Synthesis and photophysical properties of biaryl-substituted nucleos(t)ides. Polymerase synthesis of DNA probes bearing solvatochromic and pH-sensitive dual fluorescent and 19F NMR labels

Article

pubs.acs.org/joc

Synthesis and Photophysical Properties of Biaryl-Substituted

Nucleos(t)ides. Polymerase Synthesis of DNA Probes

Bearing Solvatochromic and pH-Sensitive Dual Fluorescent

19

and F NMR Labels

Jan Riedl, Radek Pohl, Lubomír Rulísek, and Michal Hocek*

̌

Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the Czech Republic,

Gilead Sciences & IOCB Research Center, Flemingovo nam. 2, CZ-16610 Prague 6, Czech Republic

S

* Supporting Information

ABSTRACT: The design of four new fluorinated biaryl fluo-

rescent labels and their attachment to nucleosides and nu-

cleoside triphosphates (dNTPs) by the aqueous cross-coupling

reactions of biarylboronates is reported. The modified dNTPs

were good substrates for KOD XL polymerase and were

enzymatically incorporated into DNA probes. The photo-

physical properties of the biaryl-modified nucleosides, dNTPs,

and DNA were studied systematically. The different sub-

stitution pattern of the biaryls was used for tuning of emission

maxima in the broad range of 366−565 nm. Using methods of

computational chemistry the emission maxima were reproduced with a satisfactory degree of accuracy, and it was shown that the

large solvatochromic shifts observed for the studied probes are proportional to the differences in dipole moments of the ground

(S₀) and excited (S₁) states that add on top of smaller shifts predicted already for these systems in vacuo. Thus, we present a set

of compounds that may serve as multipurpose base-discriminating fluorophores for sensing of hairpins, deletions, and mis-

matches by the change of emission maxima and intensities of fluorescence and that can be also conviently studied by ¹⁹F NMR

spectroscopy. In addition, aminobenzoxazolyl-fluorophenyl-labeled nucleotides and DNA also exert dual pH-sensitive and

solvatochromic fluorescence, which may imply diverse applications.

Fluorescent pH sensors are an important class of compounds

mostly applied in the development of novel functional

materials. Very interesting and useful fluorescent pH sensors

in cell and molecular biology are dual fluorescent pH sensors

that change the emission maxima in the physiological range of

pH.⁹Particularly interesting fluorophores are the dual fluo-

rescent mutants of green fluorescent protein, which can be

directly expressed in the cell.¹⁰Several phenol-substituted nu-

cleosides exerted fluorescent pH-sensing properties.¹¹Dual

fluorophores connected to nucleic acids may be attractive for

measurement and visualization of microenvironments with

different pH values associated with various biological processes.

This may also indicate difference between tumor and normal

tissues.

NMR spectroscopy plays also an important role in the

structural studies of nucleic acids. Particularly, the measure-

ments of ¹⁹F nuclei were shown to be advantageous owing to its

low abundance compared to ¹H (typically, an artificial

fluorinated substituent is introduced site-specifically). Their

sensitivity and high range of chemical shifts reflect better the

structure and hybridization in 1D experiments. ¹⁹F NMR

INTRODUCTION

■

Fluorescence labeling of biomolecules¹and fluorescence

analytical methods have recently become one of the most

frequently used techniques in chemical biology. Nucleic acids

bearing fluorescent labels are widely used probes in molecular

biology for genomic sequencing²or for the detection of infec-

tions or genetic diseases by molecular beacons.³The

fluorophores can be attached to nucleic acids in several ways:

to phosphate or sugar moiety or to nucleobase via a conjugate

or nonconjugate linker, or a fluorophore can even replace a

nucleobase. The fluorophores attached via longer nonconjugate

aliphatic linkers are generally used for the detection in sequenc-

ing²or FRET techniques³and are favorable for decreasing the

steric hindrance in enzymatic reactions and during DNA hy-

bridization. The intrinsically fluorescent nucleoside analogues

(IFN), where a fluorophore is linked directly⁴or via conjugate

tether⁵or replacing a nucleobase either by a fused analogue⁶or

even by a structurally unrelated molecule,⁷typically respond

well to hybridization (base-discriminating fluorophores, BDF)

and formation of secondary structures. Even the use of a

nonconjugate but short propargylamide linker for attachment

of fluorophores (e.g., pyrene) resulted in the specific response

of the fluorescence to single nucleotide polymorphism (SNP).⁸

Received: November 9, 2011

Published: December 12, 2011

1026

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

a

spectroscopy was successfully implemented for studies of struc-

tural motives, ligand binding and hybridization of diverse fluorine-

labeled nucleic acids.¹²

Scheme 1. Synthesis of Biaryl Pinacolatoboronates

Apart from the chemical synthesis, base-modified DNA can

be prepared enzymatically by polymerase incorporations of the

base-modified deoxyribonucleoside triphosphates (dNTPs).¹³

Particularly efficient is the single-step synthesis of modified

dNTPs by aqueous cross-coupling reactions followed by the

polymerase incorporation. The polymerase incorporation of

modified dNTPs has been extensively used for fluorescence,¹⁴

redox,¹⁵and spin¹⁶labeling on DNA. Also, RNA polymerase

incorporation of fluorescent ribonucleoside triphosphates was

used for the construction of fluorescent RNA.¹⁷

The aim of this work is the construction of functionalized

DNA bearing novel versatile multipurpose biaryl labels capable

of base-discriminating, solvatochromic and/or pH-sensitive

fluorescence and ¹⁹F NMR detection. Four different types of

biaryl groups have been designed: 4-methoxybiphenyl (BIF),

2-phenylbenzofuryl (BFU), 2-phenylbenzoxazole (BOX), and

2-phenyl-5-aminobenzoxazole (ABOX) directly bound at the

5-position of pyrimidines or at 7-position of 7-deazapurines

with a fluorine substituent in the ortho position. The study in-

cludes the synthesis of nucleosides and dNTPs, polymerase

incorporations, photophysical properties of nucleosides (including

pH and solvent effects) studied both experimentally and com-

putationally, different secondary structures of DNA, and the

¹⁹F NMR spectroscopy.

a

Reagents and conditions: (i) Pd(PPh₃)₂Cl₂, K₂CO₃, DMF, 80 °C,

5 h, yields 1a (74%), 1b (85%); (ii) polyphosphoric acid, 170 °C, 16 h;

yields 1c (89%), 1d (94%); (iii) 1a−1d, B₂Pin₂, PdCl₂(dppf), KOAc,

dioxane, 80 °C, 1 h, yields 2a (62%), 2b (59%), 2c (65%), 2d (74%)

respectively.

RESULTS AND DISCUSSION

■

Synthesis. The attachment of the above-mentioned biaryls

to nucleosides and dNTPs was planned to be realized by the

Suzuki−Miyaura cross-couplings of halogenated nucleos(t)ides

with the corresponding biarylboronates. Therefore, the first

task was the synthesis of pinacol esters of biarylboronates via

the Suzuki coupling of the corresponding brominated biaryls

(1a−1d) with bis(pinacolato)diboron. 4-Methoxyphenyl- (1a)

and benzofuryl- (1b) derivatives were prepared in good yields

by the Suzuki coupling of 1-bromo-2-fluoro-4-iodobenzene

with the corresponding arylboronic acids (Scheme 1) in the

presence of Pd(PPh)₃Cl₂and K₂CO₃in DMF. The

benzoxazole (1c) and aminobenzoxazole (1d) derivatives

were efficiently prepared by cyclization reaction of amino-

phenols with 4-bromo-3-fluorobenzoic acid in the presence of

polyphosphoric acid (Scheme 1). The biaryl bromides (1a−1d)

were converted to the desired pinacol-boronates 2a−2d (59−

74% yields) by the cross-coupling with B₂Pin₂catalyzed by

PdCl₂(dppf) in presence of potassium acetate in dry dioxane

(Scheme 1).

best results were obtained using KOD XL DNA polymerase,

which was able to incorporate all the dN^RTPs smoothly to

achieve the full length products containing 4 modified nucleo-

tides (Figure 1). In comparison, Vent(exo-) did not give full-

length products (Figure S7 in Supporting Information). The

PEX products show slightly different mobilities in polyacryl-

amide gel electrophoresis (PAGE), but a set of representative

samples of products containing dA^BFU, dA^BOX, and dU^BOX

modifications was characterized by MALDI-TOF analysis (see

Experimental Section) as the correct full-length products. The

MALDI analysis also excluded any potential misincorporation

of natural dNTPs. The increased mobilities of some oligo-

nucleotides may be caused by more packed DNA conforma-

tions due to the hydrophobic interactions of the biaryl-

modifications. The PEX products of incorporation of modified

dU^Rin analytical scale contained a one-nucleotide shorter

impurity (Figure 1, lanes 9−12), but in preparative scale, the

PEX gave clean full-length products (Figure S8 in Supporting

Information).

Thermal Denaturation Study. For comparison and

determination of the influence of modifications on the DNA

hybridization, thermal denaturation studies were performed for

the oligonucleotides containing single and multiple incor-

porations. All modified oligonucleotides showed destabiliz-

ing effect characterized by 2−3 °C decrease of melting tem-

perature per modified nucleobase (Table 3). The stability of

single-functionalized duplexes is only slightly affected (2−3 °C),

while duplexes containing four modifications show proportional

destabilization (up to 12 °C). Since these fluorophores are

assumed to be used as single-positioned labels in modified

oligodeoxyribonucleotides, their destabilization effect is

acceptable.

The aqueous-phase Suzuki−Miyaura cross-coupling reactions

of boronates 2a−d with 7-iodo-7-deaza-2′-deoxyadenosine

(dA^I) or 5-iodo-2′-deoxyuridine (dU^I) in the presence of the

Pd(OAc)₂/TPPTS catalytic system and Cs₂CO₃in H₂O/

CH₃CN (Scheme 2, Table 1) gave the desired biaryl-sub-

stituted nucleosides dN^Rin moderate to good yields (44−71%).

Analogously, the halogenated dNTPs (dA^ITP and dU^ITP)

reacted with the boronates 2a−d to give directly the biaryl-

dNTPs (dN^RTP) in yields of 17−28%, somewhat lowered due

to the hydrolysis of the triphosphate during the coupling reaction.

Incorporation of the Modified dN^RTPs by DNA

Polymerase. The biaryl-modified dN^RTPs were tested in

primer extension (PEX; for primers and templates, see Table 2)

incorporations using several DNA polymerases (KOD XL, Vent

(exo-), Phusion, Therminator, 9°N DNA polymerase). The

1027

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

a

Scheme 2. Synthesis of Modified Nucleosides and Nucleoside Triphosphates

a

Reagents and conditions: (i) 2a-2d, Pd(OAc)₂, TPPTS, Cs₂CO₃, H₂O/CH₃CN (2:1), 80 °C, 2 h; (ii) 2a-2d, Pd(OAc)₂, TPPTS, Cs₂CO₃, H₂O/

CH₃CN (2:1), 90 °C, 0.75 h.

Table 1. Preparation of Biaryl Modified Nucleosides (dN^R) and dNTPs (dN^RTP)

entry

boronate

dN^I

dN^R

yield (%)

dN^ITP

dN^RTP

yield (%)

1

2

3

4

5

6

7

8

2a

2b

2c

2d

2a

2b

2c

2d

dA^I

dU^I

dA^BIF

61

69

57

44

65

59

71

61

dA^ITP

dU^ITP

dA^BIFTP

22

28

23

26

21

17

20

25

dA^BFU

dA^BOX

dA^ABOX

dU^BIF

dA^BFUTP

dA^BOXTP

dA^ABOXTP

dU^BIFTP

dU^BFUTP

dU^BOXTP

dU^ABOXTP

dU^BFU

dU^BOX

dU^ABOX

Photophysical Properties of the Modified Nucleo-

sides. The absorption and fluorescence emission spectra of all

biaryl-modified nucleosides dN^Rwere measured in methanol

(Figure 2, Table 4). The emission maxima as well as the inten-

sities differ depending on the nucleobase and on the biaryl

(λ_em= 422, 538 nm; Figure 2b, Table 4) originating from the

presence of a small amount of highly emissive protonated form

of dU^ABOX(vide infra).

Solvatochromic Fluorescence of ABOX Nucleosides.

ABOX boronate (2d) itself (Figure S11 in Supporting

Information) and both dN^ABOXnucleosides exerted bathochromic

(red-shifted) solvatochromic effect. The intensity of fluores-

cence strongly decreases while emission maxima are red-shifted

with increasing solvent polarity. The emission maxima change

from 480 nm in dioxane to 565 nm in water for dA^ABOXwhile

the intensity decreases 70-fold (Figure 3). dU^ABOXexerted similar

solvatochromic effects, but the fluorescence spectra showed

additional violet emission (λ_em= 422 nm) in methanol and

(λ_em= 406 nm) in water originating from the acidic form of

dU^ABOXalso observable under neutral conditions (vide infra).

For quantification of the solvatochromic effects, see Figure S9

in Supporting Information, and for UV spectra see Figure S13

in Supporting Information.

substitution pattern. dA^BIF(λ_em= 366, 386 nm), dA^BFU(λ_em

=

409 nm), dA^BOX(λ_em= 475 nm) exhibit red-shifted emission

spectra compared to free biaryl fluorophores (the correspond-

ing boronates 2a−2d) emitting almost at the same emission

maximum regardless of the structural changes (λ_em= 348−355 nm)

(see Figure S10 in Supporting Information) apparently caused by

conjugation with adenosine. Replacement of benzofurane

(dA^BFU) by benzoxazole (dA^BOX) causes another significant

red shift of the emission (λ_em= 475 nm). The fluorescence

intensities of dA^Rnucleosides decrease with longer-wavelength

emission maxima. In contrast to dA^R, the uridine portion of

fluorophores tended to decrease intensity of the emission

(dU^BIFis nonfluorescent) and change the fluorescence pro-

perties of dU^BFUand dU^BOX. The dU^BOXshows a more intense

fluorescence at slightly shorter wavelength than dU^BFU, whereas

both are still slightly red-shifted by conjugation with uridine

compared to free fluorophores. The addition of an electron-

donating amino group in dA^ABOXfurther significantly red-shifted

the emission maximum up to 535 nm (yellow fluorescence).

On the other hand, the dU^ABOXshows a dual fluorescence

Computional Study of dA^RPhotophysical Properties.

In order to explain the observed photophysical properties of the

studied compounds, quantum chemical calculations of the abs-

orption and emission spectra have been carried out, both in the

gas-phase and in solvent (using the implicit solvation model)

for three simplified model compounds, 9-methyl-7-deazaade-

nine derivatives MeA^ABOX, MeA^BOX, and MeA^BFU. We presume

1028

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

Table 2. Oligo-2′-deoxyribonucleotides Used or Synthesized in This Study

oligonucleotide

oligodeoxyribonucleotide sequence (5′−3′)

a

Prim1

5′-d(CATGGGCGGCATGGG)

a

Prim2

5′-d(GGGTGGGTGGGTGGCTTTTGT)

a

Prim3

5′-d(GGGTGGGTGGGTGGTTGT)

ON1

ON2

ON3

5′-d(CATGGGCGGCATGGGA^RGGG)

5′-d(CATGGGCGGCATGGGU^RGGG)

5′-d(GGGTGGGTGGGTGGCTTTTGTU^RAAAAAGGGG)

5′-d(CCCCTTTTTAACAAAAGCCACCCACCCACCC)

(bio) 5′-d(CCCCTTTTTAACAAAAGCCACCCACCCACCC)

5′-d(GGGTGGGTGGGTGGTTGTU^RAAGGG)

5′-d(CATGGGCGGCATGGGCAGCU^RGGACGACGAA)

5′-d(TTCGTCGTCCAGCTGCCCATGCCGCCCATG)

(bio) 5′-d(TTCGTCGTCCAGCTGCCCATGCCGCCCATG)

5′-d(TTCGTCGTCCACTGCCCATGCCGCCCATG)

5′-d(TTCGTCGTCCGCTGCCCATGCCGCCCATG)

5′-d(TTCGTCGTCCCGCTGCCCATGCCGCCCATG)

5′-d(TTCGTCGTCCTGCTGCCCATGCCGCCCATG)

5′-d(TTCGTCGTCCGGCTGCCCATGCCGCCCATG)

5′-d(CCCTCCCATGCCGCCCATG)

a

ON4

a

ON4(bio)

ON5

ON6

a

ON7

a

ON7(bio)

a

ON8

a

ON9

a

ON10

a

ON11

a

ON12

a

ON13

a

ON13(bio)

(bio) 5′-d(CCCTCCCATGCCGCCCATG)

a

ON14

5′-d(CCCGCCCATGCCGCCCATG)

a

ON15

5′-d(CCCACCCATGCCGCCCATG)

a

ON15(bio)

(bio) 5′-d(CCCACCCATGCCGCCCATG)

a

ON16

5′-d(CCCCCCCATGCCGCCCATG)

ON17 (U^R)

5′-d(CATGGGCGGCATGGGACU^RGAGCU^RCAU^RGCU^RAG)

5′-d(CTAGCATGAGCTCAGTCCCATGCCGCCCATG)

(bio) 5′-d(CTAGCATGAGCTCAGTCCCATGCCGCCCATG)

5′-d(CCCTTAACAACCACCCACCCACCC)

(bio) 5′-d(CCCTTAACAACCACCCACCCACCC)

a

ON18

a

ON18(bio)

a

ON19

a

ON19(bio)

a

Purchased oligonucleotide, (bio) = 5′-biotinylated.

Table 3. Melting Temperatures of DNA Duplexes

a

duplex

T_m(°C)

ΔT_m, (°C)

ON1/ON13

73.6

70.6

70.7

70.5

70.1

73.3

70.4

71.1

71.2

75.6

72.6

72.7

84.6

81.3

81.4

81.2

68.3

69.4

72.1

0

ON1/ON13 dA^BIF

ON1/ON13 dA^BFU

ON1/ON13 dA^BOX

ON1/ON13 dA^ABOX

ON2/ON15

−3.0

−2.9

−3.1

−3.5

0

ON2/ON15 dU^BFU

ON2/ON15 dU^BOX

ON2/ON15 dU^ABOX

ON3/ON4

ON3/ON4 dU^BFU

ON3/ON4 dU^BOX

ON3/ON4 dU^ABOX

ON6/ON7

ON6/ON7 dU^BFU

ON6/ON7 dU^BOX

ON6/ON7 dU^ABOX

ON17/ON18

ON17/ON18 dA^BFU

ON17/ON18 dA^BOX

ON17/ON18 dU^BOX

−2.9

−2.2

−2.1

0

−3.0

−2.9

0

−3.3

−3.2

0

Figure 1. Multiple incorporations of dN^RTP by KOD XL DNA

polymerase. The gel shows eight PEX experiments for the study of

dN^RTP incorporation denoted A^Ror U^R. Experiments are

supplemented by position of primer (P), positive control (+) (all

natural dNTPs are present), and two negative controls (absence of

either natural dATP (A−) or dUTP (U−)). The full length products

(ON17) contain four modified dA^Ror dU^Rnucleotides.

−3.2

−2.9

−2.3

a

ΔT_m= (T_mmod- T_mnat)/n_mod. The biaryl functionalized nucleosides

exert moderate destabilizing effect around 2−3 °C per modified base.

that these three model compounds possess the important

photophysical features of the full nucleoside systems and enable

us to explain significantly different (and solvent-dependent)

Stokes shifts in the measured emission spectra. In the gas-phase,

presumably the most accurate spectra (absorption and emission)

were obtained using RI-CC2 method that should represent

the most rigorous (and still, computationally tractable) method

1029

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

Figure 2. Normalized emission spectra of the 10 μM modified

nucleosides in methanol. (a) The emission spectra of dA^Rnucleosides.

dA^BIF(λ_em= 366, 386 nm), dA^BFU(λ_em= 409 nm), dA^BOX(λ_em

=

475 nm), and dA^ABOX(λ_em= 535 nm). (b) The emission spectra of

dU^Rnucleosides. dU^BFU(λ_em= 402 nm), dU^BOX(λ_em= 392 nm), and

dU^ABOX(λ_em= 422, 538 nm). The emission spectra were measured by

excitation at 320 nm (310 nm for dA^BIF, 340 nm for dA^BOXand

dN^ABOX).

Table 4. Photophysical Properties of the Modified

Nucleosides in Methanol

Figure 3. Solvatochromic properties of 5 μM dN^ABOXin various

solvents. (a) Normalized emission spectra of dA^ABOXin different

solvents: dioxane (λ_em= 480 nm), acetonitrile (λ_em= 515 nm),

methanol (λ_em= 535 nm), and water (λ_em= 565 nm). (b) Relative

emission spectra of dA^ABOXin different solvents: dioxane (Φ = 0.62),

acetonitrile (Φ = 0.35), methanol (Φ = 0.12), and water (Φ = 0.009).

(c) Relative emission spectra of dU^ABOXin different solvents: dioxane

(λ_em= 491 nm, Φ = 0.69), acetonitrile (λ_em= 528 nm, Φ = 0.32),

methanol (λ_em= 422, 538 nm, Φ = 0.10), and water (λ_em= 406 nm,

Φ = 0.008). The emission spectra were measured by excitation at 340 nm.

−1

dN^R

dA^BIF

dA^BFU

dA^BOX

dA^ABOX

dU^BIF

λ_abs

286

ε (L mol⁻¹cm )

λ_em

Φ_F

23000

366, 386

409

0.73

0.66

0.10

0.12

323

36000

321

26000

475

280, 327

288

22400, 16000

18000

535

dU^BFU

dU^BOX

dU^ABOX

318

38000

402

0.11

0.52

0.10

312

33000

392

301

25000

422, 538

Table 5. Calculated Photophysical Properties of Three

Model Compounds, MeA^ABOX, MeA^BOX, and MeA^BFU, and

Comparison with Experimental Data

available for the systems containing 40−50 atoms. The solvent

effects (solvatochromic shifts) were then evaluated using TD-

DFT method (CAM-B3LYP functional that is assumed to yield

satisfactorily accurate description of the excited states with

significant charge transfer character) and SMD solvation model

according to the multistep protocol described in the Computa-

tional Details. The results of the calculations are summarized in

Table 5.

Several observations can be made from the data presented in

Table 5. Absorption spectra are predicted to a good accuracy by

both methods, more accurate RI-CC2 and cheaper TD-DFT-

(CAM-B3LYP). In agreement with the experimental data, sol-

vatochromic shifts in the absorption spectra are quite small,

with the largest being computed for MeA^ABOX(λ_abs= 311 nm in

the gas-phase vs 330 nm in acetonitrile, CAM-B3LYP values).

Large Stokes shifts in the emission spectra can be explained

by a combination of two factors: solvatochromic shifts and the

change in nuclear coordinates between S₀and S₁equilibrium

geometries. The latter is largest for the MeA^ABOXwith λ_em(RI-

CC2, gas-phase) = 414 nm (cf., λ_abs= 326 nm), whereas it is

smaller for the other two systems. When analyzed in more

details, the S₁stabilization (i.e., the difference in the energy of

MeA^ABO-

X

environment

gas-phase

method

RI-CC2

MeA^BOXMeA^BFU

314 308

λ_abs

(osc strength)

326 nm

(0.77)

(0.88) (1.11)

CAM-

B3LYP

λ_abs

311

(0.90)

305 305

(0.88) (1.13)

RI-CC2

λ_em

414

369

372

364

361

364

CAM-

B3LYP

1,4-dioxane

acetonitrile

CAM-

λ_abs

320

311

313

a

b

c

B3LYP

(λ_abs-exp)

(349)

(325)

(327)

CAM-

B3LYP

λ_em

(λ_em-exp)

391

(480)

361

(432)

348

(403)

a

CAM-

B3LYP

λ_abs

(λ_abs-exp)

330

(339)

317

(322)

321

(322)

CAM-

B3LYP

λ_em

(λ_em-exp)

477

(515)

404

(469)

376

(423)

a

b

Experimental emission maxima for dA^ABOX

.

Experimental emission

c

maxima for dA^BOX. Experimental emission maxima for dA^BFU

.

the first excited state in the ground state geometry and in its

optimized geometry) in the MeA^ABOXaccounts for 3363 cm⁻¹

1030

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

Figure 4. Frontier molecular orbitals for (a, b) MeA^ABOX, (c, d) MeA^ABOX, and (d, e) MeA^BFUsystems.

whereas the S₀destabilization for approximately the same value,

3137 cm⁻¹(yielding a total of 6500 cm⁻¹as the calculated

in vacuo Stokes shift). Corresponding values for MeA^BOXand

MeA^BFUare 4962 and 4757 cm⁻¹. The geometrical change

responsible for the greater Stokes shift in MeA^ABOXis plana-

rization of the NH₂group on benzoxazole ring upon excitation.

Unfortunately, these trends are not quantitatively reproduced

by more approximate TD-DFT(CAM-B3LYP) calculations.

What is, however, nicely reproduced, are the observed

solvatochromic shifts, as can be seen from the calculated values

of λ_emvalues presented in Table 5. In relative scale (i.e., as the

differences between the calculated in vacuo and solvent values

compared to their experimental counterparts in nonpolar and

polar solvents), these shifts are reproduced almost quantita-

tively. We explain the observed trends by the different character

of the excitation between MeA^ABOXand MeA^BOXon one hand

and MeA^BFUon the other hand as depicted in Figure 4. The

dominant excitations in the RI-CC2 ansatz are always from

HOMO to LUMO orbital (contributing 85−91% in the RI-

CC2 wave function). As can be seen in Figure 4, the character

of LUMO is almost the same in all three fluorophores and is

mostly localized on the fluorobenzene moiety and the bond

connecting the two aryl rings. The HOMO is, however,

localized mostly on aminobenzoxazole (MeA^ABOXdue to the

presence of the electron-donating amino goup) or adenine

(MeA^BOX) rings, whereas it is more delocalized in the case of

MeA^BFU. It suggests that a greater charge-transfer character

of the S₁−S₀excitation can be expected for MeA^ABOXand

MeA^BOX, whereas it is more of a rather valence-type excitation

in the case of MeA^BFU. Quantitatively, it is exemplified by the

difference in the dipole moments of the ground and excited

states, which were calculated to be Δμ = 9.45, 8.79, and 4.88 D

for MeA^ABOX, MeA^BOX, and MeA^BFU, respectively. In other

words, introduction of the N-heteroatom to the benzofurane

moiety (from MeA^BFUto MeA^BOX) and even further the ad-

dition of electron-donating amino group (in MeA^ABOX) largely

increase the dipole moment of the excited state and thus

increase the Stokes shifts. It is well-known that the solva-

tochromic shifts are much smaller for the absorption spectra

(despite the fact that the individual μ’s for three studied

systems are of the comparable magnitude to their emission

counterparts) since the absorption is the fast process and solvent

does not have time to reorient itself to effectively solvate the

more polar excited states.

Photophysical Properties of the Modified dNTPs and

the Effect of pH. Absorption and emission spectra of the

modified dN^RTPs were measured in water (Table 6) at dif-

ferent pH values. At pH = 7, they showed lower intensity of

fluorescence compared to modified nucleosides in methanol.

Some functional groups of the fluorophores can be protonated

or deprotonated depending on pH, which influences the elec-

tronic densities of the fluorophores. Modified dA^RTPs contain

one amino group (pK_a= 5.2¹⁸) at the deazaadenosine moiety,

whereas dN^ABOXTP derivatives possess one extra amino group

at the biaryl moiety. Consistently with the pK_a, the fluorescence

changes within a range of slightly acidic pH values (4−6).

1031

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

Table 6. Photophysical Properties of Modified dN^RTPs in Water with Respect to pH

pH = 3

pH = 7

pH = 10

dN^RTP

λ_abs

287

ε (L mol⁻¹cm⁻¹)

λ_em

Φ_F

λ_em

409

Φ_F

λ_em

409

Φ_F

dA^BIFTP

dA^BFUTP

dA^BOXTP

dA^ABOXTP

dU^BIFTP

dU^BFUTP

dU^BOXTP

21000

0.23

0.28

0.015

0.01

0.23

0.28

0.015

0.01

320

35000

437

496

565

437

496

565

319

27000

429

443

0.13

0.01

a

280, 336

287

21000, 22000

17000

315

37000

366, 386

427

0.21

0.54

0.02

310

31000

391

406

0.18

0.81

391

0.18

b

dU^ABOXTP

293

21000

406, 560

0.002

560

a

b

dA^ABOXTP has λ_abs= 318 nm (ε = 27000 L mol⁻¹cm⁻¹) at pH = 3. dU^ABOXTP has λ_abs= 308 nm (ε = 25000 L mol⁻¹cm⁻¹) at pH = 3.

Replacement of an electron-donating amino group with an

electron-withdrawing ammonium group in acidic environment

causes the decrease of electronic densities and results in the

fluorescence quenching of dA^BIFTP (Figure S14 in Supporting

Information) and dA^BFUTP (Figure 5a). In contrast, dA^BOXTP

becomes more emissive with one extra violet emission (λ_em

=

429 nm) in the slightly acidic environment, which covers less

intense green emission (λ_em= 496 nm) in neutral or basic en-

vironment (Figure 5b). A similar effect of increase of fluo-

rescence can be observed for dA^ABOXTP upon protonation of the

additional amino group causing an interesting dual fluorescent

behavior (Figure 5c). In neutral and basic environment, the

fluorophore has yellow emission caused by the electron donating

amino group (λ_em= 565 nm). When the pH is lowered, the yellow

emission decreases until it disappears (due to the protonation

of the amino group), while an increase of another blue emission

at 443 nm (resembling the emission of protonated dA^BOXTP)

can be observed. The observed green emission at pH = 4.5

originates from presence of both forms. The fluorescence increase

of dA^ABOXabsorption spectra differed only in dN^ABOXTP due to

a stronger effect of electron charge transfer upon protonation of

amino group at the ABOX moiety (Figure S17 in Supporting

Information).

Modified dU^RTPs were characterized by lower fluorescence

intensities compared to the modified dA^RTPs. At neutral con-

ditions, dU^BFUTP is nonfluorescent, whereas dU^ABOXTP exerts

a low fluorescence (Table 3, Figure 6a,c). Uridine moiety con-

tains an imido group, which is slightly acidic (pK_a= 9.25),¹⁹

and therefore the proton is abstracted in slightly basic environ-

ment to cause an increase of intensity of fluorescence, which is

not accompanied by a significant change of UV spectra. Both

dU^BFUTP and dU^BOXTP showed a high increase of fluorescence

in basic environment, while the dU^BOXTP even changed its

emission maximum (Figure 6a,b). In contrast, dU^ABOXTP

exhibited different pH dependence (Figure 6c). When the envi-

ronment is changed from neutral to basic (pH = 10), the yellow

emission (λ_em= 560 nm) is highly increased (in accord with the

other dU^RTP derivatives). However, in acidic solutions, a new

highly intense violet emission (λ_em= 406 nm) appears due to

the protonation of the amino group. This also explains the

major band of dU^ABOXemission at the neutral pH that is due to

the presence of a low amount of highly intense dU^ABOXproto-

nated form. Further changes to more acidic conditions cause

strong enhancement of the dU^ABOXviolet emission (accom-

panied by change of UV spectrum, Figure S17).

Figure 5. Photophysical properties of (a) 12 μM dA^BFUTP, (b) 22 μM

dA^BOXTP, (c) 30 μM dA^ABOXTP in the range of pH = 3−10. Emission

spectra were measured by excitation at 340 nm. In contrast to

methanolic solutions, the fluorophores exert red-shifted emission

maxima in aqueous neutral and basic conditions dA^BFUTP (λ_em= 437),

dA^BOXTP (λ_em= 496) nm, dA^ABOXTP (λ_em= 565 nm). In acidic

environment, fluorescence of dA^BFUTP diminishes upon protonation

of 7-deazaadenosine moiety, while dA^BOXTP and dA^ABOXTP enhance

blue emissions (λ_em= 429, 443 nm, respectively).

Photophysical Properties of the Biaryl-Labeled DNA.

Single-stranded oligonucleotides (ssONs, ON1 or ON2)

containing either one of the four dA^Ror one of the four dU^R

modifications (all combinations were made) were prepared

by primer extension on biotinylated template followed by

1032

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

Emissions of fluorescent dA^Rnucleotides incorporated to

ssONs (PEX products) exhibit blue-shifted emission maxima,

which resemble emission spectra in methanol and indicate

increased hydrophobicity. This behavior may be explained by

the stacking of the fluorophore-containing nucleobase in single-

strand DNA and minor exposure of the fluorophore to aqueous

environment (Figures 2a and 7a). The stacking interactions

Figure 7. Photophysical properties of (a) ON1 functionalized by

dA^BIFand dA^BFUexerted blue-shifted emissions with lower

fluorescence intensity compared to free fluorophores (λ_em= 364,

386, and 397 nm; Φ = 0.09 and 0.18). Emission maxima of ON1

functionalized by dA^BOXand dA^ABOXare blue-shifted but with

significantly higher emission intensity compared to free fluorophores

(λ_em= 451, 535 nm; Φ = 0.1, 0.08). (b) ON2 sequence functionalized

by quenched dU^BOXand violet- and yellow-emitting dU^BFUand

dU^ABOX(λ_em= 406, 554 nm; Φ = 0.02, 0.01). The emission spectra

were measured by excitation at 330 nm (340 nm for dN^ABOX, dA^BOX

)

in 20 mM phosphate buffer, pH = 6.

Figure 6. Fluorescence spectra of (a) 20 μM dU^BFUTP, (b) 25 μM

dU^BOXTP, (c) 30 μM dU^ABOXTP in the range of pH = 3−10. The

emission spectra were measured by excitation at 330 nm. In neutral

environment, dU^BFUTP is nonemissive, dU^BOXTP exerts violet

emission (λ_em= 391 nm), and dU^ABOXTP has very low dual emission

(λ_em= 406, 560 nm). The emission intensity of all modified dUTPs is

significantly enhanced upon deprotonation of the uridine moiety in

basic environment. After deprotonation dU^BFUTP exerts violet

emission (λ_em= 366, 386 nm). Additionaly, dU^ABOXTP exerts a

significant enhancement of violet emission (λ_em= 406 nm) in acidic

environment upon the protonation of the amino group of ABOX

moiety.

induce also different response of dA^RTP fluorescence intensity

after incorporation of fluorophores into the DNA strand. The

incorporation of dA^BOXand dA^ABOXto ONs led to an increase

of fluorescence intensity, which corresponds to the presence of

adjacent stacked nucleotides and lower access to aqueous envi-

ronment. In the contrast, dA^BIFand dA^BFUshow a decrease of

emission upon incorporation to ONs. This could be attributed

to the electronic effect of the flanking guanosine nucleotides

(Figure 7a).

Modified dU^Rshowed different fluorescence properties after

incorporation to DNA compared to the corresponding dU^RTPs.

In neutral aqueous conditions, dU^BFUTP was nonfluore-

scent, dU^BOXTP exerted violet emission (λ_em= 391 nm), and

dU^ABOXTP gave violet emission of its ionized form (λ_em= 406 nm)

(Figure 6a−c). However, in the ON2 sequence, the DNA

magnetoseparation¹⁵of the modified ssON. The sequence was

selected for its high electron-donating properties containing

guanosine flanking nucleobases, which have lowest oxidation

potential of all bases.²⁰Easy oxidation of adjacent guanosines

often leads to significant decrease of fluorescence intensity of

intrinsically fluorescent nucleoside analogues causing problems

with detection and applications.²¹This phenomenon was also

utilized for the identification of mismatches by guanine-specific

fluorescence quenching caused by intercalation of pyrene fluo-

rophore to DNA strand upon mismatch formation.²²The biaryl-

substituted nucleosides were therefore studied for mismatch and

deletion studies with respect to the effect of guanosine electron-

rich flanking sequence.

containing dU^BFUwas fluorescent (λ_em= 401 nm), while dU^BOX

-

labeled DNA was almost nonfluorescent and the dU^ABOX-DNA

exerted only the enhanced yellow fluorescence (λ_em= 554 nm)

of its nonionized form at pH = 6 (Figures 6c and 7b). The

quenching of dU^BOXand dU^ABOXacidic forms in ON2 sequence

can be attributed to the effect of fluorescence quenching by the

flanking guanosine nucleotides.

Effect of Structural Changes in DNA on the Fluo-

rescence of the Labels. Since the fluorescent properties of

1033

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

the free fluorophores in water differ from the properties of

stacked fluorophores within DNA (particularly in the case of

dU^Rderivatives), further studies of the influence of the

structural changes of DNA on the fluorescence have been

conducted. The model example was the conversion of a hairpin

to double-strand DNA (dsDNA) after addition of the

complementary strand. We have chosen the hairpin structure

of which the loop structure had been previously determined by

NMR spectroscopy (Figure 8).²³The stem was designed as

Figure 9. Fluorescence spectra of 7 μM ON3 (pH = 6) containing

hairpin (ssDNA) and hybridized with ON4 to form double-stranded

DNA (dsDNA). Labeled ON3 showed enhanced intensity of

fluorescence upon hybridization with ON4 given by ratios between

Figure 8. (a) Sequences used for hairpin (the modified nucleotide in

red)−dsDNA transition. (b) Detail of the NMR structure of the loop

region.²³(c) A reference sequence (with the same flanking

nucleotides) not forming hairpin structure.

intensities of ssDNA and duplex. ON3 was labeled by (a) dU^BFU

:

Φ

_dsDNA/Φ_ssDNA= 0.12/0.035 = 3.4, hairpin (λ_em= 413 nm), dsDNA

weakly bound and consisted of four A-T and one C-G base

pairs in order to get efficient dissociation of the hairpin stem

and duplex formation. The sequence of bases in the loop was

selected according to the published NMR structure, where the

second T in the unpaired GTTA region is exposed to the

solution. Therefore the DNA containing a modified dU^Rat this

position was expected to exert significant changes of fluo-

rescence upon hybridization. Single-strand oligonucleotides

(ON3) containing dU^BFU, dU^BOX, and dU^ABOXin the loop

position were prepared by the PEX on biotinylated template

followed by magnetoseparation¹⁵of the modified ssON. The

fluorescence spectra (Figure 9) were recorded at pH = 6 in the

absence and in the presence of the complementary strand (ON4).

Interestingly, the dU^BFUfluorophore in the hairpin structure

still showed relatively high intensity of fluorescence (Φ = 0.035)

in comparison with nonfluorescent dU^BFU, indicating the pre-

sence of some interactions even in the loop region (Figure 9a,

red curve). The lack of guanosine nucleotides in the flanking

sequence of the ON3 oligonucleotide leads to an enhancement

of the dU^Rviolet fluorescence. Hence, the violet emissions of

dU^BOXas well as the minor acidic form of dU^ABOXare not

diminished. The dU^BOXfluorophore exerts violet emission

(λ_em= 366 and 387 nm), and dU^ABOXemits dual emission

(λ_em= 401, 560 nm) (Figure 9b,c, red curves). In all cases,

the intensity of fluorescence of the incorporated dU^Rincreased

by the factor of 1.6−3.4 after addition of the complementary

strand, which indicates the base-pair formation and higher

hindrence to uridine moiety of fluorophores toward water

molecules upon duplex formation (Figure 9a−c, blue curves).

Due to the absence of flanking guanosines, the acidic form of

(λ_em= 427 nm); (b) dU^BOX: Φ_dsDNA/Φ_ssDNA= 0.095/0.06 = 1.6, λ_em

366, 386 nm; (c) dU^ABOX: Φ_dsDNA/ Φ_ssDNA= 0.02/0.008 = 2.5, λ_em

=

406 nm. The emission spectra were measured by excitation at 340 nm

(330 nm for dU^BOX) in 20 mM phosphate buffer, pH = 6.

dU^ABOXgives the major increase in fluorescence upon hybri-

dization (Figure 9c).

The dU^Rfluorophores were also studied in hybridization of

ON5 oligonucleotide containing the same flanking sequence

without a possibility of forming a hairpin structure (Figure S19

in Supporting Information). dU^BOXand dU^ABOXshow only a

minor increase of fluorescence intensity upon hybridization

(Φ_dsDNA/Φ_ssDNA= 1.05, 1.2) compared to ON3 oligonucleotide

(Φ_dsDNA/Φ_ssDNA= 1.6, 2.5), respectively. On the other hand,

dU^BFUshowed a stronger increase of fluorescence upon duplex

formation (Φ_dsDNA/Φ_ssDNA= 1.85), indicating that dU^BFU

reflects the base-pair formation more sensitively than other

fluorophores.

Mismatch Studies. ON1 and ON2 oligonucleotide

sequences were selected for the complete study of all modified

nucleotides for use in the detection of single nucleotide misma-

tches. The ONs containing one modified dA^Ror one modified

dU^Rwere synthesized by PEX with magnetoseparation as in the

previous cases. They were hybridized with a matching sequence

and all three mismatch sequences (the mismatch was the

opposite to the modified nucleotide). All modified dA^Rshowed

similar behavior of the fluorescence response to the particular

type of mismatch (Figure 10 and Table S1 in Supporting

Information). When the dA^Rwas opposite to matching T, the

1034

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

Figure 10. Fluorescence spectra of 7 μM ON1 functionalized by (a) dA^BIF, (b) dA^BFU, (c) dA^BOX, and (d) dA^ABOXhybridized with complementary

strand containing T (ON13), G (ON14), A (ON15), and C (ON16) in the opposite position of the complementary strand. Intensity of fluorescnce

was decreased by about 7−14% in perfectly matched duplex. Mismatched duplexes containing G and A led to a 33−64% and 37−68% decrease of

fluorescence intensity, respectively. The C mismatch led to a 79−87% drop of fluorescence intesity. Detailed data available is provided in the

Supporting Information. The emission spectra were measured by excitation at 340 nm (320 nm for dA^BIF) in 20 mM phosphate buffer, pH = 6.

intensity of fluorescence was about the same or slightly (7−14%)

lower compared to ssDNA. On the other hand, when any

mismatch base was opposite to the modification, a significant

drop in fluorescence intensity was observed. The mismatch of

G or A opposite to dA^Rled to a 33−68% decrease in fluo-

rescence, whereas the C mismatch exerted in even a more

pronounced effect (79−87% drop in intensity). The dA^BIFand

dA^BOXgave generally the strongest base discrimination com-

pared to dA^BFUand dA^ABOX

.

The behavior of dU^Rmodifications was slightly different.

dU^BIFand dU^BOXwere not fluorescent in this particular DNA

sequence. dU^BFUand dU^ABOXwere suitable for the base-

discrimination study (Figure 11a, Figure S18 and Table S1 in

Supporting Information). Perfectly matched dsDNA containing

dU^BFUor dU^ABOXfluorophores showed ca. 23−41% decrease of

fluorescence compared to ssDNA. Interestingly, the T-dU^R

mismatch showed only a small drop of intensity (2−18%)

compared to ssDNA and stronger fluorescence compared to

matched dsDNA. The other two mismatches (C and G) gave a

significant (77−79%) drop in the fluorescence intensity. To

determine whether this T-dU^Rmismatch dichotomy is

sequence-dependent, we studied the effect of the slightly less

electron-donating flanking CG nucleotides in the PvuII

sequence to the sensitivity of dU^BFUfluorescence with respect

to a mismatch formation. (Figure 10, ON6 vs ON10−ON12).

In this particular sequence, the match dsDNA slightly increased

intensity of fluorescence of dU^BFUcompared to ssDNA, whereas

all mismatches decreased the emission intensities by 25−35%

(Figure 11b). Apparently, even the dU^BFUmodification is able

to sense the mismatches, and the effect is sequence-dependent.

The lower discrimination may be attributed to different flanking

CG nucleotides with lower electron donating properties

compared to the GG flanking nucleotides.

Figure 11. Fluorescence spectra of (a) 7 μM ON2 functionalized by

dU^BFUhybridized with complementary strand containing T (ON13),

G (ON14), A (ON15), and C (ON16) in the opposite position of the

complementary strand. The perfectly matched duplex decreased

intensity of fluorescence about 41%. Mismatched duplexes containing

T, G, and C led to 18%, 77%, and 79% decrease of fluorescence

intensity, respectively. (b) Fluorescence spectra of 7 μM ON6

containing dU^BFUhybridized perfectly matched sequence (ON7) and

sequences containing C mismatch (ON10), T mismatch (ON11), and

G mismatch (ON12). Perfectly matched duplex led to a 15% increase

of fluorescence compared to single-stranded oligonucleotide, and

duplexes containing C, T, and G mismatches led to a 16%, 24%, and

35% decrease of fluorescence intensity, respectively. The emission

spectra were measured by excitation at 330 nm in 20 mM phosphate

buffer, pH = 6.

Effect of pH on the Photophysical Properties of dsDNA.

The dual fluorescence of the dA^ABOXand dU^ABOXmodifications

was also studied in dsDNA at pH = 4−7 and 10 (Figure 12 and

Figure S20 in Supporting Information). At neutral and basic

conditions, both modifications exert a yellow emission (λ_em

545, 555 nm). Under basic conditions, no significant increase in

fluorescent intensity was observed (compared to high increase

=

1035

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

Figure 13. ¹⁹F NMR spectra of (a) 5 mM dU^ABOXTP as a

representative of unstacked ¹⁹F NMR labels with chemical shift at

−108.9 ppm; (b) 40 μM dU^ABOX-labeled ON2 and ON2/ON15

duplex exerting identical significantly upfield-shifted ¹⁹F NMR signal at

−122.1 ppm compared to unincorporated free dU^ABOXTP. Spectra

were measured in 20 mM phosphate buffer at pH = 7.

Figure 12. Fluorescence spectra of 2 μM dA^ABOX-labeled ON1/ON13

duplex at different pH = 4−10. Under neutral or basic conditions

(pH = 7−10) dA^ABOXmodified oligonucleotide displays yellow emission

(λ_em= 550 nm). The emission maxima of dA^ABOXare decreased upon

protonation of the amino group with significant blue shift in acidic

environment at pH = 6 (λ_em= 535 nm), pH = 5 (λ_em= 499 nm), and

pH = 4 (λ_em= 483 nm). The emission spectra were measured by

excitation at 340 nm in 20 mM phosphate buffer at pH = 4, 5, 6, 7, and 10.

in dU^ABOXTP by deprotonation, vide supra). Apparently, the

intensity of the fluorescence is not significantly affected by

deprotonation in duplex DNA because of the π−π stacking

effect of flanking nucleobases. On the other hand, under acidic

conditions (pH = 4), the dA^ABOXand dU^ABOXemissions are

decreased by protonation of the amino group of the label, and a

weak blue fluorescence at 483 or 490 nm can be observed.

While the dU^ABOXretains its standard yellow emission upon

protonation of its amino group (Figure S20 in Supporting

Information), the emission of dA^ABOXis blue-shifted on the

protonation (Figure 12). The emission maxima are significantly

blue-shifted, when acidity is increased. The fluorescence is

changed from yellow at pH = 7 (λ_em= 550 nm) and pH = 6

(λ_em= 535 nm), to green at pH = 5 (λ_em= 499 nm) and finally

to blue at pH = 4 (λ_em= 483 nm). This unusual pH sensitivity

(continually blue-shifted emission with decreasing pH values)

can be attributed to a dual blue and yellow emissions of

different excited states of protonated and deprotonated forms

of dA^ABOXin combination with the π−π stacking effect of the

DNA duplex and the quenching effect of the flanking G

nucleotides. Further acidifying to pH = 3 and below did not

change the emission maxima and may lead to depurination of

DNA.

Figure 14. ¹⁹F NMR spectra of (a) 30 μM ON3 containing dU^ABOX

-

labeled hairpin structure with downfield shifted ¹⁹F NMR signal at

−112.7 ppm originated from distortion of π−π stacking; (b) 30 μM

ON3 after addition of ON4 resulting in dissolution of a hairpin

structure and ON3/ON4 duplex formation accompanied by upfield

shifted ¹⁹F NMR signal to −121.8 ppm. Spectra were measured in

20 mM phosphate buffer at pH = 7.

Information). Indeed, the hairpin ssDNA containing dU^ABOX

gave a ¹⁹F NMR signal at −112.8 ppm, whereas after addition

of ON4, the signal was shifted to −121.8 ppm. Apparently, the

¹⁹F NMR spectroscopy of the dU^ABOXin DNA can distinguish

between the hairpin and stacked ss- or dsDNA. However, it

should be noted that at the rather low concentrations of ONs

prepared by enzymatic incorporations in PEX, the intensity of

the ¹⁹F NMR signals are quite low and relatively long

acquisition times (12−48 h) are needed to get good spectra.

¹⁹F NMR Spectroscopy. The ¹⁹F NMR spectra of modified

dNTPs and ss- and dsDNA were studied. The chemical shift of

dU^ABOX(−122.1 ppm) incorporated into ssDNA exerts a

significant difference from the free dU^ABOXTP with the

chemical shift of −108.9 ppm in water (Figure 13). This

change in chemical shift can be attributed to π−π stacking

within DNA and can also be in accordance with presence of

some π−π stacking within single-stranded DNA. The same

chemical shift of dU^ABOX(ca. −122 ppm) was also observed in

dsDNA (not shown).

CONCLUSIONS

■

Eight novel nucleosides dA^R, dU^Rand nucleoside triphosphates

dA^RTP, dU^RTP bearing multimode fluorescent and ¹⁹F NMR

detectable BIF, BFU, BOX, and ABOX labeling groups were

designed and prepared by single-step aqueous cross-coupling

reactions of halogenated nucleosides or dNTPs with

biarylboronates. All of the modified dN^RTPs were good

substrates for KOD XL polymerase, and the PEX incorpo-

rations were used for synthesis of modified DNA. The modified

dN^Rexerted interesting fluorescent properties, and some of

them were very sensitive to the environment and/or to the

secondary structures of DNA. The emission maxima of dif-

ferent modified adenosine (dA^R) nucleosides range from 370 to

540 nm in methanol. dA^BIFexhibited fluorescence emission at

λ_em= 366 and 386 nm. The more conjugate and electron-rich

benzofurane derivative (dA^BFU) shifts fluorescence emission to

Detection of Structural Changes by ¹⁹F NMR Spec-

troscopy. Since the chemical shift of dU^ABOXTP (−108.9

ppm) in water differs by ca. 13 ppm from π−π stacked dU^ABOX

(−122.1 ppm) in ss- or dsDNA, it can be assumed that ¹⁹F

NMR spectroscopy could be a good method for detection of

the modification in the hairpin structure (where little π−π

stacking is expected). Therefore, the ON3 containing dU^ABOX

was measured by itself and after hybridization with a com-

plementary strand (ON4, Figures 14 and S21 in Supporting

1036

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

of DMSO-d₆) for ¹³C NMR). Coupling constants (J) are given in Hz.

NMR spectra of dNTPs were measured in phosphate buffer at pH 7.1.

Complete assignment of all NMR signals was achieved by using a

combination of H,H−COSY, H,C-HSQC, and H,C-HMBC experi-

ments. Mass spectra were measured by ESI. Semipreparative sepa-

ration of nucleoside triphosphates was performed by HPLC on a

column packed with 10 μm C18 reversed phase (Phenomenex, Luna

C18 (2)). IR spectra were measured using KBr tabletes. High reso-

lution mass spectra were measured using ESI ionization technique.

Mass spectra of functionalized DNA were measured by MALDI-TOF,

with nitrogen laser. UV−vis spectra were measured at room temperature.

4-Bromo-3-fluoro-4′-methoxybiphenyl (1a). DMF (4 mL) was

added to argon-purged flask containing 4-methoxyphenylboronic acid

(302 mg, 2 mmol, 1 equiv) 1-bromo-2-fluoro-4-iodobenzene (720 mg,

2.4 mmol, 1.2 equiv), Pd(PPh₃)₂Cl₂(68 mg, 0.1 mmol, 0.05 mol %)

and K₂CO₃(414 mg, 4 mmol, 2 equiv). The mixture was stirred at

80 °C for 5 h then evaporated and product was purified by silica gel

column chromatography using hexane-ethylacetate (0−10%) as eluent.

The product was isolated as white solid (429 mg, 74%). ¹H NMR (600

MHz, CDCl₃): 3.86 (s, 3H, CH₃O); 6.98 (m, 2H, H-3′,5′); 7.21 (ddd,

λ_em= 409 nm, introduction of a N-heteroatom (dA^BOX) led to

significant red shift to λ_em= 475 nm, and further addition of an

electron-donating amino group (dA^ABOX) caused further red-

shifted yellow fluorescent emission (λ_em= 535 nm). The Stokes

shifts were found up to 200 nm. Calculations have revealed that

the major effect caused by the introduction of another N-

heteroatom and additional amino group is based on increased

differences of the dipole moments of the frontier orbitals, which

manifest in larger charge-transfer character of the excitation

and thus in larger Stokes shifts. The modified uridine (dU^R)

nucleosides are generally blue-shifted (compared to dA^R), but

dU^BIFis nonfluorescent, whereas dU^ABOXexerts dual fluo-

rescence. Both dN^ABOXhave solvatochromic fluorescent proper-

ties, showing bathochromic shift about 85 nm with increasing

polarity from dioxane to water and 70-fold decrease in emission

intensity. Fluorescence of modified dN^RTPs depends also on

pH owing to the presence of acidic or basic groups. The most

interesting were dA^BOXTP, dA^ABOXTP, and dU^ABOXTP pos-

sessing dual character of fluorescence changing from yellow or

green in neutral or slightly basic environment to blue or violet

in acidic environment. This dual fluorescence could be used for

the study of pH microenvironments in the range from 4 to 6 for

dA^RTP and 5.5 to 9 for dU^RTP. The fluorophores incorporated

to DNA are able to sense the changes in the structure of the

DNA strand by the increase of intensity in fluorescence during

the transformation from hairpin to double strand, which has

been confirmed simultaneously by ¹⁹F NMR measurement.

The fluorophores are also able to detect the site-specific single

nucleotide mismatches in the G-rich sequence by decrease of

intensity of fluorescence. However, the effects are sequence-

dependent. The best fluorophore for study of structural changes

is dU^BFU, which is only slightly fluorescent when exposed to

water (hairpin or deletions) but gives good emission in ss- or

dsDNA. The fluorescence of dU^Rnucleosides depends on the

flanking sequence. The most electron-donating flanking guanosine

nucleotides cause decreasing dU^BFUfluorescence and quenching

of the dU^BOXand dU^ABOXviolet emissions. Several modifications

dA^BIF, dA^BOX, and dU^BFUshowed base-discrimination in the

sequence containing adjacent guanosine and thus could be used

for mismatch detection in electron-donating flanking sequen-

ces. dA^ABOXand dU^ABOXare solvatochromic and can be used as

sensors of the polarity of DNA microenvironment, i.e., in binding

studies with other biomolecules. The dA^ABOXfluorophore in DNA

is extraordinarily sensitive to acidic pH. It shows a continual blue

shift of the emission maxima upon the protonation in acidic

environment. Particularly interesting and important is a change

of emission maxima in the range of pH = 7, 6, 5 (λ_em= 550,

535, and 499 nm), which makes it possible to visually distin-

guish between pH 6 and 5. Therefore, the dA^ABOXcould be a

useful tool for fine pH sensing in biological systems. Studies

along these lines will continue in our laboratory.

1H, J_5,6= 8.3, J_5,3= 2.1, J_H,F= 0.7, H-5); 7.30 (dd, 1H, J_H,F= 10.0, J_3,5

=

2.1, H-3); 7.49 (m, 2H, H-2′,6′); 7.56 (dd, 1H, J_6,5= 8.3, J_H,F= 7.3,

H-6). ¹³C NMR (151 MHz, CDCl₃): 55.4 (CH₃O); 107.0 (d, J_C,F

21, C-1); 114.4 (CH-3′,5′); 114.5 (d, J_C,F= 23, CH-3); 123.3 (d, J_C,F

=

3, CH-5); 128.0 (CH-2′,6′); 131.4 (d, J_C,F= 2, C-1′); 133.6 (CH-6);

142.3 (d, J_C,F= 7, C-4); 159.3 (d, J_C,F= 247, C-2); 159.8 (C-4′). ¹⁹F

NMR (470.3 MHz, CDCl₃): −108.0. MS (ESI⁺): m/z (%) 280 (100)

[M + H]⁺, 282 (97) [M + H]⁺. HR-MS (ESI⁺) for C₁₃H₁₀OBrF: [M +

H]⁺calculated 279.9899, found 279.9907. IR: 2841, 1608, 1581, 1559,

1522, 1478, 1394, 1309, 1292, 1268, 1249, 1201, 1187, 1119, 1030,

891, 871, 838, 808, 694.

2-(4′-Bromo-3′-fluorophenyl)-1-benzofuran (1b). DMF (4 mL)

was added to argon-purged flask containing benzofuran boronic acid

(322 mg, 2 mmol, 1 equiv), 1-bromo-2-fluoro-4-iodobenzene (720 mg,

2.4 mmol, 1.2 equiv), Pd(PPh₃)₂Cl₂(68 mg, 0.1 mmol, 5 mol %), and

K₂CO₃(414 mg, 4 mmol, 2 equiv). The mixture was stirred at 80 °C

for 5 h and then evaporated, and product was purified by silica gel

column chromatography using hexane as eluent. The product was

isolated as white solid (491 mg, 85%). ¹H NMR (499.8 MHz, CDCl₃):

6.98 (d, 1H, J_3,7= 1.0, H-3); 7.18 (ddd, 1H, J_5,4= 7.7, J_5,6= 7.3, J_5,7

=

1.0, H-5); 7.25 (ddd, 1H, J_6,7= 8.1, J_6,5= 7.3, J_6,4= 1.4, H-6); 7.44 (m,

2H, H-7 and H-6′); 7.52 (ddd, 1H, J_4,5= 7.7, J_4,6= 1.4, J_4,7= 0.8, H-4);

7.54 (dd, 1H, J_H,F= 9.6, J_2′,6′= 2.0, H-2′); 7.54 (dd, 1H, J_5′,6′= 8.3, J_H,F= 6.9,

H-5′).¹³C NMR (125.7 MHz, CDCl₃): 102.8 (CH-3); 108.9 (d, J_C,F

=

21.1, C-4′); 111.3 (CH-7); 112.7 (d, J_C,F= 24.5, CH-2′); 121.2 (CH-

4); 121.5 (d, J_C,F= 3.5, CH-6′); 123.3 (CH-5); 125.0 (CH-6); 128.8

(C-3a); 131.7 (d, J_C,F= 7.7, C-1′); 133.9 (CH-5′); 153.6 (d, J_C,F

=

2.5, C-2); 154.9 (C-7a); 159.4 (d, J_C,F= 247.1, C-3′). ¹⁹F NMR (470.3

MHz, CDCl₃): −107.1 (dd, J_F,H= 9.6, 6.9). MS (ESI⁺): m/z (%) 290

(100) [M + H]⁺, 292 (97) [M + H]⁺. HR-MS (ESI⁺) for C₁₄H₈OBrF:

[M⁺] calculated 289.9743, found 289.9751. IR: 1609, 1556, 1483,

1472, 1453, 1426, 1397, 1350, 1289, 1260, 1218, 1190, 1168, 1054,

945, 869, 812, 750, 684.

2-(4′-Bromo-3′-fluorophenyl)-1,3-benzoxazole (1c). Poly-

phosphoric acid (20 g) was added to flask containing 2-aminophenol

(218 mg, 2 mmol, 1 equiv) and 4-bromo-3-fluorobenzoic acid (438 mg,

2 mmol, 1 equiv). The reaction mixture was heated at 170 °C for

16 h. After cooling the reaction mixture was diluted by water and

neutralized by concentrated solution of KOH, and formed precipitate

was filtered and washed by water and dried. The product was isolated

EXPERIMENTAL SECTION

■

1

NMR spectra were recorded on a 600 MHz (600 MHz for H, 564

1

MHz for ¹⁹F, 240.2 MHz for ³¹P, 151 MHz for ¹³C) or a 500 MHz

(500 MHz for ¹H, 470.4 MHz for ¹⁹F, 200.2 MHz for ³¹P, 125.8 MHz

for ¹³C) spectrometer from sample solutions in D₂O, DMSO-d₆,

methanol-d₄, or acetone-d₆. Chemical shifts (in ppm, δ scale) were

referenced to the solvent signal (D₂O, referenced to dioxane 3.75 ppm,

pH = 7.1 for ¹H NMR and to H₃PO₄0.00 ppm for ³¹P NMR; acetone-

as white solid (516 mg, 89%). H NMR (499.8 MHz, CDCl₃): 7.38

(m, 1H, H-5); 7.40 (m, 1H, H-6); 7.59 (m, 1H, H-7); 7.72 (dd, 1H,

J_5′,6′= 8.3, J_H,F= 6.8, H-5′); 7.78 (m, 1H, H-4); 7.93 (dd, 1H, J_6′,5′= 8.3,

J_6′,2′= 1.9, H-6′); 8.00 (dd, 1H, J_H,F= 9.0, J_2′,6′= 1.9, H-2′). ¹³C NMR

(125.7 MHz, CDCl₃): 110.7 (CH-7); 112.9 (d, J_C,F= 21.2, C-4′);

115.4 (d, J_C,F= 25.0, CH-2′); 120.3 (CH-4); 124.1 (d, J_C,F= 3.7, CH-

6′); 125.0 (CH-5); 125.8 (CH-6); 128.3 (d, J_C,F= 7.7, C-1′); 134.3

(CH-5′); 141.8 (C-3a); 150.8 (C-7a); 159.3 (d, J_C,F= 248.3, C-3′);

161.0 (d, J_C,F= 3.4, C-2). ¹⁹F NMR (470.3 MHz, CDCl₃): −101.7 (dd,

J_F,H= 9.0, 6.8). MS (ESI⁺): m/z (%) 292 (100) [M + H]⁺, 294 (97)

1

d₆, 2.05 ppm for H NMR and 29.8 ppm (CD₃group of acetone-d₆)

1

for ¹³C NMR; CDCl₃, 7.26 ppm for H NMR and 77.36 ppm for ¹³

C

1

NMR; methanol-d₄, 3.34 ppm for H NMR and 49.86 ppm for ¹³C

NMR; DMSO-d₆, 2.54 ppm for ¹H NMR and 40.45 ppm (CD₃group

1037

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

[M + H]⁺. HR-MS (ESI⁺) for C₁₃H₈ONBrF: [M + H]⁺calculated

291.9768, found 291.9768. IR: 3077, 1620, 1599, 1555, 1484, 1471,

1454, 1427, 1401, 1347, 1307, 1243, 1191, 1180, 1066, 1038, 1003,

943, 885, 825, 786.

168.3 (d, J_C,F= 250.4, C-3′). ¹⁹F NMR (470.3 MHz, acetone-d₆):

−103.1 (dd, J_F,H= 10.3, 6.0). MS (ESI⁻): m/z (%) 351.2 (45) [M + Na]⁺.

HR-MS (ESI⁺) for C₁₉H₂₂O₃BFNa: [M + Na]⁺calculated 351.1538,

found 351.1531.

5-Amino-2-(4′-bromo-3′-fluorophenyl)-1,3-benzoxazole

(1d). Polyphosphoric acid (20 g) was added to flask containing 2,4-

diaminophenol hydrochloride (394 mg, 2 mmol, 1 equiv) and 4-

bromo-3-fluorobenzoic acid (438 mg, 2 mmol, 1 equiv). The reaction

mixture was heated at 170 °C for 16 h. After cooling the reaction

mixture was diluted by water and neutralized by concentrated solution

of KOH, and formed precipitate was filtered and washed by water and

2-(4′-Pinacolatoboronyl-3′-fluorophenyl)-1,3-benzoxazole

(2c). 2c was prepared according to the general procedure, 1c (292 mg,

1 mmol, 1 equiv) and B₂Pin₂(506 mg, 2 mmol, 2 equiv). The product

1

was isolated as white solid (340 mg, 229 mg of 2c, 65%). H NMR

(500.0 MHz, CD₃OD): 1.39 (s, 12H, (CH₃)₂C); 7.42 (td, 1H, J_5,4

J_5,6= 7.3, J_5,7= 1.4, H-5-benzoxazole); 7.46 (td, 1H, J_6,5= J_6,7= 7.3,

J_6,4= 1.4, H-6-benzoxazole); 7.70 (ddd, 1H, J_7,6= 7.3, J_7,5= 1.4, J_7,4

=

1

dried. The product was isolated as yellow solid (567 mg 94%). H

0.7, H-7-benzoxazole); 7.76 (ddd, 1H, J_4,5= 7.3, J_4,6= 1.4, J_4,7= 0.7,

H-4-benzoxazole); 7.88 (dd, 1H, J_H,F= 9.7, J_3,5= 1.4, H-3-C₆H₃F);

NMR (499.8 MHz, CDCl₃): 3.76 (bs, 2H, NH₂); 6.74 (dd, 1H, J_5,4

=

8.6, J_5,7= 2.3, H-5); 7.03 (dd, 1H, J_7,5= 2.3, J_7,4= 0.4, H-7); 7.35 (dd,

1H, J_4,5= 8.6, J_4,7= 0.4, H-4); 7.69 (dd, 1H, J_5′,6′= 8.3, J_H,F= 6.8, H-5′);

7.87 (ddd, 1H, J_6′,5′= 8.3, J_6′,2′= 2.0, J_H,F= 0.8, H-6′); 7.95 (dd, 1H,

J_H,F= 9.2, J_2′,6′= 2.0, H-2′). ¹³C NMR (125.7 MHz, CDCl₃): 105.0

(CH-7); 110.8 (CH-4); 112.5 (d, J_C,F= 21.0, C-4′); 114.4 (CH-5);

115.2 (d, J_C,F= 25.0, CH-2′); 124.0 (d, J_C,F= 3.6, CH-6′); 128.5 (d,

J_C,F= 7.7, C-1′); 134.2 (CH-5′); 142.9 (C-7a); 144.2 (C-6); 144.8

(C-3a); 159.3 (d, J_C,F= 248.1, C-3′); 161.4 (d, J_C,F= 2.7, C-2).

¹⁹F NMR (470.3 MHz, CDCl₃): −102.0 (dd, J_F,H= 9.2, 6.8). MS

(ESI⁺): m/z (%) 307 (99) [M + H]⁺, 309 (100) [M + H]⁺. HR-MS

(ESI⁺) for C₁₃H₉N₂OBrF: [M⁺] calculated 306.9877, found 306.9878.

IR: 3404, 3334, 1630, 1604, 1553, 1482, 1451, 1427, 1398, 1351, 1305,

1272, 1214, 1185 1167, 1067, 1037, 962, 887, 860, 804, 723, 617.

General Procedure for Borylation Reaction. Dioxane (5 mL)

was added to an argon-purged flask containing aryl halide 1a−1d

(1 mmol, 1 equiv), PdCl₂(dppf) (36.5 mg, 0.05 mmol, 5 mol %), bis-

(pinacolato)diboron B₂Pin₂(506 mg, 2 mmol, 2 equiv), and potassium

acetate (294 mg, 3 mmol, 3 equiv). The reaction mixture was stirred at

80 °C for 4 h and then evaporated, and the product was purified by

silica gel column chromatography using hexane/ethylacetate (0−20%)

as eluent. The isolated product contained also unreacted B₂Pin₂. Since

the pinacolatoesters are prone to hydrolysis by slightly acidic silica gel

and B₂Pin₂does not interfere with subsequent Suzuki coupling, the

products were not repurified. The yields were calculated according

ratio of signals of B₂Pin₂and products from NMR spectra.

7.89 (t, 1H, J_6,5= J_H,F= 7.7, H-6-C₆H₃F); 8.03 (dd, 1H, J_5,6= 7.7, J_5,3

=

1.4, H-5-C₆H₃F). ¹³C NMR (125.7 MHz, CD₃OD): 25.2 ((CH₃)₂C);

85.6 (C(CH₃)₂); 112.0 (CH-7-benzoxazole); 115.0 (d, J_C,F= 27.2,

CH-3-C₆H₃F); 121.0 (CH-4-benzoxazole); 123.7 (d, J_C,F= 3.3, CH-5-

C₆H₃F); 126.3 (CH-5-benzoxazole); 127.3 (CH-6-benzoxazole);

132.8 (d, J_C,F= 9.1, C-4-C₆H₃F); 138.8 (CH-6-C₆H₃F); 142.8

(C-3a-benzoxazole); 152.1 (C-7a-benzoxazole); 163.0 (C-2-benzox-

azole); 168.5 (d, J_C,F= 251.5, C-2-C₆H₃F); (C-1-C₆H₃F not detected).

¹⁹F NMR (470.3 MHz, CD₃OD): −108.9 (dd, J_F,H= 9.7, 7.7). MS

(ESI⁺): m/z (%) 340.2 (13) [M + H]⁺. HR-MS (ESI⁺) for C₁₉H₂₀-

O₃NBF: [M + H]⁺calculated 340.1515, found 340.1509.

5-Amino-2-(4′-pinacolatoboronyl-3′-fluorophenyl)-1,3-ben-

zoxazole (2d). 2d was prepared according to the general procedure,

1d (307 mg, 1 mmol, 1 equiv) and B₂Pin₂(506 mg, 2 mmol, 2 equiv).

The product was isolated as yellow solid (494 mg, 261 mg of 2d,

74%). ¹H NMR (499.8 MHz, CD₃OD): 1.38 (s, 12H, (CH₃)₂C); 6.86

(dd, 1H, J_5,4= 8.7, J_5,7= 2.3, H-5); 7.05 (dd, 1H, J_7,5= 2.3, J_7,4= 0.7,

H-7); 7.41 (dd, 1H, J_4,5= 8.7, J_4,7= 0.7, H-4); 7.80 (dd, 1H, J_H,F= 9.7,

J_2′,6′= 1.4, H-2′); 7.86 (dd, 1H, J_5′,6′= 7.8, J_H,F= 5.9, H-5′); 7.96 (ddd,

1H, J_6′,5′= 7.8, J_6′,2′= 1.4, H-6′). ¹³C NMR (125.7 MHz, CD₃OD): 25.2

((CH₃)₂C); 85.6 ((CH₃)₂C); 105.5 (CH-7); 111.8 (CH-4); 114.6 (d,

J_C,F= 27.1, CH-2′); 116.4 (CH-5); 120.4 (C-4′); 123.4 (d, J_C,F= 3.1,

CH-6′); 133.1 (d, J_C,F= 9.1, C-1′); 138.7 (d, J_C,F= 8.3, CH-5′); 143.54

(C-7a); 145.7 (C-6); 147.1 (C-3a); 163.1 (d, J_C,F= 3.3, C-2); 168.5 (d,

J_C,F= 251.4, C-3′). ¹⁹F NMR (470.3 MHz, CDCl₃): −99.2 (dd, J_F,H

=

9.7, 5.9). MS (ESI⁺): m/z (%) 355.2 (100) [M + H]⁺. HR-MS (ESI⁺)

for C₁₉H₂₁O₃N₂BF: [M + H]⁺calculated 355.1624, found 355.1620.

General Procedure for Suzuki Cross-Coupling of Base-

Halogenated Nucleoside Analogues (dN^I) with Biaryl Pinaco-

latoboronates. A mixture of H₂O/CH₃CN (2:1, 2 mL) was added to

an argon-purged flask containing nucleoside analogue dN^I(75 μmol),

a boronate (110 μmol, 1.5 equiv adjusted to the amount of boronate),

and Cs₂CO₃(73 mg, 225 μmol, 3 equiv). In a separate flask,

Pd(OAc)₂(0.84 mg, 3.75 μmol, 5 mol %) and P(Ph-SO₃Na)₃(5.39

mg, 9.37 μmol, 2.5 equiv to Pd) were combined, and the flask was

evacuated and purged with argon followed by addition of H₂O/

CH₃CN (2:1, 0.5 mL). The mixture of catalyst was then injected to

the reaction mixture, and the reaction mixture was stirred at 80 °C for

2 h. The products were isolated by silica gel column chromatography

using chloroform/methanol (0−10%) as eluent.

4-Pinacolatoboronyl-3-fluoro-4′-methoxybiphenyl (2a). 2a

was prepared according to the general procedure, 1a (281 mg, 1 mmol,

1 equiv) and B₂Pin₂(506 mg, 2 mmol, 2 equiv). The product was

isolated as white solid (269 mg, 203 mg of 2a, 62%). ¹H NMR (499.8

MHz, DMSO-d₆): 1.30 (s, 12H, (CH₃)₂C); 3.80 (s, 3H, CH₃O); 7.03

(m, 2H, H-m-C₆H₄OMe); 7.42 (dd, 1H, J_H,F= 11.1, J_3,5= 1.6, H-3);

7.49 (dd, 1H, J_5,6= 7.7, J_5,3= 1.6, H-5); 7.68 (dd, 1H, J_6,5= 7.7, J_H,F

=

6.4, H-6); 7.69 (m, 2H, H-m-C₆H₄OMe). ¹³C NMR (125.7 MHz,

DMSO-d₆): 24.8 ((CH₃)₂C); 55.5 (CH₃O); 83.9 ((CH₃)₂C); 112.7

(d, J_C,F= 24.6, CH-3); 113.4 (C-1); 114.7 (CH-m-C₆H₄OMe); 121.8

(d, J_C,F= 2.6, CH-5); 128.3 (CH-o-C₆H₄OMe); 130.7 (d, J_C,F= 2.1,

C-i-C₆H₄OMe); 137.3 (d, J_C,F= 8.8, CH-6); 145.7 (d, J_C,F= 8.7, C-4);

159.9 (C-p-C₆H₄OMe); 167.3 (d, J_C,F= 249.3, C-2). ¹⁹F{¹H} NMR

(470.3 MHz, DMSO-d₆): −102.5. MS (ESI⁺): m/z (%) 361.1 (10)

[M + Na]⁺. HR-MS (ESI⁺) for C₂₀H₂₀O₃BFNa: [M + Na]⁺calculated

361.1382, found 361.1370.

7-Deaza-7-[(3″-fluoro-4‴-methoxy-[1″,1‴-biphenyl]-4″-yl)]-

2′-deoxyadenosine (dA^BIF). dA^BIFwas prepared according to the

general procedure, dA^I(28.2 mg, 0.075 mmol), 2a (47 mg, 0.11

2-(4′-Pinacolatoboronyl-3′-fluorophenyl)-1-benzofuran

(2b). 2b was prepared according to the general procedure, 1b (291

mg, 1 mmol, 1 equiv) and B₂Pin₂(1 g, 4 mmol, 4 equiv). An additional

2 equiv of B₂Pin₂were used to increase the conversion of the reaction.

The product was isolated as white solid (720 mg, 199 mg of 2b, 59%).

¹H NMR (499.8 MHz, acetone-d₆): 1.36 (s, 12H, CH₃); 7.28 (ddd,

1

mmol). The product was isolated as white solid (20 mg, 61%). H

NMR (500.0 MHz, CD₃OD): 2.37 (ddd, 1H, J_gem= 13.4, J_2′b,1′= 6.0,

J_2′b,3′= 2.6, H-2′b); 2.73 (ddd, 1H, J_gem= 13.4, J_2′a,1′= 8.2, J_2′a,3′= 6.0,

H-2′a); 3.74 (dd, 1H, J_gem= 12.1, J_5′b,4′= 3.7, H-5′b); 3.82 (dd, 1H, J_gem

=

1H, J_5,4= 7.8, J_5,6= 7.2, J_5,7= 1.0, H-5); 7.37 (ddd, 1H, J_6,7= 8.3, J_6,5

7.2, J_6,4= 1.3, H-6); 7.48 (d, 1H, J_3,7= 1.0, H-3); 7.60 (dtd, 1H, J_7,6

=

12.1, J_5′a,4′= 3.3, H-5′b); 3.84 (s, 3H, CH₃O); 4.04 (ddd, 1H, J_4′,5′= 3.7,

3.3, J_4′,3′= 2.6, H-4′); 4.55 (dt, 1H, J_3′,2′= 6.0, 2.6, J_3′,4′= 2.6, H-3′); 6.59

(dd, 1H, J_1′,2′= 8.2, 6.0, H-1′); 7.02 (m, 2H, H-m-C₆H₄OMe); 7.47 (t,

1H, J_6,5= J_H,F= 8.0, H-6-C₆H₃F); 7.49 (dd, 1H, J_H,F= 11.5, J_3,5= 1.5,

H-3-C₆H₃F); 7.50 (d, 1H, J_H,F= 0.7, H-6-deazapurine); 7.52 (dd, 1H,

J_5,6= 8.0, J_5,3= 1.9, H-5-C₆H₃F); 7.63 (m, 2H, H-o-C₆H₄OMe); 8.14

(s, 1H, H-2-deazapurine). ¹³C NMR (125.7 MHz, CD₃OD): 41.5

(CH₂-2′); 55.8 (CH₃O); 63.7 (CH₂-5′); 73.1 (CH-3′); 86.7 (CH-1′);

89.2 (CH-4′); 103.7 (C-4a-deazapurine); 114.8 (d, J_C,F= 23.2, CH-3-

C₆H₃F); 115.5 (CH-m-C₆H₄OMe); 120.9 (d, J_C,F= 15.8, C-1-C₆H₃F);

8.3, J_7,5= J_7,3= 1.0, J_7,4= 0.7, H-7); 7.62 (dd, 1H, J_H,F= 10.3, J_2′,6′= 1.4,

H-2′); 7.68 (ddd, 1H, J_4,5= 7.8, J_4,6= 1.3, J_4,7= 0.7, H-4); 7.77 (dd, 1H,

J_6′,5′= 7.7, J_6′,2′= 1.4, H-6′); 7.82 (dd, 1H, J_5′,6′= 7.7, J_H,F= 6.0, H-5′).

¹³C NMR (125.7 MHz, acetone-d₆): 25.1 ((CH₃)₂C); 84.67

(C(CH₃)₂); 104.7 (CH-3); 111.9 (d, J_C,F= 26.8, CH-2′); 112.0

(CH-7); 116.9 (C-4′); 120.7 (d, J_C,F= 2.9, CH-6′); 122.3 (CH-4);

124.2 (CH-5); 126.1 (CH-6); 129.8 (C-3a); 136.2 (d, J_C,F= 9.2, C-1′);

138.4 (d, J_C,F= 8.7, CH-5′); 154.9 (d, J_C,F= 2.7, C-2); 155.8 (C-7a);

1038

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

123.6 (d, J_C,F= 3.2, CH-5-C₆H₃F); 124.1 (d, J_C,F= 2.1, CH-6-

deazapurine); 129.0 (CH-o-C₆H₄OMe); 132.8 (d, J_C,F= 1.9, C-i-

C₆H₄OMe); 133.3 (d, J_C,F= 3.1, CH-6-C₆H₃F); 144.0 (d, J_C,F= 7.9,

C-4-C₆H₃F); 151.0 (C-7a-deazapurine); 152.2 (CH-2-deazapurine);

(26.5 mg, 0.075 mmol), 2b (136 mg, 0.11 mmol). The product was

isolated as white solid (19 mg, 59%). ¹H NMR (600.1 MHz,

CD₃OD): 2.32 (ddd, 1H, J_gem= 13.6, J_2′b,1′= 7.0, J_2′b,3′= 6.1, H-2′b);

2.36 (ddd, 1H, J_gem= 13.6, J_2′a,1′= 6.2, J_2′a,3′= 3.7, H-2′a); 3.72, 3.79

158.9 (C-4-deazapurine); 161.4 (C-i-C₆H₄OMe); 161.7 (d, J_C,F

=

(2 × dd, 2 × 1H, J_gem= 11.9, J_5′,4′= 3.3, H-5′); 3.95 (q, 1H, J_4′,3′= J_4′,5′=

244.9, C-2-C₆H₃F);.¹⁹F{¹H} NMR (470.3 MHz, CD₃OD): −113.1.

MS (ESI⁺): m/z (%) 451 (80) [M + H]⁺, 473 (100) [M + Na]⁺.

HR-MS (ESI⁺) for C₂₄H₂₄O₄N₄F: [M + H]⁺calculated 451.17761,

found 451.17753. IR: 3613, 3568, 3522, 3410, 3203, 2984, 2933, 2872,

1614, 1571, 1543, 1496, 1469, 1453, 1391, 1381, 1372, 1355, 1259,

1230, 1145, 1104, 985, 949, 882.

3.3, H-4′); 4.43 (ddd, 1H, J_3′,2′= 6.1, 3.7, J_3′,4′= 3.3, H-3′); 6.36 (dd,

1H, J_1′,2′= 7.0, 6.2, H-1′); 7.24 (ddd, 1H, J_5,4= 7.7, J_5,6= 7.2, J_5,7= 1.0,

H-5-benzofuryl); 7.28 (d, 1H, J_3,7= 1.0, H-3-benzofuryl); 7.32 (ddd,

1H, J_6,7= 8.3, J_6,5= 7.2, J_6,4= 1.3, H-6-benzofuryl); 7.54 (m, 2H, H-6-

C₆H₃F, H-7-benzofuryl); 7.62 (ddd, 1H, J_4,5= 7.7, J_4,6= 1.3, J_4,7= 0.7,

H-4-benzofuryl); 7.68 (dd, 1H, J_H,F= 11.2, J_3,5= 1.7, H-3-C₆H₃F);

7.73 (dd, 1H, J_5,6= 8.0, J_5,3= 1.7, H-5-C₆H₃F); 8.31 (d, 1H, J_H,F= 0.6,

H-6). ¹³C NMR (150.9 MHz, CD₃OD): 41.7 (CH₂-2′); 62.6 (CH₂-

5′); 72.1 (CH-3′); 86.8 (CH-1′); 89.1 (CH-4′); 103.9 (CH-3-

5-[(3″-Fluoro-4‴-methoxy-[1″,1‴-biphenyl]-4″-yl)]-2′-deoxy-

uridine (dU^BIF). dU^BIFwas prepared according to the general

procedure, dU^I(26.5 mg, 0.075 mmol), 2a (47 mg, 0.11 mmol).

1

The product was isolated as white solid (20.8 mg, 65%). H NMR

benzofuryl); 110.4 (C-5); 112.0 (CH-7-benzofuryl); 112.7 (d, J_C,F

=

(500.0 MHz, CD₃OD): 2.30 (ddd, 1H, J_gem= 13.6, J_2′b,1′= 7.0, J_2′b,3′

=

25.2, CH-3-C₆H₃F); 121.4 (d, J_C,F= 3.2, CH-5-C₆H₃F); 122.0 (d,

J_C,F= 15.0, C-1-C₆H₃F); 122.3 (CH-4-benzofuryl); 124.3 (CH-5-

benzofuryl); 126.1 (CH-6-benzofuryl); 130.4 (C-3a-benzofuryl); 133.4

(d, J_C,F= 3.2, CH-6-C₆H₃F); 133.5 (d, J_C,F= 9.7, C-4-C₆H₃F); 141.9

(d, J_C,F= 3.0, CH-6); 151.8 (C-2); 155.5 (d, J_C,F= 2.7, C-2-

benzofuryl); 156.4 (C-7a-benzofuryl); 161.9 (d, J_C,F= 247.2, C-2-

C₆H₃F); 164.0 (C-4). ¹⁹F{¹H} NMR (470.3 MHz, CD₃OD): −111.5.

MS (ESI⁺): m/z (%) 461 (100) [M + Na]⁺. HR-MS (ESI⁺) for

C₂₃H₁₉O₆N₂FNa: [M + Na]⁺calculated 461.1119, found 461.1119. IR:

3435, 3163, 3039, 2921, 1692, 1667, 1626, 1501, 1465, 1451, 1430,

1300, 1282, 1259, 1111, 1083, 1066, 926, 945, 889, 804, 752.

6.1, H-2′b); 2.35 (ddd, 1H, J_gem= 13.6, J_2′a,1′= 6.2, J_2′a,3′= 3.8, H-2′a);

3.71, 3.78 (2 × dd, 2 × 1H, J_gem= 11.9, J_5′,4′= 3.3, H-5′); 3.83 (s, 3H,

CH₃O); 3.95 (q, 1H, J_4′,3′= J_4′,5′= 3.3, H-4′); 4.42 (ddd, 1H, J_3′,2′= 6.1,

3.8, J_3′,4′= 3.3, H-3′); 6.35 (dd, 1H, J_1′,2′= 7.0, 6.2, H-1′); 7.01 (m, 2H,

H-m-C₆H₄OMe); 7.36 (dd, 1H, J_H,F= 11.8, J_3,5= 1.7, H-3-C₆H₃F);

7.41 (dd, 1H, J_5,6= 8.0, J_5,3= 1.7, H-5-C₆H₃F); 7.46 (t, 1H, J_6,5= J_H,F

8.0, H-6-C₆H₃F); 7.58 (m, 2H, H-o-C₆H₄OMe); 8.25 (d, 1H, J_H,F

=

0.8, H-6). ¹³C NMR (125.7 MHz, CD₃OD): 41.7 (CH₂-2′); 55.8

(CH₃O); 62.6 (CH₂-5′); 72.2 (CH-3′); 86.8 (CH-1′); 89.0 (CH-4′);

110.8 (C-5); 114.3 (d, J_C,F= 23.4, CH-3-C₆H₃F); 115.4 (CH-m-

C₆H₄OMe); 119.9 (d, J_C,F= 15.0, C-1-C₆H₃F); 123.0 (d, J_C,F= 3.0,

CH-5-C₆H₃F); 129.0 (CH-o-C₆H₄OMe); 133.0 (d, J_C,F= 1.8, C-i-

C₆H₄OMe); 133.1 (d, J_C,F= 3.6, CH-6-C₆H₃F); 141.6 (d, J_C,F= 2.8,

CH-6); 144.2 (d, J_C,F= 8.2, C-4-C₆H₃F); 151.9 (C-2); 161.32 (C-p-

C₆H₄OMe); 162.0 (d, J_C,F= 246.8, C-2-C₆H₃F); 164.17 (C-4).

¹⁹F{¹H} NMR (470.3 MHz, CD₃OD): −112.1. MS (ESI⁺): m/z (%)

7-Deaza-7-[4″-(benzo[d]oxazol-2‴-yl)-2″-fluorophenyl]-2′-

deoxyadenosine (dA^BOX). dA^BOXwas prepared according to the

general procedure, dA^I(28.2 mg, 0.075 mmol), 2c (55.3 mg, 0.11

1

mmol). The product was isolated as white solid (19 mg, 57%). H

NMR (500.0 MHz, DMSO-d₆): 2.23 (ddd, 1H, J_gem= 13.1, J_2′b,1′= 5.9,

J_2′b,3′= 2.7, H-2′b); 2.57 (ddd, 1H, J_gem= 13.1, J_2′a,1′= 8.1, J_2′a,3′= 5.8,

H-2′a); 3.52 (ddd, 1H, J_gem= 11.8, J_5′b,OH= 5.9, J_5′b,4′= 4.4, H-5′b);

3.59 (ddd, 1H, J_gem= 11.8, J_5′a,OH= 5.1, J_5′a,4′= 4.4, H-5′b); 3.85 (td,

1H, J_4′,5′= 4.4, J_4′,3′= 2.4, H-4′); 4.37 (m, 1H, J_3′,2′= 5.8, 2.7, J_3′,OH= 4.0,

J_3′,4′= 2.4, H-3′); 5.07 (dd, 1H, J_OH,5′= 5.9, 5.1, OH-5′); 5.29 (d, 1H,

J_OH,3′= 4.0, OH-3′); 6.33 (bs, 2H, NH₂-deazapurine); 6.61 (dd, 1H,

J_1′,2′= 8.1, 5.9, H-1′); 7.45 (td, 1H, J_5,4= J_5,6= 7.4, J_5,7= 1.4, H-5-

benzoxazole); 7.48 (td, 1H, J_6,5= J_6,7= 7.4, J_6,4= 1.5, H-6-

benzoxazole); 7.66 (t, 1H, J_6,5= J_H,F= 8.0, H-6-C₆H₃F); 7.70 (d, 1H,

429 (10) [M + H]⁺, 451 (100) [M + Na]⁺. HR-MS (ESI⁺) for

C₂₂H₂₂O₆N₂F: [M + H]⁺calculated 429.14564, found 429.14537. IR:

3434, 3057, 2924, 2842, 1682, 1622, 1610, 1498, 1462, 1428, 1402,

1296, 1277, 1248, 1180, 1095, 1050, 1028, 894, 825.

7-Deaza-7-[4″-(benzofuran-2‴-yl)-2″-fluorophenyl]-2′-deoxy-

adenosine (dA^BFU). dA^BFUwas prepared according to the general

procedure, dA^I(28.2 mg, 0.075 mmol), 2b (136 mg, 0.11 mmol). The

1

product was isolated as white solid (23 mg, 69%). H NMR (500.0

MHz, CD₃OD): 2.37 (ddd, 1H, J_gem= 13.4, J_2′b,1′= 6.1, J_2′b,3′= 2.7, H-

2′b); 2.72 (ddd, 1H, J_gem= 13.4, J_2′a,1′= 8.2, J_2′a,3′= 6.0, H-2′a); 3.74

(dd, 1H, J_gem= 12.1, J_5′b,4′= 3.6, H-5′b); 3.82 (dd, 1H, J_gem= 12.1, J_5′a,4′

= 3.3, H-5′a); 4.04 (ddd, 1H, J_4′,5′= 3.6, 3.3, J_4′,3′= 2.5, H-4′); 4.55

(ddd, 1H, J_3′,2′= 6.0, 2.7, J_3′,4′= 2.5, H-3′); 6.59 (dd, 1H, J_1′,2′= 8.2, 6.1,

H-1′); 7.24 (td, 1H, J_5,4= J_5,6= 7.3, J_5,7= 1.0, H-5-benzofuryl); 7.28 (d,

1H, J_3,7= 1.0, H-3-benzofuryl); 7.31 (ddd, 1H, J_6,7= 8.3, J_6,5= 7.3, J_6,4

= 1.3, H-6-benzofuryl); 7.51 (t, 1H, J_6,5= J_H,F= 8.0, H-6-C₆H₃F);

7.532 (d, 1H, J_H,F= 0.8, H-6-deazapurine); 7.535 (dq, 1H, J_7,6= 8.3,

J_H,F= 0.9, H-6-deazapurine); 7.84 (ddd, 1H, J_7,6= 7.4, J_7,5= 1.4, J_7,4=

0.6, H-7-benzoxazole); 7.86 (ddd, 1H, J_4,5= 7.4, J_4,6= 1.5, J_4,7= 0.6, H-

4-benzoxazole); 8.06 (dd, 1H, J_H,F= 10.5, J_3,5= 1.7, H-3-C₆H₃F); 8.12

(dd, 1H, J_5,6= 8.0, J_5,3= 1.7, H-5-C₆H₃F); 8.17 (s, 1H, H-2-

deazapurine). ¹³C NMR (125.7 MHz, DMSO-d₆): 39.7 (CH₂-2′); 62.2

(CH₂-5′); 71.3 (CH-3′); 83.4 (CH-1′); 87.7 (CH-4′); 101.1 (C-4a-

deazapurine); 108.4 (C-5-deazapurine); 111.3 (CH-7-benzoxazole);

114.8 (d, J_C,F= 25.1, CH-3-C₆H₃F); 120.2 (CH-4-benzoxazole); 122.9

(d, J_C,F= 2.4, CH-6-deazapurine); 123.8 (d, J_C,F= 2.6, CH-5-C₆H₃F);

125.3 (CH-5-benzoxazole); 125.9 (d, J_C,F= 15.7, C-1-C₆H₃F); 126.1

J_7,3= J_7,4= J_7,5= 1.0, H-7-benzofuryl); 7.61 (ddd, 1H, J_4,5= 7.3, J_4,6

=

1.3, J_4,7= 1.0, H-4-benzofuryl); 7.75 (dd, 1H, J_H,F= 10.9, J_3,5= 1.7, H-

3-C₆H₃F); 7.79 (dd, 1H, J_5,6= 8.0, J_5,3= 1.7, H-5-C₆H₃F); 8.15 (s, 1H,

H-2-deazapurine). ¹³C NMR (125.7 MHz, CD₃OD): 41.5 (CH₂-2′);

63.7 (CH₂-5′); 73.1 (CH-3′); 86.7 (CH-1′); 89.2 (CH-4′); 103.5

(C-4a-deazapurine); 104.0 (CH-3-benzofuryl); 110.6 (C-5-deazapurine);

112.1 (CH-7-benzofuryl); 113.2 (d, J_C,F= 25.0, CH-3-C₆H₃F); 122.1

(d, J_C,F= 3.3, CH-5-C₆H₃F); 122.3 (CH-4-benzofuryl); 123.0 (d,

J_C,F= 15.9, C-1-C₆H₃F); 124.4 (CH-5-benzofuryl); 124.4 (d, J_C,F= 2.3,

CH-6-deazapurine); 126.1 (CH-6-benzofuryl); 130.0 (C-3a-benzofur-

yl); 133.2 (d, J_C,F= 8.5, C-4-C₆H₃F); 133.5 (d, J_C,F= 3.0, CH-6-

C₆H₃F); 151.1 (C-7a-deazapurine); 152.3 (CH-2-deazapurine); 155.4

(d, J_C,F= 2.7, C-2-benzofuryl); 156.4 (C-7a-benzofuryl); 158.9 (C-4-

deazapurine); 161.5 (d, J_C,F= 245.4, C-2-C₆H₃F). ¹⁹F{¹H} NMR

(470.3 MHz, CD₃OD): −112.5. MS (ESI⁺): m/z (%) 461 (100) [M +

H]⁺, 483 (90) [M + Na] ⁺. HR-MS (ESI⁺) for C₂₅H₂₂O₄N₄F: [M+H]⁺

calculated 461.1620, found 461.1619. IR: 3401, 2930, 2837, 1623,

1610, 1586, 1544, 1520, 1493, 1464, 1401, 1297, 1249, 1215, 1177,

1094, 1040, 1026, 992, 954, 926, 886, 825, 797.

(CH-6-benzoxazole); 126.9 (d, J_C,F= 8.6, C-4-C₆H₃F); 132.9 (d, J_C,F=

3.3, CH-6-C₆H₃F); 141.6 (C-3a-benzoxazole); 150.5 (C-7a-benzox-

azole); 150.7 (C-7a-deazapurine); 152.1 (CH-2-deazapurine); 157.6

(C-4-deazapurine); 159.6 (d, J_C,F= 245.4, C-2-C₆H₃F); 161.4 (d, J_C,F

=

2.8, C-2-benzoxazole). ¹⁹F{¹H} NMR (470.3 MHz, DMSO-d₆):

−110.9. MS (ESI⁺): m/z (%) 462 (60) [M + H]⁺, 484 (100) [M +

Na]⁺. HR-MS (ESI⁺) for C₂₄H₂₁O₄N₅F: [M + H]⁺calculated

462.1572, found 462.1572. IR: 3405, 2923, 2854, 2360, 2342, 1700,

1626, 1589, 1536, 1454, 1373, 1348, 1305, 1243, 1219, 1178, 1095,

1058, 1002, 961, 883, 796, 761, 747.

5-[4″-(Benzo[d]oxazol-2‴-yl)-2″-fluorophenyl]-2′-deoxyuri-

dine (dU^BOX). dU^BOXwas prepared according to the general

procedure, dU^I(26.5 mg, 0.075 mmol), 2c (55.3 mg, 0.11 mmol).

The product was isolated as white solid (23 mg, 71%). ¹H NMR

(500.0 MHz, DMSO-d₆): 2.18 (ddd, 1H, J_gem= 13.4, J_2′b,1′= 6.2, J_2′b,3′

=

3.9, H-2′b); 2.22 (ddd, 1H, J_gem= 13.4, J_2′a,1′= 7.0, J_2′a,3′= 5.8, H-2′a);

3.54, 3.59 (2 × ddd, 2 × 1H, J_gem= 11.8, J_5′,OH= 5.0, J_5′,4′= 3.5, H-5′b);

3.81 (q, 1H, J_4′,3′= J_4′,5′= 3.5, H-4′); 4.27 (m, 1H, J_3′,2′= 5.8, 3.9, J_3′,OH

=

4.3, J_3′,4′= 3.5, H-3′); 5.02 (t, 1H, J_OH,5′= 5.0, OH-5′); 5.27 (d, 1H,

J_OH,3′= 4.3, OH-3′); 6.24 (dd, 1H, J_1′,2′= 7.0, 6.2, H-1′); 7.44 (td, 1H,

5-[4″-(Benzofuran-2‴-yl)-2″-fluorophenyl]-2′-deoxyuridine

(dU^BFU). dU^BFUwas prepared according to the general procedure, dU^I

1039

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

J_5,4= J_5,6= 7.4, J_5,7= 1.4, H-5-benzoxazole); 7.48 (td, 1H, J_6,5= J_6,7

=

(CH-6-bezoxazole); 122.7 (d, J_C,F= 3.1, CH-5-C₆H₃F); 124.2 (d, J_C,F

14.6, C-1-C₆H₃F); 127.2 (d, J_C,F= 8.6, C-4-C₆H₃F); 132.9 (d, J_C,F

=

7.4, J_6,4= 1.5, H-6-benzoxazole); 7.66 (dd, 1H, J_6,5=8.0, J_H,F= 7.6,

H-6-C₆H₃F); 7.82 (ddd, 1H, J_7,6= 7.4, J_7,5= 1.4, J_7,4= 0.6, H-7-

benzoxazole); 7.85 (ddd, 1H, J_4,5= 7.4, J_4,6= 1.5, J_4,7= 0.6, H-4-

benzoxazole); 7.98 (dd, 1H, J_H,F= 10.6, J_3,5= 1.7, H-3-C₆H₃F); 8.05

(dd, 1H, J_5,6= 8.0, J_5,3= 1.7, H-5-C₆H₃F); 8.27 (s, 1H, H-6); 11.68

(bs, 1H, NH). ¹³C NMR (125.7 MHz, DMSO-d₆): 40.2 (CH₂-2′);

61.2 (CH₂-5′); 70.4 (CH-3′); 84.8 (CH-1′); 87.8 (CH-4′); 108.0 (C-

5); 111.3 (CH-7-benzoxazole); 114.3 (d, J_C,F= 25.3, CH-3-C₆H₃F);

120.2 (CH-4-benzoxazole); 123.2 (d, J_C,F= 3.2, CH-5-C₆H₃F); 124.8

(d, J_C,F= 14.7, C-1-C₆H₃F); 125.3 (CH-5-benzoxazole); 126.1 (CH-6-

benzoxazole); 127.7 (d, J_C,F= 8.8, C-4-C₆H₃F); 133.1 (d, J_C,F= 3.5,

CH-6-C₆H₃F); 140.8 (d, J_C,F= 2.8, CH-6); 141.6 (C-3a-benzoxazole);

150.1 (C-2); 150.50 (C-7a-benzoxazole); 159.9 (d, J_C,F= 248.2, C-2-

C₆H₃F); 161.2 (d, J_C,F= 2.9, C-2-benzoxazole); 161.4 (C-4). ¹⁹F{¹H}

NMR (470.3 MHz, DMSO-d₆): −108.9. MS (ESI⁺): m/z (%) 462

(100) [M + Na]⁺. HR-MS (ESI⁺) for C₂₂H₁₈O₆N₃FNa: [M+Na]⁺

calculated 462.10718, found 462.10716. IR: 3445, 3064, 1718, 1687,

1628, 1556, 1501, 1455, 1426, 1414, 1293, 1243, 1213, 1098, 1062,

1003, 955, 884, 761, 746.

3.3, CH-6-C₆H₃F); 140.7 (d, J_C,F= 2.6, CH-6); 142.6 (C-3a-

benzoxazole); 142.9 (C-7a-benzoxazole); 147.1 (C-5-benzoxazole);

150.1 (C-2); 159.9 (d, J_C,F= 247.8, C-2-C₆H₃F); 160.8 (d, J_C,F= 3.1,

C-2-benzoxazole); 161.4 (C-4). ¹⁹F{¹H} NMR (470.3 MHz, DMSO-

d₆): −113.0. MS (ESI⁺): m/z (%) 455 (100) [M + H]⁺, 477 (31) [M

+ Na]⁺. HR-MS (ESI⁺) for C₂₂H₂₀O₆N₄F: [M + H]⁺calculated

455.1361, found 455.1360. IR: 3421, 3064, 1704, 1628, 1574, 1551,

1490, 1451, 1416, 1354, 1315, 1299, 1209, 1185, 1101, 1091, 1060,

961, 890, 808, 782.

General Procedure for Suzuki Cross-Coupling of Base-

Halogenated Nucleoside Triphosphates Analogues (dN^ITPs)

with Biaryl Pinacolatoboronates. A mixture of H₂O/CH₃CN (2:1,

2 mL) was added to an argon-purged flask containing nucleoside

analogue dN^ITP (0.05 mmol), a biaryl pinacolatoboronate (0.075

mmol, 1.5 equiv), and Cs₂CO₃(49 mg, 0.15 mmol, 3 equiv). In a

separate flask, Pd(OAc)₂(0.56 mg, 0.0025 mmol, 5 mol %) and P(Ph-

SO₃Na)₃(3.59 mg, 0.00625 mmol, 2.5 equiv. to Pd) were combined,

and the flask was evacuated and purged with argon followed by

addition of H₂O/CH₃CN (2:1, 0.5 mL). The mixture of catalyst was

then injected to the reaction mixture, and the reaction mixture was

stirred at 90 °C for 0.75 h. The products were isolated by C18 reverse

phase column chromatogryphy using water/methanol (5−100%) as

eluent.

7-Deaza-7-[4″-(5‴-aminobenzo[d]oxazol-2‴-yl)-2″-fluoro-

phenyl]-2′-deoxyadenosine (dA^ABOX). dA^ABOXwas prepared

according to the general procedure, dA^I(28.2 mg, 0.075 mmol), 2d

(74 mg, 0.11 mmol). The product was isolated as yellow solid (18 mg,

1

44%). H NMR (500.0 MHz, DMSO-d₆): 2.23 (ddd, 1H, J_gem= 13.2,

7-Deaza-7-[(3″-fluoro-4‴-methoxy-[1″,1‴-biphenyl]-4″-yl)]-

2′-deoxyadenosine 5′-O-Triphosphate (dA^BIFTP). dA^BIFTP was

prepared according to the general procedure, dA^ITP (35.2 mg, 0.05

mmol), 2a (33 mg, 0.075 mmol). The product was isolated as white

solid (8.5 mg, 22%). ¹H NMR (499.8 MHz, D₂O, pD = 7.1, phosphate

buffer): 2.36 (ddd, 1H, J_gem= 13.9, J_2′b,1′= 6.1, J_2′b,3′= 3.0, H-2′b); 2.61

(ddd, 1H, J_gem= 13.9, J_2′a,1′= 8.1, J_2′a,3′= 6.3, H-2′a); 3.81 (s, 3H,

CH₃O); 4.10, 4.15 (2 × ddd, 2 × 1H, J_gem= 11.2, J_H,P= 6.4, J_5′,4′= 4.9,

J_2′b,1′= 6.0, J_2′b,3′= 2.7, H-2′b); 2.56 (ddd, 1H, J_gem= 13.2, J_2′a,1′= 8.2,

J_2′a,3′= 5.9, H-2′a); 3.52 (ddd, 1H, J_gem= 11.7, J_5′b,OH= 5.9, J_5′b,4′= 4.3,

H-5′b); 3.59 (ddd, 1H, J_gem= 11.7, J_5′a,OH= 5.2, J_5′a,4′= 4.3, H-5′b); 3.85

(td, 1H, J_4′,5′= 4.3, J_4′,3′= 2.5, H-4′); 4.37 (m, 1H, J_3′,2′= 5.9, 2.7, J_3′,OH

=

4.1, J_3′,4′= 2.5, H-3′); 5.07 (dd, 1H, J_OH,5′= 5.9, 5.2, OH-5′); 5.16 (bs,

2H, NH₂-benzoxazole); 5.28 (d, 1H, J_OH,3′= 4.1, OH-3′); 6.30 (bs, 2H,

NH₂-deazapurine); 6.60 (dd, 1H, J_1′,2′= 8.2, 6.0, H-1′); 6.70 (dd, 1H,

J_6,7= 8.7, J_6,4= 2.3, H-6-benzoxazole); 6.90 (d, 1H, J_4,5= 2.3, H-4-

benzoxazole); 7.45 (d, 1H, J_7,6= 8.7, H-7-benzoxazole); 7.61 (t, 1H,

J_6,5= J_H,F= 8.0, H-6-C₆H₃F); 7.68 (d, 1H, J_H,F= 0.8, H-6-

deazapurine); 7.97 (dd, 1H, J_H,F= 10.6, J_3,5= 1.7, H-3-C₆H₃F); 8.03

(dd, 1H, J_5,6= 8.0, J_5,3= 1.7, H-5-C₆H₃F); 8.16 (s, 1H, H-2-

deazapurine). ¹³C NMR (125.7 MHz, DMSO-d₆): 39.7 (CH₂-2′); 62.2

(CH₂-5′); 71.3 (CH-3′); 83.3 (CH-1′); 87.7 (CH-4′); 101.1 (C-4a-

deazapurine); 102.7 (CH-4-benzoxazole); 108.4 (C-5-deazapurine);

110.8 (CH-7-benzoxazole); 113.8 (CH-6-benzoxazole); 114.4 (d, J_C,F

= 25.1, CH-3-C₆H₃F); 122.8 (d, J_C,F= 3.0, CH-6-deazapurine); 123.4

(d, J_C,F= 2.8, CH-5-C₆H₃F); 125.2 (d, J_C,F= 15.5, C-1-C₆H₃F); 127.4

(d, J_C,F= 8.6, C-4-C₆H₃F); 132.8 (d, J_C,F= 2.9, CH-6-C₆H₃F); 142.7

(C-3a-benzoxazole); 142.9 (C-7a-benzoxazole); 147.1 (C-5-benzox-

azole); 150.7 (C-7a-deazapurine); 152.1 (CH-2-deazapurine); 157.6

H-5′); 4.23 (td, 1H, J_4′,5′= 4.9, J_4′,3′= 2.2, H-4′); 4.69 (ddd, 1H, J_3′,2′

=

6.3, 3.0, J_3′,4′= 2.2, H-3′); 6.53 (dd, 1H, J_1′,2′= 8.1, 6.1, H-1′); 6.86 (m,

2H, H-m-C₆H₄OMe); 7.26 (t, 1H, J_6,5= J_H,F= 8.2, H-6-C₆H₃F); 7.28

(s, 1H, H-6-deazapurine); 7.29 (d, 1H, J_H,F= 11.0, H-3-C₆H₃F); 7.42

(m, 3H, H-5-C₆H₃F, H-o-C₆H₄OMe); 8.11 (s, 1H, H-2-deazapurine).

¹³C NMR (125.7 MHz, D₂O, pD = 7.1, phosphate buffer): 40.9 (CH₂-

2′); 58.0 (CH₃O); 68.3 (d, J_C,P= 5.1, CH₂-5′); 73.8 (CH-3′); 85.5

(CH-1′); 87.7 (d, J_C,P= 8.8, CH-4′); 104.4 (C-4a-deazapurine); 113.1

(C-5-deazapurine); 116.2 (d, J_C,F= 23.4, CH-3-C₆H₃F); 116.9 (CH-

m-C₆H₄OMe); 121.6 (d, J_C,F= 15.1, C-1-C₆H₃F); 124.2 (CH-5-

C₆H₃F); 125.1 (CH-6-deazapurine); 130.5 (CH-o-C₆H₄OMe); 134.0

(C-i-C₆H₄OMe); 134.5 (CH-6-C₆H₃F); 144.2 (d, J_C,F= 9.1, C-4-

C₆H₃F); 152.3 (C-7a-deazapurine); 153.7 (CH-2-deazapurine); 159.6

(C-4-deazapurine); 161.5 (C-p-C₆H₄OMe); 162.4 (d, J_C,F= 244.4, C-

2-C₆H₃F). ³¹P{¹H} NMR (202.3 MHz, D₂O, pD = 7.1, phosphate

buffer, ref(phosphate buffer) = 2.35 ppm): −20.95 (bdd, J = 18.6,

17.1, P ); −10.32 (d, J = 18.6, P_α); −6.27 (bd, J = 17.1, P ). ¹⁹F{¹H}

(C-4-deazapurine); 159.6 (d, J_C,F= 245.1, C-2-C₆H₃F); 161.0 (d, J_C,F

=

3.0, C-2-benzoxazole). ¹⁹F{¹H} NMR (470.3 MHz, DMSO-d₆):

−111.1. MS (ESI⁺): m/z (%) 477 (80) [M + H]⁺, 499 (100) [M +

Na] ⁺. HR-MS (ESI⁺) for C₂₄H₂₂O₄N₆F: [M + H]⁺calculated

477.16811, found 477.16810. IR: 3411, 2922, 2855, 1627, 1590, 1534,

1487, 1468, 1450, 1352, 1306, 1217, 1182, 1094, 1057, 993, 884, 798.

5-[4″-(5‴-Aminobenzo[d]oxazol-2‴-yl)-2″-fluorophenyl]-2′-

deoxyuridine (dU^ABOX). dU^ABOXwas prepared according to the

general procedure, dU^I(26.5 mg, 0.075 mmol), 2d (74 mg, 0.11

β

γ

NMR (470.3 MHz, D₂O, pD = 7.1, phosphate buffer): −112.3. MS

(ESI⁻): m/z (%) 609.1 (100) [M⁻+ 2H-PO₃H], 631.1 (40) [M + H +

Na - PO₃H]⁻, 689.1 (10) [M + 2H]⁻, 711.0 (20) [M + H + Na]⁻. HR-

MS (ESI⁻) for C₂₄H₂₅O₁₃N₄FP₃: [M + 2H]⁻calculated 689.0620,

found 689.0618.

5-[(3″-Fluoro-4‴-methoxy-[1″,1‴-biphenyl]-4″-yl)]-2′-deoxy-

uridine 5′-O-Triphosphate (dU^BIFTP). dU^BIFTP was prepared

according to the general procedure, dU^ITP (34 mg, 0.05 mmol), 2a

(33 mg, 0.075 mmol). The product was isolated as white solid (7.9 mg,

21%). ¹H NMR (499.8 MHz, D₂O, pD = 7.1, phosphate buffer,

1

mmol). The product was isolated as yellow solid (21 mg, 61%). H

NMR (500.0 MHz, DMSO-d₆): 2.18 (ddd, 1H, J_gem= 13.2, J_2′b,1′= 6.2,

J_2′b,3′= 3.8, H-2′b); 2.21 (ddd, 1H, J_gem= 13.2, J_2′a,1′= 7.0, J_2′a,3′= 5.9,

H-2′a); 3.54, 3.59 (2 × dd, 2 × 1H, J_gem= 12.2, J_5′,4′= 3.5, H-5′); 3.81

(q, 1H, J_4′,3′= J_4′,5′= 3.5, H-4′); 4.27 (ddd, 1H, J_3′,2′= 5.9, 3.8, J_3′,4′= 3.5,

H-3′); 5.02 (bs, 1H, OH-5′); 5.16 (bs, 2H, NH₂-benzoxazole); 5.27

ref(dioxane) = 3.75 ppm): 2.42 (ddd, 1H, J_gem= 14.2, J_2′b,1′= 6.6, J_2′b,3′

=

(bs, 1H, OH-3′); 6.23 (dd, 1H, J_1′,2′= 7.0, 6.2, H-1′); 6.70 (dd, 1H, J_6,7

8.7, J_6,4= 2.3, H-6-benzoxazole); 6.89 (dd, 1H, J_4,6= 2.3, J_4,7= 0.5, H-

4-benzoxazole); 7.44 (dd, 1H, J_7,6= 8.7, J_7,4= 0.5, H-7-benzoxazole);

=

4.1, H-2′b); 2.46 (ddd, 1H, J_gem= 14.2, J_2′a,1′= 7.3, J_2′a,3′= 5.9, H-2′a);

3.89 (s, 3H, CH₃O); 4.17 (bm, 2H, H-5′); 4.22 (bm, 1H, H-4′); 4.64

(dt, 1H, J_3′,2′= 5.9, 4.1, J_3′,4′= 4.1, H-3′); 6.35 (dd, 1H, J_1′,2′= 7.3, 6.6,

H-1′); 7.12 (m, 2H, H-m-C₆H₄OMe); 7.47 (t, 1H, J_6,5= J_H,F= 7.8, H-

6-C₆H₃F); 7.46 (dd, 1H, J_H,F= 11.7, J_3,5= 1.8, H-3-C₆H₃F); 7.54 (dd,

1H, J_5,6= 8.0, J_5,3= 1.8, H-5-C₆H₃F); 7.72 (m, 2H, H-o-C₆H₄OMe);

7.93 (s, 1H, H-6). ¹³C NMR (125.7 MHz, D₂O, pD = 7.1, phosphate

buffer, ref(dioxane) = 69.3 ppm): 41.1 (CH₂-2′); 58.2 (CH₃O); 68.1

(d, J_C,P= 5.7, CH₂-5′); 73.4 (CH-3′); 88.3 (d, J_C,P= 8.9, CH-4′);

7.65 (dd, 1H, J_6,5= 8.1, J_H,F= 7.5, H-6-C₆H₃F); 7.89 (dd, 1H, J_H,F

=

10.7, J_3,5= 1.7, H-3-C₆H₃F); 7.97 (dd, 1H, J_5,6= 8.1, J_5,3= 1.7, H-5-

C₆H₃F); 8.25 (s, 1H, H-6); 11.66 (bs, 1H, NH). ¹³C NMR (125.7

MHz, DMSO-d₆): 40.2 (CH₂-2′); 61.2 (CH₂-5′); 70.4 (CH-3′); 84.8

(CH-1′); 87.7 (CH-4′); 102.7 (CH-4-benzoxazole); 108.1 (C-5);

110.9 (CH-7-benzoxazole); 113.8 (d, J_C,F= 25.3, CH-3-C₆H₃F); 113.9

1040

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

88.4 (CH-1′); 113.5 (C-5); 116.1 (d, J_C,F= 23.0, CH-3-C₆H₃F); 117.3

(CH-m-C₆H₄OMe); 120.4 (d, J_C,F= 15.7, C-1-C₆H₃F); 125.2 (d,

(bd, J = 19.5, P ). ¹⁹F{¹H} NMR (470.3 MHz, D₂O, pD = 7.1,

γ

phosphate buffer): −110.1. MS (ESI⁻): m/z (%) 597.1 (90) [M +

2H - PO₃H]⁻, 619.1 (35) [M + H + Na - PO₃H]⁻, 677.1 (15) [M +

2H]⁻, 699.1 (20) [M + H + Na]⁻. HR-MS (ESI⁻) for C₂₃H₂₁O₁₅N₂-

FP₃: [M + 2H]⁻calculated 677.0144, found 677.0147.

J_C,F= 3.2, CH-5-C₆H₃F); 131.0 (CH-o-C₆H₄OMe); 134.6 (d, J_C,F

=

1.8, C-i-C₆H₄OMe); 134.8 (d, J_C,F= 3.1, CH-6-C₆H₃F); 143.2 (CH-6);

145.5 (d, J_C,F= 8.5, C-4-C₆H₃F); 154.1 (C-2); 161.8 (C-p-C₆H₄OMe);

163.2 (d, J_C,F= 246.0, C-2-C₆H₃F); 167.2 (C-4). ³¹P{¹H} NMR (202.3

MHz, D₂O, pD = 7.1, phosphate buffer): −21.47 (bdd, J = 21.0, 19.5,

P ); −10.56 (d, J = 19.5, P ); −6.86 (bd, J = 21.0, P ). ¹⁹F{¹H} NMR

7-Deaza-7-[4″-(benzo[d]oxazol-2‴-yl)-2″-fluorophenyl]-2′-

deoxyadenosine 5′-O-Triphosphate (dA^BOXTP). dA^BOXTP was

prepared according to the general procedure, dA^ITP (35.2 mg, 0.05

mmol), 2c (38 mg, 0.075 mmol). The product was isolated as white

β

α

γ

(470.3 MHz, D₂O, pD = 7.1, phosphate buffer): −110.6. MS (ESI⁻):

m/z (%) 587.1 (100) [M + 2H - PO₃H]⁻, 609.1 (30) [M + H +

Na -PO₃H]⁻, 667.1 (5) [M + 2H]⁻, 689.1 (13) [M + H + Na]⁻. HR-MS

(ESI⁻) for C₂₂H₂₃O₁₅N₂FP₃: [M + 2H]⁻calculated 667.0301, found

667.0291.

1

solid (9 mg, 23%). H NMR (499.8 MHz, D₂O, pD = 7.1, phosphate

buffer): 2.42 (ddd, 1H, J_gem= 13.9, J_2′b,1′= 5.7, J_2′b,3′= 3.0, H-2′b); 2.61

(ddd, 1H, J_gem= 13.9, J_2′a,1′= 8.4, J_2′a,3′= 6.1, H-2′a); 4.06−4.16 (m, 2H,

H-5′); 4.21 (m, 1H, H-4′); 4.71 (m, 1H, H-3′); 6.37 (dd, 1H, J_1′,2′= 8.4,

5.7, H-1′); 7.23 (t, 1H, J_5,4= J_5,6= 7.3, H-5-benzoxazole); 7.27 (t, 1H,

J_6,5= J_6,7= 7.3, H-6-benzoxazole); 7.41 (m, 3H, H-6-C₆H₃F, H-4,7-

benzoxazole); 7.49 (s, 1H, H-6-deazapurine); 7.77 (d, 1H, J_H,F= 11.5,

H-3-C₆H₃F); 7.79 (dd, 1H, J_5,6= 9.1, H-5-C₆H₃F); 8.01 (s, 1H, H-2-

deazapurine). ¹³C NMR (125.7 MHz, D₂O, pD = 7.1, phosphate

buffer): 41.0 (CH₂-2′); 68.3 (d, J_C,P= 6.2, CH₂-5′); 73.8 (CH-3′); 85.5

(CH-1′); 87.8 (d, J_C,P= 8.5, CH-4′); 103.7 (C-4a-deazapurine); 112.2

(C-5-deazapurine); 113.4 (CH-7-benzoxazole); 117.6 (d, J_C,F= 25.8,

CH-3-C₆H₃F); 121.4 (CH-4-benzoxazole); 125.1 (CH-6-deazapur-

ine); 126.3 (CH-5-C₆H₃F); 127.2 (d, J_C,F= 14.9, C-1-C₆H₃F); 127.7

(CH-5-benzoxazole); 128.6 (CH-6-benzoxazole); 129.0 (d, J_C,F= 8.6,

C-4-C₆H₃F); 134.7 (d, J_C,F= 2.2, CH-6-C₆H₃F); 142.6 (C-3a-

benzoxazole); 152.1 (C-7a-deazapurine); 152.6 (C-7a-benzoxazole);

7-Deaza-7-[4″-(benzofuran-2‴-yl)-2″-fluorophenyl]-2′-deoxy-

adenosine 5′-O-Triphosphate (dA^BFUTP). dA^BFUTP was prepared

according to the general procedure, dA^ITP (35.2 mg, 0.05 mmol), 2b

(92 mg, 0.075 mmol). The product was isolated as white solid (11 mg,

28%). ¹H NMR (499.8 MHz, D₂O, pD = 7.1, phosphate buffer,

ref(dioxane) = 3.75 ppm): 2.42 (ddd, 1H, J_gem= 13.8, J_2′b,1′= 5.7, J_2′b,3′

= 2.9, H-2′b); 2.65 (dt, 1H, J_gem= 13.8, J_2′a,1′= J_2′a,3′= 7.3, H-2′a); 4.08

(ddd, 1H, J_gem= 11.3, J_H,P= 5.0, J_5′b,4′= 4.2, H-5′b); 4.12 (ddd, 1H, J_gem

= 11.3, J_H,P= 6.4, J_5′a,4′= 4.2, H-5′a); 4.21 (q, 1H, J_4′,5′= J_4′,3′= 4.2,

H-4′); 4.71 (bm, 1H, H-3′); 6.40 (dd, 1H, J_1′,2′= 7.3, 5.7, H-1′); 7.02

(s, 1H, H-3-benzofuryl); 7.19 (t, 1H, J_5,4= J_5,6= 7.1, H-5-benzofuryl);

7.26 (t, 1H, J_6,7= J_6,5= 7.1, H-6-benzofuryl); 7.34 (m, 2H, H-6-C₆H₃F,

H-7-benzofuryl); 7.44 (d, 1H, J_4,5= 7.1, H-4-benzofuryl); 7.45 (s, 1H,

H-6-deazapurine); 7.56 (d, 1H, J_5,6= 8.0, H-5-C₆H₃F); 7.59 (d, 1H,

J_H,F= 11.0, H-3-C₆H₃F); 7.98 (s, 1H, H-2-deazapurine). ¹³C NMR

(125.7 MHz, D₂O, pD = 7.1, phosphate buffer, ref(dioxane) = 69.3

ppm): 40.9 (CH₂-2′); 68.28 (d, J_C,P= 6.2, CH₂-5′); 73.8 (CH-3′); 85.4

(CH-1′); 87.7 (d, J_C,P= 8.6, CH-4′); 104.1 (C-4a-deazapurine); 105.6

(CH-3-benzofuryl); 112.8 (C-5-deazapurine); 113.5 (CH-7-benzofur-

yl); 114.9 (d, J_C,F= 25.9, CH-3-C₆H₃F); 123.4 (d, J_C,F= 14.7, C-1-

C₆H₃F); 123.6 (CH-5-C₆H₃F); 123.8 (CH-4-benzofuryl); 124.3 (CH-

6-deazapurine); 125.9 (CH-5-benzofuryl); 127.6 (CH-6-benzofuryl);

131.2 (C-3a-benzofuryl); 133.7 (d, J_C,F= 8.7, C-4-C₆H₃F); 134.6 (CH-

6-C₆H₃F); 152.1 (C-7a-deazapurine); 153.5 (CH-2-deazapurine);

156.3 (d, J_C,F= 2.9, C-2-benzofuryl); 157.0 (C-7a-benzofuryl); 159.4

(C-4-deazapurine); 162.1 (d, J_C,F= 242.6, C-2-C₆H₃F). ³¹P{¹H} NMR

(202.3 MHz, D₂O, pD = 7.1, phosphate buffer, ref(phosphate buffer)

= 2.35 ppm): −21.30 (dd, J = 20.3, 19.0, P ); −10.21 (d, J = 19.0, P );

153.6 (CH-2-deazapurine); 159.2 (C-4-deazapurine); 161.7 (d, J_C,F

=

246.0, C-2-C₆H₃F); 164.1 (d, J_C,F= 2.7, C-2-benzoxazole). ³¹P{¹H}

NMR (202.3 MHz, D₂O, pD = 7.1, phosphate buffer): −21.28 (bdd,

J = 19.4, 18.7, P ); −10.49 (d, J = 18.7, P ); −6.52 (bd, J = 19.4, P ).

β

α

γ

¹⁹F{¹H} NMR (470.3 MHz, D₂O, pD = 7.1, phosphate buffer):

−110.5. MS (ESI⁻): m/z (%) 620.1 (100) [M + 2H - PO₃H]⁻, 642.1

(35) [M + H + Na - PO₃H]⁻700.0 (12) [M + 2H]⁻, 722.0 (16) [M +

H + Na]⁻. HR-MS (ESI⁻) for C₂₄H₂₂O₁₃N₅FP₃: [M + 2H]⁻calculated

700.0416, found 700.0396.

5-[4″-(Benzo[d]oxazol-2‴-yl)-2″-fluorophenyl]-2′-deoxyuri-

dine 5′-O-Triphosphate (dU^BOXTP). dU^BOXTP was prepared

according to the general procedure, dU^ITP (34 mg, 0.05 mmol), 2c

(38 mg, 0.075 mmol). The product was isolated as white solid (7.6 mg,

20%). ¹H NMR (499.8 MHz, D₂O, pD = 7.1, phosphate buffer): 2.45

(dd, 2H, J_2′,1′= 6.8, J_2′,3′= 5.1, H-2′); 4.14−4.25 (m, 3H, H-4′,5′); 4.66

(td, 1H, J_3′,2′= 5.1, J_3′,4′= 3.0, H-3′); 6.33 (t, 1H, J_1′,2′= 6.8, H-1′); 7.44

(td, 1H, J_5,4= J_5,6= 7.5, J_5,7= 1.3, H-5-benzoxazole); 7.48 (td, 1H, J_6,5

β

α

−6.86 (bd, J = 20.3, P ). ¹⁹F{¹H} NMR (470.3 MHz, D₂O, pD = 7.1,

γ

phosphate buffer): −111.7. MS (ESI⁻): m/z (%) 619.1 (100) [M + 2H

- PO₃H]⁻, 641.1 (30) [M + H + Na - PO₃H]⁻, 699.0 (20) [M + 2H]⁻,

721.0 (20) [M + H + Na]⁻. HR-MS (ESI⁻) for C₂₅H₂₃O₁₃N₄FP₃: [M

+ 2H]⁻calculated 699.0464, found 699.0463.

= J_6,7= 7.5, J_6,4= 1.5, H-6-benzoxazole); 7.64 (dd, 1H, J_6,5=8.0, J_H,F

=

7.6, H-6-C₆H₃F); 7.72 (ddd, 1H, J_7,6= 7.5, J_7,5= 1.3, J_7,4= 0.7, H-7-

benzoxazole); 7.75 (ddd, 1H, J_4,5= 7.5, J_4,6= 1.5, J_4,7= 0.7, H-4-

benzoxazole); 7.96 (dd, 1H, J_H,F= 10.6, J_3,5= 1.7, H-3-C₆H₃F); 8.01

(s, 1H, H-6); 8.05 (dd, 1H, J_5,6= 8.0, J_5,3= 1.7, H-5-C₆H₃F). ¹³C NMR

(125.7 MHz, D₂O, pD = 7.1, phosphate buffer): 41.3 (CH₂-2′); 68.0

(d, J_C,P= 5.2, CH₂-5′); 70.4 (CH-3′); 88.4 (d, J_C,P= 8.6, CH-4′); 88.6

5-[4″-(Benzofuran-2‴-yl)-2″-fluorophenyl]-2′-deoxyuridine

5′-O-Triphosphate (dU^BFUTP). dU^BFUTP was prepared according to

the general procedure, dU^ITP (34 mg, 0.05 mmol), 2b (92 mg, 0.075

1

mmol). The product was isolated as white solid (7.2 mg, 17%). H

NMR (499.8 MHz, D₂O, pD = 7.1, phosphate buffer, ref(dioxane) =

3.75 ppm): 2.44 (m, 2H, H-2′); 4.18 (m, 2H, H-5′); 4.21 (m, 1H,

H-4′); 4.64 (m, 1H, H-3′); 6.33 (t, 1H, J_1′,2′= 6.9, H-1′); 7.32 (t, 1H,

J_5,4= J_5,6= 7.3, H-5-benzofuryl); 7.33 (s, 1H, H-3-benzofuryl); 7.39

(ddd, 1H, J_6,7= 8.2, J_6,5= 7.3, J_6,4= 1.1, H-6-benzofuryl); 7.52 (t, 1H,

J_H,F= J_6,5= 7.8, H-6-C₆H₃F); 7.62 (d, 1H, J_7,6= 8.2, H-7-benzofuryl);

(CH-1′); 112.6 (C-5); 113.9 (CH-7-benzoxazole); 117.3 (d, J_C,F

=

25.4, CH-3-C₆H₃F); 121.9 (CH-4-benzoxazole); 126.0 (d, J_C,F= 15.4,

C-1-C₆H₃F); 126.3 (d, J_C,F= 3.0, CH-5-C₆H₃F); 127.9 (CH-5-

benzoxazole); 128.9 (CH-6-benzoxazole); 130.8 (d, J_C,F= 8.8, C-4-

C₆H₃F); 135.4 (d, J_C,F= 2.7, CH-6-C₆H₃F); 143.2 (C-3a-

benzoxazole); 143.8 (CH-6); 153.1 (C-7a-benzoxazole); 154.0 (C-

2); 162.8 (d, J_C,F= 247.9, C-2-C₆H₃F); 164.9 (C-2-benzoxazole);

166.7 (C-4). ³¹P{¹H} NMR (202.3 MHz, D₂O, pD = 7.1, phosphate

7.71 (d, 1H, J_4,5= 7.3, H-4-benzofuryl); 7.72 (dd, 1H, J_H,F= 11.0, J_3,5

=

1.6, H-3-C₆H₃F); 7.79 (dd, 1H, J_5,6= 7.8, J_5,3= 1.6, H-5-C₆H₃F); 7.95

(s, 1H, H-6). ¹³C NMR (125.7 MHz, D₂O, pD = 7.1, phosphate

buffer, ref(dioxane) = 69.3 ppm): 41.2 (CH₂-2′); 68.1 (d, J_C,P= 4.2,

CH₂-5′); 73.4 (CH-3′); 88.3 (d, J_C,P= 8.8, CH-4′); 88.43 (CH-1′);

105.9 (CH-3-benzofuryl); 113.2 (C-5); 114.0 (CH-7-benzofuryl);

114.5 (d, J_C,F= 25.0, CH-3-C₆H₃F); 122.2 (d, J_C,F= 16.4, C-1-C₆H₃F);

123.6 (CH-5-C₆H₃F); 124.2 (CH-4-benzofuryl); 126.1 (CH-5-

benzofuryl); 127.8 (CH-6-benzofuryl); 131.6 (C-3a-benzofuryl);

135.0 (CH-6-C₆H₃F); 135.1 (d, J_C,F= 9.0, C-4-C₆H₃F); 143.4 (CH-

6); 154.0 (C-2); 156.9 (C-2-benzofuryl); 157.4 (C-7a-benzofuryl);

163.0 (d, J_C,F= 245.8, C-2-C₆H₃F); 167.0 (C-4). ³¹P{¹H} NMR

(202.3 MHz, D₂O, pD = 7.1, phosphate buffer, ref(phosphate buffer)

= 2.35 ppm): −21.49 (t, J = 19.5, P ); −10.60 (d, J = 19.5, P ); −6.87

buffer, ref(phosphate buffer) = 2.35 ppm): −21.41 (bt, J = 19.2, P );

β

−10.66 (d, J = 19.2, P_α); −6.69 (bs, P ). ¹⁹F{¹H} NMR (470.3 MHz,

γ

pD = 7.1, phosphate buffer): −109.0. MS (ESI⁻): m/z (%) 517.9 (90)

[M + 2H - 2PO₃H]⁻, 597.9 (65) [M + 2H - PO₃H]⁻, 619.9 (25) [M +

H + Na - PO₃H]⁻, 678.0 (2) [M + 2H]⁻, 699.8 (13) [M + H + Na]⁻.

HR-MS (ESI⁻) for C₂₂H₂₀O₁₅N₃FP₃: [M + 2H]⁻calculated 678.0097,

found 678.0098.

7-Deaza-7-[4″-(5‴-aminobenzo[d]oxazol-2‴-yl)-2″-fluoro-

phenyl]-2′-deoxyadenosine 5′-O-Triphosphate (dA^ABOXTP).

dA^ABOXTP was prepared according to the general procedure, dA^ITP

(35.2 mg, 0.05 mmol), 2d (50 mg, 0.075 mmol). The product was

1

isolated as yellow solid (10.4 mg, 26%). H NMR (499.8 MHz, D₂O,

β

α

1041

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

pD = 7.1, phosphate buffer): 2.37 (ddd, 1H, J_gem= 13.8, J_2′b,1′= 6.0,

J_2′b,3′= 2.9, H-2′b); 2.53 (ddd, 1H, J_gem= 13.8, J_2′a,1′= 8.1, J_2′a,3′= 6.4,

H-2′a); 4.08 (dt, 1H, J_gem= 11.4, J_H,P= J_5′b,4′= 5.4, H-5′b); 4.13 (ddd,

1H, J_gem= 11.4, J_H,P= 6.8, J_5′a,4′= 4.7, H-5′a); 4.21 (ddd, 1H, J_4′,5′= 5.4,

4.7, J_4′,3′= 2.2, H-4′); 4.67 (ddd, 1H, J_3′,2′= 6.4, 2.9, J_3′,4′= 2.2, H-3′);

6.34 (dd, 1H, J_1′,2′= 8.1, 6.0, H-1′); 6.67−6.75 (m, 2H, H-4,6-

benzoxazole); 7.14 (d, 1H, J_7,6= 9.0, H-7-benzoxazole); 7.33 (t, 1H,

J_6,5= J_H,F= 8.0, H-6-C₆H₃F); 7.42 (s, 1H, H-6-deazapurine); 7.64 (d,

1H, J_H,F= 11.5, H-3-C₆H₃F); 7.67 (d, 1H, J_5,6= 8.0, H-5-C₆H₃F); 8.05

(s, 1H, H-2-deazapurine). ¹³C NMR (125.7 MHz, D₂O, pD = 7.1,

phosphate buffer): 41.0 (CH₂-2′); 68.3 (CH₂-5′); 73.8 (CH-3′); 85.6

(CH-1′); 87.7 (d, J_C,P= 7.9, CH-4′); 103.6 (C-4a-deazapurine); 107.6

(CH-4-benzoxazole); 112.2 (C-5-deazapurine); 113.5 (CH-7-benzox-

azole); 117.3 (d, J_C,F= 24.5, CH-3-C₆H₃F); 118.3 (CH-6-bezoxazole);

5′-end allowing radiographic detection. Preparative primer extension

for fluorescence and NMR studies: Reaction mixture for oligonucleo-

tide preparation contained primer (6.6 μM), 5′-biotinylated template

(6.6 μM), dNTPs (200 μM), dN^RTPs (200 μM), 10x buffer, and

KOD XL DNA polymerase (7.5 U). Reaction was incubated for 1 h.

Biotinylated templates were used allowing magnetoseparation.

Isolation of Single-Strand Oligonucleotides by Magneto-

separatic Procedure. The reaction mixture containing 0.3 M NaCl

was added to a suspension of magnetic beads (50 μL of the MagPrep

P-25 Streptavidin Particles stock solution from Novagen) washed

three times by 450 μL of buffer (0.3 M NaCl, 10 mM TRIS, pH = 7.4).

The suspension was shaken for 40 min at room temperature, allowing

the oligonucleotides to bind to the Magselect beads, which were

washed three times by 500 μL of PBS solution (0.14 M NaCl, 3 mM

KCl, 4 mM sodium phosphate pH = 7.4), three times by 500 μL of

buffer (0.3 M NaCl, 10 mM TRIS, pH = 7.4). Single-strand

oligonucleotides were released by shaking and heating of the sample

to 75 °C for 2 min. Each medium exchange was performed using a

magnetoseparator (Dynal, Norway). The samples were desalted by

Amicon Ultra centrifugal filters containing 3K cellulose membrane and

lyophilized.

125.2 (CH-6-deazapurine); 126.1 (CH-5-C₆H₃F); 128.9 (d, J_C,F

=

15.2, C-1-C₆H₃F); 129.00 (d, J_C,F= 6.5, C-4-C₆H₃F); 134.5 (CH-6-

C₆H₃F); 143.5 (C-3a-benzoxazole); 146.0 (C-5-benzoxazole); 147.1

(C-7a-benzoxazole); 152.0 (C-7a-deazapurine); 153.2 (CH-2-deaza-

purine); 158.9 (C-4-deazapurine); 161.6 (d, J_C,F= 243.7, C-2-C₆H₃F);

164.3 (C-2-benzoxazole). ³¹P{¹H} NMR (202.3 MHz, D₂O, pD = 7.1,

phosphate buffer, ref(phosphate buffer) = 2.35 ppm): −21.14 (t, J =

19.3, P ); −10.15 (d, J = 19.3, P ); −6.72 (bd, J = 19.3, P ). ¹⁹F{¹H}

Characterization of Oligonucleotides. Oligonucleotides were

characterized by MALDI-TOF mass spectrometry. A mixture of 3-

hydroxypicolinic acid (HPA)/picolinic acid (PA)/ammonium tartrate

in the ratio 8/1/1 in 50% acetonitrile was used as matrix for MALDI-

TOF measurement. Then 2 μL of the matrix and 1 μL of the sample

were mixed on MTP 384 polished steel target by use of anchor-chip

desk. The acceleration tension in reflectron mode was 19.5 kV and

range of measurement 3−13 kDa.

β

α

γ

NMR (470.3 MHz, D₂O, pD = 7.1, phosphate buffer): −110.7. MS

(ESI⁻): m/z (%) 635.2 (20) [M + 2H - PO₃H]⁻, 657.2 (8) [M + H +

Na - PO₃H]⁻715.2 (3) [M + 2H]⁻, 737.2 (6) [M + H + Na]⁻. HR-MS

(ESI⁻) for C₂₄H₂₃O₁₃N₆FP₃: [M + 2H]⁻calculated 715.0525, found

715.0520.

5-[4″-(5‴-Aminobenzo[d]oxazol-2‴-yl)-2″-fluorophenyl]-2′-

deoxyuridine 5′-O-Triphosphate (dU^ABOXTP). dU^ABOXTP was

prepared according to the general procedure, dU^ITP (34 mg, 0.05

mmol), 2d (50 mg, 0.075 mmol). The product was isolated as yellow

solid (9.7 mg, 25%). ¹H NMR (499.8 MHz, D₂O, pD = 7.1, phosphate

buffer): 2.44 (m, 2H, H-2′); 4.13−4.26 (m, 3H, H-4′,5′); 4.65 (m, 1H,

H-3′); 6.30 (t, 1H, J_1′,2′= 6.9, H-1′); 6.89 (dd, 1H, J_6,7= 8.7, J_6,4= 1.6,

Table 7

ON1 (A^BIF) [M + H]⁺

ON1 (A^BFU) [M + H]⁺

ON1 (A^BOX) [M + H]⁺

ON1 (A^ABOX) [M + H]⁺

ON2 (U^BFU) [M + H]⁺

ON2 (U^BOX) [M + H]⁺

ON2 (U^ABOX) [M + H]⁺

ON3 (U^BFU) [M + H]⁺

ON3 (U^BOX) [M + H]⁺

ON3 (U^ABOX) [M + H]⁺

ON5 (U^BFU) [M + H]⁺

ON5 (U^BOX) [M + H]⁺

ON5 (U^ABOX) [M + H]⁺

ON6 (U^BFU) [M + H]⁺

ON6 (U^BOX) [M + H]⁺

ON6 (U^ABOX) [M + H]⁺

ON17 (A^BFU) [M + H]⁺

ON17 (A^BOX) [M + H]⁺

ON17 (U^BOX) [M + H]⁺

calcd

6172.1

6182.1

6185.1

6200.1

6160.1

6161.1

6176.1

9990.7

9991.7

10006.7

7825.7

7826.7

7841.7

9539.6

9540.7

9555.6

10449.8

10453.8

10399.2

found

6174.5

6183.9

6185.7

6201.1

6161.7

6162.8

6177.4

9996.0

9996.7

10010.9

7826.7

7827.4

7842.8

9545.7

9543.9

9558.3

10452.1

10454.1

10404.8

H-6-benzoxazole); 7.03 (s, 1H, H-4-benzoxazole); 7.46 (d, 1H, J_7,6

=

8.7, H-7-benzoxazole); 7.59 (dd, 1H, J_6,5= 8.0, J_H,F= 7.6, H-6-C₆H₃F);

7.82 (d, 1H, J_H,F= 10.6, H-3-C₆H₃F); 7.95 (d, 1H, J_5,6= 8.0, H-5-

C₆H₃F); 7.97 (s, 1H, H-6). ¹³C NMR (125.7 MHz, D₂O, pD = 7.1,

phosphate buffer): 41.4 (CH₂-2′); 68.0 (d, J_C,P= 5.6, CH₂-5′); 73.5

(CH-3′); 88.5 (d, J_C,P= 8.6, CH-4′); 88.7 (CH-1′); 107.9 (CH-4-

benzoxazole); 112.5 (C-5); 114.0 (CH-7-benzoxazole); 117.0 (d, J_C,F

= 24.9, CH-3-C₆H₃F); 118.5 (CH-6-bezoxazole); 125.7 (d, J_C,F= 15.1,

C-1-C₆H₃F); 126.1 (d, J_C,F= 3.1, CH-5-C₆H₃F); 130.8 (d, J_C,F= 9.0,

C-4-C₆H₃F); 135.2 (d, J_C,F= 3.2, CH-6-C₆H₃F); 143.7 (CH-6); 144.0

(C-3a-benzoxazole); 146.5 (C-7a-benzoxazole); 147.6 (C-5-benzox-

azole); 153.9 (C-2); 162.7 (d, J_C,F= 248.3, C-2-C₆H₃F); 165.1 (C-2-

benzoxazole); 166.6 (C-4). ³¹P{¹H} NMR (202.3 MHz, D₂O, pD =

7.1, phosphate buffer, ref(phosphate buffer) = 2.35 ppm): −21.40

(t, J = 19.5, P ); −10.67 (d, J = 19.5, P_α); −6.67 (d, J = 19.5, P ).

β

γ

¹⁹F{¹H} NMR (470.3 MHz, D₂O, pD = 7.1, phosphate buffer):

−108.9. MS (ESI⁻): m/z (%) 612.9 (85) [M + 2H − PO₃H]⁻, 634.9

(60) [M + H + Na - PO₃H]⁻, 693.1 (8) [M + 2H]⁻, 714.8 (30) [M +

H + Na]⁻. HR-MS (ESI⁻) for C₂₂H₂₁O₁₅N₄FP₃: [M + 2H]⁻calculated

693.0206, found 693.0210.

Fluorescence Measurements. Samples were dissolved in pH

adjusted 20 mM buffers. Citric buffer was used for the range of pH =

3−5, phosphate buffer for pH = 5.25−7.75, and borate buffer for pH =

8−10. All fluorescence measurements of DNA were performed in

solution of phosphate buffer adjusted to pH = 6.

The fluorescence measurements were performed on a spectro-

fluorometer with 220−850 nm range, xenon source, excitation and

emission wavelength scans, spectral bandwidth 1−16 nm, PMT detector,

scan rate 3−6000 nm/min, and Saya-Namioka grating monochromator.

We used the comparative method for recording fluorescence quantum

yield of a sample using a 10 mM solution of quinine sulfate in 0.1 M

H₂SO₄(in H₂O) as a standard (Φ = 0.54). The area of the emission

spectrum was integrated using the instrumentation software, and the

quantum yield was calculated according to the following equation:

Biochemical Materials. Synthetic ONs were purchased from

Sigma-Aldrich (USA); for their sequences, see Table 1. Dynabeads

M-280 streptavidin (DBStv) were obtained from Sigma-Aldrich (USA);

Pwo DNA polymerase from PEQLAB (Germany); Vent (exo-) DNA

polymerase, Klenow (exo-) fragment, and T4 polynucleotide kinase

from New England Biolabs (Great Britain); DyNAzyme II DNA

polymerace from Finnzymes (Finland); standard nucleoside triphos-

phates (dATP, dTTP, dCTP, and dGTP) from Sigma-Aldrich; and

γ-³²P-ATP from MP Empowered Discovery (USA). Other chemicals

were of analytical grade.

Primer Extension. Primer extension for analysis by polyacrylamide

gel electrophoresis: The reaction mixture contained primer (0.15 μM)

template (0.22 μM), natural dNTPs (200 μM), dN^RTPs, buffer, and

DNA polymerase (0.1 U). The reaction mixture was incubated for

15 min (30 min for 4 modified ONs) at 60 °C and analyzed by

polyacrylamide gel electrophoresis. Primers were ³²P-prelabeled at

2

Φ

= Φ

[F

/F

][A

/A

][n

/n

]

F(SA)

F(ST) (SA) (ST) (ST) (SA) (SA) (ST)

1042

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

Here, Φ_F(SA)and Φ_F(ST)are the fluorescence quantum yields of the

sample and the standard, respectively. The terms F_(SA)and F_(ST)are

the integrated fluorescence intensities of the sample and the standard,

respectively; A_(SA)and A_(ST)are the optical densities of the sample and

the standard solution at the wavelength of excitation, respectively; and

n_(SA)and n_(ST)are the values of the refractive index for the solvents

used for the sample, respectively.

(2) (a) Smith, L. M.; Sanders, J. Z.; Kaiser, R. J.; Hughes, P.; Dodd,

C.; Connell, C. R.; Heiner, C.; Kent, S. B. H.; Hood, L. E. Nature

1986, 321, 674−679. (b) Guo, J.; Xu, N.; Li, Z.; Zhang, S.; Wu, J.;

Kim, D. H.; Marma, M. S.; Meng, Q.; Cao, H.; Li, X.; Shi, S.; Yu, L.;

Kalachikov, S.; Russo, J. J.; Turro, N. J.; Ju, J. Proc. Natl. Acad. Sci.

U.S.A. 2008, 105, 9145−9150.

(3) Tyagi, S.; Kramer, F. R. Nat. Biotechnol. 1996, 14, 303−308.

(4) (a) Greco, N. J.; Tor, Y. Tetrahedron 2007, 63, 3515−3527.

(b) Greco, N. J.; Tor, Y. J. Am. Chem. Soc. 2005, 127, 10784−10785.

(c) Srivatsan, S. G.; Tor, Y. J. Am. Chem. Soc. 2007, 129, 2044−2053.

(d) Pawar, M. G.; Srivatsan, S. G. Org. Lett. 2011, 13, 1114−1117.

(e) Greco, N. J.; Sinkeldam, R. W.; Tor, Y. Org. Lett. 2009, 11, 1115−

1118. (f) Wanninger-Weiss, C.; Valis, L.; Wagenknecht, H.-A. Bioorg.

Med. Chem. 2008, 16, 100−106.

(5) (a) Hudson, R. H. E.; Ghorbani-Choghamarani, A. Org. Biomol.

Chem. 2007, 5, 1845−1848. (b) Capobianco, M. L.; Cazzato, A.; Alesi,

S.; Barbarella, G. Bioconjugate Chem. 2008, 19, 171−177. (c) Ryu,

J. H.; Seo, Y. J.; Hwang, G. T.; Lee, J. Y.; Kim, B. H. Tetrahedron 2007,

63, 3538−3547. (d) Xiao, Q.; Ranasinghe, R. T.; Tang, A. M. P.;

Brown, T. Tetrahedron 2007, 63, 3483−3490. (e) Sessler, J. L;

Sathiosatham, M.; Brown, C. T.; Rhodes, T. A.; Wiederrecht, G. J. Am.

Chem. Soc. 2001, 123, 3655−3660. (f) Skorobogatyi, M. V.; Malakov,

A. D.; Pchelintseva, A. A.; Turban, A. A.; Bondarev, S. L.; Korshun,

V. A. ChemBioChem 2006, 7, 810−816.

(6) (a) Okamoto, A.; Tainaka, K.; Saito, I. J. Am. Chem. Soc. 2003,

125, 4972−4973. (b) Okamoto, A.; Tanaka, K.; Fukuta, T.; Saito, I.

J. Am. Chem. Soc. 2003, 125, 9296−9297. (c) Gardarson, H.; Kale, A.;

Sigurdsson, S. T. ChemBioChem 2011, 12, 567−575. (d) Cekan, P;

Sigurdsson, S. T. Chem. Commun. 2008, 29, 3393−3395. (e) Xie, Y.;

Maxson, T.; Tor, Y. Org. Biomol. Chem. 2010, 8, 5053−5055.

(f) Srivatsan, S. G.; Weizman, H.; Tor, Y. Org. Biomol. Chem. 2008, 6,

1334−1338. (g) Datta, K.; Johnson, N. P.; Villani, G.; Marcus, A. H.;

von Hippel, P. H. Nucleic Acids Res. 2011, E-pub ahead of print,

DOI: 10.1093/nar/gkr858.

¹⁹F NMR Measurements. ¹⁹F{¹H} NMR spectra were recorded

on a 500 MHz spectrometer in D₂O solutions containing 10 mM

phosphate buffer (pD = 7.1) and 0.1 mM EDTA. Typical experimental

parameters for measurements of oligonucleotides were chosen as

follows: 38 k data points (spectral width 40 ppm, transmitter fre-

quency offset −110 ppm), 25 k scans, acquisition time 1 s and relaxa-

tion delay 1 s. All time domain data were processed with an exponential

window function using a line broadening factor of 10 Hz for single-

stranded DNA containing hairpin and 2 or 5 Hz for duplex.

COMPUTATIONAL DETAILS

■

Quantum chemical calculations were carried out using Turbomole

6.3²⁴and Gaussian 09²⁵program packages. All results reported in the

manuscript were obtained using the medium-sized def2-SVP basis set.²⁶

Accurate gas-phase absorption and emission spectra were obtained using

the RI-CC2 method, which was also used for the optimization of the

S₁state in order to obtain S₁minimum from which the emission to the

ground S₀state (in the geometry of the S₁minimum) was calculated.

In order to address the effect of solvation, the SMD model²⁷available

in Gaussian 09 together with the long-range corrected version of the

standard and widely used B3LYP functional (Coulomb-attenuated

method), CAM-B3LY,P²⁸was used to avoid severe underestimation

of the charge-tranfer excitations by B3LYP (and other standard

functionals). We have used two solvents representing less polar (1,4-

dioxane; ε_r= 2.2099) and polar (acetonitrile; ε_r= 35.688) moieties.

The vertical absorption spectra in the solvent were calculated using

state-specific (S₁) nonequilibrium solvation with the solvent reaction

field corresponding to the ground state. The emission spectra were

calculated using (i) TD-DFT (CAM-B3LYP) optimization of the S₁

state and linear response, equilibrium solvation (of the S₁state) and

(ii) vertical emission to the ground state (at the S₁geometry) subtra-

cting energy of the S₁excited state using the state-specific equilibrium

solvation from the energy of the S₀state using nonequilibrium sol-

vation (i.e., the solvent reaction field corresponding to the S₁state).

This represents the recommended protocol for the conceptually

rigorous absorption and emission energies in solvent.²⁹

(7) (a) Karunakaran, V.; Perez Lustres, J. L.; Zhao, L.; Ernsting, N.

P.; Seitz, O. J. Am. Chem. Soc. 2006, 128, 2954−2962. (b) Kummer, S.;

Knoll, A.; Socher, E.; Bethge, L.; Herrmann, A.; Seitz, O. Angew.

Chem., Int. Ed. 2011, 50, 1931−1934. (c) Holzhauser, C.; Berndl, S.;

Menacher, F.; Breunig, M.; Gopferich, A.; Wagenknecht, H.-A. Eur. J.

̈

Org. Chem. 2010, 7, 1239−1248. (d) Berndl, S.; Wagenknecht, H.-A.

Angew. Chem., Int. Ed. 2009, 48, 2418−2421. (e) Asanuma, H.;

Kashida, H.; Liang, X.; Komiyama, M. Chem. Commun. 2003, 7, 1536−

1537. (f) Coleman, R. S.; Berg, M. A.; Murphy, C. J. Tetrahedron 2007,

63, 3450−3456.

ASSOCIATED CONTENT

* Supporting Information

■

(8) (a) Okamoto, A.; Kanatani, K.; Saito, I. J. Am. Chem. Soc. 2004,

126, 4820−4827. (b) Tainaka, K.; Tanaka, K.; Ikeda, S.; Nishiza, K.-I.;

Unzai, T.; Fujiwara, Y.; Saito, I.; Okamoto, A. J. Am. Chem. Soc. 2007,

129, 4776−4784. (c) Saito, Y.; Motegi, K.; Bag, S. S.; Saito, I. Bioorg.

Med. Chem. 2008, 16, 107−113.

(9) (a) Han, J.; Burgess, K. Chem. Rev. 2010, 110, 2709−2728.

(b) Craig, I. M.; Duong, H. M.; Wudl, F.; Schwartz, B. J. Chem. Phys.

Lett. 2009, 477, 319−324.

(10) Hanson, G. T.; McAnaney, T. B.; Park, E. S.; Rendell, M. E. P.;

Yarbrough, D. K.; Chu, S.; Xi, L.; Boxer, S. G.; Montrose, M. H.;

Remington, S. J. Biochemistry 2002, 41, 15477−15488.

(11) Sun, K. M.; McLaughlin, C. K.; Lantero, D. R.; Manderville,

R. A. J. Am. Chem. Soc. 2007, 129, 1894−1895.

(12) (a) Barhate, N. B.; Barhate, R. N.; Cekan, P.; Drobny, G.;

Sigurdsson, S. T. Org. Lett. 2008, 10, 2745−2747. (b) Puffer, B.;

Kreutz, C.; Rieder, U.; Bert, M.-O.; Konrat, R.; Micura, R. Nucleic

Acids Res. 2009, 37, 7728−7740. (c) Kreutz, C.; Kahlig, H.; Konrat, R.;

Micura, R. Angew. Chem., Int. Ed. 2006, 45, 3450−3453. (d) Graber,

D.; Moroder, H.; Micura, R. J. Am. Chem. Soc. 2008, 130, 17230−

17231.

S

Additional figures of PEX, quantification of solvatochromic

effects, fluorescence and ¹⁹F NMR spectra, copies of all NMR

spectra. This material is available free of charge via the Internet

at http://pubs.acs.org.

AUTHOR INFORMATION

Corresponding Author

*E-mail: hocek@uochb.cas.cz.

■

ACKNOWLEDGMENTS

■

This work is a part of the research projects Z4 055 0506

supported by the Academy of Sciences of the Czech Republic.

It was specifically supported by the Czech Science Foundation

(203/09/0317) and by Gilead Sciences, Inc. (Foster City, CA,

USA). The authors thank Dr. Dana Nachtigallova

discussions.

́

for helpful

(13) Reviews: (a) Hocek, M.; Fojta, M. Org. Biomol. Chem. 2008, 6,

2233−2241. (b) Weisbrod, S. H.; Marx, A. Chem. Commun. 2007,

1828−1830.

(14) (a) Thoresen, L. H.; Jiao, G.-S.; Haaland, W. C.; Metzker, M. L.;

Burgess, K. Chem.Eur. J. 2003, 9, 4603−4610. (b) Shoji, A.;

REFERENCES

■

(1) (a) Lavis, L. D.; Raines, R. T. ACS Chem. Biol. 2008, 3, 142−155.

(b) J. N. Wilson, J. N.; Kool, E. T. Org. Biomol. Chem. 2006, 4, 4265−

4274.

1043

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

The Journal of Organic Chemistry

Article

Hasegawa, T.; Kuwahara, M.; Ozaki, H.; Sawai, H. Bioorg. Med. Chem.

Lett. 2007, 17, 776−779.

́ ́ ́ ̌ ́

(15) (a) Brazdilova, P.; Vrabel, M.; Pohl, R.; Pivonkova, H.; Havran,

L.; Hocek, M.; Fojta, M. Chem.Eur. J. 2007, 13, 9527−9533.

(b) Cahova, H.; Havran, L.; Brazdilova, P.; Pivonkova, H.; Pohl, R.;

Fojta, M.; Hocek, M. Angew. Chem., Int. Ed. 2008, 47, 2059−2062.

́

̌

́

̌

́ ́ ̌ ́ ́

ova, P.; Pivonkova, H.; Kalachova, L.; Cernocka,

(c) Vrab

H.; Cahova,

Chem.Eur. J. 2009, 15, 1144−1154. (d) Macíck

́

el, M.; Horak

H.; Pohl, R.; Sebest, P.; Havran, L.; Hocek, M.; Fojta, M.

ova-Cahova, H.;

k, J.; Fojta, M.; Hocek, M.

̌

́

̌

́

̌

́ ́ ̌

Pohl, R.; Horakova, P.; Havran, L.; Space

Chem.Eur. J. 2011, 17, 5833−5841.

(16) Obeid, S.; Yulikow, M.; Jeschke, G.; Marx, A. Angew. Chem., Int.

Ed. 2008, 47, 6782−6785.

(17) Srivatsan, S. G.; Tor, Y. Chem. Asian J. 2009, 4, 419−427.

(18) Strobel, S. A.; Jones, F. D.; Oyelere, A. K.; Ryder, S. P. Nucleic

Acids Res. Suppl. 2003, 3, 229−230.

(19) pK_adata compiled by R. Williams: http://research.chem.psu.

edu/brpgroup/pKa_compilation.pdf.

(20) Seidel, C. A. M.; Schulz, A.; Sauer, M. H. M. J. Phys. Chem.

1996, 100, 5541−5553.

́

(21) Dierckx, A.; Diner, P.; El-Sagheer, A. H.; Kumar1, J. D.; Brown,

T.; Grøtli, M.; Wilhelmsson, L. M. Nucleic Acids Res. 2011, 39, 4513−

4524.

(22) Dohno, C.; Saito, I. Nucleic Acids Symp. Ser. 2004, 48, 93−94.

(23) van Dongen, M. J. P.; Mooren, M. M. W.; Willems, E. F. A.; van

der Marel, G. A.; van Boom, J. H.; Wijmenga, S. S.; Hilbers, C. W.

Nucleic Acids Res. 1997, 25, 1537−1547.

(24) Treutler, O.; Ahlrichs, R. J. Chem. Phys. 1995, 102, 346−354.

(25) Frisch, M. J.; Trucks, G. W.; Schlegel, H. B.; Scuseria, G. E.;

Robb, M. A.; Cheeseman, J. R.; Scalmani, G.; Barone, V.; Mennucci, B.;

Petersson, G. A.; Nakatsuji, H.; Caricato, M.; Li, X.; Hratchian, H. P.;

Izmaylov, A. F.; Bloino, J.; Zheng, G.; Sonnenberg, J. L.; Hada, M.;

Ehara, M.; Toyota, K.; Fukuda, R.; Hasegawa, J.; Ishida, M.; Nakajima,

T.; Honda, Y.; Kitao, O.; Nakai, H.; Vreven, T.; Montgomery, Jr., J. A.;

Peralta, J. E.; Ogliaro, F.; Bearpark, M.; Heyd, J. J.; Brothers, E.; Kudin,

K. N.; Staroverov, V. N.; Kobayashi, R.; Normand, J.; Raghavachari, K.;

Rendell, A.; Burant, J. C.; Iyengar, S. S.; Tomasi, J.; Cossi, M.; Rega, N.;

Millam, N. J.; Klene, M.; Knox, J. E.; Cross, J. B.; Bakken, V.; Adamo,

C.; Jaramillo, J.; Gomperts, R.; Stratmann, R. E.; Yazyev, O.; Austin,

A. J.; Cammi, R.; Pomelli, C.; Ochterski, J. W.; Martin, R. L.;

Morokuma, K.; Zakrzewski, V. G.; Voth, G. A.; Salvador, P.;

̈

Dannenberg, J. J.; Dapprich, S.; Daniels, A. D.; Farkas, O.; Foresman,

J. B.; Ortiz, J. V.; Cioslowski, J.; Fox, D. J. Gaussian 09, Revision A.02;

Gaussian, Inc.: Wallingford CT, 2009.

(26) Weigend, F.; Ahlrichs, R. Phys. Chem. Chem. Phys. 2005, 7,

3297−3305.

(27) Marenich, A. V.; Cramer, C. J.; Truhlar, D. G. J. Phys. Chem. B

2009, 113, 6378−6396.

(28) Yanai, T.; Tew, D; Handy, N. Chem. Phys. Lett. 2004, 393,

51−57.

(29) http://www.gaussian.com/g_tech/g_ur/k_scrf.htm

1044

dx.doi.org/10.1021/jo202321g | J. Org. Chem. 2012, 77, 1026−1044

Article Doi

Synthesis and photophysical properties of biaryl-substituted nucleos(t)ides. Polymerase synthesis of DNA probes bearing solvatochromic and pH-sensitive dual fluorescent and 19F NMR labels

DOI: 10.1021/jo202321g

Source and publish data:

Authors:

Article abstract of DOI:10.1021/jo202321g

Full text of DOI:10.1021/jo202321g

Products guided by the article

R&D Labs maybe for 1352918-19-4

Relevant to this article

Hot Product