Perturbation of the c-Myc-Max Protein-Protein Interaction via Synthetic α-Helix Mimetics

Article

pubs.acs.org/jmc

Perturbation of the c‑Myc−Max Protein−Protein Interaction via

Synthetic α‑Helix Mimetics

Kwan-Young Jung,^†Huabo Wang,^‡Peter Teriete,^§Jeremy L. Yap,^†Lijia Chen,^†Maryanna E. Lanning,^†

Angela Hu,^‡Lester J. Lambert,^§Toril Holien,^∥Anders Sundan,^∥Nicholas D. P. Cosford,^§

Edward V. Prochownik,^‡and Steven Fletcher*^,†,⊥

^†Department of Pharmaceutical Sciences, University of Maryland School of Pharmacy, 20 North Pine Street, Baltimore, Maryland

21201, United States

^‡Section of Hematology/Oncology, Department of Pediatrics, Children’s Hospital of Pittsburgh of UPMC Pittsburgh, Pittsburgh,

Pennsylvania 15224, United States

^§Cell Death and Survival Networks Research Program, NCI-Designated Cancer Center, Sanford-Burnham Medical Research Institute,

10901 North Torrey Pines Road, La Jolla, California 92037, United States

^∥KG Jebsen Center for Myeloma Research and Department of Cancer Research and Molecular Medicine, Norwegian University of

Science and Technology, Trondheim NO-7491, Norway

^⊥University of Maryland Greenebaum Cancer Center, 22 South Greene Street, Baltimore, Maryland 21201, United States

S

* Supporting Information

ABSTRACT: The rational design of inhibitors of the bHLH-ZIP

oncoprotein c-Myc is hampered by a lack of structure in its

monomeric state. We describe herein the design of novel, low-

molecular-weight, synthetic α-helix mimetics that recognize helical c-

Myc in its transcriptionally active coiled-coil structure in association

with its obligate bHLH-ZIP partner Max. These compounds perturb

the heterodimer’s binding to its canonical E-box DNA sequence

without causing protein−protein dissociation, heralding a new

mechanistic class of “direct” c-Myc inhibitors. In addition to

electrophoretic mobility shift assays, this model was corroborated

by further biophysical methods, including NMR spectroscopy and

surface plasmon resonance. Several compounds demonstrated a 2-

fold or greater selectivity for c-Myc−Max heterodimers over Max−

Max homodimers with IC₅₀values as low as 5.6 μM. Finally, these compounds inhibited the proliferation of c-Myc-expressing cell

lines in a concentration-dependent manner that correlated with the loss of expression of a c-Myc-dependent reporter plasmid

despite the fact that c-Myc−Max heterodimers remained intact.

viable therapeutic strategy toward the development of new and

targeted antineoplastics. Indeed, both genetic and pharmaco-

logic inhibition of c-Myc, or its closely related cousin N-Myc, in

vivo have resulted in tumor regression and prolonged

survival.^21,27,28Moreover, despite the widespread expression

of c-Myc by normal proliferating cells, recent studies have

demonstrated that long-term, whole-body genetic silencing of

c-Myc in vivo leads to remarkably mild and reversible side

eﬀects,²⁹⁻³²providing further rationale that c-Myc inhibition is

a clinically feasible strategy to expand the anticancer drug

arsenal.

INTRODUCTION

■

c-Myc is a basic helix−loop−helix leucine zipper (bHLH-ZIP)

transcription factor that, in addition to being oncogenic when

overexpressed, aﬀects many transformation-related processes

such as proliferation, apoptosis, diﬀerentiation, and metabo-

lism.¹⁻¹⁰As an intrinsically disordered protein, c-Myc becomes

transcriptionally functional only after heterodimerizing with its

obligate bHLH-ZIP partner Max to assume a coiled-coil

structure that recognizes the E-box sequence 5′-CACGTG-3′.¹¹

Indeed, this event is required for all known biological functions

of c-Myc, including its oncogenic activity.^1−5,12c-Myc

dysregulation is associated with most human cancers, including

lung, pancreatic, and colorectal cancers, as well as leukemias

and lymphomas,¹³⁻¹⁸and numerous murine cancer models are

c-Myc-dependent, even when c-Myc is not the primary

oncogenic driver.¹⁹⁻²¹Together, these studies suggest that c-

Myc inhibition, either direct or indirect (for example, via

inhibition of the BET bromodomains BRD2−4²²⁻²⁶), is a

In contrast to the bromodomain proteins BRD2−4 that

exhibit well-deﬁned, acetyl-lysine binding sites that are tractable

targets for small-molecule drug design and provide an indirect

approach to the inhibition of oncogenic c-Myc function,²²⁻²⁶

Received: October 5, 2014

A

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

the rational design of direct c-Myc inhibitors is complicated by

the intrinsic disorder of the bHLH-ZIP domain, although some

progress has been made.³³⁻⁴⁷Several of the more potent

compounds that have been identiﬁed bind to distinct segments

of this region and cause highly localized distortions that prevent

productive interaction with Max’s bHLH-ZIP domain.^43,44For

example, 10058-F4 (1) binds c-Myc_402−410, while 10074-G5 (2)

binds c-Myc_363−381(Chart 1). However, these compounds

activity relationship (SAR) analysis of the direct c-Myc

inhibitor 2,⁴⁵which binds one of these sites centered around

residues 363−381, corresponding to the junction between the

basic DNA-binding domain and helix 1. NMR analysis of the

interaction of 2 with a c-Myc_363−381synthetic peptide allowed

the delineation of a more reﬁned binding site, and our SAR

work was largely in agreement with this model. Interestingly,

NOESY experiments indicated that 2 induced helicity in the c-

Myc_363−381peptide. The successful targeting of c-Myc_363−381

with congeners of 2 coupled with c-Myc’s acquisition of

considerable helicity upon heterodimerization with Max

suggests that synthetic α-helix mimetics designed to recognize

this region of c-Myc in its helical form might perturb the c-

Myc−Max heterodimer and impair DNA binding. This may be

envisaged to occur either through directly interfering with the

construction of the c-Myc−Max interface when c-Myc is mostly

helical and complex formation is almost complete or through

disruption of c-Myc’s HLH motif within the c-Myc−Max

heterodimer. Accordingly, we designed the α-helix mimetic 4

depicted in Figure 1A. Analogous to our oligoamide-based α-

helix mimetics of the Bak-BH3 α-helix in which the side chains

of each of the three subunits mimic the i, i + 3/4, and i + 7 side

chains on one face of the native helix,⁵¹the hydrophobic R¹and

R²groups were designed to recognize Phe₃₇₄(i) and Leu₃₇₇(i +

3), respectively, of helical c-Myc in late-stage complex assembly.

Alternatively, these hydrophobic groups may recognize the

tetramethylene side chain of Lys₃₇₁(i) and Phe₃₇₅(i + 4) of the

assembled complex. Because this hydrophobic domain is

ﬂanked by arginines Arg₃₆₆/Arg₃₆₇/Arg₃₇₂and Arg₃₇₈at the

N- and C-terminal ends, respectively, we incorporated groups

into the periphery of 4 that would complement these basic side

chains. For inspiration, we looked to previous small molecules

that also bind this region: the electron rich nitro group of 2 is

Chart 1. Structures of Some Inhibitors That Bind

Monomeric c-Myc

generally exhibit only low aﬃnities to c-Myc, double-digit

micromolar IC₅₀values for the prevention of c-Myc−Max

heterodimerization in vitro and similar activities in cellular

proliferation assays. Attempted optimizations of 2 (for example,

JY-3-094 (3) and its ester prodrugs)⁴⁵⁻⁴⁷and 10058-F4³⁷have

met with limited success, and new leads are urgently required.

In contrast to monomeric c-Myc, the c-Myc−Max heterodimer

exists as a structured coiled coil with ∼70% α-helical content

that increases to 84% upon DNA binding.⁴⁸We, therefore,

reasoned that molecules appropriately crafted to recognize this

α-helical content might perturb the protein−protein interaction

(PPI). Precedent for this approach has been described by

Hamilton wherein synthetic α-helix mimetics have successfully

disrupted the assembly of multiple helices involved in HIV-1

infection⁴⁹and abrogated the aggregation of transient helical

forms of amyloid⁵⁰that would otherwise lead to amyloid

ﬁbrillogenesis. More generally, we⁵¹⁻⁵³and others^54,55have

demonstrated that synthetic α-helix mimetics are eﬀective

inhibitors of a range of helix-mediated PPIs in which only one

of the protein partners uses an α-helical recognition domain,

including Bcl-x_L−Bak, Mcl-1−Bim, and HDM2−p53.⁵⁶In light

of these observations, we hypothesized that rationally

engineered α-helix mimetics might disrupt the coiled coil of

the c-Myc−Max heterodimer, thus providing a novel

therapeutic strategy to inhibit the oncogenic function of c-Myc.

believed to interact with Arg₃₆₆, Arg₃₆₇, and Arg₃₇₂,

^43,44whereas

the carboxylic acid in the second-generation congener of 2, JY-

3-094,⁴⁵possibly interacts with Arg₃₇₈. Because the nitro group

of 2 and that of JY-3-094 along with its carboxylic acid were

instrumental in furnishing the small-molecules with c-Myc

inhibitory activities, we, thus, selected a nitro group to

recognize Arg₃₆₆, Arg₃₆₇and/or Arg₃₇₂and a carboxylic acid

to recognize Arg₃₇₈. This would allow the bis-benzamides to be

prepared from the readily available starting material 3-ﬂuoro-4-

nitrobenzoic acid (5). In addition, it was anticipated that the

carboxylic acid would serve to promote the solubilities of the

helix mimetics. A putative binding mode of target molecule 4da

(“JKY-2-169”) is given in Figures 1C and 1D.

Chemistry. Target molecules 4 were readily generated in a

short, convergent synthesis. Subunits were synthesized as

described in Schemes 1 and 2. The benzene-based subunits

were synthesized starting from 3-ﬂuoro-4-nitrobenzoic acid (5).

Nucleophilic aromatic substitution (S_NAr) reactions of 5 with

either alcohols R¹OH or R²OH (R¹and R²group identities are

given in Scheme 1) with an excess of NaH furnished the 3-

alkoxy derivatives 6. Treatment of acids 6 with oxalyl chloride

delivered acid chlorides 7, while reduction by catalytic

hydrogenation or tin (II) chloride yielded anilines 8.

Esteriﬁcation of acids 6 followed by nitro group reduction

delivered anilines 9. Two pyridine-based subunits were also

prepared (Scheme 2). Brieﬂy, 2,6-dichloro-3-nitropyridine (10)

was regioselectively 2-isobutoxylated, and then the 6-chloro

group was converted to a carboxylic acid (compound 11) via a

two-step Stille reaction with tributyl(vinyl)tin followed by

oxidative cleavage of the newly installed vinyl group. Acid

RESULTS

■

Design. We have previously shown there to be at least three

independent small-molecule binding sites on the c-Myc bHLH-

ZIP domain.^43,44We have also recently completed a structure−

B

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 1. (A) Generic α-helix mimetic designed to recognize the Arg₃₆₆−Arg₃₇₈region of c-Myc in the helical c-Myc−Max heterodimer. R¹and R²

are hydrophobic groups, such as isobutyl and benzyl (see Scheme 1). Bubbles with two sets of residues indicate side chains targeted at the c-Myc−

Max interface in late stage complex assembly (outside parentheses) or at the HLH region of c-Myc in the c-Myc−Max complex (inside parentheses).

(B) Chemical structure of 4da (“JKY-2-169”). (C) Putative binding mode of compound 4da indicating the region of the c-Myc−Max PPI to be

targeted by synthetic α-helix mimetics (PDB ID: 1NKP). The binding site was delineated by Arg₃₇₂, Phe₃₇₄, Leu₃₇₇, and Arg₃₇₈. (D) Zoom-in of

binding mode. Computational modeling was achieved with Molegro Virtual Docker. (C) and (D) were generated with PyMOL: red = c-Myc; blue =

Max; green = DNA; cyan, colored by atom type = c-Myc residues interacting signiﬁcantly with ligand; yellow, colored by atom type = 4da (“JKY-2-

169”).

chloride generation or nitro group reduction as before then

furnished subunits 12 and 13, respectively. The bis-benzamides

4 and 14−16 were then prepared by condensations of acid

chlorides 7 and 12 with anilines 8, 9, and 13 in the presence of

N,N-dimethylaniline as base (Scheme 3). To determine the

importance of the R¹and R²side chains, bis-benzamides 4aj,

4ja, and 4jj were also prepared according to Scheme 3 but in

which at least one of the subunits carried no side chain (i.e., 4-

aminobenzoic acid and/or 4-nitrobenzoyl chloride). To

investigate the signiﬁcance of the nitro group, 3-isobutox-

ybenzoyl chloride was coupled to 4-amino-3-isobutoxybenzoic

acid (8a) to aﬀord compound 17, again essentially as described

in Scheme 3. Additional analogues to test the importance of the

nitro group were prepared as shown in Scheme 4. Speciﬁcally,

the nitro groups of compounds 16, 4aa, and 4ea were reduced

by catalytic hydrogenation to deliver anilines 18, 19, and 20,

respectively. Acylation of 19 with ethyl chlorooxoacetate or

diglycolic anhydride generated compounds 21 and 22,

respectively, and then the former underwent saponiﬁcation to

deliver compound 23 as shown in Scheme 5. Modiﬁcations to

the C-terminus are depicted in Scheme 6, where the proximity

of the acidic group, as well as the number of acidic groups,

would allow further investigation of the structure−activity

relationships (SAR) of these compounds, as in compounds 26

and 27. Finally, relocation of the side chains to the 2-position of

the benzene ring was eﬀected starting from commercially

available compound 28 (Scheme 7). Appropriate subunits (4aa,

30, and 31) were then coupled together using similar chemistry

to that described in Scheme 3 to aﬀord target molecules 32−

34.

Biology. Initially, a focused library of derivatives of 4 was

prepared, and the compounds were screened in an electro-

C

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

a

Scheme 1

a

(a) R¹OH or R²OH, NaH, THF, RT, 0 °C to RT, 2 h; (b) (COCl)₂, cat. DMF, CH₂Cl₂, RT, 2 h; (c) H₂, 10% Pd/C, EtOH, RT, 1−5 h, or SnCl₂·

2H₂O, EtOAc, 50 °C, 3 h; (d) SOCl₂, MeOH, 60 °C, 6 h, or MeI, K₂CO₃, DMF, RT, 4 h.

a

EMSA screening results, where “0%” indicates complete

disruption of the c-Myc−Max/DNA complex relative to the

DMSO vehicle control (“100%”). Encouragingly, two com-

pounds, 4aa and 4da (“JKY-2-169”), from the initial batch of

10 derivatives of 4, demonstrated potent activity in this assay.

In addition to 4aa and 4da, the next most active compound,

4bb, also possesses an ionizable carboxylic acid. The remaining

seven compounds are methyl ester derivatives and were largely

inactive, thus indicating the important contribution of the

carboxylic acid.

Scheme 2

a

(a) Isobutanol, NaH, THF, RT, 0 °C to RT, 4 h; (b) Bu₃SnCH

CH₂, Pd(PPh₃)₄, toluene, 110 °C, 5 h; (c) KMnO₄, H₂O/acetone, RT,

6 h; (d) (COCl)₂, cat. DMF, CH₂Cl₂, RT, 2 h; (e) SnCl₂·2H₂O,

EtOAc, 50 °C, 3 h.

Given the promising EMSA screening data in Table 1, we

expanded our library of c-Myc−Max disruptors. Although two

methyl esters (14ba and 14ca) demonstrated modest inhibitory

activities, they exhibited poor solubilities. Hence, we focused

mostly on the preparation of only carboxylic acid-functionalized

compounds; their structures are shown in Tables 2 and 3. All

compounds in Table 2 exhibit a nitro group at the N-terminus

and either a carboxylic acid or a methyl ester at the C-terminus.

In Table 3, these functional groups were varied somewhat. Also,

the scaﬀold benzene rings were changed to pyridines and the

positions of the side chains were investigated. We again used an

EMSA-based screening assay to evaluate the second group of

helix mimetic-based putative c-Myc inhibitors. From a total of

31 tested compounds, we identiﬁed an additional four

inhibitors (4ca, 15, 16, and 21) that produced complete

disruption of the c-Myc−Max/DNA binding at 100 μM

(Tables 2 and 3). Although this screen was performed only

once, it is tempting to speculate that the nature and position of

the hydrophobic side chains are critical to activity (compare the

data for 4ac, 4ca, and 4jj; 4ca with 4ga; and also 4aa with 32−

34). A carboxylic acid appears important at the C-terminus (for

example, compare 4aa and 14aa), as does a nitro group at the

N-terminus (for example, compare 4aa with 17 and 19, where

the nitro group has been replaced with a hydrogen atom or an

amino group, respectively). Finally, replacement of the scaﬀold

benzene rings with more hydrophilic pyridines seems to be

tolerated (compare 4aa with 15 and 16).

a

Scheme 3

a

(a) N,N-dimethylaniline, acetone, 0 °C to RT, 16 h.

phoretic mobility shift assay (EMSA) at 100 μM concentrations

for their abilities to disrupt c-Myc−Max(S)/DNA complexes,

where “S” refers to the short (151 residue) isoform of Max that

binds DNA only as a heterodimer with c-Myc. The structures

of these compounds are presented in Table 1 along with the

D

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

a

Scheme 4

a

(a) H₂, 10% Pd/C, EtOH, RT, 1−5 h.

a

Scheme 5

a

(a) ClCOOEt, pyridine, CH₂Cl₂, 0 °C to RT, 16 h, or diglycolic anhydride, Et₃N, DIPEA, 50 °C, 16 h; (b) LiOH·H₂O, THF/MeOH/H₂O, 3:1:1,

24 h, RT.

a

Scheme 6

a

(a) Glycine tert-butyl ester·HCl or di-tert-butyliminodiacetate, HBTU, DIPEA, DMF, RT, 16 h; (b) 20% TFA/CH₂Cl₂, RT, 3 h.

With the above screening data in hand, 4aa, 4ca, 4da, 15, 16,

and 21 were evaluated in further detail by conﬁrmatory EMSA

analysis. Each compound demonstrated a dose-dependent

inhibition of the c-Myc−Max(S)/DNA ternary complex with

IC₅₀s < 50 μM (Figure 2, Table 4). The most potent inhibitor

21 (IC₅₀= 5.6 μM) displays an ethyl aminooxalate, indicating

the nitro group in our original design of generic compound 4 is

not critical for activity provided a suitable bioisostere is present.

To examine the speciﬁcity of these compounds, we also tested

their abilities to disrupt DNA binding by Max homodimers in

otherwise identical EMSA assays (Figure 2, Table 4). The

foregoing experiments capitalized on the fact that the 151

residue “short” isoform of Max [Max(S)] only binds DNA as a

heterodimer in association with c-Myc. In contrast, the 160

reside “Max(L)” isoform also binds DNA as a homodimer and

can therefore be used to assess the speciﬁcity of direct Myc

inhibitors.⁵⁷⁻⁵⁹In each case, the six helix mimetics exhibited a

2-fold or greater selectivity for c-Myc−Max(S)/DNA com-

plexes over Max(L)−Max(L)/DNA complexes, thereby

suggesting that these compounds recognize c-Myc rather than

Max (Table 4).

4da Recognizes the α-Helical Structure of c-Myc in the c-

Myc−Max(S) Heterodimer. We next performed NMR experi-

ments to further our understanding of the mechanism of 4da’s

inhibition at an atomic level. For this, we utilized homoge-

neously pure, recombinant ¹⁵N-labeled or unlabeled c-Myc and

E

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

a

experimental outcome consistent with this previously proposed

model is shown in Figure 4. After ﬁrst establishing conditions

under which c-Myc−Max(S) heterodimer binding to an E-box-

containing oligonucleotide could be quantiﬁed (Figure 4A), we

showed that 2 prevented c-Myc−Max(S) oligonucleotide from

binding signiﬁcantly better if it was preincubated with c-Myc

monomer prior to the addition of Max(S) (Figure 4B,C). In

contrast, while 4da was also somewhat better at inhibiting DNA

binding if added to c-Myc and Max(S) proteins prior to their

heterodimerization, it was much more eﬀective than 2 against

preformed c-Myc−Max(S) heterodimers (Figure 4C,D). In

light of our other ﬁndings reported herein, particularly those

depicted in Figure 3, these results are most consistent with the

idea that 4da, rather than binding to the c-Myc monomer,

preferentially interacts with the c-Myc−Max(S) heterodimer,

alters its structure and renders it incapable of DNA binding

without actually promoting its dissociation into c-Myc and

Max(S) monomers.

Scheme 7

a

(a) Isobutyl iodide, K₂CO₃, DMF, 50 °C, 16 h; (b) NaOH, THF/

MeOH/H₂O, 3:1:1, RT, 1 h; (c) H₂, 10% Pd/C, EtOH, RT, 16 h.

4da Inhibits c-Myc-Expressing Cells. The six active

compounds described above were next investigated for their

abilities to inhibit the proliferation of HL60 human

promyelocytic leukemia cells and Daudi Burkitt’s lymphoma

cells, both of which overexpress c-Myc and are highly

susceptible to various c-Myc inhibitors.^{36,37,43,46,47}As shown

in Table 5, all compounds except 21 inhibited the proliferation

of both cell lines with IC₅₀s below 50 μM. Indeed, the HL60

inhibition data closely mirrored the in vitro data for inhibition

of the c-Myc−Max(S)/DNA ternary complex. 4da proved the

most potent inhibitor of cell proliferation across both cell lines.

It is unconﬁrmed at this stage why compound 21 did not

exhibit cell activity. However, standard hydrolysis of the ethyl

ester of 21 by cellular esterases would furnish the inactive

compound 25, while amide hydrolysis by peptidases would

aﬀord inactive compound 19. Therefore, we hypothesize that

metabolism of 21 to either 19 or 25 explains the lack of cell

activity.

Having established that 4da was the most potent of the

above compounds in vitro and in cells, we tested it further

against several other cell lines (Table 6), including those

representing epithelial cancers and several human multiple

myeloma lines, the latter having previously been shown to be

moderately sensitive to the growth inhibitory eﬀects of the

highly speciﬁc direct c-Myc inhibitor 10058-F4^36,60(IC₅₀s =

52−90 μM). One of these myeloma lines, U266, expresses L-

Myc instead of c-Myc and had previously been shown to be the

least sensitive of all myeloma cell lines to growth inhibition by

10058-F4 (IC₅₀∼100 μM⁶⁰). We also tested 4da against rat

ﬁbroblasts with a homozygous deletion of the endogenous myc

gene (HO15.19 cells) as well as HO15.19 cells in which Myc

expression had been restored by stable transduction with a c-

Myc-expressing retroviral vector (HO15.19-wt-Myc cells).^61,62

Consistent with the idea that 4da is a speciﬁc c-Myc inhibitor,

we found all c-Myc-expressing cell lines to be sensitive to

relatively low concentrations of the compounds. However,

U266 myeloma cells were the most resistant of the myeloma

cell lines tested and HO15.19 ﬁbroblasts were more resistant to

4da than HO15.19-Myc cells. That both transformed and

nontransformed cells were growth-inhibited by 4da is in

agreement with the premise that c-Myc expression is necessary

for the proliferation of virtually all cells and that c-Myc

overexpression and/or deregulation is not a prerequisite for

sensitivity to this class of inhibitors or to other modes of

pharmacologic or genetically mediated Myc inhibition in

Max(S) proteins. ¹⁵N-HSQC spectroscopy allows the observa-

tion of interactions between small molecules and a protein of

interest over a broad range of aﬃnities. Furthermore, even

without residue-speciﬁc assignment, the technique provides

insight into changes in secondary structures and potentially

allows the elucidation of aﬃnities. First, we examined the ability

of 4da to interact with the Max(S) homodimer or the c-Myc

monomer (Figure 3A,B). Titration of the compound up to 100

μM failed to reveal any observable chemical shift perturbations,

thereby indicating that this compound does not bind either of

the individual proteins. We then formed the c-Myc−¹⁵N-

Max(S) heterodimer through the addition of an equimolar

amount of unlabeled c-Myc to ¹⁵N-Max(S). This led to the

expected substantial change in the HSQC spectrum of ¹⁵N-

Max(S) (Figure 3C). Finally, addition of 4da to the

heterodimer led to further and substantial chemical shift

perturbations, clearly indicating that the heterodimer is needed

to provide a suitable binding site for this inhibitor and that,

following 4da addition, the ﬁnal conﬁguration attained is unlike

that of either of the individual proteins alone (Figure 3D).

Careful analysis of four isolated peaks suggested a K_d∼ 13 μM

for 4da (Figure 3E).

This study conclusively shows that 4da is unable to bind

these proteins in either of their alternate conformations by

themselves (c-Myc monomer or Max(S) homodimers) but

clearly interacts with the c-Myc−Max heterodimer. This is

particularly important in the case of the Max(S) homodimer,

which has an α-helical structure that closely resembles that of

the c-Myc−Max heterodimer.¹¹The binding of 4da to speciﬁc

residues dictated by this heterodimer alters its structure in a

manner that does not restore either of the spectra generated by

the individual protein partners. Rather, the novel structure

indicates that it remains in a heterodimeric form that is unable

to bind DNA, as shown in Figure 3C.

Surface Plasmon Resonance (SPR) Indicates 4da Binds the

c-Myc−Max(S) Heterodimer. We next utilized SPR to

determine whether 4da behaves in a manner distinct from

that of previously described direct c-Myc inhibitors such as

10058-F4 and 2, which interfere with c-Myc−Max dimerization

and DNA binding as a consequence of their eﬃcient interaction

with the unstructured c-Myc monomer, rendering it incapable

of interacting with Max.³³However, they are relatively

ineﬃcient at disrupting preformed dimers due to the high

free energy of protein−protein association.^{33−37,43−47}An

F

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Table 1. EMSA Screening Analysis of Abilities of Synthetic α-Helix Mimetics to Disrupt the c-Myc−Max/DNA Complex at 100

a

μM (n = 1)

a

For these experiments, we used the 151 residue isoform of Max, which we term Max(S), which binds DNA only in heterodimeric association with

c-Myc and not as a homodimer.⁵⁸The last column refers to the amount of DNA binding obtained in the presence of the compound relative to that

obtained in its absence. See Experimental Section for further information.

general.^20,63The residual susceptibilities of U266 and myeloma

cells and HO15.19 suggests that 4da may have additional

targets that are necessary to support proliferation and/or

nonspeciﬁc toxicities.

4da Promotes Cell Cycle Arrest and Accumulation of

Neutral Lipids. The inhibition of c-Myc in proliferating cells,

either in vitro or in vivo, leads to cell cycle arrest and eventual

apoptosis.^64,65This induced quiescence is likely related to

changes in cellular energy metabolism given the fact that c-Myc

is intimately involved in supporting mitochondrial biogenesis

and glycolysis.⁶⁶⁻⁶⁸Indeed, c-Myc-depleted cells possess

atrophic mitochondria and defective electron transport chain

complexes as well as low levels of oxidative phosphorylation,

glycolysis, and ATP.⁶⁶⁻⁶⁸Recently, Zirath et al. have shown

that N-Myc-ampliﬁed neuroblastoma cells accumulate stores of

neutral lipid following their exposure to the small-molecule c-

Myc inhibitor 10058-F4,²⁷and we have made similar ﬁndings in

myc−/− ﬁbroblasts.⁶⁹We have shown this to result from an

increase in the transport of exogenous very long chain fatty

acids that represents a compensatory attempt to fuel the TCA

cycle with substrates other than glucose or glutamine, whose

utilization by the TCA cycle is compromised in c-Myc-depleted

cells. However, because of the defective mitochondrial structure

G

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Table 2. EMSA-Based Screening Results of the Disruption of c-Myc−Max(S)/DNA Binding at 100 μM of Synthetic α-Helix

Mimetic (n = 1)

and function, the uptake of these fatty acids exceeds their

utilization and the diﬀerence is stored as neutral lipid.

Myc (wt-Myc) or NF-κB. Control vectors contained either no

binding sites or mutant c-Myc binding sites (mut-Myc)

(CTCGAG rather than the canonical CACGTG). Relative to

the latter control lines whose expression of luciferase was

indistinguishable from the background of untransfected cells,

the luciferase activities in cells expressing the wt-c-Myc and NF-

kB vectors were 10−20 times and 100−200 times, respectively,

higher than the background. As seen in Figure 7, both 4da and

the control direct c-Myc inhibitor showed a dose-dependent

inhibition of luciferase in cells expressing the wt-c-Myc vector,

whereas no inhibition of luciferase was observed in cells

expressing the NF-kB vector. From these studies, we conclude

that 2 and 4da selectively suppress the expression of genes

containing c-Myc binding sites, with the latter compound again

being more potent.

4da Does Not Disrupt c-Myc−Max Heterodimers in Cells.

The foregoing studies, particularly those shown in Figure 3,

suggested that, while 4da was speciﬁc for c-Myc, its mechanism

of action was distinct from that of previously described direct c-

Myc inhibitors which prevent/disrupt c-Myc−Max associa-

tion.³³To further conﬁrm that 4da did not promote c-Myc−

Max dissociation, we exposed HL60 cells to concentrations of

the compound shown in the above studies to inhibit cell cycle

progression, proliferation, and Myc-speciﬁc gene expression

and then performed c-Myc−Max co-IP studies. As a positive

To determine whether our synthetic α-helix mimetics

imitated the above-described phenotypes associated with c-

Myc depletion, we treated HL60 promyelocytic leukemia cells

and H460 large cell lung cancer cells with 4da and then

evaluated the cells for evidence of proliferative arrest and

neutral lipid accumulation, respectively. As positive controls for

these studies, parallel cultures were treated with the previously

well-characterized direct c-Myc inhibitors 10058-F4 or 2.³⁶As

seen in Figure 5, both 10058-F4 and 4da promoted a G0/G1

arrest in HL60 cells, with the latter compound being both more

eﬃcient and potent. Repeat experiments performed on diﬀerent

occasions yielded very similar results (Supporting Information,

Table 1). Similarly, treatment of H460 cells with both 2 and

4da led to an increase in neutral lipid stores, with 4da again

being more eﬀective (Figure 6). From these studies, we

conclude that these structurally unrelated c-Myc inhibitors exert

similar eﬀects on proliferation and cellular energetics.

4da Speciﬁcally Inhibits a c-Myc-Dependent Reporter. To

determine whether, as previously described for 10058-F4,⁷⁰4da

speciﬁcally inhibited c-Myc-dependent genes, we stably trans-

fected HeLa cells with a vector encoding a highly labile

luciferase protein. The minimal promoter of this vector was

engineered to contain tandemly triplicated binding sites for c-

H

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Table 3. EMSA-Based Screening Results of the Disruption of c-Myc−Max(S)/DNA Binding at 100 μM of Synthetic α-Helix

a

Mimetic (n = 1)

a

R⁴and R⁵groups located at the 3-positions of the aryl rings unless otherwise stated with a (2), indicating the group is at the 2-position.

I

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 2. (A,C,E,G,I,K) c-Myc−Max(S) EMSA assays for synthetic α-helix mimetics. Recombinant c-Myc_353−437and full-length Max(S), which does

not bind DNA as homodimers,⁵⁷⁻⁵⁹were puriﬁed to homogeneity from Escherichia coli and used at a ﬁnal concentration of 30 nM. (B,D,F,H,J,L)

Control experiments showed that none of the compounds signiﬁcantly aﬀected DNA binding by Max(L)−Max(L) homodimers, which bind DNA

well. Each panel is representative of three independent trials (Supporting Information, Figure 1).

conﬁrmation that 4da, while inhibiting a variety of c-Myc-

regulated functions, does so without promoting c-Myc−Max

dissociation.

Table 4. EMSA-Determined Disruption of Ternary c-Myc−

Max(S)/DNA and Max(L)−Max(L)/DNA Complexes by

a

Synthetic α-Helix Mimetics

inhibition (IC₅₀, μM)

DISCUSSION

■

no.

c-Myc−Max(S)/DNA

Max(L)−Max(L)/DNA

Synthetic α-helix mimetics have been successfully utilized in the

past to interrogate and disrupt pathogenic helix-mediated

PPIs.⁴⁹⁻⁵⁶The transcriptionally active c-Myc−Max coiled coil

presents itself as a potential target that might be disrupted or

otherwise perturbed by such agents. We designed biphenyl-

based α-helix mimetics that, along with a hydrophobic core and

electron-rich peripheries, were intended to recognize a

hydrophobic domain of helical c-Myc ﬂanked by arginines

and other polar residues, speciﬁcally the region

4aa

4ca

4da

15

20.2 1.3

43.0 1.7

11.6 2.3

43.8 2.9

23.8 2.7

5.6 0.7

84.9 12.0

79.0 8.5

>20

>100

16

68.7 4.5

>12.5

21

a

Each IC₅₀and standard error were calculated based on three

independent EMSAs performed for each compound concentration

tested (Supporting Information, Figure 1).

R

₃₆₆RNELKRSFFALR₃₇₈, that ensures the formation of a

rigid tertiary structure upon dimerizing with Max. Importantly,

this would represent an unprecedented strategy to inhibit the

oncogenic activity of c-Myc because those direct inhibitors that

have been fully characterized to date operate through binding

and stabilizing the unstructured c-Myc monomer, rendering it

incapable of interacting with Max.³⁴

Several of the compounds reported herein impaired the

ability of the c-Myc−Max(S) dimer to recognize its DNA-

binding sequence, as shown by EMSA. To delineate the mode

of inhibition of the synthetic helix mimetics, we recruited an

control, a parallel culture of cells was exposed to the compound

10058-F4, at a concentration previously shown to disrupt c-

Myc−Max heterodimers.³⁷As shown in Figure 8, 10058-F4

treatment abrogated c-Myc’s association with Max, in a dose-

dependent manner, without signiﬁcantly aﬀecting the overall

level of the former protein. In contrast, c-Myc−Max

heterodimers remain largely intact following exposure to even

the highest levels of 4da. Taken together with the studies

shown in Figure 2, these ﬁndings provide independent

J

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 3. (A) ¹⁵N-Max(S) HSQC spectra with (red) and without (black) the addition of 100 μM 4da. (B) ¹⁵N-c-Myc HSQC spectra with (red) and

without (black) the addition of 100 μM 4da. (C) Heterodimeric complex of ¹⁵N-Max(S) (black alone) and with c-Myc (red). (D) c-Myc−¹⁵N-

Max(S) binary complex (black) with the addition of 100 μM of 4da (red). (E) Dose−response curves of four isolated NMR cross-peak intensities

(108.98/8.35, 109.37/8.02, 123.96/7.63, 133.38/7.992 [¹⁵N ppm/¹H ppm]). (Analysis was performed based on eq 1 (NMR Experimental Section)).

array of biophysical techniques. HSQC NMR spectroscopy

employing ¹⁵N-labeled Max(S) indicated that the helix mimetic

4da interacted only with c-Myc−Max(S) heterodimers and not

with Max(S)−Max(S) homodimers or c-Myc monomers. This

allowed us to infer that the biological target is the c-Myc−

Max(S) heterodimer exclusively. Furthermore, according to

NMR titrations, 4da bound helical c-Myc with a K_dof

approximately 13 μM. These ﬁndings were further corrobo-

rated by SPR, which was consistent with the idea that 4da binds

the c-Myc−Max heterodimer and alters its structure such that

DNA binding is impaired. Indeed, the K_dfor this interaction, ca.

10 μM (Figure 4D), is in excellent agreement with that

obtained by NMR (K_d∼ 13 μM (Figure 3E)). The somewhat

higher K_dobtained under conditions in which c-Myc−Max(S)

heterodimers were allowed to preform before the addition of

4da (Figure 4E) suggests that the heterodimer is more stable

under these conditions. This could be explained by assuming

that, in the initial stages of heterodimerization, the helix 1

regions of c-Myc and Max(S) may assemble into a structure

that is recognized by 4da, as originally proposed in the Design

section, before the remaining regions of the proteins have the

opportunity to fully assemble into their ﬁnal and most stable

conformations. Such a partially formed heterodimer might be

more readily distorted by 4da.

explain 4da’s mechanism of action. Moreover, they are

consistent with our inability to demonstrate disruption of c-

Myc−Max heterodimers with 4da by in situ co-immunopreci-

pitation under conditions where it can be readily demonstrated

by inhibitors that directly bind the c-Myc monomer, such as

10058-F4, 2, or their analogues.^{36,37,45−47}The helix mimetics

reported herein inhibited the proliferation of c-Myc-over-

expressing cells in a manner that reﬂected their abilities to

disrupt DNA binding by the c-Myc−Max heterodimer in vitro.

Finally, the induction of cell cycle arrest, the accumulation of

neutral lipids, and the inhibition of c-Myc-dependent gene

expression, are all consistent with c-Myc being the main cellular

target of 4da and other such compounds. Nonetheless, 4da

may possess some nonspeciﬁc toxicities or recognize other

targets that are needed to drive proliferation as evidenced by

the inhibition of some cell lines that do not express c-Myc

(Table 6). It will be important to minimize such properties in

future attempts to optimize this class of compounds. It is

tempting to speculate that compounds such as 4da might be

particularly eﬀective in conjunction with other direct inhibitors

such as 10058-F4 and 2 by preventing or reversing DNA

binding by any residual c-Myc−Max(S) heterodimers that

formed in the presence of the latter compounds.

CONCLUSIONS

SPR alone cannot directly discriminate between a mechanism

that distorts the c-Myc−Max(S) heterodimer as proposed here

for 4da and one that prevents c-Myc−Max(S) interaction.

However, the markedly diﬀerent behaviors in response to 2 and

4da (Figure 5), together with the results of our NMR studies

(Figure 3), argue strongly in favor of the former model to

■

Novel, direct inhibitors of c-Myc were designed based on a

synthetic α-helix mimetic strategy to recognize and perturb the

structure of the coiled coil c-Myc−Max heterodimer. Our most

potent, cellularly-active compound, 4da, demonstrated this

activity in vitro with IC₅₀values in the low micromolar range.

K

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 4. SPR analysis of 2 and 4da. Concentrations refer to (A) c-Myc−Max(S) dimer or (B−E) small-molecule ligand. (A) Concentration-

dependent binding of c-Myc−Max(S) heterodimers to a biotin-tagged E-box-containing double-stranded oligonucleotide immobilized to a

streptavidin-coated biosensor chip. Binding of the oligonucleotide itself was associated with a response of 700−800 units. After resetting this value to

baseline, equimolar concentrations of c-Myc and Max(S) were allowed to dimerize for 30 min and then passed over the biosensor chip. Note the

concentration-dependent increase in response. (B) Prevention of heterodimerization by 2. The indicated concentrations of 2 were incubated with 20

nM of c-Myc for 20 min, followed by the addition of 20 nM Max(S). Following an additional 30 min incubation, the mixture was applied to the E-

Box-containing biosensor chip. (C) DNA binding by preformed c-Myc−Max(S) heterodimers is relatively resistant to 2. Preformed c-Myc−Max(S)

heterodimers (20 nM of each protein) were incubated for 30 min with the indicated concentrations of 2 and then applied to the E-Box-containing

biosensor chip. (D) Disruption of DNA binding by 4da. The experiment was performed as described in (B) except that the indicated concentrations

of 4da were incubated with c-Myc monomer prior to the addition of Max(S). (E) The experiment was performed as described in (D), except that

preformed c-Myc−Max(S) heterodimers were incubated with the indicated concentrations of 4da. Blue bars indicate the period during which

protein−compound mixtures were being injected. Note that the relative response in each case has been normalized to 100 to denote the maximal

response for each set of curves in order to allow intergroup comparisons. Similar results for each panel were obtained on at least two additional

occasions.

Table 5. Viability of HL60 and Daudi Cells in the Presence

of Synthetic α-Helix Mimetics after 3 Days

Table 6. Growth Inhibition Studies Were Performed As

Described for Table 3

a

inhibition (IC₅₀, μM)

cell line or strain

H460

cell type

lung cancer

inhibition (IC₅₀, μM)

15.9 1.1

10.8 0.8

10.4 1.3

15.7 0.9

18.1 0.8

20.6 1.1

35.6 2.6

23.0 2.6

46.0 3.2

20.6 1.0

14.1 1.2

no.

HL60 cells

Daudi cells

HeLa

uterine cervical cancer

embryonic kidney

myeloma

4aa

4ca

4da

15

39.9 5.3

44.8 0.9

19.9 1.6

21.5 2.7

30.3 4.6

>50

22.9 2.5

25.6 1.4

9.5 0.7

11.2 1.4

11.1 1.1

>50

HEK-293

JJN3

INA-6

myeloma

IH-1

myeloma

16

ANBL-6

KJON

myeloma

21

myeloma

a

MTT cell proliferation assays performed as previously de-

U266

myeloma

scribed.^{36,37,43,46,47}The results shown represent the means and

standard deviations of quadruplicate experiments.

HO15.19 (myc−/−)

HO15.19-wt-Myc

rat ﬁbroblasts

a

Cells were incubated in serial dilutions of 4da for 3 days before

Several techniques were enlisted to delineate the mechanism of

inhibition of our compounds. The outcomes of these studies

are consistent with the idea that, as designed, these compounds

bind helical c-Myc and impair the c-Myc−Max heterodimer’s

ability to bind DNA without causing the dissociation of c-Myc−

Max heterodimers. The in vitro results were mirrored by studies

showing that, under conditions where 4da inhibited cell

growth, c-Myc−Max heterodimers remained intact in situ.

Current work is focused on determining the metabolic stability

of 4da because the c-Myc inhibitor 2 exhibits a short half-life

determining viable cell numbers relative to untreated cells.

due to metabolism of the nitro group to the toxic

hydroxylamino derivative and the inactive amino derivative.^45,71

Hence, in addition to contributing to a short half-life, the nitro

group in 4da may also be responsible for the general toxicity of

the compound. Thus, toward the further optimization of our

helix mimetics, eﬀorts will be made to seek out nitro group

bioisosteres, of which it is already known there exists at least

L

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 5. 4da promotes cell cycle arrest. Logarithmically growing HL60 promyelocytic leukemia cells were incubated with the indicated

concentrations of 4da or the previously described c-Myc inhibitor 10058-F4³⁶for 24 h. Cells were then collected and stained with propidium iodide

as previously described.⁶⁹Typical results are shown. Repeat experiments performed in triplicate on a separate occasion yielded very similar ﬁndings

(Supporting Information, Table 1).

NMR spectrometers at 25 °C. Chemical shifts are reported in parts per

1

million (ppm). Data for H NMR are reported as follows: chemical

shift (δ ppm) (integration, multiplicity, coupling constant (Hz),

identity). Multiplicities are reported as follows: s = singlet, d = doublet,

t = triplet, q = quartet, hep = heptet, dd = doublet of doublets, m =

multiplet. Data for ¹³C are reported in terms of chemical shifts (δ

ppm). The residual solvent peak was used as an internal reference. The

mass spectra were obtained on an electrospray TOF (ESI-TOF) mass

spectrometer (BrukerAmaZon X). Target molecules that were

evaluated beyond the initial EMSA screen (4aa, 4da, 4ca, 15, 16,

and 21) exhibited purities of >95% as determined by CHN elemental

combustion analysis.

Figure 6. 4da causes neutral lipid accumulation. H460 large cell lung

General Procedure A. Nucleophilic Aromatic Substitution

cancer cells were incubated in the indicated concentrations of 2 or 4da

(S_NAr). NaH (3 equiv) was suspended in anhydrous THF (0.1 M),

for 48 h and then stained with the neutral lipid-speciﬁc ﬂuorescent dye

BODIPY-459/503.⁶⁹Control, untreated cells were stained in parallel.

Curves depict the ﬂuorescence distribution of at least 10⁴individual

events from each group. The numbers in the upper left corner depict

the ratio of mean ﬂuorescence intensity of inhibitor-treated cells to

control cells, based on the average of biological triplicates stained in

parallel one standard error. Typical ﬂow diagrams are indicated in

each panel.

and the requisite alcohol (1.3 equiv) was added at 0 °C under an inert

(N₂) atmosphere. After 15 min, 3-ﬂuoro-4-nitrobenzoic acid (1 equiv)

was added. The reaction mixture was stirred for 15 min at 0 °C, then

at RT for 2 h. TLC indicated the reaction was complete. The reaction

was quenched by adding satd NH₄Cl, then partitioned with EtOAc.

The aqueous layer was put to one side, and then the organic layer was

washed twice with 0.1 M HCl. The organic layer was dried over

Na₂SO₄, ﬁltered, concentrated, and puriﬁed by ﬂash column

chromatography over silica gel using an eluent of Hex/EtOAc/

AcOH, 1:1:0.1, to provide the title compound.

one (ethyl aminooxalate in compound 21). More generally, the

identiﬁcation of a new mechanism of action by which direct c-

Myc inhibitors may function should provide ample oppor-

tunities for the design of novel analogues of compounds such as

those described here that are intended to promote more

eﬃcient cellular uptake and PPI disruption.

General Procedure B. Acid Chloride Synthesis. To a solution of

the carboxylic acid in CH₂Cl₂or THF (0.1 M) at 0 °C was added

dropwise oxalyl chloride followed by one drop of DMF. The reaction

was stirred under an inert atmosphere at room temperature for 2 h

(typically, all reactions were complete after this time) and then

concentrated in vacuo and dried for at least 5 h under high vacuum to

aﬀord the acid chloride which was used without further puriﬁcation.

General Procedure C. Reduction of Nitro Group with Pd/C. 10%

Pd/C (20 wt %) was carefully added to an evacuated ﬂask of the nitro

compound in EtOH (0.1 M). H₂was bubbled through the reaction

mixture for 10 min, and then the reaction was stirred under 1 atm of

H₂(balloon) for 1−5 h. TLC conﬁrmed the reaction was complete.

The reaction mixture was ﬁltered over Celite, washing with MeOH.

The ﬁltrate was concentrated in vacuo, then dried under high vacuum

to furnish the title compound.

EXPERIMENTAL SECTION

■

Chemistry: General. Unless otherwise stated, all reactions were

performed under an inert (N₂) atmosphere. Reagents and solvents

were reagent grade and purchased from Sigma-Aldrich, Alfa Aesar,

Oakwood, and TCI America. Anhydrous solvents were purchased

from Sigma-Aldrich and used as provided. Reactions were monitored

by TLC, visualizing with a UV lamp and/or KMnO₄stain. Silica gel 60

(70−230 mesh, Merck) was used for ﬂash column chromatography.

¹H and ¹³C NMR spectra were recorded on Varian INOVA 400 MHz

M

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 7. 4da speciﬁcally inhibits a c-Myc reporter vector. HeLa cells stably expressing luciferase vectors under the control of a minimal promoter

bearing c-Myc or NF-kB binding sites were exposed to the indicated concentrations of 4da or the previously well-characterized c-Myc inhibitor 2 for

6 h. Cells were assayed for luciferase activity as described in the Experimental Section. The results depicted represent the mean of triplicate

determinations 1 standard error, with the value for untreated cells arbitrarily being set to 100%.

1

a pale-yellow solid (80 mg, 56%). H NMR (DMSO-d₆, 400 MHz) δ

12.98 (1H, s, CO₂H), 9.79 (1H, s, NH), 8.03 (1H, d, J = 8.0 Hz, Ar),

7.97 (1H, d, J = 8.0 Hz, Ar), 7.79 (1H, s, Ar), 7.62 (2H, d, J = 8.0 Hz,

Ar), 7.57 (1H, s, Ar), 4.03 (2H, d, J = 6.4 Hz, OCH₂), 3.89 (2H, d, J =

6.4 Hz, OCH₂), 2.08 (2H, m, 2 × CH(CH₃)₂), 0.99 (12H, m, 2 ×

CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 167.3, 163.9, 151.4,

150.8, 141.5, 139.7, 131.2, 128.5, 125.5, 123.7, 122.3, 119.9, 114.2,

112.9, 75.6, 74.9, 28.2, 28.0, 19.4, 19.1. MS (ESI) m/z calcd for

C₂₂H₂₆N₂O₇(M⁺), 430.2; found, 431.1 (M + H⁺); Anal. Calcd for

C₂₂H₂₆N₂O₇: C, 61.39; H, 6.09; N, 6.51. Found: C, 61.11; H, 6.07; N,

Figure 8. 4da fails to promote c-Myc−Max dissociation in situ. HL60

promyelocytic leukemia cells were exposed for 6 h the indicated

6.37.

concentrations of 10058-F4 or 4da or to DMSO vehicle alone. Total

cell lysates were then prepared as previously described,⁴⁶and Max

3-(Benzyloxy)-4-(3-isobutoxy-4-nitrobenzamido)benzoic

Acid (4ac). 3-Isobutoxy-4-nitrobenzoic acid⁷²(6a) was converted to

proteins were immunoprecipitated (IP) followed by immunoblotting

its corresponding acid chloride according to general procedure B on a

(IB) of the precipitate with an anti-c-Myc antibody. The bottom

0.19 mmol scale, then coupled to 4-amino-3-benzyloxybenzoic acid⁷³

portion of each panel shows the total amount of c-Myc protein in

lysates prior to IP.

(8c) according to general procedure F to deliver the title compound as

1

a pale-yellow solid (46 mg, 52%). H NMR (DMSO-d₆, 400 MHz) δ

12.96 (1H, s, CO₂H), 9.91 (1H, s, NH), 7.99 (1H, d, J = 8.0 Hz, Ar),

7.91 (1H, d, J = 8.0 Hz, Ar), 7.74 (1H, s, Ar), 7.65 (1H, s, Ar), 7.59

(2H, t, J = 8.4 Hz, Ar), 7.50 (2H, d, J = 6.8 Hz, Ar), 7.34 (2H, t, J = 6.8

Hz, Ar), 7.30 (1H, d, J = 6.8 Hz, Ar), 5.24 (2H, s, OCH₂), 3.96 (2H, d,

J = 5.6 Hz, OCH₂), 2.01 (1H, m, CH(CH₃)₂), 0.95 (6H, d, J = 6.4 Hz,

CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 167.2, 164.1, 151.5,

150.6, 141.5, 139.7, 137.1, 131.4, 128.8, 128.6, 128.2, 127.6, 125.4,

124.3, 122.6, 120.0, 114.3, 113.7, 75.6, 70.3, 28.0, 19.1. MS (ESI) m/z

calcd for C₂₅H₂₄N₂O₇(M⁺), 464.2; found, 465.1 (M + H⁺).

General Procedure D. Reduction of Nitro Group with

SnCl₂.2H₂O. The nitro compound (1 equiv) was dissolved in EtOAc

(0.1 M), and then SnCl₂·2H₂O (5 equiv) was added. The reaction

mixture was stirred for 3 h at 50 °C, by which time TLC conﬁrmed the

reaction was complete. The reaction mixture was partitioned between

EtOAc and satd NaHCO₃. The organic layer was collected, and the

aqueous layer was extracted with further EtOAc (×2). The organic

layers were combined, washed with satd NaHCO₃and brine, dried

(Na₂SO₄), ﬁltered, and concentrated. The residue was puriﬁed by silica

gel ﬂash column chromatography using a gradient of EtOAc in Hex as

eluent to furnish the corresponding aniline.

General Procedure E. Methyl Ester Hydrolysis. NaOH (4 equiv)

was added to a solution of the methyl ester (1 equiv) in a 3:1:1

mixture of THF/MeOH/H₂O (0.08 M). The reaction was stirred at

room temperature until complete consumption of the starting material

(1 h−4 d). The reaction mixture was diluted with further water,

acidiﬁed to pH 5 with 1 N HCl, and then extracted into EtOAc (×5).

The organic layers were combined, dried over Na₂SO₄, ﬁltered, and

concentrated to give the carboxylic acid which did not require further

puriﬁcation.

General Procedure F. Bis-arylamide Synthesis. To a solution of

the aniline (1 equiv) and N,N-dimethylaniline in anhydrous acetone

(0.2 M) at 0 °C was added dropwise a solution of the acid chloride of

the appropriate 4-nitrobenzoic acid (1 equiv) in anhydrous acetone

(0.2 M). The resulting mixture was allowed to warm to room

temperature overnight. The white precipitate was collected by vacuum

ﬁltration and washed with acetone, 2 N HCl, and water until the

ﬁltrate was neutral, and then dried in vacuo at 40 °C overnight.

3-Isobutoxy-4-(3-isobutoxy-4-nitrobenzamido)benzoic Acid

(4aa). 3-Isobutoxy-4-nitrobenzoic acid⁷²(6a) was converted to its

corresponding acid chloride according to general procedure B on a

0.33 mmol scale, then coupled to 4-amino-3-isobutyoxybenzoic acid⁷²

(8a) according to general procedure F to deliver the title compound as

4-(3-Isobutoxy-4-nitrobenzamido)-3-(pyridin-2-ylmethoxy)-

benzoic Acid (4ag). 3-Isobutoxy-4-nitrobenzoic acid⁷²(6a) was

converted to its corresponding acid chloride according to general

procedure B on a 0.24 mmol scale, then coupled to 4-amino-3-

(pyridin-2-ylmethoxy)benzoic acid (8g) according to general

procedure F to deliver the title compound as a white solid (55 mg,

49%). ¹H NMR (DMSO-d₆, 400 MHz) δ 12.99 (1H, s, CO₂H), 10.19

(1H, s, NH), 8.06 (1H, d, J = 8.0 Hz, Ar), 8.02 (1H, d, J = 8.0 Hz, Ar),

7.82 (2H, m, Py), 7.68 (3H, m, Ar + Py), 7.61 (1H, d, J = 8.0 Hz, Ar),

7.35 (1H, t, J = 4.8 Hz, Py), 5.37 (2H, s, OCH₂), 4.02 (2H, d, J = 6.4

Hz, OCH₂), 2.05 (1H, m, CH(CH₃)₂), 0.99 (6H, d, J = 6.0 Hz,

CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 167.1, 164.1, 156.7,

151.5, 150.2, 149.4, 141.6, 139.7, 137.4, 131.9, 128.4, 125.5, 123.9,

123.5, 123.2, 121.8, 119.9, 114.7, 114.5, 75.6, 71.8, 28.0, 19.1. MS

(ESI) m/z calcd for C₂₄H₂₃N₃O₇(M⁺), 465.2; found, 466.1 (M + H⁺).

4-(3-Isobutoxy-4-nitrobenzamido)-3-(pyridin-3-ylmethoxy)-

benzoic Acid (4ah). 3-Isobutoxy-4-nitrobenzoic acid⁷²(6a) was

converted to its corresponding acid chloride according to general

procedure B on a 0.37 mmol scale, then coupled to 4-amino-3-

(pyridin-3-ylmethoxy)benzoic acid (8h) according to general

procedure F to deliver the title compound as a white solid (120 mg,

1

70%). H NMR (DMSO-d₆, 400 MHz) δ 13.01 (1H, bs, CO₂H),

10.01 (1H, s, NH), 8.94 (1H, s, Py), 8.71 (1H, d, J = 4.0 Hz, Py), 8.35

(1H, d, J = 8.0 Hz, Ar), 8.00 (1H, d, J = 8.4 Hz, Ar), 7.91 (1H, d, J =

8.0 Hz, Py), 7.77 (2H, m, Ar + Py), 7.69 (1H, s, Ar), 7.65 (1H, d, J =

N

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

8.0 Hz, Ar), 7.61 (1H, d, J = 8.4 Hz, Ar), 5.41 (2H, s, OCH₂), 3.98

(2H, d, J = 6.4 Hz, OCH₂), 2.02 (1H, m, CH(CH₃)₂), 0.96 (6H, d, J =

6.8 Hz, CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 167.1, 164.2,

151.5, 150.3, 145.4, 144.7, 141.5, 140.5, 139.6, 135.2, 131.4, 128.7,

125.7, 125.4, 124.7, 123.0, 120.1, 114.5, 113.7, 75.6, 67.4, 28.0, 19.1.

MS (ESI) m/z calcd for C₂₄H₂₃N₃O₇(M⁺), 465.2; found, 466.1 (M +

H⁺).

4-(3-Isobutoxy-4-nitrobenzamido)-3-(pyridin-4-ylmethoxy)-

benzoic Acid (4ai). 3-Isobutoxy-4-nitrobenzoic acid⁷²(6a) was

converted to its corresponding acid chloride according to general

procedure B on a 0.28 mmol scale, then coupled to 4-amino-3-

(pyridin-4-ylmethoxy)benzoic acid (8i) according to general proce-

dure F to deliver the title compound as a white solid (94 mg, 72%). ¹H

NMR (DMSO-d₆, 400 MHz) δ 13.00 (1H, bs, CO₂H), 10.27 (1H, s,

NH), 8.87 (2H, d, J = 5.6 Hz, Py), 8.06 (2H, d, J = 5.6 Hz, Py), 8.02

(1H, d, J = 8.8 Hz, Ar), 7.87 (2H, d, J = 8.4 Hz, Ar), 7.66 (3H, m, Ar),

5.58 (2H, s, OCH₂), 4.01 (2H, d, J = 5.6 Hz, OCH₂), 2.02 (1H, m,

CH(CH₃)₂), 0.96 (6H, d, J = 6.0 Hz, CH(CH₃)₂). ¹³C NMR (DMSO-

d₆, 100 MHz) δ 166.9, 164.1, 155.6, 151.4, 150.1, 143.4, 141.5, 139.4,

131.2, 128.8, 125.3, 125.2, 123.9, 123.1, 120.0, 114.5, 113.6, 75.6, 68.1,

27.9, 19.0. MS (ESI) m/z calcd for C₂₄H₂₃N₃O₇(M⁺), 465.2; found,

466.1 (M + H⁺).

12.96 (1H, s, CO₂H), 9.80 (1H, s, NH), 8.14 (1H, s, Ar), 8.07 (1H, d,

J = 7.2 Hz, Ar), 8.04 (1H, d, J = 8.0 Hz, Ar), 7.96−7.92 (3H, m, Ar),

7.69 (1H, d, J = 7.2 Hz, Ar), 7.65 (1H, d, J = 8.0 Hz, Ar), 7.60−7.50

(5H, m, Ar), 5.82 (2H, s, OCH₂), 3.85 (2H, d, J = 5.6 Hz, OCH₂),

2.04 (1H, m, CH(CH₃)₂), 0.95 (6H, d, J = 6.0 Hz, CH(CH₃)₂). ¹³C

NMR (DMSO-d₆, 100 MHz) δ 167.3, 164.0, 151.1, 150.8, 141.8,

139.8, 133.6, 131.6, 131.2, 129.4, 128.9, 128.5, 126.9, 126.8, 126.5,

125.8, 125.6, 124.1, 123.8, 122.3, 120.3, 115.0, 112.9, 74.9, 69.8, 28.1,

19.4. MS (ESI) m/z calcd for C₂₉H₂₆N₂O₇(M⁺), 514.2; found, 515.1

(M + H⁺). Anal. Calcd for C₂₉H₂₆N₂O₇: C, 67.70; H, 5.09; N, 5.44.

Found: C, 67.41; H, 4.94; N, 5.35.

4-(3-((2,3-Dihydro-1H-inden-2-yl)oxy)-4-nitrobenzamido)-3-

isobutoxybenzoic Acid (4ea). 3-(2,3-dihydro-1H-inden-2-yl)oxy)-

4-nitrobenzoic acid (6e) was converted to its corresponding acid

chloride according to general procedure B on a 0.66 mmol scale, then

coupled to 4-amino-3-isobutyoxybenzoic acid⁷³(8a) according to

general procedure F to deliver the title compound as a pale-yellow

solid (252 mg, 78%). ¹H NMR (DMSO-d₆, 400 MHz) δ 12.95 (1H, s,

CO₂H), 9.79 (1H, s, NH), 7.98 (1H, d, J = 8.4 Hz, Ar), 7.95 (1H, d, J

= 8.4 Hz, Ar), 7.87 (1H, s, Ar), 7.59 (2H, m, Ar), 7.54 (1H, s, Ar),

7.23 (2H, m, Ar), 7.16 (2H, m, Ar), 5.50 (1H, m, OCH), 3.86 (2H, d,

J = 6.4 Hz, OCH₂), 3.45 (2H, dd, J = 6.0 Hz, 17.2 Hz, CHCH₂), 3.08

(2H, d, J = 17.2 Hz, CHCH₂), 2.06 (1H, m, CH(CH₃)₂), 0.97 (6H, d,

J = 6.0 Hz, CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 167.3,

164.0, 150.9, 150.2, 142.3, 140.5, 139.6, 131.2, 128.5, 127.1, 125.7,

125.0, 123.9, 122.3, 120.2, 115.1, 112.9, 80.3, 74.9, 28.3, 19.4. MS

(ESI) m/z calcd for C₂₇H₂₆N₂O₇(M⁺), 490.2; found, 491.1 (M + H⁺).

3-Methoxy-4-(3-methoxy-4-nitrobenzamido)benzoic Acid

(4ﬀ). 3-Methoxy-4-nitrobenzoic acid (6f) was converted to its

corresponding acid chloride according to general procedure B on a

0.49 mmol scale, then coupled to 4-amino-3-methoxybenzoic acid (8f)

according to general procedure F to deliver the title compound as a

4-(3-Isobutoxy-4-nitrobenzamido)benzoic Acid (4aj). 3-Iso-

butoxy-4-nitrobenzoic acid⁷²(6a) was converted to its corresponding

acid chloride according to general procedure B on a 0.31 mmol scale,

then coupled to 4-aminobenzoic acid (8j) according to general

procedure F to deliver the title compound as a pale-yellow solid (76

1

mg, 69%). H NMR (DMSO-d₆, 400 MHz) δ 12.78 (1H, s, CO₂H),

10.65 (1H, s, NH), 8.00 (1H, d, J = 8.8 Hz, Ar), 7.94 (2H, d, J = 8.8

Hz, Ar), 7.87 (2H, d, J = 8.8 Hz, Ar), 7.76 (1H, s, Ar), 7.61 (1H, d, J =

8.0 Hz, Ar), 4.02 (2H, d, J = 6.0 Hz, OCH₂), 2.03 (1H, m,

CH(CH₃)₂), 0.97 (6H, d, J = 6.4 Hz, CH(CH₃)₂). ¹³C NMR (DMSO-

d₆, 100 MHz) δ 167.3, 164.7, 151.4, 143.1, 141.5, 140.1, 130.7, 126.4,

125.3, 120.1, 114.7, 75.7, 28.1, 19.1. MS (ESI) m/z calcd for

C₁₈H₁₈N₂O₆(M⁺), 358.1; found, 359.1 (M + H⁺).

1

pale-yellow solid (129 mg, 76%). H NMR (DMSO-d₆, 400 MHz) δ

12.99 (1H, s, CO₂H), 9.92 (1H, s, NH), 8.02 (1H, d, J = 8.0 Hz, Ar),

7.95 (1H, d, J = 8.0 Hz, Ar), 7.83 (1H, s, Ar), 7.65−7.60 (3H, m, Ar),

4.02 (3H, s, OCH₃), 3.91 (3H, s, OCH₃). ¹³C NMR (DMSO-d₆, 100

MHz) δ 167.3, 164.2, 152.0, 151.3, 141.4, 139.8, 131.0, 128.4, 125.4,

124.0, 122.3, 120.1, 114.0, 112.1, 57.3, 56.3. MS (ESI) m/z calcd for

C₁₆H₁₄N₂O₇(M⁺), 346.1; found, 347.0 (M + H⁺).

3-Isopropoxy-4-(3-isopropoxy-4-nitrobenzamido)benzoic

Acid (4bb). 3-Isopropoxy-4-nitrobenzoic acid⁵¹(6b) was converted

to its corresponding acid chloride according to general procedure B on

a 0.31 mmol scale, then coupled to 4-amino-3-isopropoxybenzoic

acid⁷²(8b) according to general procedure F to deliver the title

3-Isobutoxy-4-(4-nitro-3-(pyridin-2-ylmethoxy)benzamido)-

benzoic Acid (4ga). 4-Nitro-3-(pyridin-2-ylmethoxy)benzoic acid

(6g) was converted to its corresponding acid chloride according to

general procedure B on a 0.20 mmol scale, then coupled to 4-amino-3-

isobutyoxybenzoic acid⁷³(8a) according to general procedure F to

1

compound as a pale-yellow solid (38 mg, 31%). H NMR (CDCl₃+

CD₃OD, 400 MHz) δ 8.44 (1H, s, NH), 7.80 (2H, d, J = 8.0 Hz, Ar),

7.59 (2H, s, 2 × Ar-1H), 7.27 (2H, d, J = 8.0 Hz, Ar), 4.73 (2H, m, 2 ×

OCH(CH₃)₂), 1.38 (12H, d, J = 5.2 Hz, 2 × OCH(CH₃)₂. ¹³C NMR

(CDCl₃+ CD₃OD, 100 MHz) δ 163.0, 151.4, 145.7, 142.7, 139.3,

131.7, 125.7, 118.5, 117.1, 115.2, 73.0, 71.6, 29.6, 22.0, 21.7. MS (ESI)

m/z calcd for C₂₀H₂₂N₂O₇(M⁺), 402.1; found, 403.0 (M + H⁺).

3-Isobutoxy-4-(3-benzyloxy-4-nitrobenzamido)benzoic

Acid (4ca). 3-Benzyloxy-4-nitrobenzoic acid⁷³(6c) was converted to

its corresponding acid chloride according to general procedure B on a

0.37 mmol scale, then coupled to 4-amino-3-isobutyoxybenzoic acid⁷³

(8a) according to general procedure F to deliver the title compound as

1

deliver the title compound as a white solid (72 mg, 77%). H NMR

(DMSO-d₆, 400 MHz) δ 13.00 (1H, s, CO₂H), 9.85 (1H, s, NH), 8.61

(1H, s, Ar), 8.11 (1H, d, J = 8.0 Hz, Ar), 7.97 (1H, s, Ar), 7.93−7.89

(2H, m, Ar + Py), 7.69 (1H, d, J = 8.4 Hz, Ar), 7.63 (1H, d, J = 8.4 Hz,

Ar), 7.58 (2H, m, Py), 7.39 (1H, t, J = 6.0 Hz, Py), 5.49 (2H, s,

OCH₂), 3.89 (2H, d, J = 5.2 Hz, OCH₂), 2.07 (1H, m, CH(CH₃)₂),

0.99 (6H, d, J = 6.0 Hz, CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100

MHz) δ 167.3, 163.8, 155.8, 151.0, 150.9, 149.6, 141.6, 139.8, 137.6,

131.1, 128.6, 125.8, 124.1, 123.6, 122.3, 121.7, 120.5, 114.9, 113.0,

74.9, 71.8, 28.1, 19.4. MS (ESI) m/z calcd for C₂₄H₂₃N₃O₇(M⁺),

465.2; found, 466.1 (M + H⁺).

1

a pale-yellow solid (68 mg, 40%). H NMR (DMSO-d₆, 400 MHz) δ

12.98 (1H, s, CO₂H), 9.82 (1H, s, NH), 8.07 (1H, d, J = 8.0 Hz, Ar),

7.94 (2H, m, Ar), 7.66 (1H, d, J = 8.0 Hz, Ar), 7.62 (1H, d, J = 8.0 Hz,

Ar), 7.57 (1H, s, Ar), 7.46−7.41 (4H, m, Ar), 7.38 (1H, d, J = 6.4 Hz,

Ar), 5.40 (2H, s, OCH₂), 3.89 (2H, d, J = 5.6 Hz, OCH₂), 2.07 (1H,

m, CH(CH₃)₂), 0.99 (6H, d, J = 6.4 Hz, CH(CH₃)₂). ¹³C NMR

(DMSO-d₆, 100 MHz) δ 167.3, 163.9, 151.0, 150.9, 141.8, 139.7,

136.1, 131.1, 129.0, 128.6, 127.8, 125.6, 123.9, 122.3, 120.2, 115.0,

113.0, 74.9, 71.2, 28.1, 19.4. MS (ESI) m/z calcd for C₂₅H₂₄N₂O₇

(M⁺), 464.2; found, 465.1 (M + H⁺). Anal. Calcd for C₂₅H₂₄N₂O₇: C,

64.65; H, 5.21; N, 6.03. Found: C, 64.86; H, 5.23; N, 6.06.

3-Isobutoxy-4-(3-(naphthalen-1-ylmethoxy)-4-

nitrobenzamido)benzoic Acid (4da (“JKY-2-169”)). 3-Naphtha-

len-1-ylmethoxy-4-nitrobenzoic acid⁷³(6d) was converted to its

corresponding acid chloride according to general procedure B on a

0.31 mmol scale, then coupled to 4-amino-3-isobutyoxybenzoic acid⁷²

(8a) according to general procedure F to deliver the title compound as

a pale-yellow solid (134 mg, 84%). ¹H NMR (DMSO-d₆, 400 MHz) δ

3-Isobutoxy-4-(4-nitrobenzamido)benzoic Acid (4ja). 4-Ni-

trobenzoyl chloride (7j; 0.45 mmol) was coupled to 4-amino-3-

isobutyoxybenzoic acid⁷²(8a) according to general procedure F to

1

deliver the title compound as a white solid (154 mg, 96%). H NMR

(DMSO-d₆, 400 MHz) δ 12.94 (1H, s, CO₂H), 9.85 (1H, s, NH), 8.35

(2H, d, J = 8.4 Hz, Ar), 8.13 (2H, d, J = 8.4 Hz, Ar), 7.88 (1H, d, J =

7.6 Hz, Ar), 7.58 (1H, d, J = 7.6 Hz, Ar), 7.53 (1H, s, Ar), 3.85 (2H, d,

J = 6.4 Hz, OCH₂), 2.03 (1H, m, CH(CH₃)₂), 0.95 (6H, d, J = 6.4 Hz,

CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 167.3, 164.0, 151.0,

149.7, 140.4, 131.2, 129.4, 128.6, 124.2, 124.1, 122.2, 113.0, 74.9, 28.1,

19.4. MS (ESI) m/z calcd for C₁₈H₁₈N₂O₆(M⁺), 358.1; found, 359.1

(M + H⁺).

4-(4-Nitrobenzamido)benzoic Acid (4jj). 4-Nitrobenzoyl chlor-

ide (7j; 0.693 mmol) was coupled to 4-aminobenzoic acid according to

general procedure F to deliver the title compound as a pale-yellow

O

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

solid (180 mg, 91%). ¹H NMR (DMSO-d₆, 400 MHz) δ 12.81 (1H, s,

CO₂H), 10.85 (1H, s, NH), 8.40 (2H, d, J = 8.4 Hz, Ar), 8.21 (2H, d, J

= 8.4 Hz, Ar), 7.99 (2H, d, J = 8.4 Hz, Ar), 7.93 (2H, d, J = 8.4 Hz,

Ar). ¹³C NMR (DMSO-d₆, 100 MHz) δ 167.3, 164.7, 149.7, 143.2,

140.6, 130.7, 129.7, 126.4, 124.0, 120.1. MS (ESI) m/z calcd for

C₁₄H₁₀N₂O₅(M⁺), 286.1; found, 287.0 (M + H⁺).

procedure B on a 0.18 mmol scale, then coupled to methyl 4-amino-3-

isobutoxybenzoate⁷²(9a) according to general procedure F to deliver

1

the title compound as a pale-yellow solid (86 mg, 100%). H NMR

(CDCl₃, 400 MHz) δ 8.77 (1H, s, NH), 8.54 (1H, d, J = 8.4 Hz, Ar),

7.94 (1H, d, J = 8.4 Hz, Ar), 7.61 (1H, s, Ar), 7.73 (1H, d, J = 8.4 Hz,

Ar), 7.56 (1H, s, Ar), 7.46−7.30 (5H, m, Ar), 5.27 (2H, s, OCH₂),

3.92−3.89 (5H, m, OCH₃+ OCH₂CH), 2.18 (1H, m, CH₂CH-

(CH₃)₂), 1.08 (6H, d, J = 7.2 Hz, CH₂CH(CH₃)₂). ¹³C NMR (CDCl₃,

100 MHz) δ 166.6, 162.9, 152.1, 147.1, 141.9, 139.7, 134.8, 131.3,

128.7, 128.4, 127.0, 126.0, 125.8, 123.2, 118.7, 117.6, 114.6, 111.6,

75.1, 71.3, 52.2, 28.2, 19.2. MS (ESI) m/z calcd for C₂₆H₂₆N₂O₇(M⁺),

478.2; found, 479.1 (M + H⁺).

Methyl 3-Isobutoxy-4-(3-isobutoxy-4-nitrobenzamido)-

benzoate (14aa). 3-Isobutoxy-4-nitrobenzoic acid⁷²(6a) was

converted to its corresponding acid chloride according to general

procedure B on a 0.18 mmol scale, then coupled to methyl 4-amino-3-

isobutoxybenzoate⁷²(9a) according to general procedure F to deliver

1

the title compound as a pale-yellow solid (51 mg, 64%). H NMR

(CDCl₃, 400 MHz) δ 8.78 (1H, s, NH), 8.60 (1H, d, J = 8.4 Hz, Ar),

7.93 (1H, d, J = 8.4 Hz, Ar), 7.75 (1H, d, J = 8.4 Hz, Ar), 7.64 (1H, s,

Ar), 7.58 (1H, s, Ar), 7.39 (1H, d, J = 8.4 Hz, Ar), 3.95 (4H, m, 2 ×

OCH₂), 3.92 (3H, s, OCH₃), 2.18 (2H, m, 2 × CH(CH₃)₂, 1.11 (6H,

d, J = 6.4 Hz, CH(CH₃)₂, 1.07 (6H, d, J = 6.4 Hz, CH(CH₃)₂. ¹³C

NMR (CDCl₃, 100 MHz) δ 166.5, 163.0, 152.8, 147.0, 141.6, 139.7,

131.4, 125.9, 125.8, 123.3, 118.6, 117.2, 113.7, 111.5, 76.0, 75.0, 52.1,

28.2, 28.1, 19.3, 18.9. MS (ESI) m/z calcd for C₂₃H₂₈N₂O₇(M⁺),

444.2; found, 445.1 (M + H⁺).

Methyl 3-(Benzyloxy)-4-(3-benzyloxy-4-nitrobenzamido)-

benzoate (14cc). 3-Benzyloxy-4-nitrobenzoic acid⁷³(6c) was

converted to its corresponding acid chloride according to general

procedure B on a 0.16 mmol scale, then coupled to methyl 4-amino-3-

benzyloxy-benzoate⁷³(9c) according to general procedure F to deliver

1

the title compound as a pale-yellow solid (67 mg, 82%). H NMR

(CDCl₃, 400 MHz) δ 8.73 (1H, s, NH), 8.58 (1H, d, J = 8.4 Hz, Ar),

7.83 (1H, d, J = 8.4 Hz, Ar), 7.77 (1H, d, J = 8.4 Hz, Ar), 7.71 (1H, s,

Ar), 7.64 (1H, s, Ar), 7.44−7.32 (10H, m, Ar), 7.25 (1H, d, J = 8.4 Hz,

Ar), 5.19 (2H, s, OCH₂), 5.16 (2H, s, OCH₂), 3.91 (3H, s, OCH₃).

¹³C NMR (CDCl₃, 100 MHz) δ 166.7, 163.0, 152.3, 147.2, 142.2,

139.6, 135.9, 135.0, 131.9, 129.2, 129.0, 128.7, 128.1, 127.4, 126.1,

124.1, 119.1, 118.3, 114.6, 112.7, 71.8, 71.5, 52.5. MS (ESI) m/z calcd

for C₂₉H₂₄N₂O₇(M⁺), 512.2; found, 513.1 (M + H⁺).

Methyl 3-Isobutoxy-4-(3-isopropoxy-4-nitrobenzamido)-

benzoate (14ba). 3-Isopropoxy-4-nitrobenzoic acid⁵¹(6b) was

converted to its corresponding acid chloride according to general

procedure B on a 0.18 mmol scale, then coupled to methyl 4-amino-3-

isobutoxybenzoate⁷²(9a) according to general procedure F to deliver

1

the title compound as a pale-yellow solid (77 mg, 100%). H NMR

Methyl 4-(3-(Benzyloxy)-4-nitrobenzamido)-3-((2,3-dihydro-

1H-inden-2-yl)oxy)benzoate (14ce). 3-Benzyloxy-4-nitrobenzoic

acid⁷³(6c) was converted to its corresponding acid chloride according

to general procedure B on a 0.14 mmol scale, then coupled to methyl

4-amino-3-((2,3-dihydro-1H-inden-2-yl)oxy)-benzoic acid (9e) ac-

cording to general procedure F to deliver the title compound as a

(CDCl₃, 400 MHz) δ 8.76 (1H, s, NH), 8.59 (1H, d, J = 8.4 Hz, Ar),

7.86 (1H, d, J = 8.4 Hz, Ar), 7.75 (1H, d, J = 8.4 Hz, Ar), 7.67 (1H, s,

Ar), 7.57 (1H, s, Ar), 7.36 (1H, d, J = 8.4 Hz, Ar), 4.80 (1H, m,

OCH(CH₃)₂), 3.94−3.91 (5H, m, OCH₃+ OCH₂CH), 2.19 (1H, m,

CH₂CH(CH₃)₂), 1.43 (6H, d, J = 5.6 Hz, OCH(CH₃)₂), 1.10 (6H, d,

J = 7.2 Hz, CH₂CH(CH₃)₂). ¹³C NMR (CDCl₃, 100 MHz) δ 166.5,

163.1, 151.5, 147.0, 142.8, 139.4, 131.4, 125.7, 123.3, 118.6, 117.0,

115.3, 111.5, 75.1, 73.0, 52.1, 28.2, 21.7, 19.3. MS (ESI) m/z calcd for

C₂₂H₂₆N₂O₇(M⁺), 430.2; found, 431.1 (M + H⁺).

1

pale-yellow solid (69 mg, 92%). H NMR (CDCl₃, 400 MHz) δ 8.54

(1H, d, J = 8.0 Hz, Ar), 8.42 (1H, d, NH), 7.77 (2H, m, Ar), 7.62 (2H,

m, Ar), 7.43 (2H, d, J = 8.0 Hz, Ar), 7.37 (2H, d, J = 8.0 Hz, Ar), 7.32

(1H, d, J = 8.0 Hz, Ar), 7.29 (2H, m, Ar), 7.20 (2H, m, Ar), 6.41 (1H,

dd, J = 1.6 Hz, 8.4 Hz, Ar), 5.40 (1H, t, J = 5.2 Hz, OCH), 5.21 (2H, s,

OCH₂), 3.92 (3H, s, OCH₃), 3.34 (2H, dd, J = 5.2 Hz, 16.8 Hz,

CHCH₂), 3.17 (2H, d, J = 16.8 Hz, CHCH₂). ¹³C NMR (CDCl₃, 100

MHz) δ 166.4, 162.7, 151.9, 145.1, 141.7, 140.2, 139.2, 134.8, 133.5,

128.7, 128.4, 127.1, 125.8, 125.0, 124.3, 118.8, 117.2, 115.3, 114.6,

80.8, 71.2, 52.2, 39.5. MS (ESI) m/z calcd for C₃₁H₂₆N₂O₇(M⁺),

538.2; found, 539.1 (M + H⁺).

Methyl 3-(Benzyloxy)-4-(3-isopropoxy-4-nitrobenzamido)-

benzoate (14bc). 3-Isopropoxy-4-nitrobenzoic acid⁵¹(6b) was

converted to its corresponding acid chloride according to general

procedure B on a 0.16 mmol scale, then coupled to methyl 4-amino-3-

benzyloxybenzoate⁷³(9c) according to general procedure F to deliver

1

the title compound as a pale-yellow solid (71 mg, 96%). H NMR

(CDCl₃, 400 MHz) δ 8.72 (1H, s, NH), 8.60 (1H, d, J = 8.4 Hz, Ar),

7.78 (1H, d, J = 8.4 Hz, Ar), 7.74 (1H, d, J = 8.4 Hz, Ar), 7.71 (1H, s,

Ar), 7.54 (1H, s, Ar), 7.42−7.40 (5H, m, Ar), 7.23 (1H, d, J = 8.4 Hz,

Ar), 5.19 (2H, s, OCH₂), 4.63 (1H, m, OCH), 3.90 (3H, s, OCH₃),

1.34 (6H, d, J = 5.6 Hz, CH(CH₃)₂). ¹³C NMR (CDCl₃, 100 MHz) δ

166.7, 163.3, 151.6, 147.2, 143.0, 139.3, 135.9, 131.9, 129.1, 129.0,

128.2, 125.9, 124.1, 119.0, 117.7, 115.3, 112.6, 73.2, 71.8, 52.4, 21.9.

MS (ESI) m/z calcd for C₂₅H₂₄N₂O₇(M⁺), 464.2; found, 465.1 (M +

H⁺).

Methyl 3-Isobutoxy-4-(3-(naphthalen-1-ylmethoxy)-4-

nitrobenzamido)benzoate (14da). 3-Naphthalen-1-ylmethoxy-4-

nitrobenzoic acid⁷³(6d) was converted to its corresponding acid

chloride according to general procedure B on a 0.18 mmol scale, then

coupled to methyl 4-amino-3-isobutoxybenzoate⁷²(9a) according to

general procedure F to deliver the title compound as a pale-yellow

1

solid (95 mg, 100%). H NMR (CDCl₃, 400 MHz) δ 8.79 (1H, s,

NH), 8.60 (1H, d, J = 8.4 Hz, Ar), 8.05 (1H, d, J = 8.4 Hz, Ar), 7.95

(2H, t, J = 8.4 Hz, Ar), 7.88 (2H, t, J = 9.2 Hz, Ar), 7.76 (1H, d, J = 9.2

Hz, Ar), 7.71 (1H, d, J = 6.8 Hz, Ar), 7.60−7.47 (4H, m, Ar), 7.41

(1H, d, J = 6.8 Hz, Ar), 5.75 (2H, s, OCH₂), 3.94−3.92 (5H, m,

OCH₃+ OCH₂CH), 2.19 (1H, m, CH₂CH(CH₃)₂), 1.09 (6H, d, J =

6.4 Hz, CH₂CH(CH₃)₂). ¹³C NMR (CDCl₃, 100 MHz) δ 166.5,

162.8, 152.2, 147.0, 142.0, 139.7, 133.6, 131.3, 130.9, 130.1, 129.4,

128.7, 126.7, 126.3, 126.1, 125.8, 125.3, 123.3, 123.1, 118.6, 117.6,

114.7, 111.6, 75.1, 70.1, 52.2, 28.2, 19.3. MS (ESI) m/z calcd for

C₃₀H₂₈N₂O₇(M⁺), 528.2; found, 529.1 (M + H⁺).

Methyl 3-(Benzyloxy)-4-(3-(naphthalen-1-ylmethoxy)-4-

nitrobenzamido)benzoate (14dc). 3-(Naphthalen-1-ylmethoxy)-

4-nitrobenzoic acid (6d) was converted to its corresponding acid

chloride according to general procedure B on a 0.16 mmol scale, then

coupled to methyl 4-amino-3-benzyloxy-benzoic acid⁷³(9c) according

to general procedure F to deliver the title compound as a pale-yellow

solid (40 mg, 45%). ¹H NMR (CDCl₃, 400 MHz) δ 8.76 (1H, s, NH),

8.56 (1H, d, J = 8.4 Hz, Ar), 7.97 (1H, d, J = 8.0 Hz, Ar), 7.86−7.95

(4H, m, Ar), 7.76 (1H, d, J = 8.4 Hz, Ar), 7.69 (1H, s, Ar), 7.60 (1H,

d, J = 6.8 Hz, Ar), 7.50 (2H, d, J = 8.4 Hz, Ar), 7.45 (1H, d, J = 8.4 Hz,

Methyl 3-((2,3-Dihydro-1H-inden-2-yl)oxy)-4-(3-isopropoxy-

4-nitrobenzamido)benzoate (14be). 3-Isopropoxy-4-nitrobenzoic

acid⁵¹(6b) was converted to its corresponding acid chloride according

to general procedure B on a 0.14 mmol scale, then coupled to methyl

4-amino-3-((2,3-dihydro-1H-inden-2-yl)oxy)-benzoic acid (9e) ac-

cording to general procedure F to deliver the title compound as a

1

pale-yellow solid (60 mg, 87%). H NMR (CDCl₃, 400 MHz) δ 8.55

(1H, d, J = 8.0 Hz, Ar), 8.43 (1H, s, NH), 7.77 (2H, m, Ar), 7.53 (2H,

m, Ar), 7.28−7.25 (2H, m, Ar), 7.22−7.19 (2H, m, Ar), 6.38 (1H, dd,

J = 6.8 Hz, 0.8 Hz, Ar), 5.40 (1H, t, J = 5.2 Hz, OCH), 4.69 (1H, m,

OCH), 3.92 (3H, s, OCH₃), 3.35 (2H, dd, J = 5.2 Hz, 16.8 Hz,

CHCH₂), 3.18 (2H, d, J = 16.8 Hz, CHCH₂), 1.37 (6H, d, J = 6.4 Hz,

CH(CH₃)₂). ¹³C NMR (CDCl₃, 100 MHz) δ 166.4, 163.0, 151.3,

145.1, 142.6, 140.2, 138.8, 133.5, 127.1, 125.7, 125.5, 125.0, 124.2,

118.8, 116.6, 115.3, 115.1, 80.6, 72.8, 52.2, 39.5, 21.7. MS (ESI) m/z

calcd for C₂₇H₂₆N₂O₇(M⁺), 490.2; found, 491.1 (M + H⁺).

Methyl 3-Benzyloxy-4-(3-isobutoxy-4-nitrobenzamido)-

benzoate (14ca). 3-Benzyloxy-4-nitrobenzoic acid⁷³(6c) was

converted to its corresponding acid chloride according to general

P

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Ar), 7.40 (2H, d, J = 6.8 Hz, Ar), 7.32 (2H, t, J = 8.4 Hz, Ar), 7.24

(2H, t, J = 6.4 Hz, Ar), 5.52 (2H, s, OCH₂), 5.16 (2H, s, OCH₂), 3.89

(3H, s, OCH₃). ¹³C NMR (CDCl₃, 100 MHz) δ 166.8, 163.2, 163.1,

152.3, 147.2, 142.2, 139.6, 135.8, 133.9, 131.8, 131.2, 130.3, 129.7,

129.1, 128.9, 128.1, 126.9, 126.8, 126.3, 126.1, 125.5, 124.1, 123.5,

119.2, 119.1, 118.3, 114.6, 112.7, 71.8, 70.3, 52.5. MS (ESI) m/z calcd

for C₃₃H₂₆N₂O₇(M⁺), 562.2; found, 563.1 (M + H⁺).

= 1.6 Hz, 8.8 Hz, Ar), 5.42 (1H, m, OCH), 5.27 (1H, m, OCH), 3.92

(3H, s, OCH₃), 3.43 (2H, dd, J = 6.8 Hz, 16.8 Hz, CHCH₂), 3.19 (2H,

dd, J = 6.8 Hz, 16.8 Hz, CHCH₂), 3.24−3.14 (4H, m, 2 × CHCH₂).

¹³C NMR (CDCl₃, 100 MHz) δ 166.4, 162.8, 151.2, 145.1, 142.2,

140.2, 139.6, 138.9, 133.5, 127.1, 126.9, 125.8, 125.0, 124.6, 124.3,

118.8, 116.9, 115.1, 115.0, 80.6, 80.1, 52.2, 39.5. MS (ESI) m/z calcd

for C₃₃H₂₈N₂O₇(M⁺), 564.2; found, 565.1 (M + H⁺).

Methyl 3-((2,3-Dihydro-1H-inden-2-yl)oxy)-4-(3-(naphtha-

len-1-ylmethoxy)-4-nitrobenzamido)benzoate (14de). 3-(Naph-

thalen-1-ylmethoxy)-4-nitrobenzoic acid⁷³(6d) was converted to its

corresponding acid chloride according to general procedure B on a

0.14 mmol scale, then coupled to methyl 4-amino-3-((2,3-dihydro-1H-

inden-2-yl)oxy)-benzoic acid (9e) according to general procedure F to

3-Isobutoxy-4-(6-isobutoxy-5-nitropicolinamido)benzoic

Acid (15). 6-Isobutoxy-5-nitropicolinic acid (11) was converted to its

corresponding acid chloride according to general procedure B on a

0.41 mmol scale, then coupled to 4-amino-3-isobutyoxybenzoic acid⁷³

(6a) according to general procedure F to deliver the title compound as

a pale-yellow solid (156 mg, 88%). ¹H NMR (DMSO-d₆, 400 MHz) δ

12.94 (1H, s, CO₂H), 10.22 (1H, s, NH), 8.67 (1H, d, J = 8.8 Hz, Py),

8.54 (1H, d, J = 8.8 Hz, Py), 7.95 (1H, d, J = 8.4 Hz, Ar), 7.65 (1H, d,

J = 8.4 Hz, Ar), 7.58 (1H, s, Ar), 4.35 (2H, d, J = 5.6 Hz, OCH₂), 3.98

(2H, d, J = 6.4 Hz, OCH₂), 2.12 (2H, m, 2 × CH(CH₃)₂), 1.04 (12H,

m, 2 × CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 166.7, 159.8,

154.5, 149.5, 147.4, 137.3, 136.2, 130.3, 126.7, 122.5, 118.4, 115.8,

111.9, 74.7, 73.3, 27.8, 27.5, 19.1, 18.8. MS (ESI) m/z calcd for

C₂₁H₂₅N₃O₇(M⁺), 431.2; found, 432.1 (M + H⁺)⁺). Anal. Calcd for

C₂₁H₂₅N₃O₇: C, 58.46; H, 5.84; N, 9.74. Found: C, 58.37; H, 5.84; N,

9.58.

6-Isobutoxy-5-(6-isobutoxy-5-nitropicolinamido)picolinic

Acid (16). 6-Isobutoxy-5-nitropicolinic acid (11) was converted to its

corresponding acid chloride according to general procedure B on a

0.41 mmol scale, then coupled to 6-isobutoxy-5-aminopicolinic acid

(13) according to general procedure F to deliver the title compound as

a pale-yellow solid (115 mg, 65%). ¹H NMR (DMSO-d₆, 400 MHz) δ

12.97 (1H, s, CO₂H), 10.03 (1H, s, NH), 8.71 (1H, d, J = 7.6 Hz, Py),

8.62 (1H, d, J = 7.6 Hz, Py), 7.88 (1H, d, J = 7.6 Hz, Py), 7.73 (1H, d,

J = 7.6 Hz, Py), 4.29 (2H, d, J = 5.2 Hz, OCH₂), 4.19 (2H, d, J = 6.8

Hz, OCH₂), 2.09 (2H, m, 2 × CH(CH₃)₂), 1.00 (12H, m, 2 ×

CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 165.7, 160.8, 154.9,

152.6, 149.3, 139.8, 137.8, 136.7, 126.1, 125.0, 120.0, 116.2, 73.8, 73.1,

27.9, 19.6, 19.2. MS (ESI) m/z calcd for C₂₀H₂₄N₄O₇(M⁺), 432.2;

found, 433.1 (M + H⁺)⁺). Anal. Calcd for C₂₀H₂₄N₄O₇: C, 55.55; H,

5.59; N, 12.96. Found: C, 55.72; H, 5.49; N, 12.97.

1

deliver the title compound as a pale-yellow solid (60 mg, 73%). H

NMR (CDCl₃, 400 MHz) δ 8.56 (1H, d, J = 8.4 Hz, Ar), 8.44 (1H, s,

NH), 8.02 (1H, d, J = 8.4 Hz, Ar), 7.87 (1H, d, J = 8.0 Hz, Ar), 7.84

(1H, d, J = 8.0 Hz, Ar), 7.79 (3H, m, Ar), 7.63 (2H, t, J = 8.4 Hz, Ar),

7.57 (1H, t, J = 8.4 Hz, Ar), 7.50 (1H, d, J = 8.4 Hz, Ar), 7.46 (1H, d, J

= 8.0 Hz, Ar), 7.24 (2H, m, Ar), 7.15 (2H, m, Ar), 6.42 (1H, dd, J =

1.6 Hz, 8.4 Hz, Ar), 5.65 (2H, s, OCH₂), 5.40 (1H, t, J = 5.2 Hz,

OCH), 3.92 (3H, s, OCH₃), 3.33 (2H, dd, J = 4.8 Hz, 17.2 Hz,

CHCH₂), 3.17 (2H, d, J = 17.2 Hz, CHCH₂). ¹³C NMR (CDCl₃, 100

MHz) δ 166.4, 162.7, 151.9, 145.1, 141.8, 140.2, 139.2, 133.6, 133.5,

130.9, 130.2, 129.4, 128.7, 127.1, 126.6, 126.4, 126.1, 125.9, 125.2,

125.0, 124.3, 123.2, 118.8, 117.3, 115.3, 114.7, 80.8, 70.0, 52.2, 39.5.

MS (ESI) m/z calcd for C₃₅H₂₈N₂O₇(M⁺), 588.2; found, 589.1 (M +

H⁺).

Methyl 4-(3-((2,3-Dihydro-1H-inden-2-yl)oxy)-4-nitrobenza-

mido)-3-isobutoxybenzoate (14ea). 3-((2,3-Dihydro-1H-inden-2-

yl)oxy)-4-nitrobenzoic acid (6e) was converted to its corresponding

acid chloride according to general procedure B on a 0.18 mmol scale,

then coupled to methyl 4-amino-3-isobutoxybenzoate⁷²(9a) accord-

ing to general procedure F to deliver the title compound as a yellow

solid (85 mg, 94%). ¹H NMR (CDCl₃, 400 MHz) δ 8.80 (1H, s, NH),

8.61 (1H, d, J = 8.4 Hz, Ar), 7.90 (1H, d, J = 8.4 Hz, Ar), 7.77 (2H, d, J

= 10.0 Hz, Ar), 7.59 (1H, s, Ar), 7.40 (1H, d, J = 8.4 Hz, Ar),

7.26−7.19 (4H, m, Ar), 5.38 (1H, m, OCH), 3.95 (2H, d, J = 6.4 Hz,

OCH₂CH), 3.92 (3H, s, OCH₃), 3.52 (2H, dd, J = 6.4 Hz, 16.8 Hz,

CHCH₂), 3.30 (2H, dd, J = 6.4 Hz, 16.8 Hz, CHCH₂), 2.21 (1H, m,

CH₂CH(CH₃)₂), 1.10 (6H, d, J = 6.4 Hz, CH₂CH(CH₃)₂). ¹³C NMR

(CDCl₃, 100 MHz) δ 166.5, 162.9, 151.5, 147.0, 142.4, 139.6, 139.5,

131.3, 127.0, 126.0, 125.8, 124.6, 123.3, 118.6, 117.2, 115.0, 111.6,

80.2, 75.1, 52.2, 39.5, 28.2, 19.3. MS (ESI) m/z calcd for C₂₈H₂₈N₂O₇

(M⁺), 504.2; found, 505.1 (M + H⁺).

3-Isobutoxy-4-(3-isobutoxybenzamido)benzoic Acid (17). 3-

Isobutoxy-benzoic acid was converted to its corresponding acid

chloride according to general procedure B on a 0.26 mmol scale, then

coupled to 4-amino-3-isobutyoxybenzoic acid⁷³(8a) according to

general procedure F to deliver the title compound as a white solid (43

1

mg, 43%). H NMR (DMSO-d₆, 400 MHz) δ 12.97 (1H, s, CO₂H),

9.41 (1H, s, NH), 8.08 (1H, d, J = 8.0 Hz, Ar), 7.61 (1H, d, J = 8.0 Hz,

Ar), 7.55 (1H, s, Ar), 7.50−7.43 (3H, m, Ar), 7.18 (1H, d, J = 6.8 Hz,

Ar), 3.90 (2H, d, J = 6.4 Hz, OCH₂), 3.83 (2H, d, J = 6.4 Hz, OCH₂),

2.12−2.03 (2H, m, CH(CH₃)₂), 1.03−0.99 (12H, m, 2 × CH(CH₃)₂).

¹³C NMR (DMSO-d₆, 100 MHz) δ 167.3, 165.0, 159.2, 149.9, 136.1,

131.7, 130.3, 127.7, 122.5, 122.4, 119.9, 118.9, 113.1, 112.6, 74.8, 74.3,

28.2, 28.1, 19.4. MS (ESI) m/z calcd for C₂₂H₂₇NO₅(M⁺), 385.2;

found, 386.1 (M + H⁺).

Methyl 3-(Benzyloxy)-4-(3-((2,3-dihydro-1H-inden-2-yl)oxy)-

4-nitrobenzamido)benzoate (14ec). 3-((2,3-Dihydro-1H-inden-2-

yl)oxy-4-nitrobenzoic acid (6e) was converted to its corresponding

acid chloride according to general procedure B on a 0.14 mmol scale,

then coupled to methyl 4-amino-3-benzyloxy)-benzoic acid⁷³(9c)

according to general procedure F to deliver the title compound as a

1

pale-yellow solid (67 mg, 78%). H NMR (CDCl₃, 400 MHz) δ 8.77

(1H, s, NH), 8.61 (1H, d, J = 7.6 Hz, Ar), 7.78 (2H, d, J = 8.4 Hz, Ar),

7.72 (1H, s, Ar), 7.60 (1H, s, Ar), 7.42 (2H, d, J = 7.6 Hz, Ar), 7.34

(3H, m, Ar), 7.25 (1H, d, J = 7.6 Hz, Ar), 7.22 (3H, m, Ar), 5.19−5.17

(3H, m, OCH₂+ OCH), 3.91 (3H, s, OCH₃), 3.38 (2H, dd, J = 6.8

5-(5-Amino-6-isobutoxypicolinamido)-6-isobutoxypicolinic

Acid (18). 6-Isobutoxy-5-(6-isobutoxy-5-nitropicolinamido)picolinic

acid (16; 40 mg, 0.093 mmol) was reduced according to general

Hz, 17.2 Hz, CHCH₂), 3.21 (2H, dd, J = 2.4 Hz, 17 Hz, CHCH₂). ¹³

C

1

procedure C: pale-yellow solid (30 mg, 81%). H NMR (DMSO-d₆,

NMR (CDCl₃, 100 MHz) δ 166.7, 163.1, 151.6, 147.2, 142.6, 139.9,

139.4, 135.8, 131.9, 129.1, 128.2, 127.2, 126.2, 124.9, 124.1, 119.1,

118.0, 114.8, 112.6, 80.4, 71.8, 52.5, 39.8. MS (ESI) m/z calcd for

C₃₁H₂₆N₂O₇(M⁺), 538.2; found, 539.1 (M + H⁺).

400 MHz) δ 9.96 (1H, s, NH), 8.70 (1H, d, J = 7.6 Hz, Py), 7.64 (1H,

d, J = 7.6 Hz, Py), 7.58 (1H, d, J = 7.6 Hz, Py), 6.96 (1H, d, J = 7.6 Hz,

Py), 5.87 (2H, s, NH₂), 4.20 (2H, d, J = 6.4 Hz, OCH₂), 4.12 (2H, d, J

= 6.4 Hz, OCH₂), 2.11 (2H, m, 2 × CH(CH₃)₂), 1.03 (6H, d, J = 6.4

Hz, CH(CH₃)₂), 1.00 (6H, d, J = 6.4 Hz, CH(CH₃)₂). ¹³C NMR

(DMSO-d₆, 100 MHz) δ 166.8, 163.1, 152.0, 150.0, 137.7, 131.7,

124.8, 119.2, 118.8, 117.7, 72.7, 71.9, 28.1, 28.0, 19.6. MS (ESI) m/z

calcd for C₂₀H₂₆N₄O₅(M⁺), 402.2; found, 403.1 (M + H⁺).

Methyl 3-((2,3-Dihydro-1H-inden-2-yl)oxy)-4-(3-((2,3-dihy-

dro-1H-inden-2-yl)oxy)-4-nitrobenzamido)benzoate (14ee). 3-

((2,3-Dihydro-1H-inden-2-yl)oxy)-benzoic acid (6e) was converted to

its corresponding acid chloride according to general procedure B on a

0.14 mmol scale, then coupled to methyl 4-amino-3-((2,3-dihydro-1H-

inden-2-yl)oxy)-benzoic acid (9e) according to general procedure F to

4-(4-Amino-3-isobutoxybenzamido)-3-isobutoxybenzoic

Acid (19). 3-Isobutoxy-4-(3-isobutoxy-4-nitrobenzamido)benzoic acid

(4aa; 200 mg, 0.46 mmol) was reduced according to general

1

deliver the title compound as a pale-yellow solid (30 mg, 40%). H

1

NMR (CDCl₃, 400 MHz) δ 8.57 (1H, d, J = 8.4 Hz, Ar), 8.47 (1H, s,

NH), 7.78 (2H, d, J = 8.0 Hz, Ar), 7.62 (1H, s, Ar), 7.58 (1H, d, J =

8.0 Hz, Ar), 7.27 (2H, m, Ar), 7.20−7.16 (6H, m, Ar), 6.41 (1H, dd, J

procedure C: pale-yellow solid (184 mg, 100%). H NMR (DMSO-

d₆, 400 MHz) δ 8.93 (1H, s, NH), 8.18 (1H, d, J = 8.4 Hz, Ar), 7.55

(1H, d, J = 8.4 Hz, Ar), 7.50 (1H, s, Ar), 7.32 (1H, d, J = 8.4 Hz, Ar),

Q

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

7.26 (1H, s, Ar), 6.68 (1H, d, J = 7.6 Hz, Ar), 5.44 (2H, s, NH₂), 3.88

(2H, d, J = 6.4 Hz, OCH₂), 3.76 (2H, d, J = 6.4 Hz, OCH₂), 2.10 (2H,

m, 2 × CH(CH₃)₂), 1.00 (12H, m, 2 × CH(CH₃)₂). ¹³C NMR

(DMSO-d₆, 100 MHz) δ 167.6, 164.8, 148.5, 145.1, 142.5, 132.0,

122.6, 121.7, 121.2, 120.3, 112.7, 112.3, 110.2, 74.8, 74.4, 28.2, 19.6,

19.5. MS (ESI) m/z calcd for C₂₂H₂₈N₂O₅(M⁺), 400.2; found, 401.1

(M + H⁺).

that was collected by vacuum ﬁltration. The precipitate was washed on

the ﬁlter with 0.1 N HCl and dried under high vacuum to aﬀord the

title compound as a white solid (18 mg, 58%). H NMR (DMSO-d₆,

1

400 MHz) δ 12.89 (1H, s, CO₂H), 9.78 (1H, s, NH), 9.41 (1H, s,

NH), 8.26 (1H, d, J = 8.8 Hz, Ar), 8.04 (1H, d, J = 8.8 Hz, Ar), 7.59−

7.56 (3H, m, Ar), 7.52 (1H, s, Ar), 3.94 (2H, d, J = 6.4 Hz, OCH₂),

3.87 (2H, d, J = 6.0 Hz, OCH₂), 2.09 (2H, m, 2 × CH(CH₃)₂), 1.02

(6H, d, J = 6.0 Hz, CH(CH₃)₂), 0.99 (6H, d, J = 6.4 Hz, CH(CH₃)₂).

¹³C NMR (DMSO-d₆, 100 MHz) δ 167.3, 164.5, 161.8, 156.1, 150.0,

148.1, 131.8, 131.0, 129.7, 127.6, 122.5, 120.8, 119.2, 112.7, 111.1,

75.0, 74.9, 28.2, 28.1, 19.5, 19.3. MS (ESI) m/z calcd for C₂₄H₂₈N₂O₈

(M⁺), 472.2; found, 473.1 (M + H⁺).

4-(4-Amino-3-((2,3-dihydro-1H-inden-2-yl)oxy)benzamido)-

3-isobutoxybenzoic Acid (20). 4-(3-((2,3-Dihydro-1H-inden-2-

yl)oxy)-4-nitrobenzamido)-3-isobutoxybenzoic acid (4ea; 60 mg,

0.12 mmol) was reduced according to general procedure C: pale-

1

yellow solid (55 mg, 100%). H NMR (DMSO-d₆, 400 MHz) δ 8.97

(1H, s, NH), 8.17 (1H, d, J = 8.0 Hz, Ar), 7.56 (1H, d, J = 8.0 Hz, Ar),

7.51 (1H, s, Ar), 7.40 (1H, s, Ar), 7.33 (1H, d, J = 8.0 Hz, Ar), 7.23

(2H, m, Ar), 7.15 (2H, m, Ar), 6.67 (1H, d, J = 8.4 Hz, Ar), 5.38 (2H,

s, NH₂), 5.22 (1H, m, OCH), 3.87 (2H, d, J = 6.0 Hz, OCH₂), 3.40

(2H, dd, J = 6.0 Hz, 17.2 Hz, CHCH₂), 3.12 (2H, d, J = 16.4 Hz,

CHCH₂), 2.10 (1H, m, CH(CH₃)₂), 0.99 (6H, d, J = 7.2 Hz,

CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 164.9, 148.8, 143.6,

143.2, 141.0, 126.9, 125.0, 122.6, 121.8, 121.2, 120.7, 113.0, 112.4,

111.8, 79.6, 78.2, 74.8, 28.2, 19.4. MS (ESI) m/z calcd for C₂₇H₂₈N₂O₅

(M⁺), 460.2; found, 461.1 (M + H⁺).

4-(4-(2-Ethoxy-2-oxoacetamido)-3-isobutoxybenzamido)-3-

isobutoxybenzoic Acid (21). To an ice-cooled solution of 4-(4-

amino-3-isobutoxybenzamido)-3-isobutoxybenzoic acid (19; 60 mg,

0.15 mmol, 1 equiv) and pyridine (24 μL, 0.30 mmol, 2 equiv) in

CH₂Cl₂(7 mL) was added dropwise a solution of ethyl

chlorooxoacetate (18 μL, 0.16 mmol, 1.1 equiv) in CH₂Cl₂(1 mL).

The reaction mixture was allowed to warm to room temperature and

stirred overnight. The resulting precipitate was collected by vacuum

ﬁltration, and the product was washed with cold 1 M HCl and cold

EtOAc, then dried under high vacuum at 40 °C overnight to furnish

the title compound as a white solid (57 mg, 76%). ¹H NMR (DMSO-

d₆, 400 MHz) δ 12.94 (1H, bs, CO₂H), 9.73 (1H, s, NH), 9.43 (1H, s,

NH), 8.23 (1H, d, J = 8.0 Hz, Ar), 8.04 (1H, d, J = 8.0 Hz, Ar), 7.56

(3H, m, Ar), 7.52 (1H, s, Ar), 4.30 (2H, q, J = 6.8 Hz, OCH₂CH₃),

3.95 (2H, d, J = 5.2 Hz, OCH₂), 3.87 (2H, d, J = 5.6 Hz, OCH₂), 2.10

(2H, m, 2 × CH(CH₃)₂), 1.29 (3H, t, J = 6.8 Hz, OCH₂CH₃), 1.03

(6H, d, J = 6.4 Hz, CH(CH₃)₂), 0.99 (6H, d, J = 6.4 Hz, CH(CH₃)₂).

¹³C NMR (DMSO-d₆, 100 MHz) δ 167.3, 164.5, 160.3, 154.7, 150.0,

2-(3-Isobutoxy-4-(3-isobutoxy-4-nitrobenzamido)-

benzamido)acetic Acid (26). 24 (28 mg, 0.052 mmol) was

dissolved in 20% TFA/CH₂Cl₂(2 mL). After stirring at room

temperature for 3 h, TLC indicated the reaction was complete. All

solvents were removed in vacuo, and residual TFA was removed by

repeated azeotroping with CHCl₃. The residue was dried under high

vacuum to deliver the title compound as a sticky, white solid (25 mg,

100%). ¹H NMR (DMSO-d₆, 400 MHz) δ 12.58 (1H, s, CO₂H), 9.76

(1H, s, NH), 8.83 (1H, s, NH), 7.99 (1H, d, J = 8.0 Hz, Ar), 7.85 (1H,

d, J = 8.8 Hz, Ar), 7.76 (1H, s, Ar), 7.58 (1H, d, J = 8.8 Hz, Ar), 7.54

(1H, s, Ar), 7.51 (1H, d, J = 8.0 Hz, Ar), 4.00 (2H, d, J = 6.4 Hz,

OCH₂), 3.91 (2H, d, J = 5.6 Hz, NHCH₂), 3.85 (2H, d, J = 6.4 Hz,

OCH₂), 2.05 (2H, m, 2 × CH(CH₃)₂), 0.96 (12H, m, 2 ×

CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 171.8, 166.2,

163.9, 151.4, 151.1, 141.5, 139.8, 131.8, 129.7, 125.5, 124.1, 120.0,

119.9, 114.2, 111.5, 75.6, 74.9, 41.6, 28.2, 28.0, 19.5, 19.1. MS (ESI)

m/z calcd for C₂₄H₂₉N₃O₈(M⁺), 487.2; found, 488.1 (M + H⁺).

2,2′-((3-Isobutoxy-4-(3-isobutoxy-4-nitrobenzamido)-

benzoyl)azanediyl)diacetic Acid (27). 25 (36 mg, 0.055 mmol)

was dissolved in 20% TFA/CH₂Cl₂(2 mL). After stirring at room

temperature for 3 h, TLC indicated the reaction was complete. All

solvents were removed in vacuo, and residual TFA was removed by

repeated azeotroping with CHCl₃. The residue was dried under high

vacuum to deliver the title compound as a sticky, white solid (30 mg,

100%). ¹H NMR (DMSO-d₆, 400 MHz) δ 12.95 (2H, bs, 2 × CO₂H),

9.75 (1H, s, NH), 7.99 (1H, d, J = 8.0 Hz, Ar), 7.75 (2H, m, Ar), 7.57

(1H, d, J = 8.0 Hz, Ar), 6.93 (2H, m, Ar), 3.99 (4H, m, 2 ×

NCH₂CO), 3.85 (2H, d, J = 6.4 Hz, OCH₂), 3.76 (2H, d, J = 6.4 Hz,

OCH₂), 2.01 (2H, m, 2 × CH(CH₃)₂), 0.94 (12H, m, 2 ×

CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 171.4, 171.0,

170.6, 168.3, 163.9, 151.4, 141.5, 139.8, 133.3, 128.3, 125.5, 125.0,

119.9, 118.9, 114.2, 110.8, 75.6, 74.8, 66.7, 52.0, 48.3, 46.9, 28.1, 28.0,

19.4, 19.1. MS (ESI) m/z calcd for C₂₆H₃₁N₃O₁₀(M⁺), 545.2; found,

546.1 (M + H⁺).

148.2, 144.2, 131.7, 131.3, 129.4, 127.6, 126.8, 122.5, 120.8, 119.5,

112.7, 111.1, 75.0, 74.9, 63.3, 28.2, 19.5, 19.3, 14.2. MS (ESI) m/z

calcd for C₂₆H₃₂N₂O₈(M⁺), 500.2; found, 501.1 (M + H⁺). Anal.

Calcd for C₂₉H₂₆N₂O₇: C, 62.39; H, 6.44; N, 5.60. Found: C, 62.45;

H, 6.25; N, 5.54.

4-(4-(2-(Carboxymethoxy)acetamido)-3-isobutoxybenzami-

do)-3-isobutoxybenzoic Acid (22). To an ice-cooled solution of 4-

(4-amino-3-isobutoxybenzamido)-3-isobutoxybenzoic acid (19; 60 mg,

0.15 mmol, 1 equiv) and Et₃N (42 μL, 0.30 mmol, 2 equiv) in

anhydrous THF (7 mL) was added diglycolic anhydride (21 mg, 0.18

mmol, 1.2 equiv). The reaction mixture was heated at 50 °C overnight.

The resulting white precipitate was collected by vacuum ﬁltration,

washing with cold 1 M HCl and cold EtOAc, then dried under high

vacuum at 40 °C overnight to deliver the title compound (22 mg,

28%). ¹H NMR (DMSO-d₆, 400 MHz) δ 12.92 (2H, bs, 2 × CO₂H),

9.38 (1H, s, NH), 9.35 (1H, s, NH), 8.34 (1H, d, J = 8.0 Hz, Ar), 8.06

(1H, d, J = 8.0 Hz, Ar), 7.57−7.51 (4H, m, Ar), 4.18 (4H, s, 2 ×

OCH₂CO), 3.90 (4H, m, 2 × OCH₂), 2.08 (2H, m, 2 × CH(CH₃)₂),

0.99 (12H, d, J = 6.4 Hz, 2 × CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100

MHz) δ 171.5, 168.0, 167.3, 164.5, 149.8, 147.6, 131.8, 130.5, 129.9,

127.5, 122.5, 122.2, 120.7, 118.6, 112.6, 110.8, 75.0, 74.9, 70.7, 68.3,

28.2, 28.1, 19.5, 19.3. MS (ESI) m/z calcd for C₂₆H₃₂N₂O₉(M⁺),

516.2; found, 517.1 (M + H⁺).

2-Isobutoxy-4-(3-isobutoxy-4-nitrobenzamido)benzoic Acid

(32). 3-Isobutoxy-4-nitrobenzoic acid⁷³(6a) was converted to its

corresponding acid chloride according to general procedure B on a

0.42 mmol scale, then coupled to 4-amino-2-isobutyoxybenzoic acid

(31) according to general procedure F to deliver the title compound as

1

an oﬀ-white solid (120 mg, 66%). H NMR (DMSO-d₆, 400 MHz) δ

12.31 (1H, s, CO₂H), 10.55 (1H, s, NH), 8.00 (1H, d, J = 8.8 Hz, Ar),

7.75 (1H, s, Ar), 7.69 (1H, d, J = 8.8 Hz, Ar), 7.62 (2H, m, Ar), 7.38

(1H, d, J = 8.0 Hz, Ar), 4.02 (2H, d, J = 6.0 Hz, OCH₂), 3.76 (2H, d, J

= 6.4 Hz, OCH₂), 2.03 (2H, m, 2 × CH(CH₃)₂), 0.97 (12H, m, 2 ×

CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 167.0, 164.6, 159.0,

151.4, 143.6, 141.6, 140.0, 132.4, 125.3, 120.0, 116.6, 114.7, 111.8,

105.1, 75.7, 74.8, 28.2, 28.1, 19.4, 19.1. MS (ESI) m/z calcd for

C₂₂H₂₆N₂O₇(M⁺), 430.2; found, 431.1 (M + H⁺).

2-Isobutoxy-4-(2-isobutoxy-4-nitrobenzamido)benzoic Acid

(33). Compound 30 was converted to its corresponding acid chloride

according to general procedure B on a 0.42 mmol scale, then coupled

to 4-amino-2-isobutyoxybenzoic acid (31) according to general

procedure F to deliver the title compound as an oﬀ-white solid (102

4-(4-(Carboxyformamido)-3-isobutoxybenzamido)-3-isobu-

toxybenzoic Acid (23). 4-(4-(2-Ethoxy-2-oxoacetamido)-3-isobutox-

ybenzamido)-3-isobutoxybenzoic acid (21; 33 mg, 0.066 mmol, 1

equiv) was dissolved in a 3:1:1 mixture of THF/MeOH/H₂O. LiOH·

H₂O (7 mg, 0.17 mmol, 2.5 equiv) was added to the reaction mixture,

which was stirred at room temperature for 24 h. The reaction was

acidiﬁed to pH 1−2 with 1 N HCl, which generated a white precipitate

1

mg, 57%). H NMR (DMSO-d₆, 400 MHz) δ 12.28 (1H, s, CO₂H),

10.51 (1H, s, NH), 7.87 (2H, m, Ar), 7.75 (1H, d, J = 8.0 Hz, Ar), 7.67

(1H, d, J = 8.8 Hz, Ar), 7.51 (1H, s, Ar), 7.25 (1H, d, J = 8.0 Hz, Ar),

3.97 (2H, d, J = 6.0 Hz, OCH₂), 3.73 (2H, d, J = 6.4 Hz, OCH₂), 2.01

(2H, m, 2 × CH(CH₃)₂), 0.97 (6H, d, J = 6.4 Hz, CH(CH₃)₂), 0.92

R

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

(6H, d, J = 6.0 Hz, CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ

167.0, 164.2, 159.1, 156.6, 149.8, 143.5, 132.6, 132.3, 130.5, 116.3,

115.8, 110.9, 107.9, 104.2, 75.4, 74.7, 28.1, 28.0, 19.3, 19.2. MS (ESI)

m/z calcd for C₂₂H₂₆N₂O₇(M⁺), 430.2; found, 431.1 (M + H⁺).

3-Isobutoxy-4-(2-isobutoxy-4-nitrobenzamido)benzoic Acid

(34). Compound 30 was converted to its corresponding acid chloride

according to general procedure B on a 0.42 mmol scale, then coupled

to 4-amino-3-isobutyoxybenzoic acid⁷³(8a) according to general

procedure F to deliver the title compound as an oﬀ-white solid (106

with a buﬀer (50 mM Tris pH 7.5, 150 mM NaCl, 0.01% sodium

azide) to a ﬁnal concentration of 0.153 mM with 10% D₂O. NMR

samples of ¹⁵N labeled c-Myc−Max(S) were prepared by combining

equal molar amounts of the proteins to a ﬁnal concentration of 0.153

mM with 10% D₂O. Titration using compound 4da was conducted

with addition of small volumes of a stock solution of 4da in DMSO,

reaching a maximum end point DMSO concentration of 8%.

NMR Spectroscopy. NMR Experiments were performed on a

Bruker Avance 600 MHz spectrometer. A standard ¹H/¹⁵N fast HSQC

pulse sequence was used for experiments with the Max/c-Myc proteins

1

mg, 59%). H NMR (DMSO-d₆, 400 MHz) δ 12.83 (1H, bs, CO₂H),

1

10.00 (1H, s, NH), 8.40 (1H, d, J = 8.0 Hz, Ar), 8.09 (1H, d, J = 8.8

Hz, Ar), 7.96 (1H, s, Ar), 7.92 (1H, d, J = 8.0 Hz, Ar), 7.59 (1H, d, J =

8.8 Hz, Ar), 7.54 (1H, s, Ar), 4.14 (2H, d, J = 6.8 Hz, OCH₂), 3.91

(2H, d, J = 6.4 Hz, OCH₂), 2.07 (2H, m, 2 × CH(CH₃)₂), 0.92 (12H,

m, 2 × CH(CH₃)₂). ¹³C NMR (DMSO-d₆, 100 MHz) δ 167.2, 162.4,

156.9, 150.5, 148.2, 132.6, 131.6, 128.9, 127.1, 122.8, 120.5, 116.2,

112.8, 109.1, 76.4, 75.3, 27.9, 27.7, 19.3, 19.1. MS (ESI) m/z calcd for

C₂₂H₂₆N₂O₇(M⁺), 430.2; found, 431.1 (M + H⁺).

at 298 K. The chemical shifts were referenced to the H₂O signal at

4.87 ppm. The NMR data were processed using NMRPipe.⁷⁵Peak

heights were measured using a modiﬁed version of Sparky.⁷⁶

Calculation of Dissociation Constants (K_d). The dissociation

constants, K_d, for the binding of 4da to the c-Myc−Max(S) complex,

were determined by ﬁtting the change in intensity of the bound and

unbound amide crosspeaks to a simple bimolecular association

model.⁷⁷

Recombinant Proteins and EMSAs. The human c-Myc bHLH-

ZIP domain (residues 353−437) and full-length human Max(L) (160

residues) and Max(S) (151 residues) were used for all studies

requiring puriﬁed proteins. Max(L) and Max(S) arise by alternate

splicing and diﬀer only by virtue of a nine amino acid deletion near the

N-terminus of the latter that prevents it from binding DNA as a

homodimer while still being able to associate with c-Myc and bind

DNA as a heterodimer.^57,58Recombinant c-Myc bHLH-ZIP, Max(L)

and Max(S) were expressed in the Escherichia coli strain BL21DE3-

(plysS)^37,43,44as N-terminal His₆-tagged proteins in the pET151-D-

C = C₀+ (C_T− C₀)

⎡

⎢

⎣

⎤

⎥

K_d+ M_T+ P_T− (K_d+ M_T+ P_T)²− 4P_TM_T

⎢

X

⎥

⎦

2P_T

(1)

In this expression C₀and C_Tare the intensities at the initial and ﬁnal

points of the titration. P_Tis the total concentration of the c-Myc−

Max(S) complex, and M_Tis the total concentration of 4da at each

particular point in the titration. Fitting of the binding data was carried

out using Matlab (MathWorks, USA).

TOPO vector. Bacteria were grown at 37 °C in L-Broth to an A₆₀₀

≈

0.8 and then for an additional 16−18 h in the presence of 1 mM

isopropyl-^L-thio-B-D-galactopyranoside to induce expression of the

recombinant proteins. Cultures were harvested, pelleted by

centrifugation at 5000g for 10 min, washed in ice-cold PBS, and

lysed in a buﬀer containing 8 M urea, 100 mM NaH₂PO₄and 10 mM

Tris-HCl, pH 8.0. Clariﬁed lysates were then applied to Ni-NTA-

agarose aﬃnity chromatography columns (Qiagen, Inc. Chatsworth,

CA), which were washed exhaustively in lysis buﬀer and then

developed with a pH gradient according to the directions of the

supplier. Fractions containing the highest concentrations of protein

were then pooled, dialyzed against 150 mM NaCl, Tris-HCl, pH 6.7,

and cleaved with TEV protease at 25 °C as previously

described.^11,43,73,74For larger amounts of protein, the TEV

protease:His₆-tagged protein molar ratios were increased to 1:50 and

digestions were allowed to proceed for up to 72 h. The cleaved

residues containing the His₆tag were then removed by an additional

round of Ni-NTA-agarose chromatography. Proteins were dialyzed

against storage buﬀer comprised of TrisHCl 50 mM, pH 6.3, NaCl 150

mM, and 30% glycerol and were then stored in small aliquots at −80

°C. SDS-PAGE and Coomassie Blue staining of all puriﬁed proteins

was performed to verify that purity exceeded 95% is all cases.

Surface Plasmon Resonance (SPR). Recombinant, N-terminal

His₆-tagged c-Myc and Max(S) and Max(L) proteins were expressed

in the pET151/D-Topo bacterial expression vectors and puriﬁed to

>90% homogeneity using nickel-agarose gel chromatography as

previously described.^37,43,46,47In the case of c-Myc, only an 85 residue

bHLH-ZIP domain was expressed, whereas, in the case of Max(S) and

Max(L), the full-length proteins were expressed. His₆tags were cleaved

with TEV protease and removed with an additional nickel-agarose

chromatographic step. The proteins were then dialyzed against PBS

(pH 6.5) concentrated by Centriprep Ultracel YM-3 ﬁltration

(Millipore, Carrigtwohill, Co. Cork, Ireland) and stored at −80C in

small aliquots. Preliminary studies with these proteins showed them to

be capable of functioning in EMSA experiments as both c-Myc−

Max(S) heterodimers and Max(L) homodimers (not shown).

SPR was performed with a Biacore model 3000 instrument (Biacor,

Uppsala, Sweden) employing a streptavadin-coated SA biosensor chip

(BR-1000−32) (GE Healthcare Bio-Sciences AB, Pittsburgh, PA). The

following biotinylated E-box-containing oligonucleotide (5′-biotin-

[TGAAGCAGACCACGTGGTCGTCTTCA] was annealed with its

unlabeled opposite strand oligonucleotide, diluted in HBS-EP running

buﬀer (0.5 M NaCl, 10 mMM HEPES, pH 7.4, 3 mM EDTA, and

0.005% v/v Surfactant P20) and immobilized on the ﬂow cell to allow

the attachment of ∼700 RU. A second ﬂow cell without any bound

DNA was used as a blank. DNA binding experiments were carried out

with running buﬀer (0.15 M NaCl, 10 mM HEPES, pH 7.4, 3 mM

EDTA, 0.005% v/v Surfactant P20, and 5% DMSO) at a ﬂow rate of

60 μL min⁻¹.

Binding of preformed c-Myc−Max(S) or Max(L)−Max(L) dimers

was achieved by ﬁrst allowing dimerization to occur at a concentration

of 20 nM of each protein HBS-EP buﬀer for 30 min. Dimers were then

introduced onto the oligonucleotide-containing chip at a ﬂow rate of

60 μL min⁻¹. In each case, the amount of c-Myc−Max(S) heterodimer

or Max(L) homodimer binding was found to be linearly proportional

to concentration and reached equilibrium at the highest concentration,

indicating that binding was both speciﬁc and saturable. In all cases,

protein concentrations were chosen so as to provide an additional 250

relative response units upon binding to the sensor chip. Under similar

conditions, no binding to the immobilized oligonucleotide was seen

when c-Myc monomer alone was tested (not shown)).

EMSA assays were performed as previously described^{36,37,43−47}

using 30 nM of each of the above-described puriﬁed proteins and 30

nM of a 6-carboxy-2′,4,4′,5′,7,7′-hexachloro-ﬂuorescein (HEX)-tagged

double-stranded oligonucleotide containing a c-Myc binding site (IDT,

Coralville, IA). Binding reactions contained 1 × PBS (pH 7.3), 1

mmol/L EDTA, 0.1% NP40, 5% glycerol, 1 mmol/L DTT, and 400

μg/mL bovine serum albumin. Protein dimerization was allowed to

proceed at room temperature for 90 min prior to the addition of the

oligonucleotide for an additional 15 min. The entire reaction was

subjected to electrophoresis in an 8% polyacrylamide/bis-acrylamide

(80:1) gel in 0.5× Tris-borate EDTA at 20 °C.

NMR Samples. For NMR studies, which utilized ¹⁵N-labeled

proteins, proteins were propagated and puriﬁed as described above

except that the growth medium contained 1 g/L ¹⁵NH₄Cl. Uniformly

¹⁵N labeled Max(S) and c-Myc (353−437) were dialyzed at 4 °C

against an identical buﬀer comprised of 50 mM Tris, pH 7.5, 150 mM

NaCl, and 0.01% sodium azide. The dilute samples of Max(S) and c-

Myc were concentrated to 0.43 and 0.23 mM, respectively, by stirred

cell concentration (Millipore MWCO 3000). An NMR sample of

Max(S) was formed by combining the ¹⁵N labeled Max(S) protein

S

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Small molecule interaction studies were performed either by

preincubating the molecules at the indicated concentrations for 30

min with c-Myc (20 nM) followed by the addition of Max(S) at the

above-noted concentrations. In other experiments, designed to

determine whether compounds could perturb the binding of

preformed c-Myc−Max heterodimers, c-Myc and Max(S) proteins

were ﬁrst allowed to heterodimerize at the above concentrations

followed by the addition of compounds to the ﬁnal stated

concentrations for 30 min. The mixture was then passed over the

oligonucleotide-bound chip at a rate of 60 μL min⁻¹while maintaining

a constant concentration of compound.

Binding constants and graphing were performed with BIAevaluation

4.1.1 software (University of Reading, UK), all response units were

normalized to 0−100 RU. More detailed descriptions of these

procedures will be published elsewhere (Wang et al., in preparation).

Cell Viability Assays. These were performed as previously

described.^{36,37,45,46,60}Brieﬂy, cells at >90% viability were seeded into

96-well plates (2 × 10³cells/well) in fresh growth medium containing

10-point serial dilutions of the compounds of interest. Incubations

were allowed to proceed for 3 days, at which time cell viability was

assed using the MTT assay as previously described.^36,45,46Each point

was assessed in at least triplicate determinations.

Cell Cycle Analyses. Cell cycle analyses were performed as

previously described.³⁶Brieﬂy, after treating with the indicated c-Myc

inhibitors, cells were washed twice in cold PBS and resuspended in 1

mL of 10 mM NaCl, 10 mM Tris-HCl, (pH 8.0), 0.1% NP40, 10 μg/

mL RNase A, and 15 μg/mL propidium iodide (Sigma-Aldrich, Inc. St.

Louis, MO). Stained nuclei were analyzed on a Becton Dickinson

FACStar ﬂuorescence-activated cell sorter, and cell cycle quantiﬁcation

was performed using ModFit LT 3.0 software (Verity Software House,

Topsham ME).

Neutral Lipid Quantiﬁcation. H460 large cell lung cancer cells

were incubated at subconﬂuent densities in 6-well plates with the

indicated concentrations of c-Myc inhibitors for 48 h. The cells were

then washed twice in PBS, trypsinized, and again washed twice in PBS

before being resuspended in 0.1 mL of PBS. Then 0.9 mL of PBS

containing 50 μg/mL of BODIPY (4,4-diﬂuoro-3a,4adiaza-s-indacene)

459/503 (Life Technologies, Carlsbad, CA), which is speciﬁc for

neutral lipid, was added and the resuspended cells were incubated for

30 min at ambient temperature. Cells were then washed three

additional times in PBS before being resuspended in 0.5 mL of PBS

and analyzed by ﬂow cytometry. Fluorescence quantiﬁcation was

performed using Cell Quest Pro software (BD Biosciences, Franklin

Lakes, NJ) and mean ﬂuorescence of each sample was determined.

Luciferase Assays. The luciferase expression vector pGL4.28-

[luc2CP/minP/Hygro] (Promega, Inc. Madison, WI) contains a

minimal mammalian promoter (minP) and a luciferase2CP expression

cassette that imparts additional protein instability by fusing hCL1 and

PEST sequences. A large number of additional mutations were also

introduced throughout the vector to minimize the nonspeciﬁc binding

of mammalian transcription factors and otherwise reduce background

expression. Into a unique XhoI site of the polylinker adjacent to the

minP sequence we ligated one of three individual oligonucleotides

containing tandemly triplicated c-Myc binding sites (5′-TCGAGC-

CACGTGGCCACGTGGCCACGTGGC-3′) (Wt-c-Myc), mutant

Myc binding sites (5′-TCGAGCCTCGAGGCCTCGAGGCCTC-

GAGGC-3′), Mut-c-Myc), and NF-κB binding sites (5′-TCGAGG-

GACTTTCCATGGGACTTTCCATGGGACTTTCC-3′) (NF-κB),

where underlined bases indicate the relevant transcription factor

binding sites. The identities of all constructs were determined by

automated Sanger DNA sequencing. Each vector was then combined

with a 5-fold excess of the vector pFR400, which encodes a mutant

mammalian dihydrofolate reductase with a lower K_mfor the cytotoxic

drug methotrexate⁷⁸and stably transfected into HeLa cells using

Superfect (Qiagen, Valencia, CA). Following selection in hygromycin,

stably transfected clones were pooled and subjected to at least two

rounds of selection in 4-fold stepwise increasing concentrations of

methotrexate (Sigma-Aldrich, St Louis, MO) as previously described

to allow for ampliﬁcation of the adjacent vector sequences.⁷⁷Cells

were cultured continuously in methotrexate until the day of plating for

luciferase assays so as to ensure maintenance of the ampliﬁed plasmid

sequences.

To perform luciferase assays, 10⁶cells were seeded into 6-well

plates. The following day, the medium was removed and fresh medium

containing the indicated concentration of c-Myc inhibitor was added

for 6 h. Cells were then trypsinized, washed twice in PBS, and pelleted

by low-speed centrifugation. An aliquot of each sample was used for

protein determinations against which subsequent luciferase determi-

nations were normalized. The remaining cell pellets were lysed and

assayed in triplicate in 96-well plates using a ONE-Glo Luciferase

Assay luciferase assay kit according to the directions of the supplier

(Promega). Readings were obtained on a Wallac 1420 VICTOR2

(PerkinElmer Life and Analytical Sciences). Under these conditions,

background luciferase activity in cells expressing the Mut-c-Myc vector

was indistinguishable from that of untransefected cells, whereas the

expression of luciferase in control lysates of cells transfected with the

Wt-c-Myc and NF-kB vectors was typically 50−100-fold higher.

Background values were subtracted from all experimental determi-

nations. All results obtained from cells exposed to c-Myc inhibitors

were plotted as mean values 1 standard error and expressed relative

to those of untreated cells, which were arbitrarily set at 100%.

Co-immunoprecipitation (co-IP) Studies. Co-IP assays were

performed as previously described.⁴⁶Brieﬂy, approximately 5 × 10⁶

HL60 cells were exposed for 6 h to the stated concentration of c-Myc

inhibitor or to the DMSO vehicle only, which served as a negative

control. Cells were collected by centrifugation at 500g for 10 min,

washed twice in ice-cold PBS, and lysed in IP buﬀer.^46,58An aliquot of

each cleared lysate was saved prior to co-IP to allow a comparison of

input c-Myc protein levels. Then 300 μg of the cleared lysate in 1 mL

of IP buﬀer was precipitated at 4 °C overnight with a 1:200 dilution of

anti-Max antibody⁵⁸followed by precipitation with protein G-

Sepharose using conditions suggested by the supplier (Santa Cruz

Biotechnology, Inc. Santa Cruz, CA). The precipitate was then washed

three times in IP buﬀer and subjected to 10% SDS-PAGE and

immunoblotting with a 1:1000 dilution of anti-Myc monoclonal

antibody (9E10, Santa Cruz Biotechnology, Santa Cruz, CA). Blots

were developed using an enhanced chemiluminescence kit following

the directions recommended by the supplier (Pierce ECL Plus,

Thermo-Fisher, Pittsburgh, PA).

ASSOCIATED CONTENT

* Supporting Information

■

S

Synthesis of intermediates 6, 8, 9, 11, 13, 24, 25, 29−31,

EMSA dose−response plots for 4aa, 4ca, 4da, 15, 16, and 21,

and cell cycle analysis data for 4da and 10058-F4. This material

is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION

Corresponding Author

*Phone: 1-410-706-6361. Fax: 1-410-706-5017. E-mail:

s ﬂ etcher@rx.umaryland.edu.

■

Notes

The authors declare no competing ﬁnancial interest.

ACKNOWLEDGMENTS

■

Financial support of this work was provided by an American

Cancer Society Institutional Research Grant (S.F.), the

University of Maryland School of Pharmacy (S.F.), an

American Chemical Society Pre-Doctoral Medicinal Chemistry

Fellowship and American Foundation for Pharmaceutical

Education Fellowship (both to J.L.Y), and the National

Institutes of Health (R01CA140624 to E.V.P.).

ABBREVIATIONS USED

BET, bromodomain and extraterminal domain; bHLH-ZIP,

basic helix−loop−helix leucine zipper; EMSA, electrophoretic

■

T

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

(22) Filippakopoulos, P.; Qi, J.; Picaud, S.; Shen, Y.; Smith, W. B.;

Fedorov, O.; Morse, E. M.; Keates, T.; Hickman, T. T.; Felletar, I.;

Philpott, M.; Munro, S.; McKeown, M. R.; Wang, Y.; Christie, A. L.;

West, N.; Cameron, M. J.; Schwartz, B.; Heightman, T. D.; La

Thangue, N.; French, C. A.; Wiest, O.; Kung, A. L.; Knapp, S.;

Bradner, J. E. Selective inhibition of BET bromodomains. Nature

2010, 468, 1067−1073.

(23) Muller, S.; Filippakopoulos, P.; Knapp, S. Bromodomains as

therapeutic targets. Expert Rev. Mol. Med. 2011, 13, e29.

(24) Prinjha, R. K.; Witherington, J.; Lee, K. Place your BETs: the

therapeutic potential of bromodomains. Trends Pharmacol. Sci. 2012,

33, 146−153.

mobility shift assay; HSQC, heteronuclear single quantum

coherence; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenylte-

trazolium bromide; PPI, protein−protein interaction; SPR,

surface plasmon resonance; TCA, tricarboxylic acid cycle

REFERENCES

■

(1) Dang, C. V. c-Myc target genes involved in cell growth, apoptosis,

and metabolism. Mol. Cell. Biol. 1999, 19, 1−11.

(2) Nesbit, C. E.; Tersak, J. M.; Prochownik, E. V. MYC oncogenes

and human neoplastic disease. Oncogene 1999, 18, 3004−3016.

(3) Coller, H. A.; Grandori, C.; Tamayo, P.; Colbert, T.; Lander, E.

S.; Eisenman, R. N.; Golub, T. R. Expression analysis with

oligonucleotide microarrays reveals that MYC regulates genes involved

in growth, cell cycle, signaling, and adhesion. Proc. Natl. Acad. Sci. U. S.

A. 2000, 97, 3260−3265.

(4) Trumpp, A.; Refaeli, Y.; Oskarsson, T.; Gasser, S.; Murphy, M.;

Martin, G. R.; Bishop, J. M. c-Myc regulates mammalian body size by

controlling cell number but not cell size. Nature 2001, 414, 768−773.

(5) Eisenman, R. N. Deconstructing myc. Genes Dev. 2001, 15,

2023−2030.

(6) Boxer, L. M.; Dang, C. V. Translocations involving c-myc and c-

myc function. Oncogene 2001, 20, 5595−5610.

(7) Pelengaris, S.; Khan, M.; Evan, G. c-MYC: more than just a

matter of life and death. Nature Rev. Cancer 2002, 2, 764−776.

(8) Pelengaris, S.; Khan, M. The many faces of c-MYC. Arch.

Biochem. Biophys. 2003, 416, 129−136.

(9) Adhikary, S.; Eilers, M. Transcriptional regulation and trans-

formation by Myc proteins. Nature Rev. Mol. Cell Biol. 2005, 6, 635−

645.

(25) Hewings, D. S.; Rooney, T. P.; Jennings, L. E.; Hay, D. A.;

Schofield, C. J.; Brennan, P. E.; Knapp, S.; Conway, S. J. Progress in

the development and application of small molecule inhibitors of

bromodomain-acetyl-lysine interactions. J. Med. Chem. 2012, 55,

9393−9413.

(26) Sanchez, R.; Meslamani, J.; Zhou, M. M. The bromodomain:

from epigenome reader to druggable target. Biochim. Biophys. Acta

2014, 1839, 676−685.

(27) Zirath, H.; Frenzel, A.; Oliynyk, G.; Segerstrom, L.; Westermark,

̈

U. K.; Larsson, K.; Munksgaard Persson, M.; Hultenby, K.; Lehtio, J.;

̈

Einvik, C.; Pahlman, S.; Kogner, P.; Jakobsson, P. J.; Henriksson, M. A.

̊

MYC inhibition induces metabolic changes leading to accumulation of

lipid droplets in tumor cells. Proc. Natl. Acad. Sci. U. S. A. 2013, 110,

10258−10263.

(28) Soucek, L.; Nasi, S.; Evan, G. I. Omomyc expression in skin

prevents Myc-induced papillomatosis. Cell Death. Differ. 2004, 11,

1038−1045.

(29) Annibali, D.; Whitfield, J. R.; Favuzzi, E.; Jauset, T.; Serrano, E.;

Cuartas, I.; Redondo-Campos, S.; Folch, G.; Gonzal

̀ ̀

ez-Junca, A.; Sodir,

(10) Meyer, N.; Penn, L. Z. Reflecting on 25 years with MYC. Nature

Rev. Cancer 2008, 8, 976−990.

N. M.; Masso-Valles, D.; Beaulieu, M. E.; Swigart, L. B.; McGee, M.

́

M.; Somma, M. P.; Nasi, S.; Seoane, J.; Evan, G. I.; Soucek, L. Myc

inhibition is effective against glioma and reveals a role for Myc in

proficient mitosis. Nature Commun. 2014, 5, 4632.

(11) Nair, S. K.; Burley, S. K. X-ray structures of Myc−Max and

Mad−Max recognizing DNA. Molecular bases of regulation by proto-

oncogenic transcription factors. Cell 2003, 112, 193−205.

(12) Amati, B.; Brooks, M. W.; Levy, N.; Littlewood, T. D.; Evan, G.

I.; Land, H. Oncogenic activity of the c-Myc protein requires

dimerization with Max. Cell 1993, 72, 233−245.

(30) Soucek, L.; Evan, G. I. The ups and downs of Myc biology. Curr.

Opin. Genet. Dev. 2010, 20, 91−95.

(31) Delmore, J. E.; Issa, G. C.; Lemieux, M. E.; Rahl, P. B.; Shi, J.;

Jacobs, H. M.; Kastritis, E.; Gilpatrick, T.; Paranal, R. M.; Qi, J.; Chesi,

M.; Schinzel, A. C.; McKeown, M. R.; Heffernan, T. P.; Vakoc, C. R.;

Bergsagel, P. L.; Ghobrial, I. M.; Richardson, P. G.; Young, R. A.;

Hahn, W. C.; Anderson, K. C.; Kung, A. L.; Bradner, J. E.; Mitsiades,

C. S. BET bromodomain inhibition as a therapeutic strategy to target

c-Myc. Cell 2011, 146, 904−917.

(13) Berns, E. M.; Klijn, J. G.; van Putten, W. L.; van Staveren, I. L.;

Portengen, H.; Foekens, J. A. c-Myc amplification is a better

prognostic factor than HER2/neu amplification in primary breast

cancer. Cancer Res. 1992, 52, 1107−1113.

(14) Buchholz, M.; Schatz, A.; Wagner, M.; Michl, P.; Linhart, T.;

Adler, G.; Gress, T. M.; Ellenrieder, V. Overexpression of c-Myc in

pancreatic cancer caused by ectopic activation of NFATc1 and the

Ca2+/calcineurin signaling pathway. EMBO J. 2006, 25, 3714−3724.

(15) Mitani, S.; Kamata, H.; Fujiwara, M.; Aoki, N.; Tango, T.;

Fukuchi, K.; Oka, T. Analysis of c-Myc DNA amplification in non-

small cell lung carcinoma in comparison with small cell lung carcinoma

using polymerase chain reaction. Clin. Exp. Med. 2001, 1, 105−111.

(16) Erisman, M. D.; Rothberg, P. G.; Diehl, R. E.; Morse, C. C.;

Spandorfer, J. M.; Astrin, S. M. Mol. Cell. Biol. 1985, 5, 1969−1976.

(17) Delgado, M. D.; Leon, J. Myc roles in hematopoiesis and

leukemia. Genes Cancer 2010, 1, 605−616.

(32) Soucek, L.; Whitfield, J. R.; Sodir, N. M.; Masso-Valles, D.;

Serrano, E.; Karnezis, A. N.; Swigart, L. B.; Evan, G. I. Inhibition of

Myc family proteins eradicates KRas-driven lung cancer in mice. Genes

Dev. 2013, 27, 504−513.

(33) Fletcher, S.; Prochownik, E. V. Small-molecule inhibitors of the

Myc oncoprotein. Biochim. Biophys. Acta 2014, DOI: 10.1016/

j.bbagrm.2104.03.005.

(34) Yap, J. L.; Chauhan, J.; Jung, K.-Y.; Chen, L.; Prochownik, E. V.;

Fletcher, S. Small-molecule inhibitors of dimeric transcription factors:

Antagonism of protein−protein and protein−DNA interactions.

MedChemComm 2012, 3, 541−551.

(35) Prochownik, E. V.; Vogt, P. K. Therapeutic Targeting of Myc.

Genes Cancer 2010, 1, 650−659.

(36) Yin, X.; Giap, C.; Lazo, J. S.; Prochownik, E. V. Low molecular

weight inhibitors of Myc−Max interaction and function. Oncogene

2003, 22, 6151−6159.

(18) Dalla-Favera, R.; Bregni, M.; Erikson, J.; Patterson, D.; Gallo, R.

C.; Croce, C. M. Human c-Myc onc gene is located on the region of

chromosome 8 that is translocated in Burkitt lymphoma cells. Proc.

Natl. Acad. Sci. U. S. A. 1982, 79, 7824−7827.

(19) von Eyss, B.; Eilers, M. Addicted to Mycbut why? Genes Dev.

2011, 25, 895−897.

(20) Wang, H.; Mannava, S.; Grachtchouk, V.; Zhuang, D.; Soengas,

M. S.; Gudkov, A. V.; Prochownik, E. V.; Nikiforov, M. A. c-Myc

depletion inhibits proliferation of human tumor cells at various stages

of the cell cycle. Oncogene 2008, 27, 1905−1915.

(21) Soucek, L.; Whitfield, J.; Martins, C. P.; Finch, A. J.; Murphy, D.

J.; Sodir, N. M.; Karnezis, A. N.; Swigart, L. B.; Nasi, S.; Evan, G. I.

Modelling Myc inhibition as a cancer therapy. Nature 2008, 455, 679−

683.

(37) Wang, H.; Hammoudeh, D. I.; Follis, A. V.; Reese, B. E.; Lazo, J.

S.; Metallo, S. J.; Prochownik, E. V. Improved low molecular weight

Myc−Max inhibitors. Mol. Cancer Ther. 2007, 6, 2399−2408.

(38) Berg, T.; Cohen, S. B.; Desharnais, J.; Sonderegger, C.; Maslyar,

D. J.; Goldberg, J.; Boger, D. L.; Vogt, P. K. Small-molecule

antagonists of Myc/Max dimerization inhibit Myc-induced trans-

formation of chicken embryo fibroblasts. Proc. Natl. Acad. Sci. U. S. A.

2002, 99, 3830−3835.

U

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

(39) Shi, J.; Strover, J. S.; Whitby, L. R.; Vogt, P. K.; Boger, D. L.

Small molecule inhibitors of Myc/Max dimerization and Myc-induced

cell transformation. Bioorg. Med. Chem. Lett. 2009, 19, 6038−6041.

(40) Xu, Y.; Shi, J.; Yamamoto, N.; Moss, J. A.; Vogt, P. K.; Janda, K.

D. A credit-card library approach for disrupting protein−protein

interactions. Bioorg. Med. Chem. 2006, 14, 2660−2673.

(41) Kiessling, A.; Sperl, B.; Hollis, A.; Eick, D.; Berg, T. Selective

inhibition of c-Myc/Max dimerization and DNA binding by small

molecules. Chem. Biol. 2006, 13, 745−751.

(42) Kiessling, A.; Wiesinger, R.; Sperl, B.; Berg, T. Selective

inhibition of c-Myc/Max dimerization by a pyrazolo[1,5-a]pyrimidine.

ChemMedChem 2007, 2, 627−630.

(56) Lanning, M. E.; Fletcher, S. Recapitulating the α-helix:

nonpeptidic, low-molecular-weight ligands for the modulation of

helix-mediated protein−protein interactions. Future Med. Chem. 2013,

5, 2157−2174.

(57) Blackwood, E. M.; Eisenman, R. N. Max: a helix−loop−helix

zipper protein that forms a sequence-specific DNA-binding complex

with Myc. Science 1991, 251, 1211−1217.

(58) Zhang, H.; Fan, S.; Prochownik, E. V. Distinct roles for MAX

protein isoforms in proliferation and apoptosis. J. Biol. Chem. 1997,

272, 17416−17424.

(59) Prochownik, E. V.; VanAntwerp, M. E. Differential patterns of

DNA binding by myc and max proteins. Proc. Natl. Acad. Sci. U. S. A.

1993, 90, 960−964.

(60) Holien, T.; Vatsveen, T. K.; Hella, H.; Waage, A.; Sundan, A.

Addiction to c-MYC in multiple myeloma. Blood 2012, 120, 2450−

2453.

(43) Follis, A. V.; Hammoudeh, D. I.; Wang, H. B.; Prochownik, E.

V.; Metallo, S. J. Structural rationale for the coupled binding and

unfolding of the c-Myc oncoprotein by small molecules. Chem. Biol.

2008, 15, 1149−1155.

(44) Hammoudeh, D. I.; Follis, A. V.; Prochownik, E. V.; Metallo, S.

J. Multiple independent binding sites for small-molecule inhibitors on

the oncoprotein c-Myc. J. Am. Chem. Soc. 2009, 131, 7390−7401.

(45) Yap, J. L.; Wang, H.; Hu, A.; Chauhan, J.; Jung, K.-Y.; Gharavi,

R. B.; Prochownik, E. V.; Fletcher, S. Pharmacophore identification of

c-Myc inhibitor 2. Bioorg. Med. Chem. Lett. 2013, 23, 370−374.

(46) Wang, H.; Chauhan, J.; Hu, A.; Pendleton, K.; Yap, J. L.; Sabato,

P. E.; Jones, J. W.; Perri, M.; Yu, J.; Cione, E.; Kane, M. A.; Fletcher,

S.; Prochownik, E. V. Disruption of Myc−Max heterodimerization

with improved cell-penetrating analogs of the small molecule 2.

Oncotarget 2013, 4, 936−947.

(61) Mateyak, M. K.; Obaya, A. J.; Adachi, S.; Sedivy, J. M.

Phenotypes of c-Myc-deficient rat fibrobasta isolated by targeted

homologous recombination. Cell Growth Differ. 1997, 8, 1039−1048.

(62) Graves, J. A.; Rothermund, K.; Wang, T.; Qian, W.; Van

Houten, B.; Prochownik, E. V. Point mutations in c-Myc uncouple

neoplastic transformation from multiple other phenotypes in rat

fibroblasts. PLoS One 2010, 5 (10), e13717.

(63) Bennett, M. R.; Anglin, S.; McEwan, J. R.; Jagoe, R.; Newby, A.

C.; Evan, G. I. Inhibition of vascular smooth muscle cell proliferation

in vitro and in vivo by c-Myc antisense oligodeoxynucleotides. J. Clin.

Invest. 1994, 93, 820−828.

(64) Arvanitis, C.; Felsher, D. W. Conditional transgenic models

define how MYC initiates and maintains tumorigenesis. Semin. Cancer

Biol. 2006, 16, 313−317.

(65) Wang, H.; Mannava, S.; Grachtchouk, V.; Zhuang, D.; Soengas,

M. S.; Gudkov, A. V.; Prochownik, E. V.; Nikiforov, M. A. c-Myc

depletion inhibits proliferation of human tumor cells at various stages

of the cell cycle. Oncogene 2008, 27, 1905−1915.

(66) Dang, C. V. Therapeutic targeting of Myc-reprogrammed cancer

cell metabolism. Cold Spring Harb. Symp. Quant. Biol. 2011, 76, 369−

374.

(67) Graves, J. A.; Wang, Y.; Sims-Lucas, S.; Cherok, E.;

Rothermund, K.; Branca, M. F.; Elster, J.; Beer-Stolz, D.; Van

Houten, B.; Vockley, J.; Prochownik, E. V. Mitochondrial structure,

function and dynamics are temporally controlled by c-Myc. PLoS One

2012, 7, e37699.

(68) Li, F.; Wang, Y.; Zeller, K. I.; Potter, J. J.; Wonsey, D. R.;

O’Donnell, K. A.; Kim, J. W.; Yustein, J. T.; Lee, L. A.; Dang, C. V.

Myc stimulates nuclearly encoded mitochondrial genes and mitochon-

drial biogenesis. Mol. Cell. Biol. 2005, 25, 6225−6234.

(69) Edmunds, L. R.; Sharma, L.; Kang, A.; Lu, J.; Vockley, J.; Basu,

S.; Uppala, R.; Goetzman, E. S.; Beck, M. E.; Scott, D.; Prochownik, E.

V. c-Myc programs fatty acid metabolism and dictates acetyl-CoA

abundance and fate. J. Biol. Chem. 2014, DOI: 10.1074/

jbc.M114.580662.

(70) Rahl, P. B.; Lin, C. Y.; Seila, A. C.; Flynn, R. A.; McCuine, S.;

Burge, C. B.; Sharp, P. A.; Young, R. A. c-Myc regulates transcriptional

pause release. Cell 2010, 141, 432−445.

(71) Clausen, D. M.; Guo, J.; Parise, R. A.; Beumer, J. H.; Egorin, M.

J.; Lazo, J. S.; Prochownik, E. V.; Eiseman, J. L. In vitro cytotoxicity

and in vivo efficacy, pharmacokinetics, and metabolism of 10074-G5, a

novel small-molecule inhibitor of c-Myc/Max dimerization. J.

Pharmacol. Exp. Ther. 2010, 335, 715−727.

(47) Chauhan, J.; Wang, H.; Yap, J. L.; Sabato, P. E.; Hu, A.;

Prochownik, E. V.; Fletcher, S. Discovery of methyl 4′-methyl-5-(7-

nitrobenzo[c][1,2,5]oxadiazol-4-yl)-[1,1′-biphenyl]-3-carboxylate, an

improved small-molecule inhibitor of c-Myc−Max dimerization.

ChemMedChem 2014, 9, 2274−2285.

(48) Fieber, W.; Schneider, M. L.; Matt, T.; Krautler, B.; Konrat, R.;

̈

Bister, K. Structure, function, and dynamics of the dimerization and

DNA-binding domain of oncogenic transcription factor v-Myc. J. Mol.

Biol. 2001, 307, 1395−1410.

(49) Ernst, J. T.; Kutzki, O.; Debnath, A. K.; Jiang, S.; Lu, H.;

Hamilton, A. D. Design of a protein surface antagonist based on alpha-

helix mimicry: inhibition of gp41 assembly and viral fusion. Angew.

Chem., Int. Ed. 2002, 41, 278−281.

(50) Saraogi, I.; Hebda, J. A.; Becerril, J.; Estroff, L. A.; Miranker, A.

D.; Hamilton, A. D. Synthetic alpha-helix mimetics as agonists and

antagonists of islet amyloid polypeptide aggregation. Angew. Chem., Int.

Ed. 2010, 49, 736−739.

(51) Yap, J. L.; Cao, X.; Vanommeslaeghe, K.; Jung, K.-Y.; Wilder, P.;

Nan, A.; MacKerell, A. D., Jr.; Smythe, W. R.; Fletcher, S. Relaxation of

the rigid backbone of an oligoamide-foldamer-based α-helix mimetic:

identification of potent Bcl-xL inhibitors. Org. Biomol. Chem. 2012, 10,

2928−2933.

(52) Cao, X.; Yap, J. L.; Newell-Rogers, M. K.; Peddaboina, C.; Hua,

J.; Papaconstantinou, H. T.; Jupitor, D.; Rai, A.; Jung, K.-Y.; Tubin, R.

P.; Yu, W.; Vanommeslaeghe, K.; Wilder, P. T.; MacKerell, A. D., Jr.;

Fletcher, S.; Smythe, W. R. The novel BH3 α-helix mimetic JY-1-106

induces apoptosis in a subset of cancer cells (lung cancer, colon cancer

and mesothelioma) by disrupting Bcl-xL and Mcl-1 protein−protein

interactions with Bak. Mol. Cancer 2013, 12, 42.

(53) Jung, K.-Y.; Vanommeslaeghe, K.; Lanning, M. E.; Yap, J. L.;

Gordon, C.; Wilder, P. T.; MacKerell, A. D., Jr.; Fletcher, S.

Amphipathic α-helix mimetics based on a 1,2-diphenylacetylene

scaffold. Org. Lett. 2013, 15, 3234−3237.

(54) Orner, B. P.; Ernst, J. T.; Hamilton, A. D. Toward

proteomimetics: terphenyl derivatives as structural and functional

mimics of extended regions of an α-helix. J. Am. Chem. Soc. 2001, 123,

5382−5383.

(55) Plante, J. P.; Burnley, T.; Malkova, B.; Webb, M. E.; Warriner, S.

L.; Edwards, T. A.; Wilson, A. J. Oligobenzamide proteomimetic

inhibitors of the p53−hDM2 protein−protein interaction. Chem.

Commun. 2009, 5091−5093.

(72) Murphy, N. S.; Prabhakaran, P.; Azzarito, V.; Plante, J. P.;

Hardie, M. J.; Kilner, C. A.; Warriner, S. L.; Wilson, A. J. Solid-phase

methodology for synthesis of O-alkylated aromatic oligoamide

inhibitors of α-helix-mediated protein−protein interactions. Chem.

Eur. J. 2013, 19, 5546−5550.

(73) Plante, J.; Campbell, F.; Malkova, B.; Kilner, C.; Warriner, S. L.;

Wilson, A. J. Synthesis of functionalised aromatic oligamide rods. Org.

Biomol. Chem. 2008, 6, 138−146.

V

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

(74) Ferre-D’Amare, A. R.; Prendergast, G. C.; Ziff, E. B.; Burley, S.

K. Recognition by Max of its cognate DNA through a dimeric b/

HLH/Z domain. Nature 1993, 363, 38−45.

(75) Delaglio, F.; Grzesiek, S.; Vuister, G. W.; Zhu, G.; Pfeifer, J.;

Bax, A. NMRPipe: a multidimensional spectral processing system

based on UNIX pipes. J. Biomol. NMR 1995, 6, 277−293.

(76) Goddard, T. D.; Kneller, D. G. SPARKY3; University of

California, San Francisco: San Francisco, CA2001.

(77) Lian, L. Y.; Barsukov, I. L.; Sutcliffe, M. J.; Sze, K. H.; Roberts,

G. C. Protein−ligand interactions: exchange processes and determi-

nation of ligand conformation and protein−ligand contacts. Methods

Enzymol. 1994, 239, 657−700.

(78) Prochownik, E. V.; Kukowska, J. Deregulated expression of c-

myc by murine erythroleukaemia cells prevents differentiation. Nature

1986, 322, 848−850.

W

DOI: 10.1021/jm501440q

J. Med. Chem. XXXX, XXX, XXX−XXX

Article Doi

Perturbation of the c-Myc-Max Protein-Protein Interaction via Synthetic α-Helix Mimetics

DOI: 10.1021/jm501440q

Source and publish data:

Authors:

Article abstract of DOI:10.1021/jm501440q

Full text of DOI:10.1021/jm501440q

Products guided by the article

R&D Labs maybe for 1379520-51-0

Relevant to this article

Hot Product