Cell death triggered by synthetic flavonoids in human leukemia cells is amplified by the inhibition of extracellular signal-regulated kinase signaling

Article abstract of DOI:10.1016/j.ejmech.2012.07.028

A new class of methyl esters of flavonoids, with different substituents on the B ring were synthesized and evaluated for their antiproliferative activity against the human leukemia cell line HL-60. The presence of either a methyl group (1f) or a chlorine atom (1o) at position 2′ of the B ring played an important role in affecting antiproliferative activity. The cytotoxic effects of these compounds were accompanied by the concentration- and time-dependent appearance of DNA- and nuclear-fragmentation, increase in the percentage of sub-G₁ cells, and processing of multiple caspases and poly(ADP-ribose)polymerase cleavage. Pretreatment of cells with the specific mitogen-activated extracellular kinases (MEK) 1/2 inhibitor PD98059, together with 1f and 1o, resulted in an important enhancement of cell death, which might have clinical implications for the use of both compounds in combination with MEK 1/2 inhibitors as potential therapeutic agents.

Full text of DOI:10.1016/j.ejmech.2012.07.028

European Journal of Medicinal Chemistry 55 (2012) 284e296
Contents lists available at SciVerse ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Original article
Cell death triggered by synthetic flavonoids in human leukemia cells is amplified
by the inhibition of extracellular signal-regulated kinase signaling
,
Sara Rubio a, Francisco León b, José Quintana a, Stephen Cutler c, Francisco Estévez a
*
a Department of Biochemistry and Molecular Biology, Associated Unit to the Spanish National Research Council (C.S.I.C.), University of Las Palmas de Gran Canaria, Instituto Canario
de Investigación del Cáncer, Plaza Dr. Pasteur s/n, 35016 Las Palmas de Gran Canaria, Spain
b Instituto de Productos Naturales y Agrobiología-C.S.I.C, Avda Astrofísico Francisco Sánchez 3, 38206 La Laguna, Tenerife, Spain
c The Department of Medicinal Chemistry, and National Center for Natural Products Research, School of Pharmacy, The University of Mississippi, MS 38677, USA
a r t i c l e i n f o
a b s t r a c t
Article history:
A new class of methyl esters of flavonoids, with different substituents on the B ring were synthesized and
evaluated for their antiproliferative activity against the human leukemia cell line HL-60. The presence of
either a methyl group (1f) or a chlorine atom (1o) at position 20 of the B ring played an important role in
affecting antiproliferative activity. The cytotoxic effects of these compounds were accompanied by the
concentration- and time-dependent appearance of DNA- and nuclear-fragmentation, increase in the
percentage of sub-G1 cells, and processing of multiple caspases and poly(ADP-ribose)polymerase
cleavage. Pretreatment of cells with the specific mitogen-activated extracellular kinases (MEK) 1/2
inhibitor PD98059, together with 1f and 1o, resulted in an important enhancement of cell death, which
might have clinical implications for the use of both compounds in combination with MEK 1/2 inhibitors
as potential therapeutic agents.
Received 8 March 2012
Received in revised form
6 July 2012
Accepted 17 July 2012
Available online 27 July 2012
Keywords:
Apoptosis
Caspases
Cell cycle
Cytotoxicity
Ó 2012 Elsevier Masson SAS. All rights reserved.
1. Introduction
compound potentiates the cytotoxic action of the chemotherapeutic
agent 1-b-D-arabinofuranosylcytosine [6], inhibits cell invasion and
Flavonoids are phenylbenzo-
g
-pyrones derivatives, which
induces apoptosis [7]. The flavone luteolin is another dietary flavo-
noid which shows a variety of anticancer effects, such as cell growth
and kinase activity inhibition, apoptosis induction, differentiation,
suppression of the secretion of matrix metalloproteinases, and
a reduction in tumor cell adhesion, invasive behavior, metastasis and
angiogenesis [8,9]. Some natural and semi-synthetic flavonoids
display cytotoxic properties in cells that over-express the anti-
apoptotic proteins Bcl-2 and Bcl-xL, induce the activation of
mitogen-activated protein kinases (MAPK) and show a selective
growth inhibitory response in human tumor cells but not in normal
cells [10e12]. A semi-synthetic flavonoid, flavopiridol, has been the
first cyclin-dependent kinases (Cdks) inhibitor to enter in human
clinical trials. This compound induces cell cycle arrest at either G1 or
G2eM phases, in accordance with its ability to inhibit both Cdk2 and
Cdk1, respectively [13]. Preclinical data indicate that flavopiridol
inhibits the proliferation of neoplastic cells and induces apoptosis
and also can potentiate the antitumor effects of many established
chemotherapeutic agents [14].
comprise a very large class of naturally-occurring polyphenol plant
compounds [1]. Flavonoids are ubiquitous in plant foods and drinks
and therefore consumed in our daily diet [2]. These polyphenolic
compounds display a remarkable spectrum of biological activities
and they are among the most promising anticancer agents [3]. A
number of reports in different cell lines, animal models and human
epidemiological trials have pointed out an association between
consumption of fruits, vegetables and certain beverages and
reduced risk of chronic disease, including cancer [4,5].
Quercetin (3,30,40,5,7-pentahydroxyflavone) is one of the best-
studied flavonoids and it is widely distributed in nature. This
Abbreviations: Cdk, cyclin-dependent kinase; CKI, cyclin-dependent kinase
inhibitor; ERK, extracelular signal-regulated kinase; IC50, 50% inhibition of cell
growth; JNK/SAPK, c-jun N-terminal kinases/stress-activated protein kinases;
MAPK, mitogen-activated protein kinases; MEK, mitogen-activated extracellular
kinases; MLL, mixed-lineage leukemia; MTT, 3-(4,5-dimethyl-2-thiazolyl-)-2,5-
diphenyl-2H-tetrazolium bromide; PARP, poly(ADP-ribose)polymerase; PBMC,
peripheral blood mononuclear cells; PCR, polymerase chain reaction; p38MAPK, p38
mitogen-activated protein kinases; SDS, sodium dodecyl sulfate; TRAIL, tumor
necrosis factor-related apoptosis-induced ligand; wt, wild type.
The mechanisms involved in cell death triggered by a specific
group of flavone-8-carboxylic acid derivatives are largely unex-
plored. In this article we describe the synthesis and cytotoxic
evaluation of new methyl esters derivatives of flavonoids, some of
which display cytotoxic activity in the human leukemia cell line HL-
* Corresponding author. Tel.: þ34 928 451443; fax: þ34 928 451441.
E-mail address: festevez@dbbf.ulpgc.es (F. Estévez).
0223-5234/$ e see front matter Ó 2012 Elsevier Masson SAS. All rights reserved.
http://dx.doi.org/10.1016/j.ejmech.2012.07.028

S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
285
60. In this series, the A ring was kept unchanged because we were
interested in investigating the influence of different substituents on
the B ring (2-phenyl group) of the phenylbenzo- -pyrone core. Two
g
selected methyl esters of flavonoids (1f and 1o) were cytotoxic,
induced G1 arrest and were also potent apoptotic inducers in this
cell line. The results also demonstrate that apoptosis induced by
these compounds is mediated by caspase activation and is associ-
ated with cytochrome c release and with the activation of the ERK
1/2 (extracellular signal-regulated kinases 1 and 2), JNK/SAPK (c-
jun N-terminal kinases/stress-activated protein kinases) and
p38MAPK (p38 mitogen-activated protein kinases). Moreover, an
important enhancement of apoptosis was observed with both
flavones when ERK 1/2 signaling was inhibited.
Scheme 2. Synthesis of compounds 1aeq. Reagents and conditions: a) (trimethylsilyl)
diazomethane, diethyl ether, dry methanol.
[10]. Here we have synthesized and analyzed the cytotoxicity of
seventeen methyl esters of flavonoids against the HL-60 cell line.
This is a useful model to study cell growth inhibition of leukemia
cells by chemical, physical and physiological agents. We were
interested in the effect on cytotoxic activity of electron-donating
(methoxy or methyl) and electron-withdrawing (fluoro, chlorine
or trifluoromethyl) groups and combinations of donating and
withdrawing groups in different positions of the B ring. The effect of
these compounds was investigated by MTT assay (Fig. 1A). Among
them, two flavonoids containing either an atom of chlorine (1f) or
a methyl group (1o) at position 20 of the B ring showed significant
growth inhibition of the HL-60 cell line (Fig. 1A).
2. Chemistry
The flavonoid derivatives of type 2aeq were prepared through
a
known procedure starting with DielseAlder like-reaction
employing 2-amino-3-cyano-4,5-dimethylfuran and methyl vinyl
ketone. Workup of this adduct with aqueous hydrochloric acid led
to the formation of 3-cyano-4,5-dimethyl-2-hydroxyacetophenone
3. The esterification of 3 with the appropriate benzoyl chloride
yielded the benzoates 4. Treatment of compounds 4 with potas-
sium hydroxide/pyridine under heat, followed by refluxing in
glacial acetic acid/sodium acetate afforded the cyano-flavone
derivatives 5. Acid hydrolysis of the cyano derivative with sulfuric
acid 80% or phosphoric acid yielded the amide derivatives, which
were converted to the corresponding carboxyl acids 2 by treatment
with nitrous acid. The synthetic route is shown in Scheme 1 [15,16].
Carboxylic acid flavones 2aeq, then were converted to a methyl
ester 1aei and 1leq with TMSCHN2 in good yield according to the
Scheme 2. In the case of the methylation of 2j, two products have
been isolated the methyl ester 1j1 and the methyl ester mono-
methylamine 1j2 in ratio (7:3). The rings B in the compounds 1aeq
are listed in the Table 1.
Antiproliferative studies indicate that both compounds display
cytotoxic properties with IC50 values between 9 and 10 mM (Fig. 1B,
Table 2). Interestingly, the compound containing the methyl group
(1o) was more cytotoxic than 1f in the mitoxantrone resistant HL-
60/MX1 cell line (IC50 ¼ 18.9 ꢀ 3.7
m
M vs. IC50 ¼ 70.7 ꢀ 0.7
mM). The
cytotoxic-inducing capacity of flavonoids 1f and 1o in human
leukemia cells raised the question whether they also affect healthy
human peripheral blood mononuclear cells (PBMCs). Therefore, we
also investigated whether these compounds were also cytotoxic for
human PBMC. A very low cytotoxicity (up to 30 mM) to either fresh
or proliferating PBMC growth was observed after treatment with
1f. However, there was an important reduction in the proliferation
of HL-60 cells, which were included in the experiment as a positive
control (Fig. 1C). Although 1o was slightly cytotoxic against normal
lymphocytes, the sensitivity of HL-60 cells was higher than that of
PBMC. Thus, the percentage of cell viability was 25 ꢀ 3% and
75 ꢀ 4% in HL-60 and PBMC, respectively, upon treatment with
3. Pharmacology
3.1. Methyl esters of flavonoids 1f and 1o inhibit the viability of
human myeloid leukemia cells
30
mM of 1o (Fig. 1D).
Recently, we have showed that the human myeloid leukemia
HL-60 cell line was highly sensitive to the antiproliferative effect of
Previous studies have shown that natural flavonoids induce
cleavage in the mixed-lineage leukemia (MLL) gene and may
some compounds with a phenylbenzo-
g-pyrone core structure
contribute to infant leukemia [17,18]. In order to assess the ability of
Scheme 1. Synthesis of compounds 2aeq. Reagents and conditions: a) acetone, reflux, overnight; b) HCl, H2O; c) triethylamine, dioxane; d) KOH, pyridine; e) acetic acid glacial,
sodium acetate; f) sulfuric acid or phosphoric acid; g) sulfuric acid/H2O and sodium nitrate or nitrous acid.

286
S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
Table 1
Different substituent’s in the ring B for compounds 1aeq.
Ring B
Ring B
Ring B
Ring B
1a
1f
1j2
1p
1b
1c
1g
1h
1l
1q
1m
1d
1e
1i
1n
1o
1j1
these methyl esters of flavonoids to induce site-specific DNA
cleavage in the breakpoint cluster region of the MLL gene, periph-
eral blood mononuclear cells were exposed to methyl esters 1f and
increase) and to 26.9 ꢀ 3.5% (5 times increase) in 1f- and 1o-treated
cells, respectively, after 24 h exposure at a concentration of 30 M.
m
To assess whether 1f- and 1o-induced cell growth inhibition is
mediated via alterations in cell cycle progression, we evaluated the
effect of these compounds on cell cycle phase distribution by flow-
cytometric studies. As shown in Fig. 2C and Table 3, consistent with
growth inhibitory effects, both compounds caused a significant G1
arrest at the expense of G2eM phase cell population at 24 h of
treatment. When the sub-diploid (sub-G1) portions of the histo-
grams were excluded from the analyses, the relative increases in
the G1 phase of the cell cycle in 1f- and 1o-treated HL-60 cells were
43% and 45%, respectively, when compared to the untreated
control. The percentage of control cells in G1 was w49%, which
1o (30 mM) for 16 h, and the occurrence of MLL rearrangements
were investigated by inverse PCR following the protocol described
by Libura et al. [19]. Inverse PCR on the DNA isolated from control
and treated samples generated one single band of approximately
1.8 kb, suggesting the amplification of the wt MLL only. There were
not any bands additional to wt MLL in methyl esters-treated cells.
However when the wt MLL was eliminated prior to PCR by enzy-
matic digestion with Pvu II a single band of approximately 0.65 kb
was observed only in 1o-treated cells, suggesting that this
compound might induce MLL translocation (Fig. 1E).
increased to w58% and w70% after treatment with 10
30 M of 1f. The percentage of cells in G1 increased to w56% and
w71% after treatment with 10 M and 30 M of 1o. This increase in
mM and
3.2. Compounds 1f and 1o induce G1 phase cell cycle arrest and
apoptosis on human myeloid leukemia cells
m
m
m
G1 cell population was accompanied with a concomitant decrease
of cell number in G2eM phase of the cell cycle.
When HL-60 cells were incubated with 1f and 1o, they dis-
played the morphological changes characteristic of apoptotic cells
(condensed and fragmented chromatin) visualized by fluorescent
microscopy (Fig. 2A) and the DNA showed the typical fragmenta-
tion patterns formed by internucleosomal hydrolysis of chromatin
(Fig. 2B). The quantification of apoptotic cells by measurement of
the number of hypodiploid cells by flow cytometry shows a 12-fold
increase in response to 1f and 1o (Fig. 2C, Table 3). Evaluation of
nuclear morphology (Fig. 2D) indicates that the percentage of
apoptotic cells increased from 4.9 ꢀ 1.0% to 30.6 ꢀ 0.3% (6 times
Next we evaluated the expression of the cyclin D1, a protein
which is known to be operative in G1 phase. The results indicate
that both compounds induce the expression of this protein on
HL-60 cells (Fig. 2E). Since the protein kinase activity of
the cyclin-dependent kinases (Cdks) is controlled not only by
their regulatory subunits but also by the cyclin-dependent
kinases inhibitors (CKI), we assessed whether the expression
of the CKI p21Cip1 is modulated by the compounds under study. A
doseeresponse experiment shows that the levels of p21Cip1

S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
287
Fig. 1. (A) Analysis of cell viability in methyl ester of flavonoids-treated HL-60 cells by the MTT assay. Cells were plated into 96-well plates and treated with 100
mM of indicated
compound for 72 h. Cell viability was determined by measuring the absorbance at a wavelength of 570 nm. (B) Effect of 1f on human HL-60 cell viability. Cells were cultured in the
presence of the indicated concentrations of 1f for 72 h, and thereafter cell viability was determined by the MTT assay. The results of a representative experiment are shown. Each
point represents the average of triplicate determinations. (C) Differential effect of 1f and (D) 1o on proliferation of normal peripheral blood mononuclear cells (PBMC) versus HL-60
cells. Proliferation of HL-60 cells, quiescent PBMCs and phytohemagglutinin (PHA)-activated healthy human PBMC cultured in presence of the indicated concentrations of 1f and 1o
for 48 h. Values represent means ꢀ SE of two independent experiments each performed in triplicate. *P < 0.05, significantly different from untreated control. (E) Inverse PCR on
genomic DNA of peripheral blood mononuclear cells. Genomic DNA was digested with Xba I restriction enzyme and circularized. Nested PCR reactions were carried out with
MF1eMR1 primer pair, followed by MF2eMR2 primer pair. MF1, MF2, MR1 and MR2 are primers used for PCR (see Experimental part).
were increased after treatment with both compounds for 24 h
(Fig. 2F).
on poly(ADP-ribose) polymerase (PARP) cleavage, a hallmark of
apoptosis that indicates activation of caspase. As shown (Fig. 3),
hydrolysis of the 116 kDa PARP protein to the 85 kDa fragment was
detected after 24 h exposure with both compounds.
3.3. 1f- and 1o-induced cell death is mediated by a caspase-
Cytochrome c released from mitochondria binds to the adapter
protein APAF-1 (Apoptotic Protease Activating Factor-1) and
procaspase-9 to stimulate the auto-catalytic cleavage of the
proenzyme to its active form, thereby initiating the so called
intrinsic or mitochondrial pathway [20]. Caspase-9 then cleaves
caspase-3 which recognizes multiple substrates including PARP. To
determine whether 1f- and 1o-induced apoptosis involves the
release of cytochrome c from mitochondria to cytosol, HL-60 cells
were treated with these compounds and cytosolic preparations
were analyzed by immunoblotting. As shown (Fig. 3), both
compounds induce cytochrome c release. Next, we studied the
effect on caspase-9 and found that both compounds stimulate the
cleavage of inactive procaspase-9 to the active 35e37 kDa fragment
(Fig. 3).
dependent pathway
To determine whether caspases were involved in the response
of the cells to 1f and 1o, we evaluated the effect of these flavonoids
Table 2
Effects of synthetic flavonoids on the growth of human tumor cell lines.
Compound
IC50
(
m
M)
HL-60
HL-60/MX1
1f
1o
9.3 ꢀ 1.2
70.7 ꢀ 0.7
18.9 ꢀ 3.7
10.1 ꢀ 1.1
Cells were cultured for 72 h and the IC50 values were calculated as described in the
Materials and methods section. The data shown represent the mean ꢀ SEM of three
independent experiments with three determinations in each.

288
S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
Fig. 2. Effects of 1f and 1o on apoptosis on human myeloid leukemia HL-60 cells. (A) Photomicrographs of representative fields of HL-60 cells stained with bisbenzimide trihy-
drochloride to evaluate nuclear chromatin condensation (i.e. apoptosis) after treatment with 30 M of 1f for 24 h. (B) Qualitative assessment of apoptotic DNA damage. Cells were
treated with the indicated concentrations of 1f and 1o and genomic DNA was extracted, separated on an agarose gel and visualized under UV light by ethidium bromide staining. (C)
Cells were incubated with 30 M of compounds for 24 h and subjected to DNA flow cytometry. Hypodiploid cells (apoptotic cells) are shown in region marked with an arrow. (D)
m
m
Cells were incubated with the indicated concentrations of flavonoids and apoptotic cells were quantitated by fluorescence microscopy. Values represent means ꢀ S.E. of two
independent experiments each performed in triplicate. *P < 0.05, significantly different from untreated control. (E, F) Effect of 1f and 1o on the cell cycle regulatory protein
expression levels in HL-60 cells. Cells were incubated in the presence of 1f and 1o, harvested at 24 h and whole cell lysates were assayed by immunoblotting. b-Actin was used as
a loading control. A representative Western blot is shown; two additional experiments yielded similar results.
To determine the contribution of the extrinsic pathway, HL-60
cells were treated with 1f and 1o and the cell lysates were then
subjected to immunoblot analysis. The results clearly demonstrate
that both compounds significantly promote procaspase-8 hydro-
lysis after 24 h of treatment (Fig. 3). Proteolytic cleavage of the
initiator caspase-8, which is demonstrated in response to 1f and 1o,
typically occurs after triggering cell surface death receptors like the
TRAIL (Tumor Necrosis factor-related Apoptosis-Inducing Ligand)
receptors [21]. Active caspase-8 initiates the proteolytic activation
of executioner caspases and in parallel may cleave the proapoptotic
Bcl-2 family member Bid, which in the truncated form (tBid)
promotes the release of mitochondrial factors that initiate caspase-
9 activation and links the extrinsic pathway to the mitochondrial
pathway of apoptosis. Therefore, we evaluated the effect of 1f and
1o on Bid cleavage by Western blot and found that the full-length
Bid decreased after treatment with both compounds. This
decrease implies a protein truncation and the transference of
apoptotic signals from the extrinsic pathway to mitochondria [22].
As shown in Fig. 3, 1f and 1o also stimulate the proteolytic pro-
cessing of executioner caspases-3, -6 and -7.
To determine whether 1f- and 1o-triggered apoptosis requires
the activation of caspases, HL-60 cells were pretreated with the
broad-spectrum caspase inhibitor z-VAD-fmk. The almost complete
inhibition of apoptosis observed (Fig. 4A) suggests that both
compounds induce a caspase-dependent mechanism. To identify
which caspases were important in 1f- and 1o-induced apoptosis,
the effect of selective caspase inhibitors was examined. The
caspase-3 & -7 inhibitor (z-DEVD-fmk), the caspase-8 inhibitor (z-
IETD-fmk) and the caspase-9 inhibitor (z-LEHD-fmk) partially
blocked 1f- and 1o-induced apoptosis in HL-60 cells (Fig. 4BeD).
3.4. 1f and 1o activate mitogen-activated protein kinases (MAPK)
In view of evidence that the MAPK play a critical role in cell fate,
the effects of 1f and 1o on the activation of this pathway were
examined. The results demonstrate that these compounds lead to
a fast (30 min) phosphorylation of ERK 1/2, JNK/SAPK and p38MAPK
in HL-60 cells (Fig. 5A). The level of phosphorylated p38MAPK was
transient and returned to the control level at 2 h in 1f- or 4 h in 1o-
treated cells, while phosphorylation of ERK 1/2 and JNK/SAPK
remained elevated for at least 6 h. These results indicate that 1f and
1o lead to activation of ERK 1/2, JNK/SAPK and p38MAPK following
different kinetics. To determine whether the phosphorylation of
MAPK plays a key role in 1f- and 1o-induced apoptosis, we
examined the effects of selective inhibitors for these protein
kinases. Pretreatment with the mitogen-activated extracellular
Table 3
Effects of selected compounds on cell cycle phase distribution of HL-60 cells.
%Sub-G1
%G1
%S
%G2eM
Control
2.3 ꢀ 0.5*
6.3 ꢀ 0.6*
28.1 ꢀ 4.2*
5.5 ꢀ 0.6*
28.5 ꢀ 3.9*
48.0 ꢀ 1.6*
54.9 ꢀ 1.7*
47.2 ꢀ 1.2*
53.0 ꢀ 1.0*
48.1 ꢀ 2.3*
16.7 ꢀ 0.5*
16.7 ꢀ 0.6*
7.8 ꢀ 1.0*
16.6 ꢀ 1.3*
7.6 ꢀ 1.0*
33.2 ꢀ 2.1*
22.9 ꢀ 2.2*
13.5 ꢀ 3.7*
24.4 ꢀ 0.7*
11.8 ꢀ 2.9*
10
30
10
30
m
m
m
m
M 1f
M 1f
M 1o
M 1o
kinases 1/2 (MEK1/2) inhibitor PD98059 (10
mM) significantly
enhances 1f- and 1o-mediated apoptosis (Fig. 5B). The percentage
of apoptotic cells increased from 16% in 1f-treated cells to 32% in
presence of the inhibitor. A similar trend was observed with the
combination of PD98059 and 1o. The percentage of apoptotic cells
increased from 15% in 1o-treated cells to 25% with PD98059. The
Cells were cultured with the indicated concentration for 24 h and the cell cycle
phase distribution was determined by flow cytometry. The values are means ꢀ SE of
two different experiments with three determinations in each. *P < 0.05, significantly
different from untreated control.

S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
289
Fig. 4. (A) Effect of cell-permeable caspase inhibitors on 1f- and 1o-stimulated
apoptosis. HL-60 cells were incubated with 30 M of flavonoids for 24 h, in absence or
presence of the broad-spectrum caspase inhibitor z-VAD-fmk (100 M), the caspase-3
& -7 inhibitor z-DEVD-fmk (50 M), the caspase-8 inhibitor z-IETD-fmk (50 M) and
the caspase-9 inhibitor z-LEHD-fmk (50 M). The percentage of hypodiploid cells was
determined and quantified by flow cytometry after staining with propidium iodide.
Values represent means ꢀ S.E. of three independent experiments each performed in
triplicate. *P < 0.05, significantly different from untreated control. #P < 0.05, signifi-
cantly different from 1f and 1o treatments alone.
m
m
m
m
m
Fig. 3. Involvement of activation of caspases in the induction of apoptosis on human
leukemia cells. HL-60 cells were incubated with 30 M of the indicated compounds
and harvested at 24 h and cell lysates (or cytosolic extracts in the case of cytochrome
c) were assayed by immunoblotting for the cleavage of PARP, caspases and Bid, and for
cytochrome c release. b-Actin was used as a loading control.
m
effect of the inhibitor on the phosphorylation status of ERK 1/2 in
the combination treatment group was also confirmed by Western
blot (results not shown). In HL-60 cells, 1f and PD98059 combined
caused almost two times more cell death than 1f alone, and almost
five times more cell death than PD98059 alone. These results
suggest that this inhibitor of ERK 1/2 signaling may serve as
sensitizer toward 1f- and 1o-mediated apoptosis in human
leukemia cells.
and treatment of cancer. Flavonoids are phenolic substances which
have attracted a great deal of attention because they appear to have
anticancer properties [1]. In this study, we have synthesized and
analyzed the cytotoxicity of seventeen methyl esters of flavonoids
1aeq. The evaluated compounds contain a common phenylbenzo-
g-pyrone core and a methyl ester functional group at C-8, with
different substituents on the B ring. The introduction of the methyl
group is essential for cytotoxicity, since the corresponding
carboxylic acids did not show any antiproliferative activity against
HL-60 cells (results not shown). It is possible that methyl esters of
flavonoids can pass through biological membranes more easily and
therefore reach a higher intracellular concentration than the cor-
responding carboxylic acids. The introduction of a substituent at
the C-40 position had no any effect (1b, 1p) or decreased the
potency (1d, 1e, 1g, 1n) with respect to 1a against cell growth
inhibition. Similar results were obtained by the introduction of
a substituent in C-30 position. The 30-methoxy derivative 1c was
less active than 1a, but the 30-methyl derivative 1m displayed
similar cell growth inhibition as 1a. The structural requirement for
the antiproliferative action of these compounds seems to be the
mono substitution at position C-20. The introduction of an atom of
chlorine (1f) as well as a methyl group (1o) on position 20 improves
the antiproliferative activity with respect to 1a. When a methoxy
Pretreatment of HL-60 cells with the specific JNK/SAPK inhibitor
SP600125 (10
(2 M) did not alter the rate of 1f- and 1o-mediated apoptosis. Both
m
M) or with the specific p38MAPK inhibitor SB203580
m
inhibitors had no influence on basal levels of apoptosis (results not
shown). These data suggest that the activation of JNK/SAPK and
p38MAPK is not involved in 1f- and 1o-mediated cell death.
4. Discussion
In the area of cancer chemotherapy, more than 60% of the
effective drugs are of natural origin or can be traced back to
a natural products source [23]. Most modern medicines currently
available are very expensive, toxic and less effective in treating the
disease. Therefore, the agents derived from natural and synthetic
sources should be investigated further in detail for the prevention

290
S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
Fig. 5. Effects of 1f and 1o on MAPK pathway. (A) Representative Western blots show the time-dependent phosphorylation of ERK 1/2, JNK/SAPK and p38MAPK by 1f and 1o. HL-60
cells were incubated with both flavonoids for the indicated time points and protein extracts were prepared and analyzed on Western blots. Membranes were stripped and reprobed
with total ERK 1/2, JNK/SAPK or p38MAPK antibodies as loading controls. (B) HL-60 cells were preincubated with PD98059 (PD, 10
mM), SP600125 (SP, 10 mM) or SB203580 (SB, 2 mM)
for 1 h and then treated with 1f and 1o. Apoptosis was quantified by flow cytometry as described in Materials and methods. Bars represent the mean ꢀ S.E. of three independent
experiments each performed in triplicate. *P < 0.05, significantly different from untreated control. #P < 0.05, significantly different from 1f and 1o treatments alone.
group is placed in the same position, the resulting compound (1q)
also displays higher antiproliferative activity than 1a, but is
significantly less cytotoxic than 1f and 1o. These results suggest
that both the C-20 position and the substituent seem to play a key
role in determining the potency of these compounds on cell
viability. The lesser cytotoxic activity of compound 1q with respect
to 1f and 1o could be explained by the fact that the CH3 of the
methoxy group can be oriented in such way that it imposes a steric
restriction and/or the methoxy oxygen atom might accept
a hydrogen bond from the side chain of specific aminoacids resi-
dues of the target proteins which might be accompanied by an
alteration of the compound binding mode. However, there are
probably additional factors that play important roles in deter-
mining the final biological response in this particular tumor cell
line. The antiproliferative activity of 1f was reduced by the intro-
duction of an additional atom of chlorine in position 40 (1h), and led
to similar growth inhibition as 1a.
One of the most potent derivatives 1f contains chlorine at the
same position as in the semi-synthetic flavonoid flavopiridol a well
known cyclin-dependent kinase inhibitor. Moreover, the 20-chloro
substituent of the flavopiridol is important for the Cdk inhibitory
activity [24]. Further studies are needed to determine whether the
different cytotoxicity between 1f and 1a could be explained by Cdk
inhibition. Although 1f and 1o show similar potency in HL-60 cells,
the latter was more cytotoxic against the mitoxantrone resistant
HL-60/MX1. This result is relevant because these cells display
atypical multidrug resistance and cross resistance to etoposide and
the anthracyclines daunorubicin and doxorubicin [25]. The effects
of 1f and 1o against human PBMCs were also determined since
selectivity toward cancer cells is an important criterion in the study
of the agents used or developed for cancer treatment. Dose-
response studies revealed that quiescent PBMC and proliferating
PBMC were more resistant than HL-60 cells toward 1f and 1o.
The inverse PCR approach demonstrate that cells exposed to the
methyl ester 1f showed no abnormal PCR products indicating that
this compound does not induce MLL translocations in the experi-
mental conditions assayed. However the inverse PCR method
generated the amplification of a smaller fusion product in 1o-
treated cells suggesting that this compound might induce MLL
translocation.
Flow cytometry studies in HL-60 cells indicate that both
compounds induce cell cycle arrest at G1 phase and increase the
percentage of cells in the sub-G1 region which is considered as
a marker of cell death by apoptosis. Although other targets are
possible, the changes in the expression and/or activity of G1 cell
cycle regulators might also be involved in the antiproliferative
activity of these methyl esters. The G1 cell cycle arrest was associ-
ated with induction of cyclin D1 and accumulation of the cyclin-
dependent kinases inhibitor p21Cip1 which can induce a G1
arrest through its interactions with cyclin/Cdk complexes. The

S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
291
up-regulation of p21Cip1 involves a p53-independent pathway since
HL-60 cells lack functional p53. These results might have important
implications for developing 1f and 1o as chemopreventive or as
chemotherapeutic agents in treatment of cancer, because approx-
imately 50% of human cancers harbor p53 mutations [26,27].
Apoptotic hallmarks such as DNA fragmentation and apoptotic
bodies formation were also observed in 1f- and 1o-treated cells.
Apoptosis induction was accompanied by PARP cleavage which
indicates involvement of this protein as a key regulator of cell death
[28]. The experiments shown here demonstrate proteolytic pro-
cessing of the effector caspases-3, -6 and -7, and the initiator
caspases-8 and -9, suggesting that both compounds activate these
proteases in HL-60 cells. Our results indicate that the cell death was
dependent on caspase activation since apoptosis was pharmaco-
logically inhibited by the general caspase inhibitor z-VAD-fmk.
Previous studies have demonstrated that many cytotoxic agents
induce mitochondrial cytochrome c release [29], which triggers
a caspase-dependent assembly of the apoptosome [30]. Here we
have shown that both methyl esters 1f and 1o induce the release of
cytochrome c from mitochondria into the cytosol, and thus the
activation of caspase-9 and caspase-3. Moreover, the use of selec-
tive caspase inhibitors against caspase-3 (z-DEVD-fmk), caspase-8
(z-IETD-fmk) and caspase-9 (z-LEHD-fmk) reduced the
percentage of hypodiploid cells induced by 1f and 1o which suggest
that the intrinsic and the extrinsic apoptotic pathways appear to be
involved.
lower dosages are more attainable during cancer therapy and likely
to be less toxic to patients. These results might have important
clinical implications for the use of these methyl esters of flavonoids
as potential therapeutic agents in combination of MEK 1/2
inhibitors.
Although the JNK/SAPK pathway has been shown to be closely
linked to apoptosis [37], its exact role seems to depend on the cell
type and stimulus. Here we show that 1f and 1o induce JNK/SAPK
activation in HL-60 cells and its inhibition by SP600125 did not
influence 1f- and 1o-induced apoptosis indicating that this protein
kinase is not required for cell death.
The p38MAPK signaling has been shown to promote cell death,
but also to enhance survival, cell growth and differentiation.
Therefore, the role of p38MAPK in apoptosis is dependent on cell
types and stimuli [38]. In the present study we show that although
p38MAPK is activated prior to caspase processing, this protein kinase
is not required for 1f- and 1o-induced apoptosis since SB203580
MAPK
was unable to block cell death. Activation of p38
has been
reported to be involved in cadmium-induced apoptosis on U937
cells [39] and resveratrol-induced apoptosis of human malignant B
cells [40], while it is not involved in UV-induced apoptosis in U937
cells [41] and in Fas-induced apoptosis in Jurkat T cells [42].
In this paper we describe that these compounds modulate
multiple biochemical signals that control tumor cell proliferation
and apoptosis, which suggests the existence of many substrates.
However the direct molecular targets of these novel anti-
proliferative compounds are unknown. Previous studies have
shown that the direct targets of natural occurring flavonoids such
as quercetin are key anti-apoptotic protein kinases, such as, phos-
phatidylinositide-3-kinase (PI3K) [43], Raf and MEK [44].
Among the different potential targets, methyl esters of flavonoids
could interact with cellular receptors such as receptor tyrosine
kinases involved in cell proliferation. The results shown here
demonstrate that these compounds display an effect on the phos-
phorylation of ERK, which suggests that they could block other
proteins involved in survival such as the PI3K pathway perhaps by
direct inhibition of PI3K and/or the serine threonine protein kinase
B (AKT) in these cells, although direct inhibition of additional
upstream tyrosine kinases can not be ruled out. Further studies will
be needed to determine the effect of these compounds on these
potential targets.
We have previously demonstrated on HL-60 cells an effective
blockage of betuletol 3-methyl ether induced-apoptosis by z-IETD-
fmk but not by z-LEHD-fmk, supporting a caspase-8 mediated
mechanism [10]. Therefore, different apoptotic pathways are acti-
vated in this cell line in response to the phenylbenzo-
g-pyrones 1f
and 1o and betuletol 3-methyl ether. We also evaluated whether 1f
and 1o could induce cleavage of Bid since it is known that this Bcl-2
family protein is a substrate for caspase-8, and observed a reduc-
tion of this protein after 24 h of treatment, in accordance with the
results of caspase-8 activation. Further studies are needed to
determine the effect of 1f and 1o on expression and/or activation of
Fas, tumor necrosis factor receptor 1 and TRAIL receptors, which are
usually involved in the extrinsic pathway activation.
Mitogen-activated protein kinases are essential parts of the
signal transduction machinery and play central roles in cell growth,
differentiation and cell death. The JNK/SAPK and p38MAPK have
generally been associated with pro-apoptotic actions, whereas ERK
1/2 in most cases exerts cytoprotective effects [31]. The ability of
ERK 1/2 inhibitors has been reported to potentiate the antitumor
5. Conclusion
In summary, our results show that 1f and 1o display cytotoxic
properties, induce G1 phase cell cycle arrest and apoptosis on
human myeloid leukemia HL-60 cells. Since these cells are p53 null,
our results clearly demonstrate that apoptosis induced by 1f and 1o
could occur independently of p53-mediated cellular events. Given
the fact that about 50% of human cancers harbor p53 mutations
[26,27], these results have important implications for developing
these flavonoid derivatives as chemopreventive or chemothera-
peutic agents. 1f- and 1o-induced apoptosis is accompanied by the
activation of multiple caspases, mitochondrial release of cyto-
chrome c, PARP cleavage and DNA fragmentation. Although
cleavage of procaspase-8, -9, -3, -6 and -7 is detected in 1f- and 1o-
treated cells by immunoblotting, the inhibition data indicate that
these caspases do not fully account for cell death. These results,
when considered together with the almost complete blockage of
apoptosis by z-VAD-fmk, suggest that additional caspases may
contribute to apoptosis. One possibility is that other executioner
caspases, such as caspase-6 is involved in this process as it is shown
in this paper. 1f and 1o induce the activation of the MEK/ERK
pathway, and the combination with the inhibitor of MEK 1/2
kinases leads to enhanced cell death. The findings of this study
effects of cytotoxic agents such as 1-b-D-arabinofuranosylcytosine
in a substantial increase in release of cytochrome c [32]. Previous
studies have shown that quercetin treatment results in high and
sustained activation of ERK 1/2 in A549 lung cancer epithelial cells
[33]. However, the inhibition of MEK-ERK activation utilizing
PD98059 abolishes quercetin-induced apoptosis [33]. Treatment of
ovarian carcinoma cells and the C8161 melanoma cell line with
cisplatin caused ERK 1/2 activation and cell death, and this latter
effect was potentiated by ERK 1/2 inhibitors, indicating that ERKs
behave as survival-inducing kinases in these cells [34e36].
One of the findings described here is that 1f and 1o also induce
activation of the MEK/ERK pathway, which is expected to increase
cell proliferation and survival, and may compromise the efficacy of
both compounds in potential cancer treatment. Our data indicate
that the MEK 1/2 inhibitor PD98059 potentiates the apoptotic
effects of 1f and 1o. This finding is in agreement with previous
work that has shown that inhibition of MEKeERK activation with
U0126 or PD98059 enhances cell death induced by the acetyl
derivative of the flavonoid quercetin 3-methyl ether [11]. The
potential use of low dose in chemotherapy is important, because

292
S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
suggest that these synthetic flavonoids could be useful in the
development of novel anticancer agents.
126.8 (CH, C-5), 123.9 (C, C-10), 123.6 (C, C-8), 121.5 (C, C-10), 114.5
(2ꢁ CH, C-30 and C-50), 106.0 (CH, C-3), 56.0 (CH3, OCH3eC-40), 52.7
(CH3, OCH3), 19.8 (CH3, C-11), 17.5 ppm (CH3, C-12); IR (KBr):
6. Experimental protocols
nmax ¼ 2962, 1724, 1651, 1514, 1434, 1370, 1261, 1058, 800 cmꢂ1
;
HRMS (ESIþ): m/z [M þ H]þ calcd for C20H19O5: 339.1232, found:
6.1. Chemistry
339.1295.
6.1.1. Materials and methods
6.1.3.3. Methyl 2-(3-methoxyphenyl)-6,7-dimethyl-4-oxo-4H-chro-
mene-8-carboxylate (1c). This compound was prepared from 2c
using the procedure described above. (0.034 mmol, 11.7 mg, 75%)
Purity of all tested compounds was >95.0% at 254 nm as
determined by high-performance liquid chromatography. HPLC
analysis was obtained on a Waters W2690/5 using a Phenomenex
Luna C18 column (150 ꢁ 4.60 mm, 5
yellow solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.00 (1H, s, H-5),
mm particle size) with a 1.0 mL/
7.38e7.37 (2H, m, H-50, H-60), 7.34 (1H, d, J ¼ 1.0 Hz, H-20), 7.03 (1H,
dd, J ¼ 8.3, 5.4 Hz, H-40), 6.76 (1H, s, H-3), 4.06 (3H, s, OCH3), 3.86
(3H, s, OCH3eC-30), 2.37 (3H, s, CH3-11), 2.36 ppm (3H, s, CH3-12);
min flow rate using a gradient of 3%e100% [0.1% formic acid in
acetonitrile] in [0.1% formic acid in water] over 37 min. 1H and
13C NMR spectra were obtained on Bruker model AMX 500 and
400 NMR spectrometers with standard pulse sequences,
operating at 500 MHz in 1H and 125 MHz in 13C. CDCl3 was used
as solvent, and TMS was used as internal standard. IR spectra
were recorded using a PerkineElmer model spectrum-100 spec-
trophotometer. High-resolution mass spectra (HRMS) were recor-
ded on a Micromass Q-Tof Micro mass spectrometer with a lock
spray source. Column chromatography was carried out on silica gel
(70e230 mesh, Merck) and fractions were monitored by TLC (silica
gel 60 F254). Preparative TLC was carried out on silica gel 60
PF254 þ 366 plates (20 ꢁ 20 cm, 1 mm thick). All products reported
showed 1H and 13C NMR spectra in agreement with the assigned
structures.
13C NMR (125 MHz, CDCl3):
d
¼ 177.6 (C, C-4), 167.0 (C, C-13), 162.6
(C, C-2), 159.8 (C, C-30), 151.4 (C, C-9), 141.3 (C, C-7), 134.7 (C, C-6),
132.8 (C, C-10), 130.1 (CH, C-50), 126.7 (CH, C-5), 123.7 (C, C-8), 121.5
(C, C-10), 118.5 (CH, C-60), 117.4 (CH, C-40), 111.48 (CH, C-20), 107.5
(CH, C-3), 55.3 (CH3, OCH3eC-30), 52.7 (CH3, OCH3), 19.8 (CH3, C-11),
17.5 ppm (CH3, C-12); IR (KBr): nmax ¼ 2951, 1728, 1648, 1607, 1492,
1365, 1274, 1251, 1211, 1051, 846, 782 cmꢂ1; HRMS (ESIþ): m/z
[M þ H]þ calcd for C20H19O5: 339.1232, found: 339.1291.
6.1.3.4. Methyl
6,7-dimethyl-4-oxo-2-p-tolyl-4H-chromene-8-
carboxylate (1d). This compound was prepared from 2d using the
procedure described above. (0.040 mmol, 13.0 mg, 83%) white
solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.07 (1H, s, H-5), 7.75 (2H, t,
J ¼ 8.2 Hz, H-20, H-60), 7.34 (2H, d, J ¼ 8.2 Hz, H-30, H-50), 6.79 (1H, s,
6.1.2. Experimental part
General procedure for the synthesis of compounds 2aeq have
already been described [15,16].
H-3), 4.09 (3H, s, OCH3), 2.46 (3H, s, CH3eC-40), 2.43 (3H, s, CH3-11),
2.41 ppm (3H, s, CH3-12); 13C NMR (125 MHz, CDCl3):
d
¼ 177.8 (C,
C-4), 167.2 (C, C-13), 163.2 (C, C-2), 151.5 (C, C-9), 142.3 (C, C-40),
141.1 (C, C-7), 134.6 (C, C-6), 129.8 (2ꢁ CH, C-30 and C-50), 128.9 (C,
C-10), 126.8 (CH, C-5), 126.2 (2ꢁ CH, C-20 and C-60), 123.7 (C, C-8),
121.6 (C, C-10), 106.8 (CH, C-3), 52.7 (CH3, OCH3), 21.5 (CH3, CH3eC-
40), 19.8 (CH3, C-11), 17.5 ppm (CH3, C-12); IR (KBr): nmax ¼ 2964,
1731, 1638, 1260, 1027, 799 cmꢂ1; HRMS (ESIþ): m/z [M þ H]þ calcd
for C20H19O4: 323.1283, found: 323.1319.
6.1.3. General procedure for the preparation of compounds 1aei
and 1leq
To a solution of the respective flavonoid (15 mg) in dehydrated
MeOH (5 mL), excess of dissolution of TMSCHN2 in diethyl ether
2.0 M (0.5 mL) was added and stirred at room temperature for 24 h,
the mixture was concentrated under vacuum, and then the
resulting residue was chromatographed over silica gel with n-
hexaneeEtOAc (8:2) to give the methyl ester flavonoids.
6.1.3.5. Methyl
2-(4-fluorophenyl)-6,7-dimethyl-4-oxo-4H-chro-
mene-8-carboxylate (1e). This compound was prepared from 2e
using the procedure described above. (0.037 mmol, 12.4 mg, 79%)
6.1.3.1. Methyl
6,7-dimethyl-4-oxo-2-phenyl-4H-chromene-8-
yellow solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.01 (1H, s, H-5), 7.80
carboxylate (1a). This compound was prepared from 2a using the
(2H, dd, J ¼ 1.9, 8.6 Hz, H-20, H-60), 7.17 (2H, t, J ¼ 8.6 Hz, H-30, H-50),
procedure described above. (0.040 mmol, 12.5 mg, 80%) yellow
6.71 (1H, s, H-3), 4.06 (3H, s, OCH3), 2.38 (3H, s, CH3-11), 2.37 ppm
solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.06 (1H, s, H-5), 7.86e7.84
(3H, s, CH3-12); 13C NMR (125 MHz, CDCl3):
d
¼ 177.5 (C, C-4), 167.0
(2H, m, H-20, H-60), 7.54e7.52 (3H, m, H-30, H-40, H-50), 6.82 (1H,
s, H-3), 4.09 (3H, s, OCH3), 2.53 (3H, s, CH3-11), 2.40 ppm (3H, s,
(C, C-13), 164.7 (C, JFC ¼ 251 Hz, C-40), 161.9 (C, C-2), 151.4 (C, C-9),
141.4 (C, C-7), 134.8 (C, C-6), 127.7 (C, JFC ¼ 3.7 Hz, C-10), 128.4 (2ꢁ
CH, JFC ¼ 8.7 Hz, C-20 and C-60), 126.8 (CH, C-5), 123.7 (C, C-8), 121.4
(C, C-10), 128.9 (C, C-10), 116.2 (2ꢁ CH, JFC ¼ 22.5 Hz, C-30 and C-50),
107.1 (CH, C-3), 52.7 (CH3, OCH3), 19.8 (CH3, C-11), 17.5 ppm (CH3, C-
12); IR (KBr): nmax ¼ 3001, 2956, 1715, 1651, 1605, 1510, 1432, 1367,
1238, 1164, 1017, 836, 748 cmꢂ1; HRMS (ESIþ): m/z [M þ H]þ calcd
for C19H16FO4: 327.1033, found: 327.1070.
CH3-12); 13C NMR (125 MHz, CDCl3):
d
¼ 177.7 (C, C-4), 167.1 (C, C-
13), 162.9 (C, C-2), 151.5 (C, C-9), 141.3 (C, C-7), 134.7 (C, C-6), 131.7
(C, C-10), 131.6 (CH, C-40), 129.1 (2ꢁ CH, C-30 and C-50), 126.8 (CH, C-
5), 126.2 (2ꢁ CH, C-20 and C-60), 123.8 (C, C-8), 121.6 (C, C-10), 107.4
(CH, C-3), 52.7 (CH3, OCH3), 19.8 (CH3, C-11), 17.5 ppm (CH3, C-12);
IR (KBr): nmax ¼ 2960, 1715, 1650, 1429, 1368, 1336, 1259, 1058,
769 cmꢂ1; HRMS (ESIþ): m/z [M þ H]þ calcd for C19H17O4: 309.1127,
found: 309.1189.
6.1.3.6. Methyl
2-(2-chlorophenyl)-6,7-dimethyl-4-oxo-4H-chro-
mene-8-carboxylate (1f). This compound was prepared from 2f
6.1.3.2. Methyl 2-(4-methoxyphenyl)-6,7-dimethyl-4-oxo-4H-chro-
mene-8-carboxylate (1b). This compound was prepared from 2b
using the procedure described above. (0.035 mmol, 12.0 mg, 76%)
using the procedure described above. (0.038 mmol, 13.3 mg, 85%)
white solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.06 (1H, s, H-5), 7.62
(1H, dd, J ¼ 9.3, 1.6 Hz, H-60), 7.52 (1H, dd, J ¼ 9.3, 2.4 Hz, H-30), 7.46
(1H, td, J ¼ 9.3, 2.3 Hz, H-40), 7.40 (1H, td, J ¼ 9.2, 1.9 Hz, H-50), 6.70
(1H, s, H-3), 3.97 (3H, s, OCH3), 2.41 (3H, s, CH3-11), 2.37 ppm (3H, s,
yellow solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.04 (1H, s, H-5), 7.79
(2H, d, J ¼ 8.0 Hz, H-20, H-60), 7.01 (2H, d, J ¼ 8.0 Hz, H-30, H-50), 6.72
(1H, s, H-3), 4.09 (3H, s, OCH3), 3.89 (3H, s, OCH3eC-40), 2.41 (3H, s,
CH3-11), 2.39 ppm (3H, s, CH3-12); 13C NMR (125 MHz, CDCl3):
CH3-12); 13C NMR (125 MHz, CDCl3):
d
¼ 177.4 (C, C-4), 167.0 (C, C-
13), 162.1 (C, C-2), 151.7 (C, C-9), 141.3 (C, C-7), 134.9 (C, C-6), 132.9
(C, C-20), 131.8 (CH, C-40), 131.6 (C, C-10), 131.0 (CH, C-30), 130.8 (CH,
C-60), 127.2 (CH, C-50), 126.6 (CH, C-5), 124.1 (C, C-8), 121.4 (C, C-10),
d
¼ 177.4 (C, C-4), 167.2 (C, C-13), 163.0 (C, C-2), 162.4 (C, C-40), 151.4
(C, C-9), 141.0 (C, C-7), 134.5 (C, C-6), 127.9 (2ꢁ CH, C-20 and C-60),

S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
293
112.9 (CH, C-3), 52.7 (CH3, OCH3), 19.8 (CH3, C-11),17.5 ppm (CH3, C-
12); IR (KBr): nmax ¼ 2962, 1732, 1648, 1435, 1363, 1302, 1259, 1162,
1058, 799 cmꢂ1; HRMS (ESIþ): m/z [M þ H]þ calcd for C19H16ClO4:
343.0737, found: 343.0780.
750 cmꢂ1; HRMS (ESIþ): m/z [M þ H]þ calcd for C19H15Cl2O4:
377.0347, found: 377.0378.
6.1.3.11. Methyl
6,7-dimethyl-4-oxo-2-m-tolyl-4H-chromene-8-
carboxylate (1m). This compound was prepared from 2m using
6.1.3.7. Methyl
2-(4-chlorophenyl)-6,7-dimethyl-4-oxo-4H-chro-
the procedure described above. (0.026 mmol, 10.1 mg, 65%) white
mene-8-carboxylate (1g). This compound was prepared from 2g
solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.00 (1H, s, H-5), 7.61 (2H, s br,
using the procedure described above. (0.038 mmol, 13.3 mg, 85%)
H-20, H-60), 7.35 (1H, t, J ¼ 7.0 Hz, H-50), 7.29 (1H, d, J ¼ 1.8 Hz, H-40),
6.75 (1H, s, H-3), 4.07 (3H, s, OCH3), 2.41 (3H, s, OCH3eC-30),
2.36 ppm (6H, s, CH3-11, CH3-12); 13C NMR (125 MHz, CDCl3):
white solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.00 (1H, s, H-5), 7.72
(2H, t, J ¼ 9.0 Hz, H-20, H-60), 7.45 (2H, d, J ¼ 9.0 Hz, H-30, H-50), 6.73
(1H, s, H-3), 4.07 (3H, s, OCH3), 2.39 (3H, s, CH3-11), 2.37 ppm (3H, s,
d
¼ 177.6 (C, C-4), 167.1 (C, C-13), 163.0 (C, C-2), 151.4 (C, C-9), 141.3
CH3-12); 13C NMR (125 MHz, CDCl3):
d
¼ 177.4 (C, C-4), 167.0 (C, C-
(C, C-7),138.7 (C, C-30),134.7 (C, C-6),132.4 (CH, C-40),131.5 (C, C-10),
129.0 (CH, C-50), 126.8 (CH, C-20), 126.7 (CH, C-5), 123.7 (C, C-8),
123.3 (CH, C-60), 121.5 (C, C-10), 107.2 (CH, C-3), 52.7 (CH3, OCH3),
21.5 (CH3, OCH3eC-30), 19.9 (CH3, C-11), 17.5 ppm (CH3, C-12); IR
(KBr): nmax ¼ 2950, 1731, 1645, 1436, 1362, 1302, 1247, 1196, 1062,
999, 943, 879, 848, 782, 756, 696 cmꢂ1; HRMS (ESIþ): m/z [M þ H]þ
calcd for C20H19O4: 323.1283, found: 323.1324.
13), 161.7 (C, C-2), 151.3 (C, C-9), 141.5 (C, C-7), 137.9 (C, C-40), 135.0
(C, C-6), 130.0 (C, C-10), 129.4 (2ꢁ CH, C-30 and C-50), 127.4 (2ꢁ CH,
C-20 and C-60), 126.8 (CH, C-5), 123.7 (C, C-8), 121.4 (C, C-10), 107.4
(CH, C-3), 52.7 (CH3, OCH3), 19.9 (CH3, C-11), 17.6 ppm (CH3, C-12);
IR (KBr): nmax ¼ 2963, 1716, 1661, 1435, 1366, 1259, 1058, 827,
799 cmꢂ1; HRMS (ESIþ): m/z [M þ H]þ calcd for C19H16ClO4:
343.0737, found: 343.0778.
6.1.3.12. Methyl
oxo-4H-chromene-8-carboxylate
2-(4-(methoxycarbonyl)phenyl)-6,7-dimethyl-4-
(1n). This compound was
6.1.3.8. Methyl 2-(2,4-dichlorophenyl)-6,7-dimethyl-4-oxo-4H-chro-
mene-8-carboxylate (1h). This compound was prepared from 2h
using the procedure described above. (0.033 mmol, 12.4 mg, 80%)
prepared from 2n using the procedure described above.
(0.041 mmol, 15.1 mg, 93%) white solid; 1H NMR (500 MHz, CDCl3):
white solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.02 (1H, s, H-5), 7.56
d
¼ 8.12 (2H, d, J ¼ 8.3 Hz, H-30, H-50), 8.00 (1H, s, H-5), 7.56 (2H, d,
(1H, d, J ¼ 8.3 Hz, H-60), 7.51 (1H, d, J ¼ 1.8 Hz, H-30), 7.37 (1H, dd,
J ¼ 1.8, 8.3 Hz, H-50), 6.67 (1H, s, H-3), 3.96 (3H, s, OCH3), 2.39
(3H, s, CH3-11), 2.35 ppm (3H, s, CH3-12); 13C NMR (125 MHz,
J ¼ 8.3 Hz, H-20, H-60), 6.82 (1H, s, H-3), 4.08 (3H, s, OCH3), 3.95 (3H,
s, COOCH3eC-40), 2.38 (3H, s, CH3-11), 2.37 ppm (3H, s, CH3-12); 13C
NMR (125 MHz, CDCl3):
d
¼ 177.4 (C, C-4), 167.0 (C, C-13), 166.0
CDCl3):
d
¼ 177.2 (C, C-4), 166.9 (C, C-13), 161.0 (C, C-2), 151.6 (C,
(CH3, COOCH3eC-40), 161.4 (C, C-2), 151.4 (C, C-9), 141.0 (C, C-7),
135.5 (C, C-10), 135.0 (C, C-6), 132.6 (C, C-40), 130.2 (2ꢁ CH, C-30 and
C-50), 126.8 (CH, C-5), 126.1 (2ꢁ CH, C-20 and C-60), 123.7 (C, C-8),
121.5 (C, C-10), 108.5 (CH, C-3), 52.7 (CH3, OCH3), 52.4 (CH3,
COOCH3eC-40), 19.9 (CH3, C-11), 17.6 ppm (CH3, C-12); IR (KBr):
nmax ¼ 2960, 1724, 1716, 1655, 1569, 1432, 1368, 1328, 1285, 1259,
1206, 1189, 1163, 1080, 1022, 975, 857, 801 cmꢂ1; HRMS (ESIþ): m/z
[M þ H]þ calcd for C21H19O6: 367.1182, found: 367.1226.
C-9), 141.5 (C, C-7), 137.4 (C, C-40), 135.1 (C, C-6), 133.7 (C, C-20),
131.5 (CH, C-60), 130.9 (CH, C-30), 130.0 (C, C-10), 127.6 (CH, C-50),
126.6 (CH, C-5), 124.0 (C, C-8), 121.3 (C, C-10), 113.0 (CH, C-3),
52.7 (CH3, OCH3), 19.9 (CH3, C-11), 17.5 ppm (CH3, C-12); IR (KBr):
nmax ¼ 2962, 1729, 1656, 1439, 1359, 1259, 1058, 827, 801 cmꢂ1
;
HRMS (ESIþ): m/z [M þ H]þ calcd for C19H15Cl2O4: 377.0347,
found: 377.0386.
6.1.3.9. Methyl 6,7-dimethyl-2-(4-methyl-3-nitrophenyl)-4-oxo-4H-
chromene-8-carboxylate (1i). This compound was prepared from 2i
using the procedure described above. (0.031 mmol, 11.4 mg, 73%)
6.1.3.13. Methyl
6,7-dimethyl-4-oxo-2-o-tolyl-4H-chromene-8-
carboxylate (1o). This compound was prepared from 2o using the
procedure described above. (0.036 mmol, 11.6 mg, 74%) white solid;
white solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.46 (1H, d, J ¼ 1.0 Hz,
1H NMR (500 MHz, CDCl3):
d
¼ 8.05 (1H, s, H-5), 7.48 (1H, dd,
H-20), 8.00 (1H, s, H-5), 7.90 (1H, dd, J ¼ 1.2, 7.9 Hz, H-60), 7.48 (1H,
d, J ¼ 8.0 Hz, H-50), 6.80 (1H, s, H-3), 4.14 (3H, s, OCH3), 2.68 (3H, s,
CH3eC-40), 2.40 (3H, s, CH3-11), 2.39 ppm (3H, s, CH3-12); 13C NMR
J ¼ 8.3, 1.6 Hz, H-60), 7.38 (1H, td, J ¼ 7.5, 1.4 Hz, H-40), 7.28 (2H, m,
H-3, H-50), 6.46 (1H, s, H-3), 3.94 (3H, s, OCH3), 2.45 (3H, s, CH3eC-
20), 2.38 (3H, s, CH3-11), 2.35 ppm (3H, s, CH3-12); 13C NMR
(125 MHz, CDCl3):
d
¼ 177.3 (C, C-4), 166.9 (C, C-13), 160.0 (C, C-2),
(125 MHz, CDCl3):
d
¼ 177.5 (C, C-4), 167.0 (C, C-13), 165.8 (C, C-2),
151.3 (C, C-9), 149.5 (CH, C-30), 142.1 (C, C-7), 137.2 (C, C-40), 135.3 (C,
C-6), 133.8 (C, C-50), 130.7 (C, C-10), 129.7 (CH, C-60), 126.7 (CH, C-5),
123.7 (C, C-8), 122.4 (CH, C-20), 121.4 (C, C-10), 107.8 (CH, C-3), 53.1
(CH3, OCH3), 20.71 (CH3, CH3eC-40), 19.9 (CH3, C-11), 17.6 ppm (CH3,
C-12); IR (KBr): nmax ¼ 2962, 1725, 1656, 1532, 1438, 1368, 1260,
1165, 1033, 800, 701 cmꢂ1; HRMS (ESIþ): m/z [M þ H]þ calcd for
C20H18NO6: 368.1134, found: 368.1172.
151.6 (C, C-9), 141.0 (C, C-7), 136.9 (C, C-20), 134.7 (C, C-6), 132.4 (C,
C-10),131.3 (CH, C-30),130.8 (CH, C-40),129.4 (CH, C-60),126.6 (CH, C-
5), 126.2 (CH, C-50), 124.0 (C, C-8), 121.4 (C, C-10), 111.9 (CH, C-3),
52.6 (CH3, OCH3), 20.5 (CH3, C-20), 19.8 (CH3, C-11), 17.5 ppm (CH3,
C-12); IR (KBr): nmax ¼ 2959, 1733, 1648, 1435, 1361, 1302, 1253,
1161, 1061, 850, 801, 770 cmꢂ1; HRMS (ESIþ): m/z [M þ H]þ calcd for
C20H19O4: 323.1283, found: 323.1353.
6.1.3.10. Methyl
2-(3,4-dichlorophenyl)-6,7-dimethyl-4-oxo-4H-
6.1.3.14. Methyl 6,7-dimethyl-4-oxo-2-(4-(trifluoromethyl)phenyl)-
4H-chromene-8-carboxylate (1p). This compound was prepared
from 2p using the procedure described above. (0.036 mmol,
chromene-8-carboxylate (1l). This compound was prepared from 2l
using the procedure described above. (0.028 mmol, 10.6 mg, 68%)
white solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.02 (1H, s, H-5), 7.91
11.6 mg, 76%) white solid; 1H NMR (500 MHz, CDCl3):
d
¼ 7.99 (1H,
(1H, d, J ¼ 1.8 Hz, H-20), 7.63 (1H, dd, J ¼ 1.9, 8.4 Hz, H-60), 7.57 (1H,
d, J ¼ 8.4 Hz, H-50), 6.75 (1H, s, H-3), 4.11 (3H, s, OCH3), 2.41 (3H, s,
CH3-11), 2.40 ppm (3H, s, CH3-12); 13C NMR (125 MHz, CDCl3):
s, H-5), 7.91 (2H, d, J ¼ 8.0 Hz, H-20, H-60), 7.73 (2H, d, J ¼ 8.0 Hz, H-
30, H-50), 6.80 (1H, s, H-3), 4.07 (3H, s, OCH3), 2.38 (3H, s, CH3-11),
2.37 ppm (3H, s, CH3-12); 13C NMR (125 MHz, CDCl3):
d
¼ 177.3 (C,
d
¼ 177.3 (C, C-4), 166.9 (C, C-13), 160.2 (C, C-2), 151.3 (C, C-9), 142.1
C-4), 166.9 (C, C-13), 161.9 (C, C-2), 151.3 (C, C-9),141.8 (C, C-7), 135.1
(C, C-6), 135.0 (C, C-10), 133.4 (C, JFC ¼ 32.5 Hz, C-40), 126.8 (CH, C-5),
126.4 (2CH, C-20 and C-60), 126.0 (2CH, JFC ¼ 3.5 Hz, C-30 and C-50),
123.7 (C, C-8), 123.5 (C, JFC ¼ 271.0 Hz, CF3), 121.4 (C, C-10), 108.5
(CH, C-3), 52.7 (CH3, OCH3), 19.8 (CH3, C-11), 17.5 ppm (CH3, C-12);
IR (KBr): nmax ¼ 3074, 3006, 2954, 1730, 1647, 1574, 1437, 1367, 1324,
(C, C-7), 135.9 (C, C-40), 135.2 (C, C-6), 133.7 (C, C-30), 131.5 (C, C-10),
131.1 (CH, C-50), 128.0 (C, C-20), 127.6 (CH, C-50), 126.9 (CH, C-5),
125.1 (CH, C-60), 123.6 (C, C-8), 121.4 (C, C-10), 107.9 (CH, C-3), 52.9
(CH3, OCH3), 20.0 (CH3, C-11), 17.6 ppm (CH3, C-12); IR (KBr):
nmax ¼ 2961, 1725, 1642, 1435, 1355, 1257, 1160, 1025, 869, 846, 799,

294
S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
1253, 1234, 1167, 1120, 1069, 1016, 924, 843, 758 cmꢂ1; HRMS
(ESIþ): m/z [M þ H]þ calcd for C20H16F3O4: 377.1001, found:
377.1044.
purchased from Stressgen (Victoria, British Columbia, Canada).
Antibodies for cytochrome c and caspase-7 were purchased from
BD PharMingen (San Diego, CA, USA). Anti-caspase-6 monoclonal
and anti-p21Cip1 antibodies were from Medical & Biological Labo-
ratories (Nagoya, Japan) and Millipore (Temecula, CA, USA),
respectively. Anti-cyclin D1, anti-JNK/SAPK, anti-p44/42 MAP
Kinase, anti-Phospho-p44/42 MAP Kinase (T202/Y204), anti-
p38MAPK and a phosphorylated form (T180/Y182) of p38MAPK anti-
bodies were purchased from New England BioLabs (Cell Signaling
Technology, Inc., Beverly, MA, USA). JNK/SAPK (phosphor
T183 þ Y185) antibody was purchased from Abcam (Cambridge,
UK). Secondary antibodies were from GE Healthcare UK Limited
(Little Chalfont, UK). All other chemicals were obtained from Sigma
(Saint Louis, MO, USA).
6.1.3.15. Methyl 2-(2-methoxyphenyl)-6,7-dimethyl-4-oxo-4H-chro-
mene-8-carboxylate (1q). This compound was prepared from 2q
using the procedure described above. (0.035 mmol, 11.9 mg, 76%)
white solid; 1H NMR (500 MHz, CDCl3):
d
¼ 8.00 (1H, s, H-5), 7.78
(1H, d, J ¼ 7.7 Hz, H-60), 7.41 (1H, t, J ¼ 7.9 Hz, H-40), 7.15 (1H, s, H-3),
7.05 (1H, t, J ¼ 7.5 Hz, H-50), 6.99 (1H, d, J ¼ 8.3 Hz, H-30), 4.00 (3H, s,
OCH3), 3.90 (3H, s, OCH3eC-20), 2.36 (3H, s, CH3-11), 2.33 ppm (3H,
s, CH3-12); 13C NMR (125 MHz, CDCl3):
d
¼ 178.1 (C, C-4),167.2 (C, C-
13), 160.2 (C, C-2), 158.1 (C, C-20), 151.6 (C, C-9), 140.9 (C, C-7), 134.6
(C, C-6), 132.4 (CH, C-40), 129.1 (CH, C-60), 126.5 (CH, C-5), 123.7 (C,
C-8), 121.3 (C, C-10), 120.8 (CH, C-50), 120.4 (C, C-10), 112.4 (CH, C-3),
111.7 (CH, C-30), 55.6 (CH3, OCH3eC-20), 52.6 (CH3, OCH3), 19.8 (CH3,
C-11), 17.4 ppm (CH3, C-12); IR (KBr): nmax ¼ 2953, 1726, 1648, 1617,
1567, 1492, 1454, 1433, 1362, 1310, 1255, 1228, 1202, 1165, 1066,
1014, 856, 801, 756 cmꢂ1; HRMS (ESIþ): m/z [M þ H]þ calcd for
C20H19O5: 339.1232, found: 339.1270.
6.2.2. Cell culture
HL-60 cells (DSMZ No.: ACC3, DSMZ, German Collection of
Microorganisms and Cell Cultures, Braunschweig, Germany) and
HL-60/MX1 (ATCC, American Type Culture Collection, Manassas,
VA, USA) were cultured in RPMI 1640 medium containing 10% (v/v)
heat-inactivated fetal bovine serum, 100 units mLꢂ1 penicillin and
6.1.3.16. Methylation of compound 2j. To a solution of the respective
flavonoid (15 mg) in dehydrated MeOH (5 mL), excess of dissolution
of TMSCHN2 in diethyl ether 2.0 M (0.5 mL) was added and stirred
at room temperature for 24 h, the mixture was concentrated under
vacuum, and then the resulting residue was subjected to chro-
matographic separation over silica gel with n-hexaneeEtOAc (8:2)
to furnish 1j1 (9 mg) and 1j2 (4 mg) in a ratio of (7:3).
100 m
g mLꢂ1 streptomycin at 37 ꢃC in a humidified atmosphere
containing 5% CO2. Human peripheral blood mononuclear cells
(PBMCs) were isolated from heparin-anticoagulated blood of
healthy volunteers by centrifugation with Ficoll-Paque Plus (GE
Healthcare Bio-Sciences AB, Uppsala, Sweden). PBMCs were also
stimulated with phytohemagglutinin (PHA, 2
before experimental treatment.
m
g mLꢂ1) for 48 h
6.1.3.17. Methyl 2-(3-amino-4-methylphenyl)-6,7-dimethyl-4-oxo-
6.2.3. Cytotoxicity of methyl esters of flavonoids on human myeloid
leukemia cells
4H-chromene-8-carboxylate (1j1). Yellow solid; 1H NMR (500 MHz,
CDCl3):
d
¼ 8.04 (1H, s, H-5), 7.17 (2H, s br, H-50, H-60), 7.11 (1H, s br,
The cytotoxicity of methyl esters of flavonoids on HL-60 and HL-
60/MX1 cells was analyzed by colorimetric 3-(4,5-dimethyl-2-
thiazolyl-)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay as
described [45]. Concentrations inducing a 50% inhibition of cell
growth (IC50) were determined graphically using the curve-fitting
algorithm of the computer software Prism 4.0 (GraphPad). Values
are means ꢀ S.E. from three independent experiments, each per-
formed in triplicate.
H-20), 6.73 (1H, s, H-3), 4.08 (3H, s, OCH3), 2.40 (3H, s, CH3-11), 2.39
(3H, s, CH3-12), 2.23 ppm (3H, s, CH3eC-40); 13C NMR (125 MHz,
CDCl3):
d
¼ 177.8 (C, C-4), 167.3 (C, C-13), 163.5 (C, C-2), 151.5 (C, C-
9), 145.1 (CH, C-30), 141.0 (C, C-7), 134.6 (C, C-6), 131.0 (C, C-50), 130.3
(C, C-10), 126.7 (CH, C-5), 126.5 (C, C-40), 123.7 (C, C-8), 121.6 (C, C-
10), 116.5 (CH, C-60), 112.1 (CH, C-20), 106.8 (CH, C-3), 52.7 (CH3,
OCH3), 19.9 (CH3, C-11), 17.5 ppm (2CH3, C-12 and CH3eC-40); IR
(KBr): nmax ¼ 3359, 2925, 2855, 1729, 1631, 1568, 1511, 1435, 1365,
1292, 1250, 1164, 1063, 982, 846, 808, 756, 657 cmꢂ1; HRMS (ESIþ):
m/z [M þ H]þ calcd for C20H20NO4: 338.1392, found: 338.1423.
6.2.4. Inverse PCR assay
Genomic DNA was isolated using the QIAamp DNA micro kit
(Qiagen, Hilden, Germany), incubated with shrimp alkaline
phosphatase (Takara, Shiga, Japan) for 1 h at 37 ꢃC and subse-
quently inactivated at 75 ꢃC for 30 min. Next, DNA was digested
with 24 U Xba I (Takara, Shiga, Japan) for 4 h at 37 ꢃC. After 1 h heat
inactivation at 75 ꢃC, the DNA was circularized overnight at 4 ꢃC
6.1.3.18. Methyl 6,7-dimethyl-2-(4-methyl-3-(methylamino)phenyl)-
4-oxo-4H-chromene-8-carboxylate (1j2). Yellow solid; 1H NMR
(500 MHz, CDCl3):
d
¼ 8.05 (1H, s, H-5), 7.16 (2H, s br, H-50, H-60),
7.05 (1H, s br, H-20), 6.81 (1H, s, H-3), 4.07 (3H, s, OCH3), 3.00 (3H, s,
NHCH3), 2.41 (3H, s, CH3-11), 2.39 (3H, s, CH3-12), 2.21 ppm (3H, s,
using 3 U T4 DNA ligase (Takara) in a final volume of 50
mL. A
CH3eC-40); 13C NMR (125 MHz, CDCl3):
d
¼ 177.9 (C, C-4), 167.2 (C,
fraction of the ligation product was heat inactivated and digested
with Pvu II (Takara) to abolish amplification of the wild-type MLL.
Approximately 40 ng of the circularized DNA (either Pvu II treated
or untreated) was used for the first PCR. The PCR was carried out
using conditions and primers described by Libura et al. [19]. The
two sets of nested primers used to amplify MLL and putative
fusion partners were: MF1-50TCTACAAGTGCCAGGGGTCT30; MF2-
50AATAGCATGCTGCCTGCACTGCA-CTCCTAA30; MR1-50CCCGACG
TGGATT TTCTTTA30; MR2-50GATCGTAGGATATGTCCCTTATAAA
TGACAAACTACTG CTTCC30. The nested PCR products were sepa-
rated by electrophoresis on a 1.8% agarose gel and visualized
under UV light by ethidium bromide staining.
C-13), 164.1 (C, C-2), 151.5 (C, C-9), 147.5 (CH, C-30), 140.9 (C, C-7),
134.5 (C, C-6), 130.4 (C, C-50), 130.5 (C, C-10), 126.7 (CH, C-5), 126.1
(C, C-40), 123.8 (C, C-8), 121.6 (C, C-10), 115.0 (CH, C-60), 106.8 (CH, C-
3), 106.2 (CH, C-20), 52.7 (CH3, OCH3), 30.7 (CH3, NHCH3), 19.8 (CH3,
C-11), 17.5 ppm (2CH3, C-12 and CH3eC-40); IR (KBr): nmax ¼ 3401,
2962, 1731, 1642, 1571, 1523, 1437, 1365, 1259, 1162, 1030, 845, 800,
758, 705 cmꢂ1; HRMS (ESIþ): m/z [M þ H]þ calcd for C21H22NO4:
352.1549, found: 352.1580.
6.2. Pharmacology
6.2.1. Reagents
Stock solutions of the different compounds at 100 mM were
made by dissolving them in dimethyl sulfoxide (DMSO), and
aliquots were frozen at ꢂ20 ꢃC. Antibodies for poly(ADP-ribose)
polymerase (PARP), caspase-3, caspase-8 and caspase-9 were
6.2.5. Evaluation of apoptosis
The rate of apoptotic cell death was analyzed by fluorescent
microscopy and by flow-cytometric analysis of propidium iodide
(PI)-stained nuclei as described [45].

S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
295
[9] Y. Lin, R. Shi, X. Wang, H.-M. Shen, Luteolin, a flavonoid with potentials for
cancer prevention and therapy, Curr. Cancer Drug Targets 8 (2008) 634e646.
[10] S. Rubio, J. Quintana, M. López, J.L. Eiroa, J. Triana, F. Estévez, Phenyl-
benzopyrones structure-activity studies identify betuletol derivatives as
potential antitumoral agents, Eur. J. Pharmacol. 548 (2006) 9e20.
[11] S. Rubio, J. Quintana, J.L. Eiroa, J. Triana, F. Estévez, Acetyl derivative of
quercetin 3-methyl ether-induced cell death in human leukemia cells is
amplified by the inhibition of ERK, Carcinogenesis 28 (2007)
2105e2113.
6.2.6. Analysis of DNA fragmentation
DNA isolation and gel electrophoresis were performed as
described previously [12].
6.2.7. Western blot analysis
HL-60 cells (1 ꢁ 106 mLꢂ1) were treated in the absence or
presence of methyl esters of flavonoids, 1f and 1o (10e30 mM) for
[12] F. Torres, J. Quintana, F. Estévez, 5,7,30-Trihydroxy-3,40-dimethoxyflavone-
induced cell death in human leukemia cells is dependent on caspases and
activates the MAPK pathway, Mol. Carcinog. 49 (2010) 464e475.
[13] G. Kaur, M. Stetler-Stevenson, S. Sebers, P. Worland, H. Sedlacek, C. Myers,
J. Czech, R. Naik, E. Sausville, Growth inhibition with reversible cell cycle
arrest of carcinoma cells by flavone L86-8275, J. Natl. Cancer Inst. 84 (1992)
1736e1740.
[14] L.M. Wang, D.M. Ren, Flavopiridol, the first cyclin-dependent kinase inhibitor:
recent advances in combination chemotherapy, Mini Rev. Med. Chem. 10
(2010) 1058e1070.
[15] S.J. Cutler, F.M. El-Kabbani, C. Keanne, S.L. Fisher-Shore, F.L. McCabe,
R.K. Johnson, C.D. Blanton Jr., Synthesis of flavones-8-carboxylic acid
analogues as potential antitumor agents, Eur. J. Med. Chem. 28 (1993)
407e414.
[16] S.J. Cutler, F.M. El-Kabbani, C. Keanne, S.L. Fisher-Shore, C.D. Blanton Jr., Furan
o-aminonitriles as precursors to flavones analogues, Heterocycles 31 (1990)
651e661.
[17] R. Strick, P.L. Strissel, S. Borgers, S.L. Smith, J.D. Rowley, Dietary bioflavonoids
induce cleavage in the MLL gene and may contribute to infant leukemia, Proc.
Natl. Acad. Sci. U. S. A. 97 (2000) 4790e4795.
[18] S. Barjesteh van Waalwijk van Doorn-Khosrovani, J. Janssen, L.M. Maas,
R.W. Godschalk, J.G. Nijhuis, F.J. van Schooten, Dietary flavonoids induce MLL
translocations in primary human CD34þ cells, Carcinogenesis 28 (2007)
1703e1709.
[19] J. Libura, D.J. Slater, C.A. Felix, C. Richardson, Therapy-related acute myeloid
leukemia-like MLL rearrangements are induced by etoposide in primary
human CD34þ cells and remain stable after clonal expansion, Blood 105
(2005) 2124e2131.
[20] S.J. Riedl, Y. Shi, Molecular mechanisms of caspase regulation during
apoptosis, Nat. Rev. Mol. Cell. Biol. 5 (2004) 897e907.
various time periods as indicated and harvested by centrifugation.
Cell pellets were resuspended in lysis buffer [20 mM TriseHCl (pH
7.4), 2 mM EDTA, 137 mM NaCl, 10% glycerol, 1% Triton X-100, 2 mM
tetrasodium pyrophosphate, 20 mM sodium b-glycerophosphate,
10 mM sodium fluoride, 2 mM sodium orthovanadate], supple-
mented with protease inhibitors phenylmethylsulfonyl fluoride
(PMSF, 1 mM), leupeptin, aprotinin and pepstatin A (5
m
g mLꢂ1
each) for 15 min at 4 ꢃC. Lysates were homogenized by a sonifier
(five cycles) and centrifuged at 11,000ꢁ g for 10 min at 4 ꢃC. Protein
concentration of supernatants was measured by the Bradford
method and samples containing equal amounts of proteins were
boiled in sodium dodecyl sulfate (SDS)-sample buffer for 5 min
before loading on an SDS-polyacrylamide gel (7.5% for PARP, 10% for
MAPK and 12.5% for caspases). Proteins were electrotransferred to
poly(vinylidene difluoride) (PVDF) membranes and detected as
described [45].
6.2.8. Detection of cytochrome c release from mitochondria
Release of cytochrome c from mitochondria was detected by
Western blot analysis as described [45].
6.2.9. Statistical analysis
Statistical significance of differences between control and
treated samples were calculated using Student’s t-test. P values of
<0.05 were considered significant.
[21] H.N. LeBlanc, A. Ashkenazi, ApoL/TRAIL and its death and decoy receptors, Cell
Death Differ. 10 (2003) 66e75.
[22] X. Luo, I. Budihardjo, H. Zuo, C. Slaughter, X. Wang, Bid, a Bcl-2 interacting
protein, mediates cytochrome c release from mitochondria in response to
activation of cell surface death receptors, Cell 94 (1998) 481e490.
[23] D.J. Newman, G.M. Cragg, Natural products as sources of new drugs over the
last 25 years, J. Nat. Prod. 70 (2007) 461e477.
Acknowledgments
[24] A. Huwe, R. Mazitschek, A. Giannis, Small molecules as inhibitors of cyclin-
dependent kinases, Angew. Chem. Int. Ed. 42 (2003) 2122e2138.
[25] W.G. Harker, D.L. Slade, W.S. Dalton, P.S. Meltzer, J.M. Trent, Multidrug
resistance in mitoxantrone-selected HL-60 leukemia cells in the absence of P-
glycoprotein overexpression, Cancer Res. 49 (1989) 4542e4549.
[26] M. Hollstein, K. Rice, M.S. Greenblatt, T. Soussi, R. Fuchs, T. Sorlie, E. Hovig,
B. Smith-Sorensen, R. Montesano, C.C. Harris, Database of p53 gene somatic
mutations in human tumors and cell lines, Nucleic Acids Res. 22 (1994)
3551e3555.
[27] M. Hollstein, D. Sidransky, B. Vogelstein, C.C. Harris, p53 mutations in human
cancers, Science 253 (1991) 49e53.
[28] D.W. Nicholson, N.A. Thornberry, Caspases: killer proteases, Trends Biochem.
Sci. 22 (1997) 299e306.
This work was supported by a Grant from the Spanish Ministry
of Science and Innovation and from the European Regional Devel-
opment Fund (SAF2010-21380 to F.E.). F.L. was supported by JAE-
DOC Program from the Spanish Ministry of Science and Innova-
tion and CSIC.
Appendix A. Supplementary material
Supplementary material associated with this article can be
found, in the online version, at http://dx.doi.org/10.1016/j.ejmech.
2012.07.028.
[29] A. Szewczyk, L. Wojtczak, Mitochondria as a pharmacological target, Phar-
macol. Rev. 54 (2002) 101e127.
[30] M. Van Gurp, N. Festjens, G. van Loo, X. Saelens, P. Vandenabeele, Mito-
chondrial intermembrane proteins in cell death, Biochem. Biophys. Res.
Commun. 304 (2003) 487e497.
References
[31] T.G. Cross, D. Scheel-Toellner, N.V. Henriquez, E. Deacon, M. Salmon, J.M. Lord,
Serine/threonine protein kinases and apoptosis, Exp. Cell. Res. 256 (2000)
34e41.
[32] C. Yu, Z. Wang, P. Dent, S. Grant, MEK1/2 inhibitors promote Ara-C-induced
apoptosis but not loss of DJm in HL-60 cells, Biochem. Biophys. Res. Com-
mun. 286 (2001) 1011e1018.
[1] B.H. Havsteen, The biochemistry and medical significance of the flavonoids,
Pharmacol. Therapeut. 96 (2002) 67e202.
[2] J.A. Ross, C.M. Kasum, Dietary flavonoids: bioavailability, metabolic effects,
and safety, Annu. Rev. Nutr. 22 (2002) 19e34.
[3] W. Ren, Z. Qiao, H. Wang, H.L. Zhu, L. Zhang, Flavonoids: promising anticancer
agents, Med. Res. Rev. 23 (2003) 519e534.
[33] T.T.T. Nguyen, E. Tran, T.H. Nguyen, P.T. Do, T.H. Huynh, H. Huynh, The role of
activated MEK-ERK pathway in quercetin-induced growth inhibition and
apoptosis in A549 lung cancer cells, Carcinogenesis 25 (2004) 647e659.
[34] J. Hayakawa, M. Ohmichi, H. Kurachi, H. Ikegami, A. Kimura, T. Matsuoka,
H. Jikihara, D. Mercola, Y. Murata, Inhibition of extracellular signal-regulated
protein kinase or c-Jun N-terminal protein kinase cascade, differentially
activated by cisplatin, sensitizes human ovarian cancer cell line, J. Biol. Chem.
274 (1999) 31648e31654.
[35] D.L. Persons, E.M. Yazlovitskaya, W. Cui, J.C. Pelling, Cisplatin-induced acti-
vation of mitogen-activated protein kinases in ovarian carcinoma cells:inhi-
bition of extracellular signal-regulated kinase activity increases sensitivity to
cisplatin, Clin. Cancer Res. 5 (1999) 1007e1014.
[4] W. Watson, J. Cai, D. Jones, Diet and apoptosis, Ann. Rev. Nutr. 108 (2000)
153e164.
[5] U. Wenzel, S. Kuntz, M. Brendel, H. Daniel, Dietary flavone is
a potent
apoptosis inducer in human colon carcinoma cells, Cancer Res. 60 (2000)
3823e3831.
[6] L. Teofili, L. Pierelli, M.S. Iovino, G. Leone, G. Scambia, R. De Vincenzo,
P. Benedetti-Panici, G. Menichella, E. Macri, M. Piantelli, F.O. Ranelletti,
L.M. Larocca, The combination of quercetin and cytosine arabinoside syner-
gistically inhibits leukemic cell growth, Leuk. Res. 16 (1992) 497e503.
[7] Y.Q. Wei, X. Zhao, Y. Kariya, H. Fukata, K. Teshigawara, A. Uchida, Induction of
apoptosis by quercetin: involvement of heat shock protein, Cancer Res. 54
(1994) 4952e4957.
[36] A. Mandic, K. Viktorsson, T. Heiden, J. Hansson, M.C. Shoshan, The MEK1
inhibitor PD98059 sensitizes C8161 melanoma cells to cis-platin-induced
apoptosis, Melanoma Res. 11 (2001) 11e19.
[8] E.J. Middleton, C. Kandaswami, T.C. Theoharides, The effect of plant flavonoids
on mammalian cells: implications for inflammation, heart disease and cancer,
Pharmacol. Rev. 52 (2000) 673e751.

296
S. Rubio et al. / European Journal of Medicinal Chemistry 55 (2012) 284e296
[37] R.J. Davis, Signal transduction by the JNK group of MAP kinases, Cell 103
(2000) 239e252.
[38] T. Zarubin, J. Han, Activation and signaling of the p38 MAP kinase pathway,
Cell. Res. 15 (2005) 11e18.
[42] P. Juo, C.J. Kuo, S.E. Reynolds, R.F. Konz, J. Raingeaud, R.J. Davis, H.P. Biemann,
J. Blenis, Fas activation of the p38 mitogen-activated protein kinase signalling
pathway requires ICE/CED-3 family proteases, Mol. Cell. Biol. 17 (1997)
24e35.
[39] A. Galán, M.L. García-Bermejo, A. Troyano, N.E. Vilaboa, E. de Blas,
M.G. Kazanietz, P. Aller, Stimulation of p38 mitogen-activated protein kinase
is an early regulatory event for the cadmium-induced apoptosis in human
promonocytic cells, J. Biol. Chem. 275 (2000) 11418e11424.
[40] T. Shimizu, T. Nakazato, M.J. Xian, M. Sagawa, Y. Ikeda, M. Kizaki, Resveratrol
induces apoptosis of human malignant B cells by activation of caspase-3 and
p38 MAP kinase pathways, Biochem. Pharmacol. 71 (2006) 742e750.
[41] C.C. Franklin, S. Srikanth, A.S. Kraft, Conditional expression of mitogen-
activated protein kinase phosphatase-1, MKP-1, is cytoprotective
against UV-induced apoptosis, Proc. Natl. Acad. Sci. U. S. A. 95 (1998)
3014e3019.
[43] E.H. Walker, M.E. Pacold, O. Perisic, L. Stephens, P.T. Hawkins, M.P. Wymann,
R.L. Williams, Structural determinants of phosphoinositide 3-kinase inhibition
by wortmannin, LY294002, quercetin, myricetin, and staurosporine, Mol. Cell.
6 (2000) 909e919.
[44] K.W. Lee, N.J. Kang, Y.S. Heo, E.A. Rogozin, A. Pugliese, M.K. Hwang,
G.T. Bowden, A.M. Bode, H.J. Lee, Z. Dong, Raf and MEK protein kinases are
direct molecular targets for the chemopreventive effect of quercetin, a major
flavonoid in red wine, Cancer Res. 68 (2008) 946e955.
[45] O. Burmistrova, J. Quintana, J.G. Díaz, F. Estévez, Astragalin heptaacetate-
induced cell death in human leukemia cells is dependent on caspases and
activates the MAPK pathway, Cancer Lett. 309 (2011) 71e77.