5894
S. Harusawa et al. / Tetrahedron Letters 53 (2012) 5891–5894
312, 663; (c) Lafontaine, D. A.; Wilson, T. J.; Zhao, Z.; Lilley, D. M. J. J. Mol. Biol.
2002, 323, 23; (d) Lipfert, J.; Ouellet, J.; Norman, D. G.; Doniach, S.; Lilley, D. M.
J. Structure 2008, 16, 1357.
3. (a) Zhao, Z.; McLeod, A.; Harusawa, S.; Araki, L.; Yamaguchi, M.; Kurihara, T.;
Lilley, D. M. J. J. Am. Chem. Soc. 2005, 127, 5026; (b) Wilson, T. J.; Ouellet, J.;
Zhao, Z.; Harusawa, S.; Araki, L.; Kurihara, T.; Lilley, D. M. J. RNA 2006, 12, 980;
(c) Lilley, D. M. J. Biol. Chem. 2007, 388, 699.
4. Perrotta, A. T.; Shih, I.; Been, M. D. Science 1999, 286, 123.
5. (a) Araki, L.; Harusawa, S.; Yamaguchi, M.; Yonezawa, S.; Taniguchi, N.; Lilley,
D. M. J.; Zhao, Z.; Kurihara, T. Tetrahedron Lett. 2004, 45, 2657; (b) Araki, L.;
Harusawa, S.; Yamaguchi, M.; Yonezawa, S.; Taniguchi, N.; Lilley, D. M. J.; Zhao,
Z.; Kurihara, T. Tetrahedron 2005, 61, 11976; (c) Araki, L.; Morita, K.;
Yamaguchi, M.; Zhao, Z.; Wilson, T. J.; Lilley, D. M. J.; Harusawa, S. J. Org.
Chem. 2009, 74, 2350; (d) Araki, L.; Zhao, Z.; Lilley, D. M. J.; Harusawa, S.
Heterocycles 2010, 81, 1861; (e) Harusawa, S.; Fujii, K.; Nishiura, M.; Araki, L.;
Usami, Y.; Zhao, Z.; Lilley, D. M. J. Heterocycles 2011, 83, 2041.
6. For recent reviews on tetrazoles, see: (a) Bhatt, U. Five-membered Heterocycles
with Four Heteroatoms Tetrazoles In Modern Heterocyclic Chemistry; Alvarez-
Builla, J., Vaquero, J. J., Barluenga, J., Eds.; Wiley-VCH: Weinheim, 2011; Vol. 3,
pp 1401–1430; (b) Herr, R. J. Bioorg. Med. Chem. 2002, 10, 3379; (c) Bräse, S.;
Gil, C.; Knepper, K.; Zimmermann, V. Angew. Chem., Int. Ed. 2005, 44, 5188; (d)
Butler, R. N. Tetrazoles In Comprehensive Heterocyclic Chemistry II; Katritzky, A.
R., Rees, C. W., Scriven, E. F. V., Eds.; Pergamon: Oxford, 1996; Vol. 4, pp 621–
678.
7. (a) Popsavin, M.; Torovic´, L.; Spaic´, S.; Stankov, S.; Kapor, A.; Tomic´, Z.;
Popsavin, V. Tetrahedron 2002, 58, 569; (b) Kobe, J.; Prhavc, M.; Hohnjec, M.;
Townsend, L. B. Nucleosides Nucleotides 1994, 13, 2209.
8. Yoshimura, Y.; Hamaguchi, N.; Yashiki, T. J. Antibiot. 1986, 39, 1329.
9. Saneyoshi, H.; Seio, K.; Sekine, M. J. Org. Chem. 2005, 70, 10453.
10. 1a: oil; 1H NMR (500 MHz, CDCl3) d 1.01–1.26 (21H, m), 1.84 (1.05H, d,
J = 6.5 Hz), 1.85 (0.45H, d, J = 6.5 Hz), 1.88 (1.05H, d, J = 6.5 Hz), 1.90 (0.45H, d,
J = 6.5 Hz), 2.35 (0.6H, t, J = 6.6 Hz), 2.60 (1.4H, t, J = 6.3 Hz), 2.56–2.68 (2H, m),
3.06–3.11 (1H, m), 3.37–3.47 (1H, m), 3.54–3.62 (2H, m), 3.64–3.86 (2H, m),
3.78 (4.2H, s), 3.79 (1.8H, s), 3.88–4.00 (2H, m), 4.28–4.30 (0.7H, m), 4.33–4.35
(0.3H, m), 4.45–4.52 (1H, m), 4.56–4.62 (1H, m), 5.26–5.30 (1H, m), 6.78–6.82
(4H, m), 7.16–7.44 (10H, m); 31P NMR (202 MHz, CDCl3) d 149.8, 149.9, 150.4,
150.5; HRMS (FABMS:TEOA+NaCl) m/z calcd for C46H60N7O9P+Na [M+Na]+
908.4088, found 908.4085.
11. (a) Heerding, J. M.; Lampe, J. W.; Darges, J. W.; Stamper, M. L. Bioorg. Med. Chem.
1995, 5, 1839; (b) Mcdonald, I. M.; Black, J. M.; Buck, I. M.; Dunstone, D. J.;
Griffin, E. P.; Harper, E. A.; Hull, R. A. D.; Kalindjian, S. B.; Lilley, E. J.; Linney, I.
D.; Pether, M. J.; Roberts, S. P.; Shaxted, M. E.; Spencer, J.; Steel, K. I. M.; Sykes,
D. A.; Walker, M. K.; Watt, G. F.; Wright, L. W.; Wright, P. T.; Xun, W. J. Med.
Chem. 2007, 50, 3101.
12. 1b: oil; 1H NMR (400 MHz, CDCl3) d 0.11 (1.8H, s), 0.13 (2.1H, s), 0.14 (2.1H, s),
0.92 (8.4H, d, J = 7.2 Hz), 0.98 (3.6H, d, J = 6.8 Hz), 1.08–1.18 (9H, m), 1.19 (9H,
s), 1.92–2.04 (1H, m), 2.18–2.30 (2H, m), 2.53–2.67 (1H, m), 2.98–3.14 (2H, m),
3.19–3.38 (2H, m); 3.48–3.64 (3H, m), 3.74–4.22 (5H, m), 3.78 (4.2H, s), 3.79
(1.8H, s), 6.40 (0.6H, s), 6.41 (1.4H, s), 6.80–6.86 (4H, m), 7.16–7.48 (9H, m); 31
P
NMR (120 MHz, CDCl3) d 148.6, 151.2; HRMS (FABMS: TEOA+NaCl) m/z calcd
for C50H73N6O9PSi+Na [M+Na]+ 983.4844, found 983.4841.
13. (a) Fujitake, M.; Harusawa, S.; Araki, L.; Yamaguchi, M.; Lilley, D. M. J.; Zhao, Z.;
Kurihara, T. Tetrahedron 2005, 61, 4689; (b) Fujitake, M.; Harusawa, S.; Zhao, Z.;
Kurihara, T. Bull. Osaka Univ. Pharm. Sci. 2007, 1, 107; (c) Harusawa, S.; Fujitake,
M.; Kurihara, T.; Zhao, Z.; Lilley, D. M. J. Mass Determination of
Phosphoramidites. In Current Protocols in Nucleic Acid Chemistry; Beaucage, S.
L., Bergstrom, D. E., Herdewijn, P., Matsuda, A., Eds.; John Wiley & Sons: New
York, 2006; pp 10.11.1–10.11.16; (d) Fujitake, M.; Harusawa, S. Bull. Osaka
Univ. Pharm. Sci. 2011, 5, 49.
14. (a) Oligoribonucleotides were synthesized on an Applied Biosystems 394
instrument using 20-O-tBDMS PA chemistry on Applied Biosystems LV 200
polystyrene 20-deoxythymidine columns. A coupling time of 12 min was used.
0.5 M 5-ethylthio-1H-tetrazole in acetonitrile was used as an activator and
0.1 M iodine/water was used as an oxidiser.; (b) Oligoribonucleotides
containing tetrazole modification were deprotected using 75% aqueous
ammonia (35%) in ethanol for 17 h at rt and then evaporated to dryness.
Oligoribonucleotides were redissolved in 0.3 ml of 1 M TBAF in THF to remove
t-BDMS, and agitated at rt for 16 h prior to desalting by NAP-10 columns
(GEHealthcare). Following ethanol precipitation, an aliquot (0.5 OD) of
oligoribonucleotides was loaded on 20% denaturing polyacrylamide gel with
7 M urea and 90 mM TBE, and electrophoresed at 25 W for 2.5 h with
bromophenyl blue (BPB) and xylene cyanol (XC) as makers. The gel was
Figure 2. (A) Analysis of the products of RNA synthesis by gel electrophoresis.14
Lane 1 VS substrate wtG638; Lane 2 G638C0Tez; Lane 3 G638C2Tez. (B) HPLC profile
of G638C2Tez. Desired 25mer has a retention-time of 14 min.15
with Applied Biosystems 394 synthesiser with stepwise coupling
yield over 97%.14 Demonstrated here is the denaturing gel image
for wild type substrate and C0- and C2-tetrazole substituted
(G638C0Tez and G638C2Tez) strands at the same position of the se-
quence as well as the HPLC profile15 of G638C2Tez, as shown in
Figure 2.
Further investigation on the application of 1a and 1b in ribo-
zyme studies is under way and will be published in due course.
Acknowledgment
This work was supported in part by a Grant-in-Aid for Scientific
Research [Grant No.2159030 (to S.H.)] from JSPS, 2009–2013.
visualized by UV shadowing over
a F254 TLC plate.; (c) Sequences of
oligoribonucleotides synthesized; Wild type: GCGCGAAGGGCGUCGUCGC
CCCGAdT; C0Tez-strand: GCGCGAAGGGCGUCGUCGCCCC(C0Tet)AdT; C2Tez-
strand: GCGCGAAGGGCGUCGUCGCCCC(C2Tez)AdT.
References and notes
15. It was analyzed on an Ace C18–300 column, eluted (1 mL/min) with buffer A
(0.1 M TEAA, pH 7.0) and then eluted with a linear gradient from buffer A to
100% buffer B (MeCN) over a period of 60 min.
1. Lilley, D. M. J.; Eckstein, F. In Ribozymes and RNA Catalysis; Royal Society of
Chemistry: Cambridge, 2008.
2. (a) Wilson, T. J.; McLeod, A. C.; Lilley, D. M. J. EMBO J. 2007, 26, 2489; (b)
Lafontaine, D. A.; Wilson, T. J.; Norman, D. G.; Lilley, D. M. J. J. Mol. Biol. 2001,