 (m, 2H),
3.00−3.10 (m, 1H), 2.71−2.76 (m, 2H), 2.44−2.61 (m, 2H), 2.19−
2.27 (m, 2H), 1.78−2.04 (m, 2H). tR,LCMS = 7.2 min. Purity >99%. MS
[M + H]+ m/z 422.
1
yl}-4,4,4-trifluorobutan-1-one (19). White powder. Yield 77%. H
NMR (CDCl3) δ 8.02 (d, J = 8.5 Hz, 2H), 7.48 (d, J = 8.5 Hz, 2H),
4.49−4.56 (m, 1H), 3.90−3.97 (m, 1H), 3.25−3.37 (m, 2H), 3.00−
3.09 (m, 1H), 2.49−2.67 (m, 4H), 2.18−2.27 (m, 2H), 1.85−2.05 (m,
2H). tR,LCMS = 7.0 min. Purity >99%. MS [M + H]+ m/z 388.
4,4,4-Trifluoro-1-{4-[3-(4-hydroxyphenyl)-1,2,4-oxadiazol-5-
1
yl]piperidin-1-yl}butan-1-one (29). Beige powder. Yield 42%. H
79
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
NMR (CDCl3) δ 7.95 (d, J = 8.7 Hz, 2H), 6.94 (d, J = 8.7 Hz, 2H),
6.64 (brs, OH), 4.46−4.52 (m, 1H), 3.90−3.95 (m, 1H), 3.23−3.37
(m, 2H), 3.01−3.11 (m, 1H), 2.45−2.67 (m, 4H), 2.16−2.25 (m, 2H),
1.85−2.04 (m, 2H). tR,LCMS = 5.0 min. Purity 96%. MS [M + H]+ m/z
370.
AcOEt, washed twice with water and once with brine. The organic
layer was dried over MgSO4 and then evaporated under reduce
pressure to give 1.07 g of 4-(N-hydroxycarbamimidoyl)piperidine-1-
carboxylic acid tert-butyl ester. This product was used in the next step
without further purification. Thiophene-2-carboxylic acid (527 mg, 1
equiv), HBTU (1 equiv), and DIEA (2.5 equiv) were dissolved in
DMF (15 mL). The solution was stirred for 5 min, and then the
amidoxime previously synthesized (1.00 g, 1 equiv) was added. The
reaction mixture was stirred overnight at room temperature and then
evaporated under reduced pressure. The residue was dissolved in
AcOEt and washed once with brine, then dried over MgSO4 and evap-
orated under reduced pressure. The residue was dissolved in dioxane
(15 mL), and then the reaction mixture was heated 5 h at 110 °C. The
solvent was removed under vacuum, and the residue was dissolved in
AcOEt. The organic layer was washed twice with 1 N HCl, twice with
saturated aqueous NaHCO3 and twice with brine, then dried over
MgSO4, evaporated under reduced pressure, and purified by pre-
parative HPLC to give 47 mg of 4-(5-thiophen-2-yl-1,2,4-oxadiazol-3-yl)-
piperidine-1-carboxylic acid tert-butyl ester. Boc intermediate (40 mg,
0.12 mmol) was dissolved in dioxane (1 mL), and 4 N HCl solution in
dioxane (10 equiv) was added. The reaction mixture was stirred over-
night at room temperature. The product was recovered by filtration
and then washed with petroleum ether to give 30 mg of 4-(5-thiophen-
2-yl-1,2,4-oxadiazol-3-yl)piperidine hydrochloride (yield, 92%). 4,4,4-
Trifluorobutyric acid (2 equiv), EDCI (2 equiv), and TEA (4 equiv)
were mixed in DCM (3 mL) for 5 min. 4-(5-Thiophen-2-yl-1,2,4-
oxadiazol-3-yl)piperidine hydrochloride (25 mg, 0.09 mmol, 1 equiv)
was added, and the reaction mixture was stirred overnight at room
temperature and then evaporated under reduced pressure and purified
by preparative HPLC to give 35 as a colorless oil. Yield 54%. 1H NMR
(CD2Cl2) δ 7.91 (d, J = 3.7 Hz, 1H), 7.71 (d, J = 5.0 Hz, 1H), 7.25
(dd, J = 5.0 Hz, J = 3.7 Hz, 1H), 4.53−4.58 (m, 1H), 3.90−3.95 (m,
1H), 3.09−3.31 (m, 2H), 2.87−2.96 (m, 1H), 2.46−2.67 (m, 4H),
2.10−2.17 (m, 2H), 1.74−1.94 (m, 2H). 13C NMR (CD2Cl2) δ
172.97, 171.16, 167.70, 131.97, 131.72, 128.59, 127.39 (q, J = 276 Hz),
125.82, 44.73, 41.25, 33.92, 29.80, 29.48 (q, J = 29 Hz), 29.28, 25.79.
tR,LCMS = 5.8 min. Purity 96%. MS [M + H]+ m/z 360.
1-{4-[3-(4-Dimethylaminophenyl)-1,2,4-oxadiazol-5-yl]-
piperidin-1-yl}-4,4,4-trifluorobutan-1-one (30). Beige powder.
1
Yield 31%. H NMR (CDCl3) δ 7.93 (d, J = 9.1 Hz, 2H), 6.76 (d,
J = 9.1 Hz, 2H), 4.48−4.52 (m, 1H), 3.90−3.95 (m, 1H), 3.22−3.35
(m, 2H), 3.00−3.09 (m, 1H), 3.05 (s, 6H), 2.48−2.66 (m, 4H), 2.16−
2.25 (m, 2H), 1.86−2.05 (m, 2H). tR,LCMS = 6.0 min. Purity 99%. MS
[M + H]+ m/z 397.
1-{4-[3-(4-tert-Butylphenyl)-1,2,4-oxadiazol-5-yl]piperidin-1-
1
yl}-4,4,4-trifluorobutan-1-one (31). White powder. Yield 40%. H
NMR (MeOD) δ 7.98 (d, J = 12.9 Hz, 2H), 7.56 (d, J = 12.9 Hz, 2H),
4.44−4.49 (m, 1H), 4.00−4.05 (m, 1H), 3.35−3.45 (m, 2H), 2.98−
3.08 (m, 1H), 2.70−2.76 (m, 2H), 2.44−2.60 (m, 2H), 2.16−2.25 (m,
2H), 1.77−2.00 (m, 2H), 1.36 (s, 9H). tR,LCMS = 7.9 min. Purity >99%.
MS [M + H]+ m/z 410.
1-[4-(3-Cyclopentyl-1,2,4-oxadiazol-5-yl)piperidin-1-yl]-
4,4,4-trifluorobutan-1-one (32). Colorless oil. Yield 45%. 1H
NMR (CDCl3) δ 4.43−4.48 (m, 1H), 3.84−3.89 (m, 1H), 3.12−
3.29 (m, 3H), 2.91−3.00 (m, 1H), 2.42−2.61 (m, 4H), 1.97−2.16 (m,
4H), 1.63−1.92 (m, 8H). 13C NMR (CDCl3) δ 180.15, 173.91,
167.96, 127.02 (q, J = 275 Hz), 44.37, 40.96, 36.50, 34.12, 31.26, 29.49
(q, J = 29 Hz), 29.39, 28.82, 25.78, 25.44. tR,LCMS = 5.7 min. Purity
>99%. MS [M + H]+ m/z 346.
1-[4-(3-Cyclohexyl-1,2,4-oxadiazol-5-yl)piperidin-1-yl]-4,4,4-
trifluorobutan-1-one (33). Colorless oil. Yield 45%. 1H NMR
(CDCl3) δ 4.42−4.49 (m, 1H), 3.84−3.88 (m, 1H), 3.12−3.29 (m,
2H), 2.91−3.00 (m, 1H), 2.71−2.81 (m, 1H), 2.41−2.61 (m, 4H),
2.08−2.17 (m, 2H), 1.93−1.97 (m, 2H), 1.70−1.89 (m, 5H), 1.25−
1.61 (m, 5H). 13C NMR (CDCl3) δ 179.95, 174.00, 168.00, 127.02 (q,
J = 275 Hz), 44.40, 40.99, 35.82, 34.13, 30.51, 29.52 (q, J = 29 Hz),
29.41, 28.84, 25.81, 25.66, 25.60. tR,LCMS = 6.1 min. Purity >99%. MS
[M + H]+ m/z 360.
4,4,4-Trifluoro-1-[4-(4-thiophen-2-ylthiazol-2-yl)piperidin-1-
yl]butan-1-one (34). 2-Bromo-1-thiophen-2-ylethanone (2.00 g,
9.75 mmol) and 4-thiocarbamoylpiperidine-1-carboxylic acid tert-
butyl ester (2.38 g, 9.75 mmol) were mixed in 35 mL of THF. The
mixture was heated at 70 °C overnight and then cooled to room tem-
perature. The solution was filtered and then evaporated under reduced
pressure to afford 2.75 g of 4-(4-thiophen-2-ylthiazol-2-yl)piperidine-
1-carboxylic acid tert-butyl ester. This product was used in the next
step without further purification. Boc intermediate (2.60 g, 7.42
mmol) was dissolved in dioxane (25 mL), and 4 N HCl solution in
dioxane (8 equiv) was added. The reaction mixture was stirred over-
night at room temperature. The product was recovered by filtration
and then washed with petroleum ether to give 2.10 g of 4-(4-thiophen-
2-ylthiazol-2-yl)piperidine hydrochloride (yield, 99%). 4,4,4-Trifluor-
obutyric acid (2 equiv), EDCI (2 equiv), and TEA (4 equiv) were
mixed in DCM (8 mL) for 10 min. 4-(4-Thiophen-2-ylthiazol-2-yl)-
piperidine hydrochloride (150 mg, 0.5 mmol, 1 equiv) was added, and
the reaction mixture was stirred overnight at room temperature and
then evaporated under reduced pressure and purified by preparative
HPLC to give 34 as a white powder. Yield 23%. 1H NMR (CD2Cl2) δ
7.47 (dd, J = 3.6 Hz, J = 1.1 Hz, 1H), 7.32 (dd, J = 5.0 Hz, J = 1.1 Hz,
1H), 7.32 (s, 1H), 7.09 (dd, J = 5.0, Hz J = 3.6 Hz, 1H), 4.63−4.67
(m, 1H), 3.94−3.98 (m, 1H), 3.20−3.32 (m, 2H), 2.85−2.90 (m, 1H),
2.45−2.66 (m, 4H), 2.17−2.27 (m, 2H), 1.70−1.90 (m, 2H). 13C
NMR (CD2Cl2) δ 174.01, 167.72, 149.34, 138.45, 127.70, 127.43 (q,
J = 275 Hz), 125.13, 123.87, 110.51, 45.00, 41.55, 40.41, 32.60,
32.03, 29.50 (q, J = 29 Hz), 25.81. tR,LCMS = 6.4 min. Purity 99%. MS
[M + H]+ m/z 375.
4,4,4-Trifluoro-1-[4-(5-thiophen-2-yl-2H-pyrazol-3-yl)-
piperidin-1-yl]butan-1-one (36). 4,4,4-Trifluorobutyric acid (1.5
equiv), EDCI (1.5 equiv), and DIEA (4.5 equiv) were mixed in DMF
(5 mL) for 5 min. 4-[5-(2-Thienyl)-1H-pyrazol-3-yl]piperidine (117
mg, 0.5 mmol, 1 equiv) was added, and the reaction mixture was
stirred overnight at room temperature and then evaporated under
reduced pressure. The residue was dissolved in AcOEt. The organic
layer was washed twice with 1 N HCl, twice with saturated aqueous
NaHCO3, and twice with brine, then dried over MgSO4, evaporated
under reduced pressure, and purified by preparative HPLC to give 36
1
as a white powder. Yield 51%. H NMR (CD2Cl2) δ 7.26 (d, J = 3.7
Hz, 1H), 7.21 (d, J = 5.0 Hz, 1H), 7.03 (dd, J = 5.0 Hz, J = 3.7 Hz,
1H), 6.24 (s, 1H), 4.48−4.52 (m, 1H), 3.64−3.68 (m, 1H), 2.74−2.94
(m, 2H), 2.43−2.54 (m, 5H), 1.90−1.94 (m, 2H), 1.43−1.56 (m, 2H).
13C NMR (CD2Cl2) δ 168.27, 150.32, 145.93, 136.71, 128.20, 127.94
(q, J = 275 Hz), 125.03, 124.29, 99.68, 45.58, 42.20, 34.28, 32.59,
31.62, 30.03 (q, J = 29 Hz), 26.34. tR,LCMS = 5.5 min. Purity >99%. MS
[M + H]+ m/z 358.
4,4,4-Trifluoro-1-[4-(4-phenylthiazol-2-yl)piperidin-1-yl]-
butan-1-one (37). 2-Bromo-1-phenylethanone (1.00 g, 5.0 mmol)
and 4-thiocarbamoylpiperidine-1-carboxylic acid tert-butyl ester (1.23
g, 5.0 mmol) were mixed in 50 mL of THF. The mixture was heated at
70 °C overnight and then cooled to room temperature. The solu-
tion was filtered and then evaporated under reduced pressure to afford
1.65 g of 4-(4-phenylthiazol-2-yl)piperidine-1-carboxylic acid tert-butyl
ester. This product was used in the next step without further purifica-
tion. Boc intermediate (1.5 g, 4.35 mmol) was dissolved in dioxane (10
mL), and 4 N HCl solution in dioxane (8 equiv) was added. The reaction
mixture was stirred overnight at room temperature. The product was
recovered by filtration and then washed with petroleum ether to give 800
mg of 4-(4-phenylthiazol-2-yl)piperidine hydrochloride (yield, 65%). 4,4,4-
Trifluorobutyric acid (2 equiv), EDCI (2 equiv), and TEA (4 equiv) were
mixed in DCM (8 mL) for 10 min. 4-(4-Phenylthiazol-2-yl)piperidine
4,4,4-Trifluoro-1-[4-(5-thiophen-2-yl-1,2,4-oxadiazol-3-yl)-
piperidin-1-yl]butan-1-one (35). 4-Cyanopiperidine-1-carboxylic
acid tert-butyl ester (1.50 g, 7.13 mmol), hydroxylamine hydrochloride
(0.74 g, 10.70 mmol, 1.5 equiv), and DIEA (1.97 mL, 1.6 equiv) were
mixed in 20 mL of EtOH. The mixture was heated for 5 h at reflux and
then evaporated under reduced pressure. The residue was dissolved in
80
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
hydrochloride (150 mg, 0.53 mmol, 1 equiv) was added, and the reaction
mixture was stirred overnight at room temperature and then evaporated
under reduced pressure and purified by preparative HPLC to give 37 as a
with 1 N HCl, once with saturated aqueous NaHCO3, once with brine,
then dried over MgSO4 and evaporated under reduced pressure to
afford 700 mg of 4-(3-phenylisoxazol-5-yl)piperidine-1-carboxylic acid
tert-butyl ester. This product was used in the next step without further
purification. Boc intermediate (700 mg, 2.13 mmol) was dissolved in
dioxane (9 mL), and 4 N HCl solution in dioxane (8 equiv) was
added. The reaction mixture was stirred overnight at room tempera-
ture. The product was recovered by filtration and then washed with
petroleum ether to give 220 mg of 4-(3-phenylisoxazol-5-yl)piperidine
hydrochloride (yield 39% over two steps). 4,4,4-Trifluorobutyric acid
(1.5 equiv), EDCI (1.5 equiv), HOBt (1 equiv), and DIEA (4 equiv)
were mixed in DCM (8 mL) for 10 min. 4-(3-Phenylisoxazol-5-yl)-
piperidine hydrochloride (100 mg, 0.38 mmol, 1 equiv) was added
with 1 mL of DMF, and the reaction mixture was stirred overnight at
room temperature and then evaporated under reduced pressure and
purified by preparative HPLC to give 39 as a white powder. Yield 20%.
1H NMR (CDCl3) δ 7.77−7.81 (m, 2H), 7.45−7.49 (m, 3H), 6.31 (s,
1
white powder. Yield 68%. H NMR (CD2Cl2) δ 7.90−7.94 (m, 2H),
7.41−7.47 (m, 3H), 7.33−7.38 (m, 1H), 4.62−4.66 (m, 1H), 3.94−3.98
(m, 1H), 3.21−3.40 (m, 2H), 2.83−2.93 (m, 1H), 2.46−2.67 (m, 4H),
2.21−2.29 (m, 2H), 1.74−1.93 (m, 2H). 13C NMR (CD2Cl2) δ 173.73,
167.73, 154.84, 134.59, 128.68, 127.99, 127.40 (q, J = 275 Hz), 126.21,
111.82, 45.01, 41.56, 40.47, 32.61, 32.04, 29.51 (q, J = 29 Hz), 25.80.
tR,LCMS = 6.7 min. Purity >99%. MS [M + H]+ m/z 369.
4,4,4-Trifluoro-1-[4-(5-phenyl-1,3,4-oxadiazol-2-yl)-
piperidin-1-yl]butan-1-one (38). 4,4,4-Trifluorobutyric acid (1.5
equiv), EDCI (1.5 equiv), and DIEA (4.5 equiv) were mixed in DMF
(5 mL) for 5 min. 4-(5-Phenyl-1,3,4-oxadiazol-2-yl)piperidine (115 mg,
0.5 mmol, 1 equiv) was added, and the reaction mixture was stirred
overnight at room temperature and then evaporated under reduced
pressure. The residue was dissolved in AcOEt. The organic layer was
washed twice with 1 N HCl, twice with saturated aqueous NaHCO3,
and twice with brine, then dried over MgSO4, evaporated under reduced
pressure, and purified by preparative HPLC to give 38 as a white
1H), 4.63−4.67 (m, 1H), 3.91−3.96 (m, 1H), 3.20−3.30 (m, 1H),
3.07−3.16 (m, 1H), 2.82−2.91 (m, 1H), 2.45−2.65 (m, 4H), 2.13−
2.23 (m, 2H), 1.66−1.81 (m, 2H). 13C NMR (CDCl3) δ 175.42,
168.09, 162.37, 130.03, 129.03, 128.93, 126.96 (q, J = 275 Hz), 126.75,
97.89, 44.91, 41.51, 34.56, 30.59, 29.71, 29.64 (q, J = 29 Hz), 25.93.
tR,LCMS = 6.3 min. Purity >99%. MS [M + H]+ m/z 353.
1
powder. Yield 48%. H NMR (CD2Cl2) δ 7.99−8.01 (m, 2H), 7.50−
7.52 (m, 3H), 4.43−4.48 (m, 1H), 3.86−3.91 (m, 1H), 3.20−3.29 (m,
2H), 2.91−3.00 (m, 1H), 2.45−2.62 (m, 4H), 2.12−2.21 (m, 2H),
1.76−1.96 (m, 2H). 13C NMR (CD2Cl2) δ 168.58, 168.28, 165.20,
132.12, 129.55, 127.88 (q, J = 275 Hz), 127.16, 124.55, 44.92, 41.44,
3-Phenyl-1-[1-(4,4,4-trifluorobutanoyl)piperidin-4-yl]-4,5-di-
hydro-1H-pyrazol-5-one (40). Ethyl benzoylacetate (174 μL, 1
mmol) and 4-hydrazinopiperidine dihydrochloride (188 mg, 1 mmol)
were mixed in a sealed microwave glass tube with 2 mL of EtOH. The
reaction mixture was heated under microwave irradiation (50 W) for
45 min. The reaction was performed twice using a Discover microwave
from CEM. The two reaction mixtures were put together, and then the
solvent was removed under reduced pressure and the residue was
purified by preparative HPLC to give 150 mg of 3-phenyl-1-(piperidin-
4-yl)-4,5-dihydro-1H-pyrazol-5-one (yield, 31%). 4,4,4-Trifluorobuty-
ric acid (1 equiv), EDCI (1 equiv), and DIEA (3 equiv) were mixed in
DMF (3 mL) and then added dropwise to a solution of 3-phenyl-1-
(piperidin-4-yl)-4,5-dihydro-1H-pyrazol-5-one (117 mg, 0.5 mmol, 1
equiv) in DMF (2 mL). The reaction mixture was stirred overnight at
room temperature and then evaporated under reduced pressure and
purified by preparative HPLC to give 40 as a white powder. Yield 62%.
1H NMR (CD2Cl2) δ 7.69−7.72 (m, 2H), 7.44−7.47 (m, 3H), 4.68−
33.80, 29.97 (q, J = 29 Hz), 29.90, 29.38, 26.29 (q, J = 2.9 Hz). tR,LCMS
=
5.2 min. Purity >99%. MS [M + H]+ m/z 354.
4,4,4-Trifluoro-1-[4-(3-phenylisoxazol-5-yl)piperidin-1-yl]-
butan-1-one (39). Benzenesulfonyl chloride (2 mL, 15.6 mmol, 1
equiv) was dissolved in 30 mL of acetone, and the solution was cooled
to 0 °C. Sodium azide (1.52 g, 1.5 equiv) dissolved in 5 mL of water
was added dropwise to the solution. The reaction mixture was stirred
for 3 h at room temperature and then evaporated under reduced pres-
sure. The residue was dissolved in 20 mL of water, and the aqueous
phase was extracted three times with diethyl ether. The organic phases
were joined, dried over MgSO4, and then evaporated under reduced
pressure to give 2.73 g of benzenesulfonyl azide (yield, 94%). Sodium
hydride (60% in mineral oil) (330 mg, 8.2 mmol, 1.5 equiv) was added
to 19 mL of THF, and the mixture was cooled to 0 °C and stirred
5 min under nitrogen. Methyl diethylphosphonoacetate (1.5 mL, 1.5
equiv) dissolved in 2.5 mL of THF was added dropwise to the
solution. The reaction mixture was stirred for 10 min at 0 °C, and then
benzenesulfonylazide (1.0 g, 5.4 mmol) dissolved in 2.5 mL of THF
was added dropwise to the solution and the reaction mixture was
stirred 1 h at 0 °C. A yellow precipitate was observed. An amount of
2 mL of aqueous 5% NaHCO3 was added to dissolve the precipitate,
and then THF was removed under reduced pressure. The residue was
dissolved in AcOEt. The organic layer was washed once with aqueous
5% NaHCO3, three times with water, then dried over MgSO4 and
evaporated under reduced pressure. A mixture of petroleum ether/
AcOEt (95/5) was added to the residue. The precipitate of
benzenesulfonamide was removed by filtration, and then the solution
was evaporated under reduced pressure to give 580 mg of diazo-
(diethoxyphosphoryl)acetic acid methyl ester (yield, 45%). 4-Formylpi-
peridine-1-carboxylic acid tert-butyl ester (524 mg, 2.45 mmol, 1 equiv)
and K2CO3 (2 equiv) were mixed in 15 mL of MeOH. Diazo-
(diethoxyphosphoryl)acetic acid methyl ester (580 mg, 2.45 mmol,
1 equiv) dissolved in 10 mL of MeOH was added to the solution, and
the reaction mixture was stirred overnight at room temperature and
then evaporated under reduced pressure. The residue was dissolved in
diethyl ether. The organic layer was washed twice with aqueous
5% NaHCO3, then dried over MgSO4 and evaporated under reduced
pressure to give 685 mg of 4-ethynylpiperidine-1-carboxylic acid
tert-butyl ester.25 Benzaldehyde oxime (261 μL, 2.39 mmol) and
4-ethynylpiperidine-1-carboxylic acid tert-butyl ester (500 mg, 2.39
mmol) were mixed in 5 mL of DCM. The mixture was cooled to 0 °C,
and then a sodium hypochlorite solution (14% chlorine, 8 mL) was
added dropwise to the solution. The reaction mixture was stirred
overnight at room temperature, and then an amount of 20 mL of
DCM was added. The organic layer was washed once with water, once
4.75 (m, 1H), 4.33−4.43 (m, 1H), 3.94−4.00 (m, 1H), 3.67 (s, 2H),
3.18−3.27 (m, 1H), 2.73−2.83 (m, 1H), 2.49−2.69 (m, 4H), 1.86−
2.06 (m, 4H). 13C NMR (CD2Cl2) δ 171.02, 167.70, 154.02, 131.36,
130.14, 128.76, 127.38 (q, J = 275 Hz), 125.55, 50.45, 44.42, 41.07,
38.64, 30.48, 29.80, 29.50 (q, J = 29 Hz), 25.77 (q, J = 2.9 Hz). tR,LCMS
=
5.1 min. Purity 97%. MS [M + H]+ m/z 368.
4,4,4-Trifluoro-1-[(3R)-3-[3-(1,3-thiazol-2-yl)-1,2,4-oxadiazol-
5-yl]pyrrolidin-1-yl]butan-1-one (41). (R)-N-Boc-pyrrolidine-3-
carboxylic acid (700 mg, 3.25 mmol, 1.1 equiv), HBTU (1.23 g, 1.1
equiv), and DIEA (1.53 mL, 3 equiv) were dissolved in DMF (15 mL).
The solution was stirred for 5 min, and then 1,3-thiazole-2-amidoxime
(5a) (422 mg, 2.95 mmol, 1 equiv) was added. The reaction mixture
was stirred overnight at room temperature and then evaporated under
reduced pressure. The residue was dissolved in AcOEt, washed twice
with saturated aqueous NaHCO3, once with brine, then dried over
MgSO4 and evaporated under reduced pressure. The residue was
dissolved in 15 mL of DMF and then heated at 110 °C for 7 h. The
solvent was removed under vacuum and the residue was dissolved in
AcOEt. The organic layer was washed once with 1 N HCl, once with
saturated aqueous NaHCO3, and once with brine, then dried over
MgSO4 and evaporated under reduced pressure. The obtained product
was used in the next step without further purification. Boc inter-
mediate was dissolved in dioxane (10 mL), and 4 N HCl solution in
dioxane (6 mL) was added. The reaction mixture was stirred overnight
at room temperature, and then the product was recovered by filtration
and washed with petroleum ether to give 5-[(3R)-pyrrolidin-3-yl]-3-
(1,3-thiazol-2-yl)-1,2,4-oxadiazole (yield, 66% over two steps). 4,4,4-
Trifluorobutyric acid (1.3 equiv), EDCI (1.3 equiv), HOBt (0.4
equiv), and DIEA (4 equiv) were mixed in DMF (2 mL) for 5 min. 5-
[(3R)-Pyrrolidin-3-yl]-3-(1,3-thiazol-2-yl)-1,2,4-oxadiazole (0.62 mmol,
81
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
1 equiv) was added with 3 mL of DMF. The reaction mixture was
stirred overnight at room temperature and then evaporated under
reduced pressure and purified by preparative HPLC. Beige powder.
Framework Program (Research Infrastructures (Grant 226716)).
Diffraction data were collected at the Swiss Light Source (Paul
Scherrer Institute, Villigen, Switzerland). We are grateful to the
machine and beamline scientists whose outstanding efforts have
made these experiments possible. Data management was
performed using Pipeline Pilot from Accelrys. B.V. is a recipient
of a doctoral fellowship MENR. We thank Varian Inc. for their
technical support. NMR acquisitions were done by the LARMN,
Lille, France, and SPR acquisitions were done at the molecular
interaction platform (IMPRT-IFR114).
1
Yield 33%. H NMR (CDCl3) δ 8.02−8.00 (m, 1H), 7.57−7.60 (m,
1H), 3.89−4.03 (m, 2H), 3.69−3.87 (m, 2H), 3.53−3.65 (m, 1H),
2.38−2.55 (m, 6H). 13C NMR (CDCl3) cis/trans isomer mixture (60
isomer A/40 isomer B); isomer A δ 180.31, 168.50, 163.98, 153.53,
144.99, 126.94 (q, J = 276 Hz), 122.87, 49.24, 45.52, 35.03, 29.05 (q, J =
29 Hz), 28.86, 27.07 (q, J = 3 Hz); isomer B δ 179.84, 168.31, 163.98,
153.38, 144.94, 126.92 (q, J = 276 Hz), 122.81, 49.43, 45.25, 36.82,
30.28, 29.05 (q, J = 29 Hz), 27.24 (q, J = 3 Hz). tR,LCMS = 4.6 min.
Purity >99%. MS [M + H]+ m/z 347.
5,5,5-Trifluoro-1-[4-(3-thiazol-2-yl-1,2,4-oxadiazol-5-yl)-
piperidin-1-yl]pentan-1-one (42). 5,5,5-Trifluoropentanoic acid
(1.3 equiv), EDCI (1.3 equiv), HOBt (0.3 equiv), and DIEA (4
equiv) were mixed in DMF (40 mL) for 5 min. 4-(3-Thiazol-2-yl-
[1,2,4]oxadiazol-5-yl)piperidine hydrochloride 5c (8.18 g, 30 mmol, 1
equiv) was added with 20 mL of DMF, and the reaction mixture was
stirred overnight at room temperature and then evaporated under
reduced pressure. The residue was dissolved in AcOEt and then
washed twice with saturated aqueous NaHCO3, twice with 1 N HCl,
and once with brine, then dried over MgSO4 and evaporated under
reduced pressure. The residue was purified by chromatography on
silica gel (DCM/MeOH, 100:0 to 98.5:1.5) and then recrystallized in a
mixture of isopropanol and diisopropyl ether. White crystals. Yield
ABBREVIATIONS USED
■
ACM, automated confocal microscopy; AcOEt, ethyl acetate;
AcOH, acetic acid; Boc, tert-butoxycarbonyl; CH3CN, acetoni-
trile; DCM, dichloromethane; DIEA, diisopropylethylamine;
DMF, dimethylformamide; DMSO, dimethylsulfoxide; DOTS,
directly observed treatment short-course; EDCI, N-ethyl-3-(3-
dimethylaminopropyl)carbodiimide; ETH, ethionamide; Et3N,
triethylamine; EtOH, ethanol; GFP, green fluorescent protein;
HBTU, O-benzotriazole-N,N,N′,N′-tetramethyluronium hexa-
fluorophosphate; HOBt, N-hydroxybenzotriazole; MDR-TB,
multidrug resistant tuberculosis; MeOH, methanol; MIC,
minimal inhibitory concentration; PBS, phosphate buffered
saline; PK, pharmacokinetic; RT, room temperature; SAR,
structure−activity relationship; SPR, surface plasmon reso-
nance; TB, tuberculosis; TEA, triethylamine; THF, tetrahy-
drofuran; XDR-TB, extensively drug resistant tuberculosis
1
62%. H NMR (CD2Cl2) δ 8.06 (d, J = 3.0 Hz, 1H), 7.65 (d, J = 3.0
Hz, 1H), 4.51−4.55 (m, 1H), 3.90−3.95 (m, 1H), 3.22−3.39 (m, 2H),
2.91−2.98 (m, 1H), 2.44 (t, J = 7.2 Hz, 2H), 2.15−2.27 (m, 4H),
1.83−2.01 (m, 4H). 13C NMR (CDCl3) δ 182.06, 169.56, 163.97,
154.00, 144.95, 127.37 (q, J = 275 Hz), 122.66, 44.33, 40.60, 34.43,
32.97 (q, J = 29 Hz), 31.34, 29.44, 28.90, 17.52. Mp 75.6−76.3 °C.
tR,LCMS = 6.1 min. Purity >99%. MS [M + H]+ m/z 375. HRMS calcd
for C15H17F3N4O2S [M + H]+, 375.1103; found, 375.1099.
REFERENCES
■
(1) World Health Organization. Global Tuberculosis Control; World
Health Organization: Geneva, 2010; ISBN 978 92 4 156406 9.
(2) Cox, H. S.; Ford, N.; Reeder, J. C. Are we really that good at
treating tuberculosis? Lancet Infect. Dis. 2009, 9, 138−139.
(3) Kaufmann, S. H. E. How can immunology contribute to the
control of tuberculosis? Nat. Rev. Immunol. 2001, 1, 20−30.
(4) Harries, A. D. Tuberculosis and human immunodeficiency virus
infection in developing countries. Lancet 1990, 335, 387−390.
(5) Koenig, R. Drug-resistant tuberculosis: in South Africa, XDR TB
and HIV prove a deadly combination. Science 2008, 319, 894−897.
(6) Furin, J. The clinical management of drug-resistant tuberculosis.
Curr. Opin. Pulm. Med. 2007, 13, 212−217.
ASSOCIATED CONTENT
* Supporting Information
In vivo mouse AUC for compounds 2, 5, and 42. This material
■
S
is available free of charge via the Internet at http://pubs.acs.org.
Accession Codes
†PDB codes for compounds 5 and 42 are 3SDG and 3SFI,
respectively.
AUTHOR INFORMATION
Corresponding Author
■
(7) Cox, H.; Kebede, Y.; Allamuratova, S.; Ismailov, G.; Davletmuratova,
Z.; Byrnes, G.; Stone, C.; Niemann, S.; Rusch-Gerdes, S.; Blok, L.;
̈
*Phone: +33 (0)320 964 947. Fax: +33 (0) 320 964 709.
E-mail: benoit.deprez@univ-lille2.fr. Home pages: U761, http://
www.deprezlab.fr; PRIM, http://www.drugdiscoverylille.org.
Doshetov, D. Tuberculosis recurrence and mortality after successful
treatment: impact of drug resistance. PLoS Med. 2006, 3, 1836−1843.
(8) Koul, A.; Arnoult, E.; Lounis, N.; Guillemont, J.; Andries, K. The
challenge of new drug discovery for tuberculosis. Nature 2011, 469,
483−490.
(9) Mitnick, C. D.; McGee, B.; Peloquin, C. A. Tuberculosis
pharmacotherapy: strategies to optimize patient care. Expert Opin.
Pharmacother. 2009, 10, 381−401.
(10) Ejim, L.; Farha, M. A.; Falconer, S. B.; Wildenhain, J.; Coombes,
B. K.; Tyers, M.; Brown, E. D.; Wright, G. D. Combinations of
antibiotics and nonantibiotic drugs enhance antimicrobial efficacy. Nat.
Chem. Biol. 2011, 7, 348−350.
(11) Lounis, N.; Veziris, N.; Chauffour, A.; Truffot-Pernot, C.; Andries,
K.; Jarlier, V. Combinations of R207910 with drugs used to treat
multidrug-resistant tuberculosis have the potential to shorten treatment
duration. Antimicrob. Agents Chemother. 2006, 50, 3543−3547.
(12) Cox, H.; Kebede, Y.; Allamuratova, S.; Ismailov, G.;
Present Address
+Galapagos N.V., General De Wittelaan L11 A3, 2800,
Mechelen, Belgium.
Author Contributions
¶These authors contributed equally to this work.
ACKNOWLEDGMENTS
We thank Eve Willery, Julie Dumont, Youssef Jallouli, and
Anne-Sophie Drucbert for technical assistance and Pierre-Marie
■
́ ́
Danze and Pr. Andre Tartar for scientific discussions. We are
grateful to the institutions that support our laboratories (Inserm,
INSERM-Avenir fellowship to P.B., Institut Pasteur Korea
(Grants K204EA000001-08E0100-00100 and K204EA000001-
Davletmuratova, Z.; Byrnes, G.; Stone, C.; Niemann, S.; Rusch-
̈
09E0100-00100), Universite
de Lille, CNRS, EU, Region Nord-Pas de Calais, FEDER (Grants
09220019 and 09220020 PRESAGE 31510), ANR (Grant ANR-
06-EMPB-033), PRIM (Pole de Recherche Interdisciplinaire du
Medicament), and the European Commission under the 7th
́
Lille Nord de France, Institut Pasteur
Gerdes, S.; Blok, L.; Doshetov, D. Tuberculosis recurrence and
mortality after successful treatment: impact of drug resistance. PLoS
Med. 2006, 3, e384.
(13) DeBarber, A. E.; Mdluli, K.; Bosman, M.; Bekker, L. G.; Barry,
C. E. Ethionamide activation and sensitivity in multidrug-resistant
́
̂
́
82
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83

Journal of Medicinal Chemistry
Article
Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U.S.A. 2000, 97,
9677−9682.
(14) Baulard, A. R.; Betts, J. C.; Engohang-Ndong, J.; Quan, S.;
McAdam, R. A.; Brennan, P. J.; Locht, C.; Besra, G. S. Activation of the
pro-drug ethionamide is regulated in Mycobacteria. J. Biol. Chem.
2000, 275, 28326−28331.
CamR family repressor Mycobacterium tuberculosis EthR implicated in
ethionamide resistance. J. Mol. Biol. 2004, 340, 1095−1105.
(29) Leslie, A. The integration of macromolecular diffraction data.
Acta Crystallogr., Sect. D: Biol. Crystallogr. 2006, 62, 48−57.
(30) Collaborative Computational Project Number 4. The CCP4
suite: programs for protein crystallography. Acta Crystallogr., Sect. D:
Biol. Crystallogr. 1994, 50, 760−763.
(31) Emsley, P.; Lohkamp, B.; Scott, W. G.; Cowtan, K. Features and
development of Coot. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2010,
66, 486−501.
(15) Willand, N.; Dirie, B.; Carette, X.; Bifani, P.; Singhal, A.;
Desroses, M.; Leroux, F.; Willery, E.; Mathys, V.; Deprez-Poulain, R.;
Delcroix, G.; Frenois, F.; Aumercier, M.; Locht, C.; Villeret, V.;
Deprez, B.; Baulard, A. R. Synthetic EthR inhibitors boost
antituberculous activity of ethionamide. Nat. Med. 2009, 15, 537−544.
(16) Flipo, M.; Desroses, M.; Lecat-Guillet, N.; Dirie,
Leroux, F.; Piveteau, C.; Demirkaya, F.; Lens, Z.; Rucktooa, P.;
Villeret, V.; Christophe, T.; Jeon, H. K.; Locht, C.; Brodin, P.; Deprez,
́
B.; Carette, X.;
́
B.; Baulard, A. R.; Willand, N. Ethionamide boosters: synthesis,
biological activity, and structure−activity relationships of a series of
1,2,4-oxadiazole EthR inhibitors. J. Med. Chem. 2011, 54, 2994−3010.
(17) Christophe, T.; Jackson, M.; Jeon, H. K.; Fenistein, D.;
Contreras-Dominguez, M.; Kim, J.; Genovesio, A.; Carralot, J.-P.;
Ewann, F.; Kim, E. H.; Lee, S. Y.; Kang, S.; Seo, M. J.; Park, E. J.;
Skovierova, H., H.; Pham, H.; Riccardi, G.; Nam, J. Y.; Marsollier, L.;
Kempf, M.; Joly-Guillou, M.-L.; Oh, T.; Shin, W. K.; No, Z.; Nehrbass,
U.; Brosch, R.; Cole, S. T.; Brodin, P. High content screening identifies
decaprenyl-phosphoribose 2′ epimerase as a target for intracellular
antimycobacterial inhibitors. PLoS Pathog. 2009, 5, e1000645.
(18) Christophe, T.; Ewann, F.; Jeon, H. K.; Cechetto, J.; Brodin, P.
High-content imaging of Mycobacterium tuberculosis-infected
macrophages: an in vitro model for tuberculosis drug discovery.
Future Med. Chem. 2010, 2, 1283−1293.
(19) Engohang-Ndong, J.; Baillat, D.; Aumercier, M.; Bellefontaine,
F.; Besra, G. S.; Locht, C.; Baulard, A. R. EthR, a repressor of the
TetR/CamR family implicated in ethionamide resistance in
mycobacteria, octamerizes cooperatively on its operator. Mol.
Microbiol. 2004, 51, 175−188.
(20) Mega, J. L.; Close, S. L.; Wiviott, S. D.; Shen, L.; Hockett, R. D.;
Brandt, J. T.; Walker, J. R.; Antman, E. M.; Macias, W. L.; Braunwald,
E.; Sabatine, M. S. Cytochrome P450 genetic polymorphisms and the
response to prasugrel: relationship to pharmacokinetic,
pharmacodynamic, and clinical outcomes. Circulation 2009, 119,
2553−2560.
(21) Mosier, P. D.; Jurs, P. C.; Custer, L. L.; Durham, S. K.; Pearl, G.
M. Predicting the genotoxicity of thiophene derivatives from molecular
structure. Chem. Res. Toxicol. 2003, 16, 721−732.
(22) Lopez Garcia, M. P.; Dansette, P. M.; Valadon, P.; Amar, C.;
Beaune, P. H.; Guengerich, F. P.; Mansuy, D. Human-liver cytochromes
P-450 expressed in yeast as tools for reactive-metabolite formation studies.
Eur. J. Biochem. 1993, 213, 223−232.
(23) Khanna, I. K.; Yu, Y.; Huff, R. M.; Weier, R. M.; Xu, X.; Koszyk,
F. J.; Collins, P. W.; Cogburn, J. N.; Isakson, P. C.; Koboldt, C. M.;
Masferrer, J. L.; Perkins, W. E.; Seibert, K.; Veenhuizen, A. W.; Yuan,
J.; Yang, D.-C.; Zhang, Y. Y. Selective cyclooxygenase-2 inhibitors:
heteroaryl modified 1,2-diarylimidazoles are potent, orally active
antiinflammatory agents. J. Med. Chem. 2000, 43, 3168−3185.
(24) Poulain, R. F.; Tartar, A. L.; Deprez, B. P. Parallel synthesis of
1,2,4-oxadiazoles from carboxylic acids using an improved, uronium-
based, activation. Tetrahedron Lett. 2001, 42, 1495−1498.
(25) Braisted, A. C.; Oslob, J. D.; Delano, W. L.; Hyde, J.; McDowell,
R. S.; Waal, N.; Yu, C.; Arkin, M. R.; Raimundo, B. C. Discovery of a
potent small molecule IL-2 inhibitor through fragment assembly.
J. Am. Chem. Soc. 2003, 125, 3714−3715.
(26) Lipinski, C. A.; Lombardo, F.; Dominy, B. W.; Feeney, P. J.
Experimental and computational approaches to estimate solubility and
permeability in drug discovery and development settings. Adv. Drug
Delivery Rev. 2001, 46, 3−26.
(27) Veber, D. F.; Johnson, S. R.; Cheng, H. Y.; Smith, B. R.; Ward,
K. W.; Kopple, K. D. Molecular properties that influence the oral
bioavailability of drug candidates. J. Med. Chem. 2002, 45, 2615−2623.
(28) Dover, L. G.; Corsino, P. E.; Daniels, I. R.; Cocklin, S. L.;
Tatituri, V.; Besra, G. S.; Futterer, K. Crystal structure of the TetR/
83
dx.doi.org/10.1021/jm200825u | J. Med. Chem. 2012, 55, 68−83