Rational design and synthesis of 4-substituted 2-pyridin-2-ylamides with inhibitory effects on SH2 domain-containing inositol 5′-phosphatase 2 (SHIP2)

Article abstract of DOI:10.1016/j.ejmech.2013.01.014

Novel 4-substituted 2-pyridin-2-ylamides were developed using in-silico ligand-based drug design (LBDD) in an attempt to identify inhibitors of SH2-containing 5′-inositol phosphatase 2 (SHIP2), which is implicated in insulin-resistant type 2 diabetes. Among the compounds synthesized, N-[4-(4-chlorobenzyloxy)pyridin-2-yl]-2-(2,6-difluorophenyl)- acetamide (CPDA, 4a) was identified as a potent SHIP2 inhibitor. CPDA was found to enhance in vitro insulin signaling through the Akt pathway more efficiently than the previously reported SHIP2 inhibitor AS1949490, and ameliorated abnormal glucose metabolism in diabetic (db/db) mice.

Full text of DOI:10.1016/j.ejmech.2013.01.014

European Journal of Medicinal Chemistry 62 (2013) 649e660
Contents lists available at SciVerse ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Original article
Rational design and synthesis of 4-substituted 2-pyridin-
2-ylamides with inhibitory effects on SH2 domain-containing
inositol 50-phosphatase 2 (SHIP2)
Yoshinori Ichihara a, Ryohei Fujimura b, Hiroshi Tsuneki a, Tsutomu Wada a,
**
,
c
a
Kentaro Okamoto a, Hiroaki Gouda c , Shuichi Hirono , Kenji Sugimoto ,
***
Yuji Matsuya a, Toshiyasu Sasaoka a , Naoki Toyooka
,
b,d,
*
a Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194, Japan
b Graduate School of Science and Technology for Research, University of Toyama, Toyama 930-8555, Japan
c School of Pharmacy, Kitasato University, 5-9-1 Shirokane, Minato-ku, Tokyo 108-8641, Japan
d Graduate School of Innovative Life Science, University of Toyama, Toyama 930-8555, Japan
a r t i c l e i n f o
a b s t r a c t
Article history:
Novel 4-substituted 2-pyridin-2-ylamides were developed using in-silico ligand-based drug design (LBDD)
in an attempt to identify inhibitors of SH2-containing 50-inositol phosphatase 2 (SHIP2), which is impli-
cated in insulin-resistant type 2 diabetes. Among the compounds synthesized, N-[4-(4-chlorobenzyloxy)
pyridin-2-yl]-2-(2,6-difluorophenyl)- acetamide (CPDA, 4a) was identified as a potent SHIP2 inhibitor.
CPDA was found to enhance in vitro insulin signaling through the Akt pathway more efficiently than the
previously reported SHIP2 inhibitor AS1949490, and ameliorated abnormal glucose metabolism in diabetic
(db/db) mice.
Received 10 September 2012
Received in revised form
3 January 2013
Accepted 11 January 2013
Available online 28 January 2013
Keywords:
Ó 2013 Elsevier Masson SAS. All rights reserved.
Ligand-based drug design (LBDD)
SH2-containing 50-inositol phosphatase 2
(SHIP2)
N-[4-(4-Chlorobenzyloxy)Pyridin-2-yl]-2-
(2,6-difluorophenyl)-acetamide (CPDA)
1. Introduction
As insulin resistance plays a fundamental role in the pathogenesis of
type 2 diabetes, treatment with insulin-sensitizing agents could be
The prevalence of type 2 diabetes mellitus is increasing world-
wide. Although the numbers of anti-diabetic drugs in clinical use are
also increasing, their therapeutic outcome remains insufficient [1].
an ideal therapeutic strategy. Nevertheless, only a few thiazolidi-
nediones/peroxisome proliferator-activated receptor agonists,
g
such as pioglitazone, are available as insulin-sensitizing therapy [2].
Insulin is a hormone that reduces blood glucose levels by pro-
moting glucose uptake in the adipose tissue and skeletal muscle,
and suppressing glucose production in the liver. The biological
actions of insulin are initiated by binding to the insulin receptor,
leading to phosphorylation of insulin-receptor substrates at tyro-
sine residues, and subsequent activation of phosphatidyl inositol 3
(PI3) kinase. Activated PI3 kinase acts as a lipid kinase and produces
PI(3,4,5)P3 from PI(4,5)P2, resulting in activation (phosphorylation)
of Akt in the insulin metabolic-signaling pathway [3]. Impairment
of this pathway causes severe insulin resistance and glucose
intolerance in mice [4].
Abbreviations: ADME, absorption, distribution, metabolism, and excretion; AR,
aromatic ring; CPDA, N-[4-(4-chlorobenzyloxy)pyridin-2-yl]-2-(2,6-difluorophenyl)-
acetamide; DA, hydrogen-bonding donor/acceptor; DMEM, Dulbecco’s modified Eagle
medium; FBS, fetal bovine serum; GTT, glucose-tolerance test; HA, hydrogen-bonding
acceptor; HD, hydrogen-bonding donor; HP, hydrophobic atom; LBDD, ligand-based
drug design; MD, molecular dynamics; PEPCK, phosphoenolpyruvate carboxykinase;
PI3, phosphatidyl inositol 3; RMSD, root-mean-square deviation; RT-PCR, reverse
transcription-polymerase chain reaction; SHIP2, SH2 domain-containing inositol 50-
phosphatase 2; TNF, tumor necrosis factor.
* Corresponding author. Graduate School of Science and Technology for Research,
University of Toyama, 3190 Gofuku, Toyama 930-8555, Japan. Tel.: þ8176 445 6859.
** Corresponding author. Tel.: þ81 3 3444 6161.
We previously identified SH2 domain-containing inositol
50-phosphatase 2 (SHIP2) as an endogenous negative regulator of
insulin signaling [5,6]. SHIP2 hydrolyzes PI(3,4,5)P3 to PI(4,5)P2 and
attenuates insulin signaling [7e10], whereas inhibition of SHIP2 in
*** Corresponding author. Tel.: þ81 76 434 7550.
E-mail addresses: godah@pharm.kitasato-u.ac.jp (H. Gouda), tsasaoka@
pha.u-toyama.ac.jp (T. Sasaoka), toyooka@eng.u-toyama.ac.jp (N. Toyooka).
0223-5234/$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved.
http://dx.doi.org/10.1016/j.ejmech.2013.01.014

650
Y. Ichihara et al. / European Journal of Medicinal Chemistry 62 (2013) 649e660
the liver ameliorated glucose intolerance in diabetic animals [11,12],
and SHIP2-knockout mice showed resistance to diet-induced obesity
[13]. In addition, SHIP2 expression was increased in the adipose tis-
sue, skeletal muscle, and brain of diabetic (db/db) mice [14,15]. SHIP2
is therefore considered to have great potential as a drug target for
treating obesity and type 2 diabetes [16]. However, only a limited
number of compounds possessing SHIP2-inhibitory effects have
been produced to date [17e19].
In the present study, we developed four types of compound
(A-1, A-2, B-1, and B-2; Fig. 1) with new scaffolds using in-silico
ligand-based drug design (LBDD), based on the known SHIP2 in-
hibitors AS1949490 [17] and NGD-61338 [18]. We also synthesized
28 derivatives of the designed compounds, and examined their
effects on insulin-induced Akt phosphorylation, which is a crucial
step in insulin metabolic signaling that is negatively regulated by
SHIP2, in order to clarify the structureeactivity relationship. In vivo
experiments revealed that N-[4-(4-chlorobenzyloxy)pyridin-2-yl]-
2-(2,6-difluorophenyl)acetamide (CPDA, 4a) greatly improved
abnormal glucose metabolism in diabetic animals. Our LBDD
approach thus provided a series of novel, potent SHIP2 inhibitors
that could be valuable lead compounds for developing insulin-
sensitizing drugs.
Dynamics and Sampling (CAMDAS) [20]. This program, developed in
our laboratory, generates energetically stable conformations of
a target molecule by performing high-temperature MD calculations
and sampling conformations along the MD trajectory. CAMDAS then
clusters similar conformations based on the values of dihedral an-
gles defined before calculation. In total, six (nine) dihedral angles for
AS1949490 (NGD-61338) were used to cluster similar conforma-
tions (arrows in Fig. 2). We finally obtained a total of 2668 (6819)
distinct conformations for AS1949490 (NGD-61338) using CAMDAS.
Next, alignment was carried out between 2668 conformations
for AS1949490 and 6819 conformations for NGD-61338 using SU-
PERPOSE [21]. This molecular overlay programwas developed in our
laboratory based on the premise that compounds binding to the
same site of a protein possess common 3D physicochemical fea-
tures. Two molecules are superposed based on their respective
physicochemical properties by treating a pseudo-molecule con-
sisting of functional atoms instead of a real molecule. The properties
of the functional atoms are divided into five types, comprising ar-
omatic rings (ARs), hydrophobic atoms (HPs), hydrogen-bonding
donors (HDs), hydrogen-bonding acceptors (HAs), and hydrogen-
bonding donors/acceptors (DAs), each of which is represented as
ꢀ
a sphere with a predefined radius (1.0 or 0.5 A). This makes it pos-
sible to superpose two molecules with different chemical struc-
tures. The functional atoms for AS1949490 and NGD-61338 were
defined according to our previously published criteria [22].
SUPERPOSE used translational and rotational operations to
generate a number of relative orientations between conformations
of AS1949490 and NGD-61338, and calculated their scores. When
functional atoms with the same properties overlapped, points were
added to the score, and points were subtracted when functional
atoms with different properties overlapped. The orientation with
the highest score was adopted.
We obtained a total of 18,193,092 (i.e., 2668 multiplied by 6819)
different alignments between AS1949490 and NGD-61338. The
scores for the superposition of these two molecules ranged from 11
to 17. A total of 63 alignments with a top score of 17 were clustered
with respect to the superposition of the two molecules, providing
four different patterns of alignment between AS1949490 and
NGD-61338. A visual check of the four patterns was then performed
to select relevant alignments, in which functional groups with
hydrogen-bonding properties (i.e., carbonyl and amide groups) su-
perposed between AS1949490 and NGD-61338 were oriented in
a parallel fashion. We then extracted one relevant type, for which the
2. Results and discussion
2.1. Rational design of candidate compounds as novel SHIP2
inhibitors
When we started our project, the crystal structure of the SHIP2
catalytic domain had not been reported. Therefore, we used LBDD
techniques to design candidate compounds as novel SHIP2 in-
hibitors. Our LBDD strategy was to obtain new scaffolds by merging
the chemical structures of known SHIP2 inhibitors based on their
three-dimensional (3D) alignment. For this purpose, we selected
two known competitive inhibitors of SHIP2.
AS1949490 was the first reported inhibitor identified by high-
throughput screening at Astellas Pharma Inc [17] and possesses
the most potent inhibitory activity (IC50 ¼ 0.62
mM) of those so far
reported. NGD-61338 is a SHIP2 inhibitor from NeoGenesis Phar-
maceuticals Inc [18] that also exhibits a relatively strong inhibitory
activity (IC50 ¼ 1.1
mM). We therefore anticipated that merging
these two inhibitors might allow us to design a compound with
potent inhibitory activity against SHIP2.
Initially, we performed conformational analysis of AS1949490
and NGD-61338 using Conformational Analyzer with Molecular
Fig. 2. Chemical structures and functional atoms for SUPERPOSE calculation of
AS1949490 and NGD-61338. The dihedral angles used to cluster similar conformers in
CAMDAS calculations are indicated by green arrows. The dihedral angle constrained to
be trans in MD calculations is indicated by red dashed arrows. The large circles rep-
ꢀ
ꢀ
resent 1 A and the small circles represent 0.5 A with respect to the property radii of the
functional atoms.
Fig. 1. Chemical structure of targeted scaffold used for actual synthesis.

Y. Ichihara et al. / European Journal of Medicinal Chemistry 62 (2013) 649e660
651
representative alignment with the smallest value for the root-mean-
square deviation (RMSD) of the distance between every pair of
functional atoms is shown in Fig. 3A. This alignment was a possible
candidate for the relative orientation between AS1949490 and
NGD-61338 in the active site of SHIP2.
additional SUPERPOSE calculations between the conformation of
AS1949490 shown in Fig. 3A and conformational ensembles of the
four compounds generated by CAMDAS. The SUPERPOSE results
between AS1949490 and each of the four compounds (A-1, A-2, B-1,
and B-2) are included in the Supporting Information, and indicated
that all four compounds could mimic the 3D physicochemical fea-
tures of AS1949490 well. In the following section, these four com-
pounds and their derivatives with respect to two benzene rings
were synthesized and evaluated in vitro.
Finally, we carried out novel scaffold design for the new SHIP2
inhibitor using the resulting alignment. To obtain candidate com-
pounds that could be readily synthesized, we used the relatively
simplerchemicalstructure of AS1949490 as a basis, andreplacedone
of its functional groups with that of NGD-61338 to design a new
scaffold. The thiophene-2-carboxamide group of AS1949490 was
found to correspond to the pyridin-2-amine group of NGD-61338
(Fig. 3A). Based on this observation, we postulated that a new scaf-
fold could be designed by replacing the thiophene-2-carboxamide
group of AS1949490 with the pyridin-2-amine group. We therefore
devised a new scaffold in which the benzyl and the (4-chlorobenzyl)
oxy groups derived from AS1949490 were attached to the amine and
the 4-position of the pyridin-2-amine group derived from NGD-
61338, respectively (Fig. 3B). For accessibility, the targeted scaffold
used for actual synthesis included four basic chemical structures
hereafter termed A-1 (4c), A-2 (4b), B-1 (8g) and B-2 (8f).
2.2. Chemistry
The synthesis of 4aeq, including A-1 (4c), A-2 (4b), and their
derivatives, began with commercially available 4-nitoropyridine
N-oxide (1), which was converted to the known benzyl ethers
(2aec) [23,24]. Treatment of 2aec with t-butylamine in the pres-
ence of TsCl provided the pyridines (3aec). Deprotection of the
t-butyl group on 3aec with TFA followed by condensation of the
resulting amine with appropriate carboxylic acid furnished the
target compounds (4aeq) (Scheme 1).
The amides 8aek, including B-1 (8g), B-2 (8f), and their de-
rivatives, were also synthesized starting from the benzyl ethers
(6aec [25]) derived from the commercially available ethyl iso-
nicotinate (5) in two steps via pyridines (7aec) using the same
procedure as for 4aeq. The chemical structures of 4aeq and 8aek
are given in the Supporting Information (Scheme 2).
In these compounds, the attachment of the benzyl (or ethyl-
benzyl) groupto pyridin-2-amine was mediated bya carbonyl group
intended to mimic that in the thiophene-2-carboxamide group of
AS1949490. The adequacy of A-1, A-2, B-1, and B-2 was confirmed by
2.3. Pharmacological activity: effects on insulin signaling
To evaluate the potential of the presently synthesized com-
pounds as SHIP2 inhibitors, we performed an in vitro screening test
to analyze changes in SHIP2 activity indirectly. To this end, since
insulin’s metabolic action is closely related to the activity of Akt, we
investigated changes in insulin-induced phosphorylation of Akt
after treatment with each compound under insulin-resistant con-
ditions, because SHIP2 inhibition causes an increase in PI(3,4,5)P3,
leading to phosphorylation (activation) of the direct downstream
target Akt [3,7] Particularly in 3T3-L1 adipocytes, insulin-induced
phosphorylation of Akt2, which is a major isoform of Akt that me-
diates insulin metabolic signaling [26,27], is attenuated by tumor
necrosis factor (TNF)
phosphorylation of Akt2 [9]. Therefore, to mimic insulin resistance,
3T3-L1 adipocytes were pretreated with TNF in the present assay.
We observed that phosphorylation of Akt at Thr308 in response to
insulin was attenuated by treatment with TNF (Fig. 4). AS1949490
a [10], and SHIP2 preferentially regulates the
a
a
and 12 (4a, 4b, 4e, 4j, 4k, 4l, 8b, 8f, 8g, 8i, 8j, and 8k) of the 28
compounds significantly enhanced the insulin-induced Akt phos-
phorylation in 3T3-L1 adipocytes treated with TNFa (Fig. 4).
These 12 compounds comprised five A-1-type (4a, 4e, 4j, 4k,
and 4l), one A-2-type (4b), three B-1-type (8i, 8k, and 8g), and three
B-2-type (8b, 8f, and 8j) chemical structures, suggesting that all of
the designed basic scaffolds shown in Fig.1 could be useful to design
novel SHIP2 inhibitors. The chloride atom in the (4-chlorobenzyl)
oxy group seemed to be important for the enhancement of inhib-
itory activity against SHIP2, because its deletion tended to decrease
the inhibitory activity (note the differences of the effects between
4a and 4o for A-1-type, 4b and 4m for A-2-type, 8c and 8g for
B-1-type, and 8b and 8f for B-2-type). Both of the known inhibitors
AS1949490 and NGD-61338 also possess chloride atoms in the
corresponding position, as shown in Fig. 3A, which again suggests
their importance for inhibitory activity. Furthermore, di-subs-
titution on the R2 and R5 positions by a fluorine atom for A-1-type
might also be important (note the differences of the effects be-
tween 4a and 4c, and 4a and 4d). In fact, 4a (CPDA) possessing both
the R1 substitution by a chloride atom and the R2/R5 di-substitution
Fig. 3. (A): Representative alignment between AS1949490 (gray) and NGD-61338
(purple) derived from SUPERPOSE calculation. Only the functional atoms overlaid
between AS1949490 and NGD-61338 are displayed. (B): Design of new scaffold for
SHIP2 inhibitor. The upper portion shows only the pyridin-2-amine group of NGD-
61338 and the benzyl and (4-chlorobenzyl)oxy groups of AS1949490 in the align-
ment of Fig. 3A.

652
Y. Ichihara et al. / European Journal of Medicinal Chemistry 62 (2013) 649e660
Scheme 1. Synthesis of amides (4aeq). a: (4-substituted) benzyl alcohol, NaH, DMF, 100 ꢀC; b: t-butylamine, TsCl, CH2Cl2, rt; c: TFA, CH2Cl2, rt; d: EDC, DMAP, carboxylic acid,
CH2Cl2, rt.
Scheme 2. Synthesis of amides (8aek). a: LiAlH4, THF, reflux; b: (4-substituted) benzyl chloride, NaH, DMF, rt; c: mCPBA, CH2Cl2, rt; d: t-butylamine, TsCl, CH2Cl2, rt; e: TFA, CH2Cl2,
rt; f: EDC, DMAP, carboxylic acid, CH2Cl2, rt.
by fluorine atoms exhibited the most potent inhibitory activity
against SHIP2 of all the synthesized compounds. As we used the
cell-based assay for evaluation of compounds in this study, the role
of these chloride and fluorine atoms should be analyzed from the
perspective of absorption, distribution, metabolism, and excretion
(ADME) properties, such as membrane permeation, as well as
inhibitoreSHIP2 interactions in future investigations.
Next, we performed a direct comparison between the effects of
CPDA (4a) and AS1949490 on the insulin-induced Akt phosphor-
ylation in 3T3-L1 adipocytes treated with TNFa (Fig. 5). Pretreat-
ment with CPDA or AS1949490 significantly ameliorated insulin-
induced phosphorylation of Akt: the relative phosphorylation
levels in the presence of CPDA or AS1949490 were 1.3-fold or 1.2-
fold greater than those in control cells treated with TNF
a
plus
2.5
2
**
*
**
** **
**
** ** ** ** ** ** *
1.5
1
0.5
0
-
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
Insulin
TNFα
+
+
AS
4c 4p 4b 4m 8g 8c 8f 8b 4d 4n 4a 4o 8h 8d 8e 8a 4i 4j 4k 4l 8j 8i 8k 4e 4f 4g 4h 4q
Inhibitor
(CPDA)
Fig. 4. Screening tests to evaluate the inhibitory effects of novel 4-substituted 2-pyridin-2-ylamides on lipid phosphatase SHIP2 in 3T3-L1 adipocytes. Cultured 3T3-L1 adipocytes
were serum starved for 16 h in the presence of TNF (20 ng/mL), and then treated either with a novel synthesized compound (10 M), AS1949490 (10 M), or vehicle for 15 min.
Subsequently, the cells were stimulated with 17 nM insulin for 2 h. Phosphorylation of Akt at Thr308 was analyzed by western blotting as a surrogate indicator of SHIP2-inhibition
efficacy. Data are expressed as fold change relative to the control (TNF
þ insulin), and values are mean ꢁ SE. n ¼ 5e31 per group. *P < 0.05, **P < 0.01 vs. cells treated with
TNF
þ insulin (control), determined by the Student’s t-test.
a
m
m
a
a

Y. Ichihara et al. / European Journal of Medicinal Chemistry 62 (2013) 649e660
653
pAkt
Akt
pAkt
Akt
3
2.5
2
*
*
**
**
**
**
**
2
1
1.5
1
0.5
0
Insulin
0
-
+
+
+
+
+
+
+
Insulin
-
-
-
+
+
+
AS
TNFα
Inhibitor
CPDA CPDA AS
inhibitor
AS CPDA
Fig. 6. CPDA exhibited a higher potency than AS1949490 in enhancing insulin-induced
Akt phosphorylation in cultured rat cortical neuronal cells. Primary cultured neuronal
Fig. 5. CPDA exhibited a higher potency than AS1949490 in enhancing insulin-induced
Akt phosphorylation in 3T3-L1 adipocytes treated with TNF . 3T3-L1 adipocytes were
serum starved for 16 h in the presence of TNF (20 ng/mL), and then treated with CPDA
(4a, 10 M), AS1949490 (AS, 10 M), or vehicle for 15 min. Subsequently, the cells were
cells from rat cerebral cortex were pretreated with CPDA (4a, 10
mM), AS1949490 (AS,
a
10 M), or vehicle for 15 min, and then stimulated with 1 nM insulin for 5 min. Insulin-
m
a
induced Akt phosphorylation at Thr308 was analyzed by western blotting. Data are
expressed as fold change relative to the control (insulin alone), and values are
mean ꢁ SE. n ¼ 3e4 per group. *P < 0.05, **P < 0.01, determined by ANOVA with the
Bonferroni test.
m
m
stimulated with 17 nM insulin for 2 h. Insulin-induced Akt phosphorylation at Thr308
was analyzed by western blotting. Data are expressed as fold change relative to the
control (TNF
determined by ANOVA with the Bonferroni test.
a
þ insulin), and values are mean ꢁ SE. n ¼ 19 per group. **P < 0.01,
rate-limiting enzymes of gluconeogenesis in the liver of db/db
mice. The expression levels of phosphoenolpyruvate carbox-
ykinase (PEPCK) (Fig. 8) and glucose 6-phosphatase (data not
shown) were significantly suppressed by CPDA administration,
and similar changes were caused by the administration of
AS1949490. These results demonstrate that the in vivo anti-
diabetic effects of CPDA are comparable with those of AS1949490
possessing the most potent inhibitory activity among known
SHIP2 inhibitors.
insulin in the absence of CPDA, respectively. The ameliorating ef-
fects of CPDA were significantly greater than those of AS1949490.
These results indicate that CPDA is a novel potent SHIP2 inhibitor
that can effectively ameliorate insulin resistance in 3T3-L1
adipocytes.
Insulin signaling in the cerebral cortex is also known to be
negatively regulated by SHIP2 [15]. When primary cultured neu-
ronal cells from the rat cerebral cortex were pretreated with CPDA
or AS1949490, the phosphorylation levels of Akt at Thr308 in
response to insulin were 2.2-fold or 1.5-fold higher than those in
control cells treated with insulin alone, respectively (Fig. 6). Again,
the enhancing effects of CPDA were significantly greater than those
of AS1949490.
To investigate further the in vivo effect, CPDA and AS1949490
were orally administered to C57BL/6J and db/db mice (300 mg/kg
twice daily). Neither CPDA nor AS1949490 affected fasting blood
glucose levels in C57BL/6J mice (Table 1). By contrast, fasting glu-
cose levels were significantly decreased following treatment with
either CPDA or AS1949490 in db/db mice. In addition, the HOMA-R
index of insulin resistance tended to decrease in the CPDA-treated
db/db mice. Body weight, food intake, epididymal fat weight, and
liver weight were not affected by either reagent.
To compare the effects of CPDA and AS1949490 on whole-body
glucose metabolism, we conducted a glucose-tolerance test (GTT).
C57BL/6J mice showed normal glucose tolerance, and CPDA and
AS1949490 did not affect levels in the blood after glucose loading
(Fig. 7A). By contrast, db/db mice showed abnormal elevation of
blood glucose levels during the GTT. The glucose intolerance in
db/db mice was significantly ameliorated by the administration
of CPDA for 10 days, and these effects were comparable with
those of AS1949490 (Fig. 7B). The glucose areas under the
curves in db/db mice treated with CPDA or AS1949490 were
decreased by 16% or 14%, respectively, when compared to vehicle
control. As fasting serum glucose levels are mainly regulated by
hepatic glucose production, we analyzed the expression levels of
3. Conclusion
In order to develop potent inhibitors of SHIP2, a promising
therapeutic target in type 2 diabetes [16], we produced novel
4-substituted 2-pyridin-2-ylamides using LBDD based on
AS1949490 and NGD-61338, and investigated their ameliorative
effect against insulin resistance in vitro. Among 28 newly synthe-
sized compounds, 12 (4a, 4b, 4e, 4j, 4k, 4l, 8b, 8f, 8g, 8i, 8j, and 8k)
showed apparent amelioration of insulin resistance, suggesting
that our LBDD strategy could be useful in scaffold design for
novel SHIP2 inhibitors with potent inhibitory activity. The
structureeactivity relationships, particularly for CPDA (4a) with 4o,
suggested that a chloride atom was the best substituent at the R1
position. Moreover, di-substitution on the R2 and R5 positions by
fluorine atoms appeared to increase the inhibitory potency when
comparing the structures of 4a with 4c and 4d. CPDA exhibited
a greater potency to enhance insulin signaling through Akt than
AS1949490 in our in-vitro assays. Moreover, this compound sig-
nificantly improved the abnormal glucose metabolism in diabetic
(db/db) mice. We therefore consider CPDA to be a valuable tool for
in-silico drug design to develop a more efficient SHIP2 inhibitor.
Recently, the crystal structure of the catalytic domain of SHIP2 has
been uncovered (PDB ID: 3NR8) [28]. The molecular docking study
of 4a against SHIP2 will be performed in a future study for the
structural optimization of 4a with the aim of creating a more effi-
cient SHIP2 inhibitor.

654
Y. Ichihara et al. / European Journal of Medicinal Chemistry 62 (2013) 649e660
Table 1
Changes in metabolic parameters in mice treated with CPDA and AS1949490.
C57BL/6J
db/db
Control
AS1949490
CPDA
Control
AS1949490
CPDA
Body weight (g)
Food intake (g/day)
Liver weight (g)
Epididymal WAT (g)
Plasma glucose (mg/dL)
Serum insulin (ng/mL)
HOMA-R
23.2 ꢁ 0.4
3.72 ꢁ 0.23
0.74 ꢁ 0.03
0.03 ꢁ 0.0
78 ꢁ 6
23.0 ꢁ 0.8
4.10 ꢁ 0.37
0.73 ꢁ 0.05
0.02 ꢁ 0.0
87 ꢁ 6
23.4 ꢁ 0.3
3.94 ꢁ 0.19
0.86 ꢁ 0.05
0.02 ꢁ 0.0
88 ꢁ 2
39.2 ꢁ 0.6
6.06 ꢁ 0.36
1.57 ꢁ 0.04
1.82 ꢁ 0.1
106 ꢁ 6
40.1 ꢁ 0.6
6.50 ꢁ 0.36
1.80 ꢁ 0.05
1.75 ꢁ 0.1
77 ꢁ 8*
39.4 ꢁ 0.7
5.34 ꢁ 0.48
1.67 ꢁ 0.08
1.86 ꢁ 0.0
83 ꢁ 3**
0.25 ꢁ 0.11
0.69 ꢁ 0.3
0.10 ꢁ 0.02
0.27 ꢁ 0.1
0.21 ꢁ 0.06
0.59 ꢁ 0.2
7.30 ꢁ 1.10
24.7 ꢁ 3.7
9.95 ꢁ 1.26
23.8 ꢁ 3.4
6.86 ꢁ 1.02
18.2 ꢁ 3.0
Mice were orally (twice/day) administrated with CPDA (4a, 300 mg/kg/day) or AS1949490 (300 mg/kg/day) in C57BL/6J and diabetic db/db mice. Body weight and food intake
were analyzed at day 10. The weights of liver and epididymal white adipose tissue (WAT), fasting plasma glucose and serum insulin levels were measured at day 15 in C57BL/6J
mice and day 12e13 in db/db mice. Data values are means ꢁ SE. n ¼ 5e8 per group. *P < 0.05, **P < 0.01 vs. vehicle control, determined by ANOVA with Bonferroni test.
4. Experimental
4.1.1.1. 4-(4-Chlorobenzyloxy)pyridine 1-oxide (R1 ¼ Cl, 2a) [23].
1H NMR (400 MHz CDCl3)
(5H, m), 6.84 (2H, dd, J ¼ 7.3, 2.0 Hz), 5.06 (2H, s).
According to this procedure, the following known benzyl ethers
were prepared.
d
: 8.13 (2H, dd, J ¼ 7.3, 2.0 Hz), 7.42e7.24
4.1. Chemistry
General melting points are uncorrected. Flash chromatogra-
phy was performed on Kanto Kagaku silica gel 60N. NMR spectra
were recorded on a JEOL a-GX 400 spectrometer using CDCl3 as
4.1.1.2. 4-(4-Fluorobenzyloxy)pyridine 1-oxide (R1 ¼ F, 2b) [23].
the solvent. Chemical shifts (
d
) are given in ppm downfield from
Yield: 89%; 1H NMR (400 MHz CDCl3)
7.41e7.09 (4H, m), 6.86 (2H, dd, J ¼ 7.3, 2.2 Hz), 5.06 (2H, s).
d
: 8.14 (2H, dd, J ¼ 7.3, 2.2 Hz),
TMS and referenced to CHCl3 (7.26 ppm) as an internal standard.
Peak multiplicities are designated by the following abbrevia-
tions: s, singlet; d, doublet; t, triplet; q, quartet; m, multiplet; br,
broad and coupling constants in (J) Hz. High-resolution mass
spectral data were obtained on a JEOL MStation JMS-700. All
commercial reagents were used as received unless otherwise
noted.
4.1.1.3. 4-Benzyloxypyridine 1-oxide (R1 ¼ H, 2c) [24]. Yield: 89%;
1H NMR (400 MHz CDCl3)
m), 6.87 (2H, d, J ¼ 7.4 Hz), 5.10 (2H, s).
d
: 8.13 (2H, d, J ¼ 7.4 Hz), 7.44e7.38 (5H,
4.1.2. General procedure for the synthesis of pyridines (3aec)
To a stirred solution of 2a (236 mg, 1.0 mmol) in CH2Cl2 (10 mL)
were added t-butylamine (0.53 mL, 5.0 mmol) and TsCl (381 mg,
2.0 mmol) at 0 ꢀC, and the reaction mixture was stirred at 0 ꢀC for
10 min. To the reaction mixture were added t-butylamine (0.11 mL,
1.0 mmol) and TsCl (95 mg, 0.5 mmol), and then after 10 min, t-
butylamine (0.11 mL, 1.0 mmol) and TsCl (95 mg, 0.5 mmol) were
added. The resulting mixture was stirred at room temperature for
1 h. The reaction was quenched with satd. NaHCO3 (aq), and the
organic layer was separated. The aqueous mixture was extracted
with CH2Cl2 (10 mL ꢂ 3), and the organic layer and extracts were
combined, dried over K2CO3, and evaporated to give residue, which
was chromatographed on silica gel (15 g, CH2Cl2 in the presence of
small amounts of Et3N) to give 3a (273 mg, 94%) as a colorless solid.
4.1.1. General procedure for the synthesis of benzyl ethers (2aec)
To a stirred solution of 4-chlorobenzyl alcohol (143 mg,
1.0 mmol) in DMF (5 mL) was added NaH (60%, 44 mg, 1.1 mmol) at
0 ꢀC, and the resulting solution was stirred at room temperature for
0.5 h. To the reaction mixture was added 1 (140 mg, 1.0 mmol),
followed by heating at 100 ꢀC for 15 h. After cooling, the solvent was
removed under reduced pressure, and the residue was chromato-
graphed on silica gel (15 g, CH2Cl2:MeOH ¼ 10:1) to give 2a
(175 mg, 87%) as a colorless solid.
A
B
C57BL/6J
db/db
400
300
200
100
0
500
400
300
200
100
0
4.1.2.1. t-Butyl[4-(4-chlorobenzyloxy)pyridin-ꢃ21-yl]amine (R1
¼
Cl,
control
;
1H NMR (400 MHz
AS1949490
CPDA
3a). Mp: 88e90 ꢀC; IR (KBr) 3352, 1570 cm
CDCl3)
d
: 7.91 (1H, d, J ¼ 5.9 Hz), 7.35 (4H, m), 6.21 (1H, dd,
*
*
J ¼ 5.9 Hz, J ¼ 2.1 Hz), 5.98 (1H, d, J ¼ 2.1 Hz), 5.01 (2H, s), 4.53 (1H,
**
1.5
1
0
30
60
90
120
0
30
60
90
120
Time (min)
Time (min)
30000
20000
10000
0
60000
40000
20000
0
**
**
*
**
0.5
0
control AS1949490 CPDA
control AS1949490 CPDA
control AS1949490 CPDA
Fig. 7. Ameliorating effects of CPDA and AS1949490 against glucose intolerance in
diabetic (db/db) mice. Mice were orally administrated CPDA (300 mg/kg), AS1949490
(300 mg/kg), or vehicle twice daily for 13 days (A, C57BL/6J mice) or 10 days (B, db/db
mice). GTT was performed under 6-h fasting condition. Upper, plasma glucose levels
before and after the glucose injection. Lower, area under the curve (AUC). Values are
mean ꢁ SE. n ¼ 5e8 per group. *P < 0.05, **P < 0.01 vs. vehicle control, determined by
ANOVA with the Bonferroni test.
Fig. 8. Inhibitory effects of CPDA and AS1949490 on PEPCK expression in the liver of
db/db mice. Diabetic (db/db) mice were orally administrated CPDA (300 mg/kg),
AS1949490 (300 mg/kg), or vehicle twice daily for 12e13 days. After fasting overnight,
the expression levels of the gluconeogenic gene PEPCK in the liver were analyzed by
real-time PCR. Data are expressed as fold change relative to the vehicle control, and
values are mean ꢁ SE. n ¼ 7e8 per group. *P < 0.05, **P < 0.01 vs. vehicle control,
determined by ANOVA with the Bonferroni test.

Y. Ichihara et al. / European Journal of Medicinal Chemistry 62 (2013) 649e660
655
br), 1.22 (9H, s); 13C NMR (100 MHz CDCl3)
134.70,133.86,128.73,128.67,100.78, 93.34, 68.59, 50.52, 29.41; MS
(EI): m/z 290 (Mþ); HRMS (EI): calcd for C16H19ClN2O : 290.1186,
found : 290.1180.
According to this procedure, the following pyridines were
prepared.
d
: 165.47, 159.83, 149.24,
153.46, 148.25, 140.37, 134.14, 134.08, 128.93, 128.82, 128.51, 128.19,
126.27, 108.22, 99.58, 69.09, 39.11, 31.11; MS (EI): m/z 366 (Mþ);
HRMS (EI): calcd for C21H19ClN2O2: 366.1135, found : 366.1152, Anal.
Calcd for C21H19ClN2O2 C, 68.76, H, 5.22, N, 7.64. Found C, 68.56, H,
5.32, N, 7.81.
4.1.3.3. N-[4-(4-Chlorobenzyloxy)pyridin-2-yl]-2-phenylacetamide
4.1.2.2. t-Butyl[4-(4-fluorobenzyloxy)pyridin-2-yl]amine (R1 ¼ F, 3b).
(R1 ¼ Cl, R2, R3, R4, R5 ¼ H, n ¼ 1, 4c). Yield: 59%; mp: 124e127 ꢀC;
Yield: 98%; mp: 83e85 ꢀC; IR (KBr) 3398, 1564 cmꢃ1
;
1H
IR (KBr) 3421, 1670, 1604, 1576 cmꢃ1 1H NMR (400 MHz CDCl3)
; d:
NMR (400 MHz CDCl3)
d
: 7.90 (1H, d, J ¼ 5.7 Hz), 7.38e7.36 (2H, m),
8.01 (1H, d, J ¼ 5.8 Hz), 7.94 (1H, s), 7.83 (1H, br), 7.40e7.26 (9H, m),
7.15e7.04 (2H, m), 6.22 (1H, dd, J ¼ 5.7 Hz, J ¼ 2.0 Hz), 5.99 (1H, d,
6.61 (1H, dd, J ¼ 5.8, 2.4 Hz), 5.08 (2H, s), 3.74 (2H, s); 13C NMR
J ¼ 2.0 Hz), 4.98 (2H, s), 4.56 (1H, br), 1.38 (9H, s); 13C NMR
(100 MHz CDCl3) d: 169.69, 166.29, 152.89, 148.49, 134.17, 134.11,
(100 MHz CDCl3)
d
: 165.55, 162.48 (d, J ¼ 246.5 Hz), 159.86, 149.28,
133.77, 129.43, 129.21, 128.94, 128.86, 127.72, 108.44, 99.19, 69.11,
44.97; MS (EI): m/z 352 (Mþ); HRMS (EI): calcd for C20H17ClN2O2:
352.0979, found: 352.0968, Anal. Calcd for C20H17ClN2O2 C, 68.09,
H, 4.86, N, 7.94. Found C, 68.05, H, 4.69, N, 8.08.
131.97 (d, J ¼ 3.3 Hz), 129.28 (d, J ¼ 8.3 Hz), 115.49 (d, J ¼ 22.3 Hz),
100.82, 93.35, 68.72, 50.50, 29.42; MS (EI): m/z 274 (Mþ); HRMS
(EI): calcd for C16H19FN2O: 274.1482, found: 274.1487.
4.1.2.3. t-Butyl(4-benzyloxypyridin-2-yl)amine (R1
Yield: 93%; mp: 76e78 ꢀC; IR (KBr) 3354, 1570 cmꢃ1
(400 MHz CDCl3)
(1H, dd, J ¼ 5.9 Hz, J ¼ 1.7 Hz), 6.02 (1H, s), 5.05 (2H, s), 4.70 (1H, br),
1.38 (9H, s); 13C NMR (100 MHz CDCl3)
: 165.90, 159.62, 148.75,
136.11, 128.65, 128.18, 127.42, 101.05, 93.41, 69.58, 50.60, 29.44; MS
(EI): m/z 256 (Mþ); HRMS (EI): calcd for C16H20N2O: 256.1576,
found: 256.1571.
¼
H, 3c).
4.1.3.4. N-[4-(4-Chlorobenzyloxy)pyridin-2-yl]-2-(4-fluorophenyl)
acetamide (R1 ¼ Cl, R2, R3, R5 ¼ H, R4 ¼ F, n ¼ 1, 4d). Yield: 50%; mp:
;
1H NMR
d
: 7.89 (1H, d, J ¼ 5.9 Hz), 7.41e7.28 (6H, m), 6.24
153e156 ꢀC; IR (KBr) 3271, 1699, 1607, 1582 cmꢃ1 1H NMR
;
(400 MHz CDCl3)
d
: 8.02 (1H, d, J ¼ 5.9 Hz), 7.93 (1H, d, J ¼ 2.2 Hz),
d
7.90 (1H, br), 7.38e7.26 (6H, m), 7.10e7.06 (2H, m), 6.62 (1H, dd,
J ¼ 5.9, 2.2 Hz), 5.08 (2H, s), 3.71 (2H, s); 13C NMR (100 MHz CDCl3)
d
: 169.51, 166.35, 162.23 (d, J ¼ 246.5 Hz), 152.94, 148.45, 134.19,
134.05, 130.99 (d, J ¼ 8.3 Hz), 129.59 (d, J ¼ 3.3 Hz), 128.93, 128.86,
115.99 (d, J ¼ 21.5 Hz), 108.52, 99.34, 69.13, 43.86; MS (EI): m/z 370
(Mþ); HRMS (EI): calcd for C20H16ClFN2O2: 370.0885, found:
370.0872, Anal. Calcd for C20H16ClFN2O2 C, 64.78, H, 4.35, N, 7.55.
Found C, 65.03, H, 4.46, N, 7.67.
4.1.3. General procedure for the synthesis of amides (4aeq)
To a stirred solution of 3a (692 mg, 2.4 mmol) in CH2Cl2 (20 mL)
was added TFA (6.0 mL, 34.0 mmol), and the reaction mixture was
refluxed for 48 h. After cooling, the reaction was quenched with 10%
NaOH (aq), and the organic layer was separated. The aqueous layer
was extracted with CH2Cl2 (10 mL ꢂ 3). The organic layer and ex-
tracts were combined, dried over K2CO3, and evaporated to give
amine, which was used directly in the next step. To a stirred solu-
tion of the amine obtained above in CH2Cl2 (15 mL) were added 2,6-
difluorophenylacetic acid (409 mg, 2.4 mmol), EDC$HCl (910 mg,
2.62 mmol), and DMAP (29 mg, 0.24 mmol), and the resulting so-
lution was stirred at room temperature for 24 h. The reaction was
quenched with satd. NaHCO3 (aq), and the organic layer was sep-
arated. The aqueous layer was extracted with CH2Cl2 (10 mL ꢂ 3).
The organic layer and extracts were combined, dried over K2CO3,
and evaporated to give residue, which was chromatographed on
silica gel (25 g, hexane:acetone ¼ 8:1) to give 4a (925 mg, 84%) as
a colorless solid.
4.1.3.5. N-[4-(4-Chlorobenzyloxy)pyridin-2-yl]-2-(2-trifluoromethyl-
phenyl)acetamide (R1 ¼ Cl, R2 ¼ CF3, R3, R4, R5 ¼ H, n ¼ 1, 4e).
Yield: 61%; mp: 117e119 ꢀC; IR (KBr) 3247, 1686, 1609, 1585 cmꢃ1
;
1H NMR (400 MHz CDCl3)
d
: 8.00 (1H, d, J ¼ 5.9 Hz), 7.90 (1H, d,
J ¼ 2.2 Hz), 7.80 (1H, br), 7.70 (1H, d, J ¼ 7.8 Hz), 7.57 (1H, t,
J ¼ 7.8 Hz), 7.48 (1H, d, J ¼ 7.8 Hz), 7.70 (1H, t, J ¼ 7.8 Hz), 7.35e7.21
(4H, m), 6.60 (1H, dd, J ¼ 5.9, 2.2 Hz), 5.05 (2H, s), 3.91 (2H, s); 13C
NMR (100 MHz CDCl3) d: 168.77, 166.37, 153.29, 148.22, 134.07,
134.00, 132.25, 132.14, 128.89 (q, J ¼ 30.0 Hz), 128.86, 128.77, 127.64,
126.22 (q, J ¼ 5.5 Hz), 125.39 (q, J ¼ 6.1 Hz), 124.46 (q, J ¼ 288.6 Hz),
108.53, 99.54, 69.04, 40.98; MS (EI): m/z 420 (Mþ); HRMS (EI): calcd
for C21H16ClN2O2F3: 420.0853, found: 420.0856, Anal. Calcd for
C21H16ClN2O2F3 C, 59.94, H, 3.83, N, 6.66. Found C, 59.74, H, 3.63,
N, 6.44.
4.1.3.1. N-[4-(4-Chlorobenzyloxy)pyridin-2-yl]-2-(2,6-difluorophenyl)
acetamide (R1 ¼ Cl, R2, R5 ¼ F, R3, R4 ¼ H, n ¼ 1, 4a, CPDA). Mp: 122e
4.1.3.6. N-[4-(4-Chlorobenzyloxy)pyridin-2-yl]-2-(3-trifluoromethyl-
phenyl)acetamide (R1 ¼ Cl, R2, R4, R5 ¼ H, R3 ¼ CF3, n ¼ 1, 4f).
Yield: 71%; mp: 88e92 ꢀC; IR (KBr) 3242, 1661, 1607, 1573 cmꢃ1; 1H
125 ꢀC; IR (KBr) 3186, 1701, 1614, 1585 cmꢃ1 1H NMR (400 MHz
;
CDCl3)
(5H, m), 6.98e6.92 (2H, m), 6.63 (1H, dd, J ¼ 5.7, 2.3 Hz), 5.07 (2H, s),
3.82 (2H, s); 13C NMR (100 MHz CDCl3)
: 167.70, 166.40, 161.48 (dd,
J ¼ 256.4, 7.9 Hz), 153.31, 148.18, 134.13, 134.01, 129.33 (t, J ¼ 9.9 Hz),
128.90, 128.81, 111.32 (dd, J ¼ 24.8, 5.8 Hz), 110.58 (t, J ¼ 13.7 Hz),
108.70, 99.53, 69.09, 30.98; MS (EI): m/z 388 (Mþ); HRMS (EI): calcd
for C20H15ClF2N2O2 : 388.0790, found : 388.0778; Anal. Calcd for
C20H15ClF2N2O2 C, 61.78, H, 3.89, N, 7.21. Found C, 61.83, H, 3.77, N,
6.97.
d
: 8.28 (1H, br), 8.06 (1H, d, J ¼ 5.7 Hz), 7.94 (1H, s), 7.38e7.26
NMR (400 MHz CDCl3)
d
: 8.00 (1H, d, J ¼ 5.9 Hz), 7.94 (1H, br), 7.90
(1H, d, J ¼ 2.2 Hz), 7.56e7.47 (4H, m), 7.34e7,25 (4H, m), 6.62 (1H,
d
dd, J ¼ 5.9, 2.2 Hz), 5.05 (2H, s), 3.77 (2H, s); 13C NMR (100 MHz
CDCl3) d: 169.10, 166.51, 153.36, 148.10, 134.97, 134.16, 133.92,
132.62, 130.99 (q, J ¼ 32.0 Hz), 129.20, 128.90, 128.81, 126.04 (q,
J ¼ 3.9 Hz), 125.87 (q, J ¼ 268.0 Hz), 124.20 (q, J ¼ 3.6 Hz), 108.67,
99.95, 69.14, 43.89; MS (EI): m/z 420 (Mþ); HRMS (EI): calcd for
C21H16ClN2O2F3: 420.0853, found: 420.0858, Anal. Calcd for
C21H16ClN2O2F3 C, 59.94, H, 3.83, N, 6.66. Found C, 60.09, H, 3.81,
N, 6.67.
According tothis procedure, the following amides were prepared.
4.1.3.2. N-[4-(4-Chlorobenzyloxy)pyridin-2-yl]-3-phenylpropionamide
4.1.3.7. N-[4-(4-Chlorobenzyloxy)pyridin-2-yl]-2-o-tolylacetamide
(R1 ¼ Cl, R2, R3, R4, R5 ¼ H, n ¼ 2, 4b). Yield: 53%; mp: 121e122 ꢀC; IR
(R1 ¼ Cl, R2 ¼ Me, R3, R4, R5 ¼ H, n ¼ 1, 4g). Yield: 66%; mp: 105e
(KBr) 3283, 1701, 1607, 1574 cmꢃ1; 1H NMR (400 MHz CDCl3)
d: 8.04
107 ꢀC; IR (KBr) 3290, 1672, 1607, 1578 cmꢃ1 1H NMR (400 MHz
;
(1H, d, J ¼ 5.9 Hz), 7.95 (1H, d, J ¼ 2.2 Hz), 7.93 (1H, br), 7.41e7.20 (9H,
CDCl3)
(4H, m), 6.62 (1H, dd, J ¼ 5.9, 2.7 Hz), 5.07 (2H, s), 3.75 (2H, s), 2.32
(3H, s); 13C NMR (100 MHz CDCl3)
: 169.70, 166.29, 152.97, 148.29,
d
: 7.97 (1H, d, J ¼ 5.9 Hz), 7.95 (1H, d, J ¼ 2.7 Hz), 7.34e7.22
m), 6.62 (1H, dd, J ¼ 5.9, 2.2 Hz), 5.11 (2H, s), 3.05 (2H, t, J ¼ 7.8 Hz),
2.69 (2H, t, J ¼ 7.8 Hz); 13C NMR (100 MHz CDCl3)
d: 172.19, 166.33,
d

656
Y. Ichihara et al. / European Journal of Medicinal Chemistry 62 (2013) 649e660
137.09, 134.11, 134.05, 132.34, 130.85, 130.44, 128.91, 128.81, 128.07,
126.72, 108.37, 99.25, 69.07, 42.78, 19.55; MS (EI): m/z 366 (Mþ).;
HRMS (EI): calcd for C21H19ClN2O2: 366.1132, found: 366.1135, Anal.
Calcd for C21H19ClN2O2 C, 68.76, H, 5.22, N, 7.64. Found C, 68.82, H,
5.30, N, 7.59.
161.39 (dd, J ¼ 248.1, 7.4 Hz), 153.58, 147.95, 131.21 (d, J ¼ 3.3 Hz),
129.39 (d, J ¼ 8.3 Hz), 129.04 (t, J ¼ 10.3 Hz), 115.39 (d, J ¼ 21.5 Hz),
111.06 (dd, J ¼ 24.8, 5.8 Hz), 110.51 (t, J ¼ 20.3 Hz), 108.51, 99.66,
69.06, 30.58; MS (EI): m/z 372 (Mþ); HRMS (EI): calcd for
C20H15F3N2O2: 372.1085, found: 372.1080, Anal. Calcd for
C20H15F3N2O2 C, 64.51, H, 4.06, N, 7.52. Found C, 64.50, H, 3.87,
N, 7.49.
4.1.3.8. N-[4-(4-Chlorobenzyloxy)pyridin-2-yl]-2-m-tolylacetamide
(R1 ¼ Cl, R2, R4, R5 ¼ H, R3 ¼ Me, n ¼ 1, 4h). Yield: 63%; mp: 86e
89 ꢀC; IR (KBr) 3234, 1660, 1603, 1576 cmꢃ1
;
1H NMR (400 MHz
4.1.3.13. N-(4-Benzyloxypyridin-2-yl)-3-phenylpropionamide (R1, R2,
CDCl3)
d
: 8.18 (1H, br), 7.97 (1H, d, J ¼ 5.9 Hz), 7.95 (1H, d,
R3, R4, R5 ¼ H, n ¼ 2, 4m). Yield: 68%; mp: 95e97 ꢀC; IR (KBr) 3198,
J ¼ 2.4 Hz), 7.34e7.32 (4H, m), 7.16e7.09 (4H, m), 6.59 (1H, dd,
1701, 1603, 1578 cmꢃ1 1H NMR (400 MHz CDCl3)
; d: 8.34 (1H, br),
J ¼ 5.9, 2.4 Hz), 5.06 (2H, s), 3.68 (2H, s), 2.33 (3H, s); 13C NMR
8.02 (1H, d, J ¼ 5.9 Hz), 7.98 (1H, s), 7.45e7.19 (10H, m), 6.63 (1H, dd,
(100 MHz CDCl3) d: 170.13, 166.37, 153.20, 147.96, 138.64, 134.09,
J ¼ 5.9, 2.4 Hz), 5.14 (2H, s), 3.05 (2H, t, J ¼ 7.8 Hz), 2.68 (2H, t,
133.97,133.82, 130.04,128.88,128.85,128.77,128.22,126.30,108.34,
99.33, 69.05, 44.61, 21.29; MS (EI): m/z 366 (Mþ); HRMS (EI): calcd
for C21H19ClN2O2: 366.1131, found: 366.1135, Anal. Calcd for
C21H19ClN2O2 C, 68.76, H, 5.22, N, 7.64. Found C, 68.79, H, 5.06,
N, 7.56.
J ¼ 7.8 Hz); 13C NMR (100 MHz CDCl3)
d: 171.18, 166.63, 153.37,
148.09, 140.40, 135.57, 128.64, 128.52, 128.31, 128.22, 127.66, 126.26,
108.25, 99.63, 69.94, 39.15, 31.14; MS (EI): m/z 332 (Mþ); HRMS (EI):
calcd for C21H20N2O2: 332.1525, found: 332.1518, Anal. Calcd for
C21H20N2O2 C, 75.88, H, 6.06, N, 8.43. Found C, 75.85, H, 6.01, N, 8.37.
4.1.3.9. N-[4-(4-Fluorobenzyloxy)pyridin-2-yl]-3-phenylpropionamide
4.1.3.14. N-(4-Benzyloxypyridin-2-yl)-2-(4-fluorophenyl)acetamide
(R1, R2, R3, R5 ¼ H, R4 ¼ F, n ¼ 1, 4n). Yield: 57%; mp: 108e111 ꢀC; IR
(KBr) 3232, 1695, 1659, 1603, 1576 cmꢃ1; 1H NMR (400 MHz CDCl3)
(R1 ¼ F, R2, R3, R4, R5 ¼ H, n ¼ 2, 4i). Yield: 71%; mp: 112e115 ꢀC; IR
(KBr) 3260, 1701, 1611, 1578 cmꢃ1; 1H NMR (400 MHz CDCl3)
d: 8.03
(1H, d, J ¼ 5.9 Hz), 8.03 (1H, br), 7.96 (1H, s), 7.44e7.20 (7H, m), 7.09
d
: 8.02 (1H, d, J ¼ 5.8 Hz), 7.94 (1H, s), 7.81 (1H, br), 7.43e7.26 (7H,
m), 7.07 (2H, t, J ¼ 8.5 Hz), 6.64 (1H, dd, J ¼ 5.8, 2.3 Hz), 5.11(2H, s),
3.71 (2H, s); 13C NMR (100 MHz CDCl3)
: 169.51, 166.63, 162.20 (d,
(2H, t, J ¼ 8.8 Hz), 6.62 (1H, dd, J ¼ 5.9, 2.4 Hz), 5.10 (2H, s), 3.05 (2H, t,
J ¼ 7.8 Hz), 2.69 (2H, t, J ¼ 7.8 Hz); 13C NMR (100 MHz CDCl3)
d:
d
171.36, 166.33, 162.50 (d, J ¼ 246.5 Hz), 153.68, 147.95, 140.35, 131.26
(d, J ¼ 3.3 Hz), 129.46 (d, J ¼ 8.3 Hz), 128.36,128.08, 126.12, 115.46 (d,
J ¼ 22.3 Hz),108.09, 99.69, 69.09, 38.82, 31.03; MS (EI): m/z 350 (Mþ);
HRMS (EI): calcd for C21H19FN2O2: 350.1431, found: 350.1432, Anal.
Calcd for C21H19FN2O2 C, 71.98, H, 5.47, N, 8.00. Found C, 71.87, H,
5.49, N, 8.03.
J ¼ 244.0 Hz), 152.94, 148.34, 135.54, 130.98 (d, J ¼ 8.3 Hz), 129.65
(d, J ¼ 3.3 Hz), 128.66, 128.34, 127.64, 115.96 (d, J ¼ 21.5 Hz), 108.55,
99.47, 69.97, 43.83; MS (EI): m/z 336 (Mþ); HRMS (EI): calcd for
C20H17FN2O2: 336.1274, found: 336.1261, Anal. Calcd for
C20H17FN2O2 C, 71.42, H, 5.09, N, 8.33. Found C, 71.39, H, 5.17,
N, 8.08.
4.1.3.10. N-[4-(4-Fluorobenzyloxy)pyridin-2-yl]-2-phenylacetamide
4.1.3.15. N-(4-Benzyloxypyridin-2-yl)-2-(2,6-difluorophenyl)aceta-
mide (R1, R3, R4 ¼ H, R2, R5 ¼ F, n ¼ 1, 4o). Yield: 46%; mp: 118e
(R1 ¼ F, R2, R3, R4, R5 ¼ H, n ¼ 1, 4j). Yield: 71%; mp: 107e108 ꢀC; IR
(KBr) 3240,1663,1612,1535 cmꢃ1; 1H NMR (400 MHz CDCl3)
d
: 8.01
121 ꢀC; IR (KBr) 3193, 1699, 1605, 1576 cmꢃ1 1H NMR (400 MHz
;
(1H, d, J ¼ 5.9 Hz), 7.96 (1H, d, J ¼ 2.3 Hz), 7.95 (1H, br), 7.42e7.26
CDCl3)
d
: 8.05 (1H, br), 7.96 (1H, d, J ¼ 5.9 Hz), 7.96 (1H, d,
(7H, m), 7.08 (2H, t, J ¼ 8.7 Hz), 6.61 (1H, dd, J ¼ 5.9, 2.3 Hz), 5.08
J ¼ 2.3 Hz), 7.42e7.25 (6H, m), 6.96 (2H, t, J ¼ 7.8 Hz), 6.65 (1H, dd,
(2H, s), 3.75 (2H, s); 13C NMR (100 MHz CDCl3)
d: 169.97, 166.28,
J ¼ 5.9, 2.3 Hz), 5.10 (1H, s), 3.82 (1H, s); 13C NMR (100 MHz CDCl3)
162.46 (d, J ¼ 247.3 Hz), 153.40, 148.10, 134.03, 131.21 (d, J ¼ 2.5 Hz),
129.41 (d, J ¼ 8.3 Hz), 129.11, 128.76, 127.23, 115.42 (d, J ¼ 21.5 Hz),
108.30, 99.53, 69.06, 44.32; MS (EI): m/z 336 (Mþ); HRMS (EI): calcd
for C20H17FN2O2: 336.1274, found: 336.1271, Anal. Calcd for
C20H17FN2O2 C, 71.42, H, 5.09, N, 8.33. Found C, 71.32, H, 5.10,
N, 8.33.
d
: 167.76, 166.71, 161.49 (dd, J ¼ 248.0, 7.4 Hz), 153.35, 148.01,
135.50, 129.25 (t, J ¼ 10.3 Hz), 128.59, 128.26, 127.60, 111.27 (dd,
J ¼ 19.0, 5.8 Hz), 110.69 (t, J ¼ 17.8 Hz), 108.69, 99.63, 69.92, 30.90;
MS (EI): m/z 354 (Mþ); HRMS (EI): calcd for C20H16F2N2O2:
354.1180, found: 354.1182, Anal. Calcd for C20H16F2N2O2 C, 67.79, H,
4.55, N, 7.91. Found C, 67.79, H, 4.34, N, 7.91.
4.1.3.11. N-[4-(4-Fluorobenzyloxy)pyridin-2-yl]-2-(4-fluorophenyl)
acetamide (R1 ¼ F, R2, R3, R5 ¼ H, R4 ¼ F, n ¼ 1, 4k). Yield: 64%; mp:
51e54 ꢀC; IR (KBr) 3261, 1693, 1609, 1583 cmꢃ1; 1H NMR (400 MHz
4.1.3.16. N-(4-Benzyloxypyridin-2-yl)-2-phenylacetamide (R1, R2, R3,
R4, R5 ¼ H, n ¼ 1, 4p). Yield: 60%; mp: 103e106 ꢀC; IR (KBr) 3234,
1661, 1603, 1574 cmꢃ1 1H NMR (400 MHz CDCl3)
; d: 8.00 (1H, d,
CDCl3)
J ¼ 2.2 Hz), 7.41e7.05 (8H, m), 6.63 (1H, dd, J ¼ 5.7, 2.2 Hz), 5.08 (2H,
s), 3.71 (2H, s); 13C NMR (100 MHz CDCl3)
: 169.74, 166.41, 162.57
d
: 8.03 (1H, d, J ¼ 5.7 Hz), 7.97 (1H, br), 7.94 (1H, d,
J ¼ 5.9 Hz), 7.97 (1H, d, J ¼ 2.3 Hz), 7.79 (1H, br), 7.43e7.26 (10H, m),
6.62 (1H, dd, J ¼ 5.9, 2.3 Hz), 5.12 (2H, s), 3.74 (2H, s); 13C NMR
d
(100 MHz CDCl3) d: 169.90, 166.49, 153.33, 148.11, 135.45, 134.01,
(d, J ¼ 247.3 Hz), 162.04 (d, J ¼ 246.3 Hz), 153.27, 148.19, 131.23 (d,
J ¼ 3.3 Hz), 130.79 (d, J ¼ 7.4 Hz), 129.74, 129.49 (d, J ¼ 8.3 Hz),
115.73 (d, J ¼ 19.0 Hz), 115.53 (d, J ¼ 21.5 Hz), 108.49, 99.59, 69.19,
43.49; MS (EI): m/z 354 (Mþ); HRMS (EI): calcd for C20H16F2N2O2:
354.1180, found: 354.1182, Anal. Calcd for C20H16F2N2O2 C, 67.79, H,
4.55, N, 7.91. Found C, 67.51, H, 4.60, N, 7.75.
129.17, 128.84, 128.52, 128.19, 127.52, 127.29, 108.35, 99.61, 69.81,
44.45; MS (EI): m/z 318 (Mþ); HRMS (EI): calcd for C20H18N2O2:
318.1368, found: 318.1341, Anal. Calcd for C20H18N2O2 C, 75.45, H,
5.70, N, 8.80. Found C, 75.41, H, 5.76, N, 9.03.
4.1.3.17. N-[4-(4-Chlorobenzyloxy)pyridin-2-yl]-2-cyclohexylacet-
amide (4q). Yield: 60%; mp: 105e107 ꢀC; IR (KBr) 3312, 2922, 1668,
4.1.3.12. 2-(2,6-Difluorophenyl)-N-[4-(4-fluorobenzyloxy)pyridin-2-
yl]acetamide (R1 ¼ F, R2, R5 ¼ F, R3, R4 ¼ H, n ¼ 1, 4l). Yield: 65%;
1603, 1576, 1450 cmꢃ1 1H NMR (400 MHz CDCl3)
; d: 8.05 (1H, br),
8.02 (1H, d, J ¼ 5.8 Hz), 7.96 (1H, d, J ¼ 2.4 Hz), 7.35e7.34 (4H, m),
mp: 55e57 ꢀC; IR (KBr) 3206, 1705, 1605, 1583 cmꢃ1 1H NMR
;
6.60 (1H, dd, J ¼ 5.8, 2.4 Hz), 5.08 (2H, s), 2.23 (2H, d, J ¼ 7.1 Hz),
(400 MHz CDCl3)
d
: 8.21 (1H, br), 8.06 (1H, d, J ¼ 5.9 Hz), 7.95 (1H, d,
1.89e0.94 (11H, m); 13C NMR (100 MHz CDCl3)
d: 171.60, 166.43,
J ¼ 2.2 Hz), 7.40e7.26 (3H, m), 7.10e7.05 (2H, m), 6.96 (2H, t,
153.17, 148.14, 134.17, 134.09, 128.99, 128.86, 108.31, 99.16, 69.13,
45.85, 35.34, 33.06, 29.68, 26.08, 26.01; MS (EI): m/z 358 (Mþ);
HRMS (EI): calcd for C20H23ClN2O2: 358.1448, found: 358.1441,
J ¼ 7.8 Hz), 6.64 (1H, dd, J ¼ 5.9, 2.2 Hz), 5.06 (2H, s), 3.82 (2H, s); 13C
NMR (100 MHz CDCl3)
d
: 167.89, 166.39, 162.45 (d, J ¼ 247.3 Hz),

Y. Ichihara et al. / European Journal of Medicinal Chemistry 62 (2013) 649e660
657
Anal. Calcd for C20H23ClN2O2 C, 66.94, H, 6.46, N, 7.81. Found C,
66.73, H, 6.55, N, 7.62.
4.1.5.1. t-Butyl(4-benzyloxymethylpyridin-2-yl)amine (R6 ¼ H, 7a).
IR (neat) 3406, 1564 cmꢃ1; 1H NMR (400 MHz CDCl3)
: 8.02 (1H, d,
d
J ¼ 5.3 Hz), 7.37e7.28 (5H, m), 6.50 (1H, d, J ¼ 5.3 Hz), 6.46 (1H, s),
4.1.4. General procedure for the synthesis of benzyl ethers (6aec)
To a stirred solution of 5 (0.22 mL, 2.0 mmol) in THF (10 mL) was
added LiAlH4 (113 mg, 3.0 mmol) at 0 ꢀC, and the resulting mixture
was refluxed for 7 h. After cooling, the reaction was quenched with
10% NaOH (aq), and the aqueous mixture was extracted with EtOAc
(10 mL ꢂ 3). The extracts were combined, dried over K2CO3, and
evaporated to give alcohol, which was used directly in the next
step. To a stirred solution of the alcohol obtained above in DMF
(5 mL) was added NaH (60%, 88 mg, 2.2 mmol) at 0 ꢀC, and the
reaction mixture was stirred at room temperature for 0.5 h. To the
reaction mixture was added benzyl chloride (0.23 mL, 2.0 mmol) at
0 ꢀC, and the reaction mixture was stirred at room temperature for
2 h. The reaction was quenched with H2O, and the aqueous mixture
was extracted with EtOAc (10 mL ꢂ 3). The extracts were combined,
dried over K2CO3, and evaporated to give residue, which was
chromatographed on silica gel (15 g, hexane:acetone ¼ 10:1) to give
6a (250 mg, 63%) as a pale yellow oil.
4.57 (2H, s), 4.44 (2H, s), 4.53 (1H, br), 1.42 (9H, s); 13C NMR
(100 MHz CDCl3) d: 158.52, 147.88, 147.79, 137.76, 128.25, 127.55,
127.51, 110.66, 106.34, 72.20, 70.60, 50.50, 29.31; MS (EI): m/z 270
(Mþ); HRMS (EI): calcd for C17H22N2O: 288.1732, found: 288.1729.
According to this procedure, the following pyridines were
prepared.
4.1.5.2. t-Butyl-[4-(4-chlorobenzyloxymethyl)pyridin-2-yl]amine
(R6 ¼ Cl, 7b). Yield: 87%; IR (neat) 3408, 1564 cmꢃ1
;
1H NMR
(400 MHz CDCl3)
d
: 8.02 (1H, d, J ¼ 5.3 Hz), 7.34e7.28 (4H, m), 6.49
(1H, d, J ¼ 5.3 Hz), 6.44 (1H, s), 4.53 (2H, s), 4.53 (2H, s), 4.51 (1H,
br), 1.42 (9H, s); 13C NMR (100 MHz CDCl3)
d: 158.66, 148.07, 147.75,
136.42, 133.46, 128.95, 128.56, 110.80, 106.40, 71.55, 70.91, 50.71,
29.46; MS (EI): m/z 304 (Mþ); HRMS (EI): calcd for C17H21ClN2O:
304.1350, found: 304.1342.
4.1.5.3. t-Butyl[4-(4-fluorobenzyloxymethyl)pyridin-2-yl]amine
(R6 ¼ F, 7c). Yield: 93%; IR (neat) 3400, 1564 cmꢃ1
;
1H NMR
4.1.4.1. 4-Benzyloxymethylpyridine (R6
(400 MHz CDCl3)
¼
H, 6a) [25]. 1H NMR
: 8.58 (2H, dd, J ¼ 4.4, 1.5 Hz), 7.38e7.28 (6H, m),
(400 MHz CDCl3)
d
: 8.02 (1H, d, J ¼ 5.4 Hz), 7.34e7.26 (2H, m), 7.05
d
(2H, d, J ¼ 8.7 Hz), 6.49 (1H, d, J ¼ 5.4 Hz), 6.44 (1H, s), 4.52 (2H, s),
4.61 (2H, s), 4.57 (2H, s).
4.48 (1H, br), 4.43 (2H, s), 1.42 (9H, s); 13C NMR (100 MHz CDCl3)
d:
According to this procedure, the following benzyl ethers were
prepared.
162.29 (d, J ¼ 245.5 Hz), 158.60, 147.94, 147.85, 133.62 (d, J ¼ 4.2 Hz),
129.39 (d, J ¼ 8.3 Hz), 126.87, 115.21 (d, J ¼ 22.2 Hz), 110.76, 106.39,
71.60, 70.77, 50.64, 29.40; MS (EI): m/z 288 (Mþ); HRMS (EI): calcd
for C17H21FN2O: 288.1638, found: 288.1626.
4.1.4.2. 4-(4-Chlorobenzyloxymethyl)pyridine (R6
Yield: 49%; IR (neat) 1602, 1491 cmꢃ1; 1H NMR (400 MHz CDCl3)
8.64 (2H, dd J ¼ 4.4, 1.7 Hz), 7.36e7.26 (6H, m), 4.56 (2H, s), 4.56
¼
Cl, 6b).
d:
4.1.6. General procedure for the synthesis of amides (8aek)
To a stirred solution of 7a (150 mg, 0.7 mmol) in CH2Cl2 (15 mL)
was added TFA (1.7 mL, 9.6 mmol), and the reaction mixture was
refluxed for 48 h. After cooling, the reaction was quenched with 10%
NaOH (aq), and the organic layer was separated. The aqueous layer
was extracted with CH2Cl2 (10 mL ꢂ 3). The organic layer and ex-
tracts were combined, dried over K2CO3, and evaporated to give
amine, which was used directly in the next step. To a stirred solu-
tion of the amine obtained above in CH2Cl2 (5 mL) were added 2,6-
difluorophenylacetic acid (120 mg, 0.7 mmol), EDC$HCl (269 mg,
1.4 mmol) and DMAP (9 mg, 0.07 mmol), and the resulting solution
was stirred at room temperature for 24 h. The reaction was
quenched with satd. NaHCO3 (aq), and the organic layer was sep-
arated. The aqueous layer was extracted with CH2Cl2 (10 mL ꢂ 3).
The organic layer and extracts were combined, dried over K2CO3,
and evaporated to give residue, which was chromatographed on
silica gel (10 g, hexane:acetone ¼ 8:1) to give 8a (149 mg, 58%) as
a colorless solid.
(2H, s); 13C NMR (100 MHz CDCl3)
d: 149.90, 147.13, 136.09, 133.67,
129.00, 128.67, 121.76, 71.93, 70.41; MS (EI): m/z 233 (Mþ); HRMS
(EI): calcd for C13H12ClNO: 233.0608, found: 233.0610.
4.1.4.3. 4-(4-Fluorobenzyloxymethyl)pyridine (R6
Yield: 70%; IR (neat) 1603, 1508 cmꢃ1; 1H NMR (400 MHz CDCl3)
8.58 (2H, dd, J ¼ 4.5, 1.6 Hz), 7.36e7.26 (4H, m), 7.08e7.04 (2H, m),
4.56 (2H, s), 4.56 (2H, s); 13C NMR (100 MHz CDCl3)
: 162.34 (d,
¼
F, 6c).
d:
d
J ¼ 246.5 Hz), 150.44, 150.14, 149.77, 147.43, 133.24 (d, J ¼ 3.3 Hz),
130.38 (d, J ¼ 8.2 Hz), 129.46, 129.37, 128.49, 128.41, 121.80, 115.27
(d, J ¼ 21.5 Hz), 71.92, 70.16; MS (EI): m/z 217 (Mþ); HRMS (EI): calcd
for C13H12FNO: 217.0903, found: 217.0891.
4.1.5. General procedure for the synthesis of pyridines (7aec)
To a stirred solution of 6a (280 mg, 1.2 mmol) in CH2Cl2 (5 mL)
was added m-CPBA (690 mg, 2.4 mmol) at 0 ꢀC, and the reaction
mixture was stirred at room temperature for 20 h. The reaction was
quenched with 10% NaOH (aq), and the organic layer was separated.
The aqueous layer was extracted with CH2Cl2 (10 mL ꢂ 3), and the
organic layer and extracts were combined, dried over K2CO3, and
evaporated to give oxide, which was used directly in the next step.
To a stirred solution of the oxide obtained above in CH2Cl2 (10 mL)
were added t-butylamine (0.62 mL, 5.9 mmol) and TsCl (450 mg,
2.4 mmol) at 0 ꢀC, and the reaction mixture was stirred at 0 ꢀC for
10 min. To the reaction mixture were added t-butylamine (0.12 mL,
1.2 mmol) and p-TsCl (112 mg, 0.6 mmol), and then after 10 min, t-
butylamine (0.12 mL,1.2 mmol) and p-TsCl (112 mg, 0.6 mmol) were
added. The resulting mixture was stirred at room temperature for
1 h. The reaction was quenched with satd. NaHCO3 (aq), and the
organic layer was separated. The aqueous mixture was extracted
with CH2Cl2 (10 mL ꢂ 3), and the organic layer and extracts
were combined, dried over K2CO3, and evaporated to give residue,
which was chromatographed on silica gel (15 g, CH2Cl2 in the
presence of small amounts of Et3N) to give 7a (311 mg, 97%) as
a colorless solid.
4.1.6.1. N-(4-Benzyloxymethylpyridin-2-yl)-2-(2,6-difluorophenyl)
acetamide (R6, R8, R9, R10 ¼ H, R7, R11 ¼ F, n ¼ 1, 8a). Mp: 84e86 ꢀC;
IR (neat) 3209, 1701, 1628, 1570 cmꢃ1; 1H NMR (400 MHz CDCl3)
d:
8.22 (1H, d, J ¼ 4.9 Hz), 8.17 (1H, s), 7.96 (1H, br), 7.36e7.28 (6H, m),
7.12 (1H, d, J ¼ 4.9 Hz), 6.96 (2H, t, J ¼ 7.8 Hz), 4.58 (2H, s), 4.54 (2H,
s), 3.83 (2H, s); 13C NMR (100 MHz CDCl3)
d: 167.53, 161.41 (dd,
J
¼ 256.4, 8.3 Hz), 151.66, 150.51, 147.39, 137.48, 129.15 (t,
J ¼ 10.3 Hz),128.35,127.72,127.67,118.14,112.58,111.16 (dd, J ¼ 24.8,
5.8 Hz),110.476 (t, J ¼ 19.4 Hz), 72.64, 70.38, 30.73; MS (EI): m/z 368
(Mþ); HRMS (EI): calcd for C21H18F2N2O2: 368.1336, found:
368.1328; Anal. Calcd for C21H18F2N2O2 C, 68.47, H, 4.93, N, 7.60.
Found C, 68.59, H, 4.76, N, 7.65.
According to this procedure, the following amides were
prepared.
4.1.6.2. N-(4-Benzyloxymethylpyridin-2-yl)-3-phenylpropionamide
(R6, R7, R8, R9, R10 R11 ¼ H, n ¼ 2, 8b). Yield: 53%; mp: 57e60 ꢀC; IR

658
Y. Ichihara et al. / European Journal of Medicinal Chemistry 62 (2013) 649e660
(KBr) 3252,1695,1612,1576 cmꢃ1; 1H NMR (400 MHz CDCl3)
d
: 8.50
(EI): m/z 366 (Mþ); HRMS (EI): calcd for C21H19ClN2O2: 366.1135,
found: 366.1115, Anal. Calcd for C21H19ClN2O2 C, 68.76, H, 5.22, N,
7.64. Found C, 68.87, H, 5.20, N, 7.66.
(1H, br), 8.20 (1H, s), 8.18 (1H, d, J ¼ 5.1 Hz), 7.38e7.09 (11H, m),
4.60 (2H, s), 4.56 (2H, s), 3.04 (2H, t, J ¼ 7.8 Hz), 2.69 (2H, t,
J ¼ 7.8 Hz); 13C NMR (100 MHz CDCl3)
d: 170.62, 151.28, 150.34,
147.85, 140.36, 137.63, 128.63, 128.51, 128.31, 127.87, 127.83, 126.39,
118.14, 111.96, 72.81, 70.59, 39.41, 31.19; MS (EI): m/z 346 (Mþ);
HRMS (EI): calcd for C22H22N2O2: 346.1681, found: 346.1683, Anal.
Calcd for C22H22N2O2 C, 76.28, H, 6.40, N, 8.09. Found C, 76.34, H,
6.43, N, 8.05.
4.1.6.8. N-[4-(4-Chlorobenzyloxymethyl)pyridin-2-yl]-2-(4-fluoro-
phenyl)acetamide (R6 ¼ Cl, R7, R8, R10, R11 ¼ H, R9 ¼ F, n ¼ 1, 8h).
Yield: 44%; mp: 82e84 ꢀC; IR (KBr) 3290, 1692, 1614, 1576 cmꢃ1; 1H
NMR (400 MHz CDCl3)
(1H, br), 7.35e7.26 (7H, m), 7.08 (1H, t, J ¼ 8.5 Hz), 4.55 (2H, s), 4.55
(2H, s), 3.73 (2H, s); 13C NMR (100 MHz CDCl3)
: 169.40, 162.15 (d,
d
: 8.20 (1H, d, J ¼ 5.1 Hz), 8.18 (1H, s), 7.81
d
4.1.6.3. N-(4-Benzyloxymethylpyridin-2-yl)-2-phenylacetamide (R6,
J ¼ 246.5 Hz), 151.42, 150.15, 147.68, 136.05, 133.56, 130.92 (d,
J ¼ 8.3 Hz), 129.70 (d, J ¼ 4.1 Hz), 129.01, 128.59, 118.21, 115.88 (d,
J ¼ 21.5 Hz), 112.16, 71.93, 70.57, 43.70; MS (EI): m/z 384 (Mþ);
HRMS (EI): calcd for C21H18ClFN2O2: 384.1041, found: 384.1048,
Anal. Calcd for C21H18ClFN2O2 C, 65.54, H, 4.71, N, 7.28. Found C,
65.41, H, 4.68, N, 7.01.
R7, R8, R9, R10 R11 ¼ H, n ¼ 1, 8c). Yield: 61%; mp: 54e57 ꢀC; IR (KBr)
3269, 1690, 1612, 1568 cmꢃ1; 1H NMR (400 MHz CDCl3)
d: 8.18 (1H,
s), 8.17 (1H, d, J ¼ 5.0 Hz), 7.82 (1H, br), 7.39e7.26 (10H, m), 7.04 (1H,
d, J ¼ 5.0 Hz), 4.59 (2H, s), 4.55 (2H, s), 3.76 (2H, s); 13C NMR
(100 MHz CDCl3) d: 169.55, 151.34, 150.33, 147.69, 137.58, 133.92,
129.37, 129.11, 128.44, 127.80, 127.75, 127.59, 118.20, 112.05, 72.72,
70.50, 44.82; MS (EI): m/z 332 (Mþ); HRMS (EI): calcd for
C21H20N2O2: 332.1524, found: 332.1524, Anal. Calcd for C21H20N2O2
C, 75.88, H, 6.06, N, 8.43. Found C, 75.83, H, 6.22, N, 8.46.
4.1.6.9. 2-(2,6-Difluorophenyl)-N-[4-(4-fluorobenzyloxymethyl)pyr-
idin-2-yl]acetamide (R6 ¼ F, R7, R11 ¼ F, R8, R9, R10 ¼ H, n ¼ 1, 8i).
Yield: 40%; mp: 71e73 ꢀC; IR (KBr) 3281, 1670, 1628, 1568 cmꢃ1; 1H
NMR (400 MHz CDCl3)
d
: 8.22 (1H, d, J ¼ 5.1 Hz), 8.18 (1H, s), 8.06
4.1.6.4. N-(4-Benzyloxymethylpyridin-2-yl)-2-(4-fluorophenyl)aceta-
mide (R6, R7, R8, R10 R11 ¼ H, R9 ¼ F, n ¼ 1, 8d). Yield: 55%; mp: 88e
(1H, br), 7.34e7.31 (2H, m), 7.23 (1H, t, J ¼ 7.6 Hz), 7.08 (1H, d,
J ¼ 5.1 Hz), 7.06e6.93 (4H, m), 4.56 (4H, s), 3.83 (2H, s); 13C NMR
91 ꢀC; IR (KBr) 3246, 1661, 1620, 1570 cmꢃ1
;
1H NMR (400 MHz
(100 MHz CDCl3)
d: 168.78 (d, J ¼ 261.3 Hz), 167.42, 163.64, 161.49
CDCl3)
(6H, m), 7.10e7.05 (3H, m), 4.59 (2H, s), 4.55 (2H, s), 3.27 (2H, s);
13C NMR (100 MHz CDCl3)
150.48, 147.67, 137.55, 130.96 (d, J ¼ 7.4 Hz), 129.71 (d, J ¼ 2.5 Hz),
128.46, 127.84, 127.76, 118.30, 115.92 (d, J ¼ 21.5 Hz), 112.12, 72.77,
70.48, 43.78; MS (EI): m/z 350 (Mþ); HRMS (EI): calcd for
C21H19FN2O2: 350.1431, found: 350.1431, Anal. Calcd for
C21H19FN2O2 C, 71.98, H, 5.47, N, 8.00. Found C, 71.72, H, 5.53, N, 7.85.
d
: 8.19 (1H, d, J ¼ 5.4), 8.18 (1H, s), 7.86 (1H, br), 7.37e7.26
(dd, J ¼ 248.5, 7.9 Hz), 151.38, 151.36, 150.47, 147.46, 133.32 (d,
J ¼ 3.3 Hz), 129.35 (d, J ¼ 10.8 Hz), 129.26 (t, J ¼ 11.2 Hz), 115.34 (d,
J ¼ 21.4 Hz), 111.38 (dd, J ¼ 19.0, 6.6 Hz), 110.38 (t, J ¼ 20.3 Hz),
72.05, 70.51, 31.05; MS (EI): m/z 386 (Mþ); HRMS (EI): calcd for
C21H17N2O2F3: 386.1242, found: 386.1249, Anal. Calcd for
C21H17N2O2F3 C, 65.28, H, 4.43, N, 7.25. Found C, 65.44, H, 4.60,
N, 7.37.
d: 169.36, 162.19 (d, J ¼ 246.5 Hz), 151.32,
4.1.6.10. N-[4-(4-Fluorobenzyloxymethyl)pyridin-2-yl]-3-phenylpro-
pionamide (R6 ¼ F, R7, R8, R9, R10, R11 ¼ H, n ¼ 2, 8j). Yield: 57%; mp:
56e59 ꢀC; IR (KBr) 3262, 1697, 1614, 1576 cmꢃ1; 1H NMR (400 MHz
4.1.6.5. N-[4-(4-Chlorobenzyloxymethyl)pyridin-2-yl]-2-(2,6-difluoro-
phenyl)acetamide (R6 ¼ Cl, R7, R11 ¼ F, R8, R9, R10 ¼ H, n ¼ 1, 8e).
Yield: 63%; mp: 67e70 ꢀC; IR (KBr) 1701, 1570 cmꢃ1
;
1H NMR
CDCl3)
d
: 8.21 (1H, d, J ¼ 5.1 Hz), 8.19 (1H, s), 7.97 (1H, br), 7.37e7.26
(400 MHz CDCl3)
7.34e7.26 (5H, m), 7.09 (1H, d, J ¼ 4.6 Hz), 6.96 (2H, t, J ¼ 7.8 Hz), 4.53
(2H, s), 4.53 (2H, s), 3.83 (2H, s); 13C NMR (100 MHz CDCl3)
: 167.48,
d: 8.23 (1H, d, J ¼ 4.6 Hz), 8.18 (1H, s), 8.03 (1H, br),
(8H, m), 7.06 (2H, t, J ¼ 8.8), 4.56 (2H, s), 4.56 (2H, s), 3.06 (2H, t,
J ¼ 7.8 Hz), 2.70 (2H, t, J ¼ 7.8 Hz); 13C NMR (100 MHz CDCl3)
d:
d
171.04, 162.34 (d, J ¼ 245.6 Hz), 151.80, 150.21, 147.42, 140.38, 133.31
(d, J ¼ 3.3 Hz), 129.50 (d, J ¼ 8.3 Hz), 128.44, 128.16, 126.20, 117.86,
115.26 (d, J ¼ 21.5 Hz), 112.44, 71.97, 70.46, 38.96, 31.08; MS (EI): m/
z 364 (Mþ); HRMS (EI): calcd for C22H21FN2O2: 364.1587, found:
364.1585, Anal. Calcd for C22H21FN2O2 C, 72.51, H, 5.81, N, 7.69.
Found C, 72.58, H, 5.96, N, 7.76.
161.43 (dd, J ¼ 255.6, 7.4 Hz), 151.60, 150.17, 147.54, 136.05, 133.48,
129.26 (t, J ¼ 9.9 Hz),128.98,128.53,118.14,112.47,111.24 (dd, J ¼ 24.8,
5.8 Hz), 110.41 (t, J ¼ 20.0 Hz), 71.86, 70.56, 30.85; MS (EI): m/z 402
(Mþ); HRMS (EI): calcd for C21H17ClF2N2O2: 402.0946, found:
402.0946, Anal. Calcd for C21H17ClF2N2O2 C, 62.61, H, 4.25, N, 6.95.
Found C, 62.64, H, 4.48, N, 6.78.
4.1.6.11. 2-(3,5-Difluorophenyl)-N-[4-(4-fluorobenzyloxymethyl)pyr-
idin-2-yl]acetamide (R6 ¼ F, R7, R9, R11 ¼ H, R8, R10 ¼ F, n ¼ 1, 8k).
4.1.6.6. N-[4-(4-Chlorobenzyloxymethyl)pyridin-2-yl]-3-phenylpro-
pionamide (R6 ¼ Cl, R7, R8, R9, R10, R11 ¼ H, n ¼ 2, 8f). Yield: 40%;
Yield: 46%; mp: 101e104 ꢀC; IR (KBr) 3213, 1690, 1614, 1597 cmꢃ1
;
mp: 57e59 ꢀC; IR (KBr) 3252, 1701, 1614, 1578 cmꢃ1
;
1H NMR
1H NMR (400 MHz CDCl3)
d
: 8.22 (1H, d, J ¼ 5.1 Hz), 8.18 (1H, d,
(400 MHz CDCl3)
d
: 8.21 (1H, s), 8.19 (1H, d, J ¼ 5.2 Hz), 8.18 (1H,br),
J ¼ 1.3 Hz), 7.84 (1H, br), 7.36e7.32 (1H, m), 7.10 (1H, dd, J ¼ 5.1,
7.37e7.19 (9H, m), 7.07 (1H, d, J ¼ 5.2 Hz), 4.56 (2H, s), 4.56 (2H, s),
J ¼ 1.3 Hz), 7.08e6.87 (6H, d, m), 4.54 (4H, s), 3.89 (2H, s); 13C NMR
3.05 (2H, t, J ¼ 7.7 Hz), 2.70 (2H, t, J ¼ 7.7 Hz); 13C NMR (100 MHz
(100 MHz CDCl3)
d
: 168.33, 163.10 (d, J ¼ 249.8 Hz), 163.04 (dd,
CDCl3)
d: 151.25, 150.63, 147.17, 140.34, 136.09, 133.68, 129.10,
J ¼ 249.4, 12.8 Hz), 161.17, 157.28, 151.41, 150.66, 147.39, 137.57 (t,
J ¼ 10.0 Hz), 133.26 (d, J ¼ 3.3 Hz), 129.53 (d, J ¼ 8.3 Hz), 115.32 (d,
J ¼ 21.5 Hz), 112.34 (dd, J ¼ 28.9, 6.6 Hz), 102.96 (t, J ¼ 24.8 Hz),
72.07, 70.39, 43.83; MS (EI): m/z 386 (Mþ); HRMS (EI): calcd for
C21H17N2O2F3: 386.1242, found: 386.1253, Anal. Calcd for
C21H17N2O2F3 C, 65.28, H, 4.43, N, 7.25. Found C, 65.06, H, 4.45,
N, 7.15.
128.69, 128.62, 128.33, 126.39, 124.15, 117.09, 112.09, 72.05, 70.66,
39.35, 31.16; MS (EI): m/z 380 (Mþ); HRMS (EI): calcd for
C22H21ClN2O2: 380.1291, found: 380.1292, Anal. Calcd for C, 69.38,
H, 5.56, N, 7.36. Found C, 69.04, H, 5.56, N, 7.44.
4.1.6.7. N-[4-(4-Chlorobenzyloxymethyl)pyridin-2-yl]-2-phenylacet-
amide (R6 ¼ Cl, R7, R8, R9, R10, R11 ¼ H, n ¼ 1, 8g). Yield: 52%; IR (neat)
3215, 1686, 1612, 1568 cmꢃ1; 1H NMR (400 MHz CDCl3)
d: 8.34 (1H,
4.2. Conformational analysis of AS1949490 and NGD-61338
br), 8.21 (1H, s), 8.17 (1H, d, J ¼ 5.0 Hz), 7.38e7.26 (9H, m), 7.06 (1H, d,
J ¼ 5.0 Hz), 4.53 (2H, s), 4.53 (2H, s), 3.74 (2H, s); 13C NMR (100 MHz
We initially prepared structures of AS1949490 and NGD-61338
using SYBYL6.91 (Tripos, St Louis, MO, USA). Then, the following
calculations were performed for each initial structure using
CDCl3) d: 169.78, 151.29, 150.67, 147.03, 136.06, 133.94, 133.91, 133.65,
129.46, 129.14, 129.08, 128.67, 118.08, 112.11, 72.00, 70.60, 44.90; MS

Y. Ichihara et al. / European Journal of Medicinal Chemistry 62 (2013) 649e660
659
CAMDAS. Ten molecular dynamics (MD) calculations were simul-
taneously performed using different conformers. Each of the MD
calculations was carried out for 1000 ps with an integral time step
of 1 fs. The lengths of covalent bonds were fixed with SHAKE
algorithm through the MD [29]. The temperature of the system was
maintained at 1200 K in order to enhance the sampling efficiency.
The Merck Molecular Force Field was used to evaluate the potential
energy surface of the molecule [30]. The electrostatic terms of the
potential were neglected in order to mimic the shield effects of
solvent molecules on electrostatic interactions. The value of the
dihedral angle of the peptide bond in AS1949490 was constrained
to be 180ꢀ ꢁ 10ꢀ in MD calculations in order to keep its con-
formation trans. The constraint energy term was quadratic, and
the force constants were 100 kcal molꢃ1 radꢃ2. Conformers were
sampled at 100-step intervals, thus producing 10,000 conforma-
tions for each MD calculation. In total, 100,000 conformations were
preclustered with a dihedral angle deviation threshold of ꢁ30ꢀ. The
dihedral angles used to cluster similar conformations are indicated
by arrows in Fig. 2. Each of the conformers obtained after pre-
clustering was then minimized until the RMS of the potential-
(Beverly, MA). Monoclonal anti-Akt1 antibody was from Santa Cruz
Biotechnology (Santa Cruz, CA). Dulbecco’s modified Eagle medium
(DMEM) was from Life Technologies (Gibco, Carlsbad, CA). All other
reagents were of analytical grade and purchased from Sigma
Chemical (St. Louis, MO), Wako Pure Chemical Industries (Osaka,
Japan), or Nacalai Tesque (Kyoto, Japan).
4.5. Animals
Male C57BL/6J mice and BKS.Cg-þLeprdb/þLeprdb/Jcl (db/db)
mice were purchased from CLEA Japan, Inc (Tokyo, Japan). Mice (8
weeks old) were housed with a 12:12 h lightedark cycle (lights on
at 0700 a.m.) in a temperature-controlled colony room (23e25 ꢀC)
with ad libitum access to tap water and standard laboratory rodent
chow. SpragueeDawley rats were purchased from Japan SLC
(Hamamatsu, Japan). CPDA or AS1949490 suspended in 0.5%
methylcellulose (300 mg/kg) was orally administered to the mice
twice daily. After administration for 13 days in C57BL/6J mice or 10
days in db/db mice, the animals were fasted for 6 h, and GTT was
conducted as described previously [31]. In brief, glucose solution
(2 g/kg) was injected intraperitoneally and blood samples were
collected from the tail vain at indicated time points. Plasma glucose
levels were measured with a Nipro FreeStyle Freedom (Nipro,
Osaka, Japan). To measure serum insulin levels, mice were treated
with CPDA or AS1949490 for 15 days (C57BL/6J mice) or 12e13 days
(db/db mice), and then deprived of food overnight. Blood samples
were collected from the orbital sinus. Serum insulin levels were
analyzed using an insulin ELISA kit (Morinaga Bioscience Labora-
tory, Kanagawa, Japan). All experimental procedures used in this
study were approved by the Committee of Animal Experiments at
University of Toyama.
energy gradient fell below 0.001 kcal molꢃ1
Å
ꢃ1. The minimized
conformers were reclustered with a dihedral angle-deviation
threshold of ꢁ30ꢀ, furnishing a final conformer set.
4.3. Molecular alignment of AS1949490 and NGD-61338
The superposition between AS1949490 and NGD-61338 was
performed using the parallel version of the molecular overlay
program SUPERPOSE. The definition of functional spheres for these
two molecules is provided in Fig. 2. In order to systematically su-
perpose two molecules, the center of mass of each is first translated
to the origin of the coordinates, and the circumscribed rectangular
boxes are calculated. The molecule with a large box volume is fixed,
and the center of mass for the molecule with a small box volume is
then translated and rotated. The range of translation represents the
maximum distance that the small box volume can translate inside
4.6. Cell culture
3T3-L1 fibroblasts were grown and passaged in DMEM supple-
mented with 10% donor calf serum. Cells at 2e3 days post-
confluence were used for differentiation in medium containing
ꢀ
the large box. The translational increment is 1 A and the center of
10% fetal bovine serum (FBS), 1
isobutyl-1-methylxantine, and 6
m
m
M dexamethazone, 0.5 mM 3-
g/mL insulin. After 3 days, the
mass is translated on the body-centered cubic-lattice points made
in the circumscribed rectangular box of the large volume. The
rotation is performed on each of the lattice points. The ranges of
differentiation medium was replaced with postdifferentiation me-
dium containing 10% FBS and 4 g/mL insulin. After an additional 3
three Eulerian angles are 0ꢀ ꢄ
f
, 4 ꢄ 355ꢀ and 0ꢀ ꢄ
q
ꢄ 180ꢀ, and the
m
rotational increment is 5ꢀ. The overlays of the functional spheres
are scored using the score matrix (Table 2). When the planes of two
ARs match well, the score between two ARs is 4 points. Otherwise,
the score of AReAR is 3 points, as is that of HPeHP.
days, the medium was replaced with DMEM supplemented with
10% FBS, and 3T3-L1 adipocytes 10e13 days after initial differen-
tiation were used for the experiment [7,9,10]. A primary culture of
neuronal cells from the cerebral cortices of 17e18-day-old
SpragueeDawley rat embryos was prepared by the method
described previously [15].
4.4. Materials in pharmacological experiments
4.7. Western blotting
AS1949490 and the designed compounds were synthesized with
reference to the previous study [17] unless otherwise stated. Human
regular insulin was provided by Novo Nordisk Pharmaceutical
3T3-L1 adipocytes grown in six-well multiplates were serum
starved for 16 h with 20 ng/mL TNF
4-substituted 2-pyridin-2-ylamide compound (10
(10 M, a positive control), or 0.1% dimethyl sulfoxide (vehicle
a
. After treatment with a novel
(Copenhagen, Denmark). Human recombinant TNFa was obtained
from Pepro Tech (Rocky Hill, NJ). Polyclonal anti-Thr308 phospho-
specific Akt antibody was purchased from Cell Signaling Technology
mM), AS1949490
m
control) for 15 min, the cells were stimulated with 17 nM insulin at
37 ꢀC for 2 h. By contrast, primary cultured rat cortical neuronal
Table 2
Scoring matrix.
cells were serum-starved for 3 days, treated with 10
mM CPDA (4a),
10 M AS1949490, or vehicle (0.1% dimethyl sulfoxide) for 15 min,
and then stimulated with 1 nM insulin for 5 min. The cells were
lysed in buffer containing 20 mM Tris, 140 mM NaCl, 1 mM EDTA,
m
HP
AR
HD
HA
DA
HP
AR
HD
HA
DA
þ3
þ3
ꢃ2
ꢃ2
ꢃ2
þ3
þ4a
ꢃ2
ꢃ2
ꢃ2
ꢃ2
ꢃ2
þ2
ꢃ2
þ1
ꢃ2
ꢃ2
ꢃ2
þ2
þ1
ꢃ2
ꢃ2
þ1
þ1
þ1
1 mM EGTA, 2.5 mM sodium pyrophosphate, 1 mM
ophosphate, 1% NP-40, 1 mM PMSF, 2 mM Na3VO4, 50 mM sodium
fluoride, and 10
b-glycer-
m
g/mL aprotinin (pH ¼ 7.5) for 30 min on ice. Equal
a
amounts of protein lysates were separated by SDS-PAGE, trans-
ferred onto membranes, and immunoblotted, as described
If the planes of two rings cannot be superposed upon each other, a score of þ3 is
given.

660
Y. Ichihara et al. / European Journal of Medicinal Chemistry 62 (2013) 649e660
[5] H. Ishihara, T. Sasaoka, H. Hori, T. Wada, H. Hirai, T. Haruta, W.J. Langlois,
M. Kobayashi, Biochem. Biophys. Res. Commun. 260 (1999) 265e272.
[6] T. Sasaoka, T. Wada, H. Tsuneki, Pharmacol. Ther. 112 (2006) 799e809.
[7] T. Wada, T. Sasaoka, M. Funaki, H. Hori, S. Murakami, M. Ishiki, T. Haruta,
T. Asano, W. Ogawa, H. Ishihara, M. Kobayashi, Mol. Cell. Biol. 21 (2001) 1633e
1646.
previously [7,9,10]. Densitometric analysis was carried out using
the LAS-4000 lumino-image analyzer system (Fujifilm, Tokyo,
Japan). The phosphorylation level of Akt was calculated as the ratio
of the intensity of the band relative to that of total Akt protein in
each sample.
[8] T. Sasaoka, H. Hori, T. Wada, M. Ishiki, T. Haruta, H. Ishihara, M. Kobayashi,
Diabetologia 44 (2001) 1258e1267.
[9] T. Sasaoka, T. Wada, K. Fukui, S. Murakami, H. Ishihara, R. Suzuki, K. Tobe,
T. Kadowaki, M. Kobayashi, J. Biol. Chem. 279 (2004) 14835e14843.
[10] M. Ikubo, T. Wada, K. Fukui, M. Ishiki, H. Ishihara, T. Asano, H. Tsuneki,
T. Sasaoka, Am. J. Physiol. Endocrinol. Metab. 296 (2009) E157eE164.
[11] K. Fukui, T. Wada, S. Kagawa, K. Nagira, M. Ikubo, H. Ishihara, M. Kobayashi,
T. Sasaoka, Diabetes 54 (2005) 1958e1967.
[12] R. Grempler, D. Zibrova, C. Schoelch, A. van Marle, J.F. Rippmann,
N. Redemann, Diabetes 56 (2007) 2235e2241.
[13] M.W. Sleeman, K.E. Wortley, K.M. Lai, L.C. Gowen, J. Kintner, W.O. Kline,
K. Garcia, T.N. Stitt, G.D. Yancopoulos, S.J. Wiegand, D.J. Glass, Nat. Med. 11
(2005) 199e205.
4.8. Reverse transcription-polymerase chain reaction (RT-PCR)
The diabetic (db/db) mice were orally administrated CPDA
(300 mg/kg), AS1949490 (300 mg/kg), or vehicle twice daily for
12e13 days. Subsequently, the mice were fasted overnight, and the
liver was isolated. The expression of gluconeogenic enzymes in the
liver was analyzed by real-time PCR using SYBR-green, as described
previously [15]. The primers used were as follows: PEPCK, forward
(CAGGATCGAAAGCAAGACAGT) and reverse (AAGTCCTCTTCCGA-
CATCCAG); G6Pase, forward (GAAAAAGCCAACGTATGGATTCC) and
[14] H. Hori, T. Sasaoka, H. Ishihara, T. Wada, S. Murakami, M. Ishiki, M. Kobayashi,
Diabetes 51 (2002) 2387e2394.
[15] Y. Soeda, H. Tsuneki, H. Muranaka, N. Mori, S. Hosoh, Y. Ichihara, S. Kagawa,
X. Wang, N. Toyooka, Y. Takamura, T. Uwano, H. Nishijo, T. Wada, T. Sasaoka,
Mol. Endocrinol. 24 (2010) 1965e1977.
reverse (CAGCAAGGTAGATCCGGGA); and b-actin, forward (ATGC-
TCCCCGGGCTGTAT) and reverse (CATAGGAGTCCTTCTGACCCATTC).
[16] D.F. Lazar, A.R. Saltiel, Nat. Rev. Drug Discov. 5 (2006) 333e342.
[17] A. Suwa, T. Yamamoto, A. Sawada, K. Minoura, N. Hosogai, A. Tahara,
T. Kurama, T. Shimokawa, I. Aramori, Br. J. Pharmacol. 158 (2009) 879e887.
[18] D.A. Annis, C.C. Cheng, C.C. Chuang, J.D. McCarter, H.M. Nash, N. Nazef,
T. Rowe, R.J. Kurzeja, G.W. Shipps Jr., Comb. Chem. High Throughput Screen.
12 (2009) 760e771.
4.9. Statistical analysis
Data are presented as mean ꢁ SE. P values were determined by
the Student’s t-test (Fig. 4) or the Bonferroni test after ANOVA.
P < 0.05 was considered statistically significant.
[19] A. Suwa, T. Kurama, T. Yamamoto, A. Sawada, T. Shimokawa, I. Aramori, Eur. J.
Pharmacol. 642 (2010) 177e182.
[20] H. Tsujishita, S. Hirono, J. Comput. Aided Mol. Des. 11 (1997) 305e315.
[21] K. Iwase, S. Hirono, J. Comput. Aided Mol. Des. 13 (1999) 499e512.
[22] N. Yamaotsu, H. Fujii, H. Nagase, S. Hirono, Bioorg. Med. Chem. 18 (2010)
4446e4452.
[23] S.R. Selness, R.V. Devraj, J.B. Monahan, T.L. Boehm, J.K. Walker, B. Devadas,
R.C. Durley, R. Kurumbail, H. Shieh, L. Xing, M. Hepperle, P.V. Rucker,
K.D. Jerome, A.G. Benson, L.D. Marrufo, H.M. Madsen, J. Hitchcock, T.J. Owen,
L. Christie, M.A. Promo, B.S. Hickory, E. Alvira, W. Naing, R. Blevis-Bal, Bioorg.
Med. Chem. Lett. 19 (2009) 5851e5856.
Acknowledgments
This study was supported, in part, by a Grant from Japan Science
and Technology Agency and the First Bank of Toyama Foundation
(to T.S.). We thank A. Nakano for technical assistance with the
screening assay.
[24] E. Ochiai, J. Org. Chem. 18 (1953) 534e551.
[25] I. Suzuki, Chem. Pharm. Bull. 4 (1956) 211e216.
Appendix A. Supplementary data
[26] H. Cho, J. Mu, J.K. Kim, J.L. Thorvaldsen, Q. Chu, E.B. Crenshaw, K.H. Kaestner,
M.S. Bartolomei, G.I. Shulman, M.J. Birnbaum, Science 292 (2001) 1728e1731.
[27] M.M. Hill, S.F. Clark, D.F. Tucker, M.J. Birnbaum, D.E. James, S.L. Macaulay, Mol.
Cell. Biol. 19 (1999) 7771e7781.
[28] PDB ID: 3NR8, L. Tresaugues, M. Welin, C.H. Arrowsmith, H. Berglund, C.
Bountra, R. Collins, A.M. Edwards, S. Flodin, A. Flores, S. Graslund, M. Ham-
marstrom, I. Johansson, T. Karlberg, S. Kol, T. Kotenyova, E. Kouznetsova, M.
Moche, T. Nyman, C. Persson, H. Schuler, P. Schutz, M.I. Siponen, A.G. Thorsell,
S. van der Berg, E. Wahlberg, J. Weigelt, P. Nordlund, unpublished results.
[29] J.-P. Ryckaert, G. Ciccotti, H.J.C. Berendsen, J. Comput. Phys. 23 (1977)
327e341.
Supplementary data related to this article can be found at
http://dx.doi.org/10.1016/j.ejmech.2013.01.014.
References
[1] T.J. Hoerger, J.E. Segel, E.W. Gregg, J.B. Saaddine, Diabetes Care 31 (2008) 81e86.
[2] B. Cariou, B. Charbonnel, B. Staels, Trends Endocrinol. Metab. 23 (2012) 205e215.
[3] A.R. Saltiel, C.R. Kahn, Nature 414 (2001) 799e806.
[30] H. Halgren, J. Am. Chem. Soc. 112 (1990) 4710e4723.
[31] S. Kagawa, Y. Soeda, H. Ishihara, T. Oya, M. Sasahara, S. Yaguchi, R. Oshita,
T. Wada, H. Tsuneki, T. Sasaoka, Endocrinology 149 (2008) 642e650.
[4] V.R. Sopasakis, P. Liu, R. Suzuki, T. Kondo, J. Winnay, T.T. Tran, T. Asano,
G. Smyth, M.P. Sajan, R.V. Farese, C.R. Kahn, J.J. Zhao, Cell Metab. 11 (2010)
220e230.