Preparation of dihydroxy polycyclic aromatic hydrocarbons and activities of two dioxygenases in the phenanthrene degradative pathway

Article abstract of DOI:10.1016/j.abb.2019.108081

Dihydroxy phenanthrene, fluoranthene, and pyrene derivatives are intermediates in the bacterial catabolism of the corresponding parent polycyclic aromatic hydrocarbon (PAH). Ring-opening of the dihydroxy species followed by a series of enzyme-catalyzed re

Full text of DOI:10.1016/j.abb.2019.108081

ArchivesofBiochemistryandBiophysics673(2019)108081
Contents lists available at ScienceDirect
Archives of Biochemistry and Biophysics
journal homepage: www.elsevier.com/locate/yabbi
Preparation of dihydroxy polycyclic aromatic hydrocarbons and activities of
two dioxygenases in the phenanthrene degradative pathway
Kaci L. Erwina, William H. Johnson Jr.b, Andrew J. Meichanb, Christian P. Whitmanb,∗
a Department of Molecular Biosciences, College of Natural Sciences, 1 University Station, University of Texas, Austin, TX, 78712, USA
b Division of Chemical Biology and Medicinal Chemistry, College of Pharmacy, 1 University Station, University of Texas, Austin, TX, 78712, USA
A R T I C L E I N F O
A B S T R A C T
Keywords:
Dihydroxy phenanthrene, fluoranthene, and pyrene derivatives are intermediates in the bacterial catabolism of the
corresponding parent polycyclic aromatic hydrocarbon (PAH). Ring-opening of the dihydroxy species followed by a
series of enzyme-catalyzed reactions generates metabolites that funnel into the Krebs Cycle with the eventual pro-
duction of carbon dioxide and water. One complication in delineating these pathways and harnessing them for useful
purposes is that the initial enzymatic processing produces multiple dihydroxy PAHs with multiple ring opening pos-
sibilities and products. As part of a systematic effort to address this issue, eight dihydroxy species were synthesized and
characterized as the dimethoxy or diacetate derivatives. Several dihydroxy compounds were examined with two di-
oxygenases in the phenanthrene degradative pathway in Mycobacterium vanbaalenii PYR-1. One, 3,4-dihydrox-
Polycyclic aromatic hydrocarbons
Enzyme kinetics
Dioxygenases
Phenanthrene
yphenanthrene, was processed by PhdF with a kcat/Km of 6.0 × 106 M−1 −1
, a value that is consistent with the an-
s
notated function of PhdF in the pathway. PhdI processed 1-hydroxy-2-naphthoate with a kcat/Km of 3.1 × 105 M−1 −1
,
s
which is also consistent with the proposed role in the pathway. The observations provide the first biochemical evidence
for these two reactions in M. vanbaalenii PYR-1 and, to the best of our knowledge, the first biochemical evidence for the
reaction of PhdF with 3,4-dihydroxyphenanthrene. Although PhdF is upregulated in the presence of pyrene, it did not
process two dihydroxypyrenes. Methodology was developed for product analysis of the extradiol dioxygenases.
1. Introduction
[7,8]. The high-molecular-weight (HMW) PAHs have four or more
aromatic rings and include fluoranthene (3) and pyrene (4). The LMW
Polycyclic aromatic hydrocarbons (PAHs) and their derivatives are
pervasive environmental contaminants that adversely affect air, soil, and
water quality [1]. PAHs persist in the environment due to their limited
aqueous solubility and low volatility. They also accumulate in the food
chain. PAHs are toxic to humans (either directly or indirectly by reactive
metabolites) as well as marine and aquatic organisms [2–4]. Hence, there is
interest in the development of technologies to remove PAHs from the en-
vironment. One particularly attractive technology is bioremediation, which
exploits the nutritional versatility of microorganisms to convert the PAHs
into carbon dioxide and water [5]. This technology requires a compre-
hensive understanding of the degradative pathways.
PAHs are more tractable systems, but the degradative pathway for only
one of these, naphthalene, is understood in any significant detail. As the
number of rings increases, the systems become less tractable, making
our understanding of the degradative pathways for phenanthrene and
the HMW PAHs limited, at best [9–11].
Several factors contribute to this lack of knowledge, but one troubling
issue is that as the number of rings increases, the number of potential hy-
droxylation sites by the ring-hydroxylating enzymes increases [7–11]. This
produces multiple dihydroxy species with multiple ring-opening possibi-
lities and products. These observations (along with other factors) hinder a
systematic examination of the PAH catabolic pathways. As part of an effort
to address this problem, we developed methodology for the chemical
synthesis of four dihydroxyphenanthrenes (5a-d, Scheme 2), two dihy-
droxyfluoranthenes (6a,b), and two dihydroxypyrenes (7a,b).1 The com-
pounds were characterized as the dimethoxy or diacetate derivatives. In
PAHs are categorized according to their molecular weights when
referring to their degradation by bacterial pathways. The low-mole-
cular-weight (LMW) PAHs consist of three or less aromatic rings and are
exemplified by naphthalene (1, Scheme 1) [6] and phenanthrene (2)
∗ Corresponding author.
E-mail address: whitman@austin.utexas.edu (C.P. Whitman).
1 The literature for PAH degradation pathways generally refers to these compounds as dihydroxy PAHs. More precisely, they are named 1,2-, 2,3-, 3,4-, and 9,10-
phenanthrenediol (5a-d), 2,3- and 7,8-fluoranthenediol (6a,b), and 1,2- and 4,5-pyrenediol (7a,b). In order to be consistent with the field, we retain the dihydroxy
PAHs nomenclature.
https://doi.org/10.1016/j.abb.2019.108081
Received 17 June 2019; Received in revised form 15 August 2019; Accepted 20 August 2019
Availableonline22August2019
0003-9861/©2019ElsevierInc.Allrightsreserved.

K.L. Erwin, et al.
ArchivesofBiochemistryandBiophysics673(2019)108081
Scheme 1. Representative LMW and HMW polycyclic
aromatic hydrocarbons (PAHs). The LMW PAHs in-
clude naphthalene (1) and phenanthrene (2) and the
HMW PAHs include fluoranthene (3) and pyrene (4).
Scheme 2. Dihydroxy PAHs synthesized in this work and characterized as the dimethoxy or diacetate derivatives. The R group is a hydrogen unless otherwise
indicated.
addition, the dihydroxypyrenes were examined with two ring-opening di-
oxygenases (PhdI and PhdF) from M. vanbaalenii PYR-1, the first bacterium
identified to completely degrade pyrene [7,8,11]. Although PhdI and PhdF
did not process the dihydroxypyrenes, ring-opening activities were observed
for these enzymes using four other compounds. Most notably, PhdF pro-
cesses 5c, which is the first biochemical evidence for this reaction. The
results, reported herein, along with the availability of the dihydroxy com-
pounds, set the stage for future investigations of the enzymes in PAH
catabolic pathways.
Synthesis of 6a,b. The 2,3- and 7,8-dihydroxyfluoranthenes (6a,b,
respectively) were synthesized in 2 steps from 3- or 8-hydroxy-
fluoranthene (17 and 20, respectively, Scheme 4). The appropriately
substituted hydroxyl fluoranthenes were synthesized by published
procedures [16]. The individual hydroxyfluoranthenes were treated
with o-iodoxybenzoic acid (IBX) to generate the corresponding ortho-
quinones [17]. Treatment of 3-hydroxyfluoranthene with IBX yielded
18 and treatment of 8-hydroxyfluoranthene (20) yielded a mixture of
21 and 22. The ortho-quinones were not isolated and the isomers were
not separated. Acetylation of 18 generated the diacetyl derivative, 19.
As needed, small amounts were treated with acetyl chloride and ethanol
(under argon) to afford 6a. Treatment of 21/22 with NaBH4 followed
by dimethyl sulfate produced a mixture of the corresponding dimethoxy
compounds (23 and 24). The isomers were separated by silica gel
chromatography. From 42.6 mg of 20, 19.2 mg of 8,9-dimethoxy-
fluoranthene (23) and 2.2 mg of 24 were obtained. As needed, small
amounts of the dimethoxy derivative was treated with BBr3 [13], and
the product (6b) was stored under argon at −20 °C.
2. Results and discussion
Synthesis of 5a-d. The 1,2- and 2,3-dihydroxyphenanthrenes (5a, 5b,
respectively) were synthesized in 3 steps from 2,3- or 3,4-dimethox-
ybenzaldehyde (8a and 8b, respectively, Scheme 3A). The starting
material (8a or 8b) was combined with potassium t-butoxide and
benzyltriphenylphosphonium bromide in toluene to produce an E,Z
mixture of the 1,2- or 3,4-dimethoxystilbene (9a and 9b, respectively)
[12]. Oxidative cyclization was carried out in the presence of O2, I2, and
UV irradiation to yield the 1,2- and 2,3-dimethoxyphenanthrenes (10a
and 10b, respectively) [12]. The dimethoxy derivatives were depro-
tected, as needed, using BBr3 [13], and the products were stored under
argon at −20 °C.
Synthesis of 7a,b. Oxidation of the commercially available 1-hydro-
xypyrene (25, Scheme 5) to pyrene-1,2-dione (26) was performed by
treatment with o-iodoxybenzoic acid (IBX) [17]. Acetylation of 26 and
pyrene-4,5-dione (28), prepared as described elsewhere [18], to the
respective diacetates, pyrene-1,2-diyl diacetate (27) and pyrene-4,5-
diyl diacetate (29), was performed by following published procedures
[15]. The compounds were stored at −20 °C. When needed, small
amounts of the diacetate esters were treated as described above (for 5d)
to produce 1,2-dihydroxypyrene (7a) or 4,5-dihydroxypyrene (7b).
Kinetic Characterization of PhdF and PhdI. There is an extensive body
of literature on PAH degradation including the identification of several
gene clusters and individual enzymes, the detection of metabolites by
mass spectrometry or gas chromatography, and the demonstration of
the conversion of specific PAHs to cellular intermediates [6–11].
However, there is limited knowledge about the actual substrates and
products for many of the individual enzymes, and little biochemical
confirmation of several proposed activities because many substrates are
not readily available [7–11]. Assignments of functions are mostly based
by analogy with the corresponding steps in the well-characterized
3,4-Dihydroxyphenanthrene (5c) was synthesized from methyl 2-
formyl-4,5-dimethoxybenzoate (11, Scheme 3B), which was generated
by a published protocol [13]. Subsequently, a Wittig reaction (using
NaH and benzyltriphenylphosphonium bromide) was carried out on the
aldehyde to produce the E-isomer of the stilbene (12) [12]. Oxidative
cyclization was carried out as above, and the resulting methyl ester (13)
was hydrolyzed and decarboxylated using copper in quinolone [14].
The product, 3,4-dimethoxyphenanthrene (14), was deprotected, as
needed, by treatment with BBr3 to afford 5c [13].
9,10-Dihydroxyphenanthrene (5d) was generated from the com-
mercially available 9,10-phenanthrenequinone (15, Scheme 3C), which
was converted into phenanthrene-9,10-diyl diacetate (16) by a varia-
tion on published procedures [15]. When needed, small amounts were
treated with acetyl chloride and ethanol (under argon) to afford 5d.
2

K.L. Erwin, et al.
ArchivesofBiochemistryandBiophysics673(2019)108081
Scheme 3. Synthetic routes resulting in 5a-d. The details for the individual steps are described in the text.
Scheme 4. Synthetic routes resulting in 6a,b. The details for the individual steps are described in the text.
pathway for the degradation of naphthalene.
(in ethanol), 1-hydroxy-2-naphthoate (32, in ethanol), 5a,c,d, 6a,b,
7a,b (Scheme 2), 3-methylcatechol (34, Scheme 7A), and 2,3-dihy-
droxybiphenyl (35, Scheme 7B) following changes in the UV/Vis
spectra. The only substrates processed were 5c, 32 (by PhdI), 34, and
35 (see supporting information for representative UV/Vis traces). No-
tably, PhdF did not process the dihydroxypyrenes (7a,b), suggesting
that the observed upregulation of PhdF in the presence of pyrenes might
be due to steps downstream of the dihydroxypyrene ring-opening step.
However, PhdF processed 5c to 31 (Scheme 6A), the expected extradiol
product, and PhdI processed 32 to the intradiol product (i.e., 33,
Scheme 6B). Both activities are in accord with the proposed functions
and the presence of the genes for other enzymes in the phenanthrene
catabolic pathway in. M. vanbaalenii PYR-1 [8,11]. In addition, PhdF
processed 3-methylcatechol (34, Scheme 7A) and 2,3-dihydrox-
ybiphenyl (35, Scheme 7B), to the extradiol products (36 and 38 in
Scheme 7).
There are 9 annotated extradiol dioxygenases (including PhdF) and 3
annotated intradiol dioxygenases (including PhdI) in the PAH gene cluster
in M. vanbaalenii PYR-1 [8]. PhdF and PhdI are proposed to carry out two
steps in the degradation of phenanthrene [8]. PhdF is a Type I extradiol
dioxygenase and a member of the vicinal oxygen chelate superfamily [19],
that is proposed to convert 3,4-dihydroxyphenanthrene (5c, Scheme 6A)
into trans-o-hydroxybenzylidenepyruvate (31) presumably via 2-hydro-
xybenzo[h]chromene-2-carboxylate (30) (Scheme 6A) [8]. PhdI is an in-
tradiol dioxygenase and a purported member of the cupin superfamily [20],
that is proposed to convert 1-hydroxy-2-naphthoic acid (32, Scheme 6B)
into trans-o-carboxybenzylidenepyruvate (33) [8]. In addition to these
proposed reactions, PhdF is upregulated in the bacterial degradation of
pyrene [11]. This observation suggests that it might play a role in the ring-
opening process of 7a and 7b.
The genes for both enzymes were cloned from M. vanbaalenii PYR-1
genomic DNA, the enzymes were expressed, and purified in good yield.
PhdF has to be activated after purification, whereas PhdI does not
[19,20]. Both enzymes were examined with 1,2-dihydroxynaphthalene
The kinetic parameters for PhdI and PhdF with these substrates are
summarized in Table 1. The high value of the kcat/Km for 32 and PhdI
indicates that 32 is a reasonably good substrate for the enzyme and
3

K.L. Erwin, et al.
ArchivesofBiochemistryandBiophysics673(2019)108081
Scheme 5. Synthetic routes resulting in 7a,b. The details for the individual steps are described in the text.
likely the biological one. Likewise, the high value of the kcat/Km for 5c
and PhdF indicates that 5c is likely the biological substrate. A com-
parison of the kcat/Km values for 5c, 34, and 35 with PhdF
(5c > 35 > 34) shows that PhdF prefers larger substrates.
3. Experimental procedures
Materials. Chemicals, biochemicals, buffers, and solvents were ob-
tained from Sigma-Aldrich Chemical Co. (St. Louis, MO), Fisher
Scientific Inc. (Pittsburgh, PA), Fluka Chemical Corp. (Milwaukee, WI),
or EMD Millipore, Inc. (Billerica, MA). 2,3-Dimethoxybenzaldehyde
(8a), 3,4-dimethoxybenzaldehyde (8b), 3,4-dimethoxybenzoic acid,
9,10-phenanthrenequinone (15), 1,2-dihydroxynaphthalene, 1-hy-
droxy-2-naphthoic acid (32), and 3-methylcatechol (34) were pur-
chased from Sigma-Aldrich Chemical Co. 1-Hydroxypyrene (25) was
acquired from Tokyo Chemical Industry Co., Ltd. (TCI) America
(Portland, OR). 2,3-Dihydroxybiphenyl (99%) (35) was purchased from
Wako Chemicals Inc. (Richmond, VA). Oligonucleotide primers were
synthesized by Sigma-Aldrich Co. The EconoColumn® chromatography
columns were obtained from BioRad (Hercules, CA). The DEAE-
Sepharose resin, the HiLoad 16/60 Superdex resin, and the Sephadex G-
25 resin were obtained from GE Healthcare (Piscataway, NJ). The
GenElute gel extraction kit, the HisPur Ni-NTA resin, and Escherichia
coli strain C41(DE3) were purchased from Sigma-Aldrich Co. Enzymes
and reagents used for molecular techniques and the Gibson Assembly
Cloning Kit were purchased from New England Biolabs, Inc. The
QIAprep spin miniprep kit was purchased from Qiagen (Hilden,
Product Analysis for PhdF and PhdI. In addition to the kinetic para-
meters, the products of the four reactions (Scheme 6B, Scheme 7A-C)
were isolated and identified. The product analysis for the PhdF-cata-
lyzed reactions with 34 and 35 was done in part to develop the
methodology for future studies of these pathways where more complex
products are generated. The product for the reaction of PhdI and 32 is
trans-o-carboxybenzylidenepyruvate (33), which was identified by 1H
NMR analysis (and comparison to an authentic sample) [21]. The
predicted extradiol product for the reaction of 34 and PhdF is 2-hy-
droxymuconaldehyde (36, Scheme 7A), which was trapped as the pi-
colonate derivative (37). The identity was confirmed by 1H, 13C NMR,
and mass spectral analysis. The predicted extradiol product for the re-
action of 35 and PhdF is 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate
(38, Scheme 7B), which was isolated as the methyl ester, 39. The
predicted product (but not confirmed) for the reaction of 5c and PhdF is
30 (Scheme 7C), which was isolated as its methyl ester, 40. The iden-
tities of 39 and 40 were established by 1H, 13C NMR, and mass spectral
analysis.
Scheme 6. Proposed PhdF- and PhdI-catalyzed reactions for 5c and 32. PhdF is proposed to convert 5c into 31 via the presumed intermediate 30 and PhdI is
proposed to convert 32 into 33.
4

K.L. Erwin, et al.
ArchivesofBiochemistryandBiophysics673(2019)108081
Scheme 7. Product analysis for the reactions catalyzed by PhdF. PhdF catalyzes a ring-opening reaction using 34, 35, or 5c, where the products are trapped as their
picolinate (37) or methyl ester derivatives (39 or 40).
Cellular and Molecular Biology (ICMB) at the University of Texas at
Austin. Sonication was performed using a W385 sonicator of Heat
systems-ultrasonics, Inc. (Farmingdale, NY). Sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE) was carried out on a
Bio-Rad Mini-Protean II gel electrophoresis apparatus [22]. Protein
concentrations were determined using the Bradford method [23]. Nu-
clear magnetic resonance (NMR) spectra were recorded on a Varian
UNITY+ 300 MHz (Palo Alto, CA), Varian DirectDrive 400 MHz (Palo
Alto, CA),or a Bruker AVANCE III 500 MHz spectrometer (Billerica,
MA). NMR signals were analyzed using the software program Spin-
Works 3.1.6 (Copyright 2009 Kirk Marat, University of Manitoba).
High-resolution mass spectrometry (HRMS) analysis was carried out
on an Agilent 6530 Accurate Mass Q-TOF LC/MS housed in the Mass
Spectrometry Facility, Department of Chemistry, University of Texas.
Steady-state kinetic assays were performed on an Agilent 8453 diode-
array spectrophotometer. Nonlinear regression data analysis was per-
formed using the program Grafit (Erithacus Software Ltd., Staines, U.K.)
[24]. Compounds 5a-c and 6b were characterized as the dimethoxy
derivatives (10a,b, 14, and 21, respectively) and compounds 5d, 6a,
7a,b were characterized as the diacetate derivatives (16, 19, 27, 29,
respectively) due to the rapid oxidation (and decomposition) of the
dihydroxy species.
Table 1
Kinetic parameters for PhdI and PhdI using the indicated substratesa.
Substrate
Enzyme
kcat
(s−1
7.0
Km
kcat/Km
)
(μM)
23
(M−1 s−1
)
PhdI
0.2
0.9
2
3.1 ( 0.3) × 105
PhdF
9.3
1.7
0.5
6.0 ( 2.0) × 106
PhdF
0.32
0.17
0.01
50
6
6.5 ( 0.9) × 103
> 1.5 × 104
PhdFb
0.01
< 11
Synthesis of 1,2-Dimethoxyyphenanthrene (10a) and 2,3-
Dimethoxyphenanthrene (10b). An (E, Z)-mixture of 3,4-
Dimethoxystilbene (9b) was generated by the addition of potassium t-
butoxide (1.1 eq) to a stirred and chilled solution (on ice) of 3,4-di-
methoxybenzaldehyde (8b, 1.0 g) and benzyltriphenylphosphonium
bromide (1.1 eq) dissolved in toluene (25 mL) [12]. The reaction was
monitored by TLC and determined to be complete after 3 h. The solvent
was filtered and removed under reduced pressure and the residue was
purified by silica gel chromatography (4:1 hexanes/ethyl acetate). The
procedure generates 0.4 g of the (Z)-isomer as a clear colorless liquid
along with 0.6 g of the (E)-isomer as a white solid. The same procedure
was used to generate 9a, using 2,3-dimethoxybenzaldehyde (8a) as the
starting material. (E)-9b: 1H NMR (CDCl3, 400 MHz) δ 3.89 (s, 3H),
3.94 (s, 3H), 6.85 (d, 1H, J = 8.2 Hz), 6.96 (d, 1H, J = 16.3 Hz), 7.05
(m, 3H), 7.23 (m, 1H), 7.34 (m, 2H), 7.48 (m, 2H) ppm; 13C NMR
(CDCl3, 125 MHz) δ 55.8, 55.9, 108.7, 111.2, 119.9, 126.2 (2C), 126.8,
127.3, 128.4 128.6 (2C), 130.4, 137.5, 148.9, 149.1 ppm. (Z)-9b: 1H
a
The steady-state kinetic parameters were determined under the conditions
described in the text.
b
The steady-state kinetic parameters can only be estimated for the reaction
of PhdF and 35 because the enzyme was saturated at all substrate concentra-
tions, as detailed in the experimental.
Germany). ArcticExpress cells were obtained from Agilent Technologies
(Santa Clara, CA). Genomic DNA from Mycobacterium vanbaalenii PYR-1
was a gift from the laboratory of Dr. Carl Cerniglia (National Center for
Toxicology Research, Food and Drug Administration, Jefferson, AR).
The Amicon stirred cell concentrators and ultrafiltration membranes
(10000 Da cutoff) were purchased from EMD Millipore Inc.
General Methods. The PCR amplification of DNA was conducted in a
GeneAmp 2700 thermocycler (Applied Biosystems, Carlsbad, CA). DNA
sequencing was performed in the DNA Core Facility in the Institute for
5

K.L. Erwin, et al.
ArchivesofBiochemistryandBiophysics673(2019)108081
NMR (CDCl3, 400 MHz) δ 3.58 (s, 3H), 3.84 (s, 3H), 6.52 (m, 2H), 6.73
(m, 2H), 6.81 (ddd, 1H, J = 0.4 Hz, J = 2.0 Hz, J = 8.2 Hz), 7.17 (m,
1H), 7.26 (m, 4H) ppm; 13C NMR (CDCl3, 125 MHz) δ 56.1, 56.5, 111.5,
112.4, 122.6, 127.7, 129.0 (2C), 129.6 (3C), 130.5, 130.7 138.4, 148.9,
149.0 ppm. 13C NMR (CD3OD, 125 MHz) δ 56.2, 56.6, 112.9, 113.7,
123.6, 128.4, 129.6 (2C), 130.18, 130.23 (2C), 131.4, 131.7 139.5,
150.1 (2C) ppm.
126.7, 127.0, 127.6, 127.8, 128.0, 129.2, 132.4, 149.9, 150.2,
169.6 ppm.
3,4-Dimethoxyphenanthrene (14) was generated from the car-
boxylic acid (derived from the hydrolysis of 13) as follows. Copper
powder (25 mg) was added to freshly distilled quinoline (0.5 mL), and
the mixture was allowed to stir for 1 h under argon [14]. The carboxylic
acid (200 mg) was added and the reaction was gently refluxed for 18 h.
After cooling, the mixture was diluted with ether and slowly poured
into 6 M HCl (10 mL). The resulting mixture was extracted with ether
(3 × 20 mL). The organic layers were combined, dried (over anhydrous
Na2SO4), and the solvent removed. The residue was purified by silica
gel chromatography (4:1 hexanes/ethyl acetate) to afford 14 (110 mg)
as a white solid. 3,4-Dimethoxyphenanthrene (14): 1H NMR (CDCl3,
300 MHz) δ 4.0 (s, 1H), 4.1 (s, 1H), 7.4 (d, 1H, J = 8.7 Hz), 7.6 (m, 5H),
7.9 (dd, 1H, J = 1.8 Hz, 7.7 Hz), 9.7 (dd, 1H, J = 0.9 Hz, 8.2 Hz); 13C
NMR (CDCl3, 75 MHz) δ 56.5, 59.7, 113.0, 124.6, 124.8, 125.5, 126.48,
120.51, 126.9, 127.9, 128.26, 128.33, 129.6, 133.0, 147.1, 151.5 ppm.
Removal of the Dimethoxy Groups. In a typical procedure, the di-
methoxy derivative (10a,b or 14, ~20 mg) was dissolved in CH2Cl2
(3 mL) and cooled to −78 °C. A solution of BBr3 (3 eq of a 1 M solution
in CH2Cl2) was added [13]. After 1 h, the reaction mixture was allowed
to warm to ambient temp and was then stirred for an additional 1 h.
Subsequently, the mixture was poured into cold water (5 mL) and ex-
tracted with CH2Cl2 (3 × 10 mL). The CH2Cl2 layers were collected,
purged with argon, dried over anhydrous Na2SO4, and the solvent is
removed to yield 18 mg of the dihydroxy compound as a white solid.
The material is kept under argon and stored at least at −20 °C (or
below). The purity was assessed by TLC.
Oxygen is bubbled into a solution of 9a or 9b (1 g) dissolved in ether
(50 mL) and contained in a quartz glass reaction vessel [12]. After
10 min, the oxygen flow was stopped and I2 (50 mg) was added. The
flask was gently stoppered and irradiated by UV (UV transilluminator
set on high). Oxygen and I2 (10 mg) were added after 24 h until reaction
is complete. The reaction was monitored by TLC and determined to be
complete after 48 h. The ether layer was washed with 0.5 M sodium
metabisulphite (50 mL) and the organic layer separated and removed.
The aqueous layer was extracted with ethyl acetate (2 × 50 mL). The
organic layers were combined, dried over anhydrous sodium sulfate,
and the solvent was removed. The residue was purified by silica gel
chromatography (4:1 hexanes/ethyl acetate) to afford 0.5 g of 2,3-di-
methoxyphenanthrene (10b, 0.5 g). 1,2-Dimethoxyphenanthrene
(10a): 1H NMR (CDCl3, 400 MHz) δ 4.02 (s, 3H), 4.04 (s, 3H), 7.37 (d,
1H, J = 9.1 Hz), 7.54 (m, 1H), 7.62 (m, 1H), 7.74 (d, 1H, J = 9.1 Hz),
7.86 (dd, 1H, J = 1.4 Hz, 7.8 Hz), 8.09 (dd, 1H, J = 0.5 Hz, 9.1 Hz),
8.42 (d, 1H, J = 9.0 Hz), 8.59 (dd, 1H, J = 0.5 Hz, 8.2 Hz) ppm; 13C
NMR (CDCl3, 75 MHz) δ 56.4, 61.3, 113.4, 118.9, 120.2, 122.3, 125.4,
125.9, 126.7, 127.36, 127.41, 128.6, 130.3, 131.0, 143.8, 149.8 ppm.
2,3-Dimethoxyphenanthrene (10b): 1H NMR (CDCl3, 500 MHz) δ 4.08
(s, 3H), 4.16 (s, 3H), 7.28 (s, 1H), 7.57 (m, 1H), 7.65 (m, 1H), 7.69 (m,
1H), 7.91 (d, 1H, J = 7.9 Hz), 8.05 (s, 1H), 8.57 (d, 1H, J = 8.3 Hz)
ppm; 13C NMR (CDCl3, 125 MHz) δ 55.9, 56.0, 103.3, 108.3, 122.1,
124.9, 125.3, 125.6, 126.0, 126.2, 127.2, 128.7, 129.8, 131.4, 149.33,
149.35 ppm.
Synthesis of Phenanthrene-9,10-diyl diacetate (16). The commercially
available 9,10-phenanthrenequinone was treated as described below
for the synthesis of pyrene-4,5-diyl diacetate (29) to generate diacetate
16 [15]. As needed, small quantities of 16 were dissolved in ethanol
(3 mL) and purged with argon. Three drops of acetyl chloride are added
and the reaction heated to 70 °C. The reaction is allowed to cool and the
solvent removed under reduced pressure. The purity of the resulting 5d
was assessed by TLC. The compound was stored under argon at least
−20 °C, to minimize oxidation. Phenanthrene-9,10-diyl diacetate (16):
1H NMR (CDCl3, 300 M Hz) δ 2.5 (s, 6H), 7.7 (m, 4H), 7.9 (m, 2H), 8.7
(d, 2H, J = 8.5 Hz) ppm; 13C NMR (CDCl3, 75 MHz) δ 20.5, 122.0,
123.0, 126.5, 127.1, 127.3, 129.7, 135.8, 168.2 ppm.
Synthesis of 3,4-Dimethoxyphenanthrene (14). (E)-2-Carboxymethyl-
3,4-dimethoxystilbene (12) was generated from methyl 2-formyl-4,5-
dimethoxybenzoate (11) [13], as follows. To a chilled mixture (on ice)
of 11 (1.0 g) and NaH (1.1 eq of a 60% mineral oil dispersion) in an-
hydrous THF (25 mL) is added benzyltriphenylphosphonium bromide
(1.1 eq) [12]. After 1.5 h, the reaction mixture was poured into chilled
water (200 mL). The resulting solution was extracted with ethyl acetate
(3 × 200 mL). The organic layers were combined, dried (over anhy-
drous Na2SO4), and the solvent removed. The residue was purified by
silica gel chromatography (4:1 hexanes/ethyl acetate) to afford 12 (1 g)
as a white solid. The product (12) was treated as described above for 9a
and 9b to yield 13 [12]. (E)-2-Carboxymethyl-3,4-Dimethoxystilbene
(12): 1H NMR (CDCl3, 300 MHz) δ 3.89 (s, 3H), 3.92 (s, 3H), 6.90 (d,
1H, J = 16.2 Hz), 7.14 (s, 1H) 7.24 (m, 1H), 7.34 (m, 2H), 7.46 (s, 1H),
7.54 (m, 2H), 8.06 (d, 1H J = 16.2) ppm; 13C NMR (CDCl3, 75 MHz) δ
52.0, 55.99, 56.03, 109.0, 113.0, 120.5, 126.7 (2C), 127.6, 127.7,
128.6 (2C), 130.0, 134.0, 137.5, 147.9, 152.0, 167.3 ppm.
Synthesis of 7,8-Dimethoxyfluoranthene (24). In a typical procedure,
20 (42.6 mg) is added to a mixture of IBX (1.2 eq in 3 mL of a solution
of 1% methanol/CH2Cl2) and reacted for 6–8 h (until starting material
is consumed). Most of the solvent is removed, ethyl acetate is added,
and most of the solvent is removed again (to remove CH2Cl2) and then
ethyl acetate (~5–10 mL) is added. A solution of NaBH4 (200 mg in
20 mL H2O) is added to the round bottom flask and the mixture is
stirred at room temperature. The mixture is then extracted with ethyl
acetate, the ethyl acetate layers are collected, dried over anhydrous
Na2SO4, while purging with argon, and the solvent is removed.
Subsequently, (CH3)2SO4 (5 eq) followed by K2CO3 (10 eq) are added to
the residue, and the reaction is refluxed (under argon) in acetone (2 mL)
for 2 days. The acetone is removed under reduced pressure to near
dryness, the remaining liquid is diluted with ethyl acetate, filtered, and
then the solvent is removed under reduced pressure. The residue is
subjected to silica gel chromatography (8:1 hexanes/ethyl acetate). The
appropriate fractions (for 21 and 22) are collected, and the solvent is
removed under reduced pressure to yield 23 (19.2 mg) and 24 (2.2 mg).
7,8-Dimethoxyfluoranthene (24): 1H NMR (CDCl3, 500 MHz) δ 4.0 (s,
3H), 4.1 (s, 3H), 7.0 (d, 1H, J = 8.1 Hz), 7.6 (m, 2H), 7.7 (m, 1H), 7.8
(d, 2H, J = 8.2 Hz), 7.9 (m, 2H), 8.19 (d, 1H, J = 6.9 Hz); 13C NMR
(CDCl3, 125 MHz) δ 56.3, 60.3, 111.4, 117.3, 119.1, 123.3, 125.6,
126.4, 127.8, 128.2, 129.9, 132.4, 132.8. 133.4, 135.4, 136.9, 146.0,
153.0. The dimethoxy groups were removed as described above for 5a-
c.
1-Carboxymethyl-3,4-dimethoxyphenanthrene (13): 1H NMR
(CDCl3, 300 MHz) δ 3.96 (s, 3H), 4.01 (s, 3H), 4.05 (s, 3H), 7.62 (m,
2H), 7.68 (d, 1H, J = 9.3 Hz), 7.85 (m, 1H), 7.92 (s, 1H), 8.65 (d, 1H
J = 9.3 Hz), 9.64 (m, 1H) ppm; 13C NMR (CDCl3, 75 MHz) δ 52.4, 56.5,
59.9, 116.0, 123.4, 123.9, 125.3, 126.8, 127.0, 127.5, 127.7, 128.0,
128.2, 129.3, 132.6, 150.1, 150.7, 168.1 ppm.
Subsequently, the methyl ester (13, 0.4 g) is suspended in 1 M NaOH
(10 mL) and refluxed for 2 h. The reaction is allowed to cool and the pH
is adjusted to 1.8 with phosphoric acid. The resulting solution was
extracted with ethyl acetate (3 × 20 mL). The organic layers were
combined, dried (over anhydrous Na2SO4), and the solvent removed to
give 0.3 g of 1-carboxy-3,4-dimethoxyphenanthrene acid as a white
solid. 1-Carboxy-3,4-dimethoxyphenanthrene acid: 1H NMR (0.6 mL
CDCl3 with 30 μL DMSO‑d6, 300 MHz) δ 3.88 (s, 3H), 3.98 (s, 3H), 7.53
(m, 2H), 7.58 (d, 1H, J = 9.4 Hz), 7.77 (m, 1H), 7.95 (s, 1H), 8.73 (d,
1H, J = 9.4 Hz), 9.55 (m, 1H) ppm; 13C NMR (0.6 mL CDCl3 with 30 μL
DMSO‑d6, 75 MHz) δ 56.3, 59.7, 116.2, 123.7, 124.5, 125.0, 126.5,
Synthesis of Fluoranthene-2,3-diyl (19) and Pyrene-1,2-diyl diacetate
6

K.L. Erwin, et al.
ArchivesofBiochemistryandBiophysics673(2019)108081
(27). In a typical procedure IBX (3 eq), prepared as described [17], is
added to a solution of 1-hydroxypyrene (25, 60.0 mg) in a 2:1 mixture
of CH2Cl2/CH3OH (3 mL). The reaction is monitored by TLC until 25 is
consumed (~4 h). The solvent is filtered and removed under reduced
pressure. Ethyl acetate (5 mL) is added to the residue followed by the
slow addition of a solution of NaBH4 (150 mg in 1 mL of H2O). The
mixture is stirred until the gas evolution subsides (1 h). The organic
layer is separated and the aqueous layer is extracted with ethyl acetate
(3 × 2 mL). The organic layers are combined and dried over anhydrous
Na2SO4. The solvent is removed under reduced pressure and the residue
is dissolved in anhydrous pyridine. Acetic anhydride (3 eq) is added to
the solution, and the reaction is allowed to proceed under argon for
24 h [18]. The solvent is then removed and the residue is purified by
silica gel chromatography (8:1 hexanes/ethyl acetate). This gives 19 or
27 (14.7 mg) as off-white solids. Fluoranthene-2,3-diyl diacetate (19):
1H NMR (CDCl3, 300 MHz) δ 2.4 (s, 3H), 2.5 (s, 3H), 7.4 (m, 2H), 7.65
(m, 1H), 7.8 (m, 5H); 13C NMR (CDCl3, 75 MHz) δ 20.5, 20.8, 116.5,
120.3, 121.4, 121.71, 121.73, 124.4, 127.9, 127.93, 129.0, 131.0,
135.7, 137.1, 137.6, 138.4, 139.7, 141.5, 168.4, 168.7. Pyrene-1,2-diyl
diacetate (27): 1H NMR (acetone-d6, 500 MHz) δ 1.6 (s, 3H), 2.6 (s, 3H),
7.4 (d, 1H, J = 9.2 Hz), 8.0 (d, 1H, J = 9.3 Hz), 8.1 (m, 1H), 8.3 (d, 2H,
J = 8.9 Hz), 8.37 (s, 1H), 8.41 (m, 2H); 13C NMR (acetone-d6, 125 MHz)
δ 19.9, 20.5, 121.3, 124.0, 124.7, 124.9, 126.1, 126.2, 127.2, 127.3,
127.7, 129.1, 130.18, 130.21, 131.6, 131.8, 138.0, 141.1, 168.4,
139.5 ppm. As needed, the diacetate groups were removed as described
above for 5d.
PhdI or PhdF was transformed into E. coli C41(DE3) by the calcium heat
shock method [25]. Transformed cells were grown on agar plates
containing ampicillin (100 μg/mL) at 37 °C overnight. A single colony
was used for the generation of additional plasmid for sequencing and
protein expression.
For expression, LB media cultures (25 mL) containing ampicillin
(100 μg/mL) were inoculated using a single colony and grown over-
night at 37 °C. LB media cultures (1.6 L) were inoculated using an ap-
propriate amount of the overnight culture to make OD600 = 0.05 and
grown at 37 °C for 2.5 h. Protein expression was induced overnight
(18 h) at 21 °C using a final isopropyl-β-D-thiogalactoside concentration
of 0.1 mM. Cells were harvested by centrifugation (10,000 × g) with
yields ranging from 3 to 5 g and stored at −80 °C.
Purification of PhdI and PhdF. Cells were suspended to a final con-
centration of 10 mg/mL in in Buffer A (20 mM HEPES, 300 mM NaCl,
pH 7) made 15 mM in imidazole. Cells were disrupted by sonication and
the resulting solution was centrifuged for 30 min at 17,700 × g and
4 °C. The supernatant was loaded onto a Ni-NTA column (1 × 10 cm,
~6 mL resin) pre-equilibrated with Buffer A. The column was washed
with Buffer A (made 70 mM in imidazole) and the desired protein was
eluted with Buffer A (made 90 mM imidazole). Protein purity was as-
sessed by the observation of a single band on an SDS-PAGE gel. The
eluant was concentrated to ~1 mg/mL and exchanged into Buffer B
(20 mM HEPES, 300 mM NaCl, pH 7.0, and 5% glycerol) using an
Amicon stirred cell equipped with an ultrafiltration membrane
(10,000 Da cutoff). The typical yields were 2–4 mg of protein per gram
of cells.
Synthesis of Pyrene-4,5-diyl diacetate (29). Quinone 28 (0.75 g),
prepared as described elsewhere [18], was dissolved in anhydrous THF
(50 mL), and Pd/C (100 mg), K2CO3 (15 eq), and acetic anhydride (15
eq) were added [15]. The reaction is shaken on a Parr Hydrogenator (5
psi of H2) for 48 h. Subsequently, the mixture was diluted with ethyl
acetate (100 mL), purged with argon and filtered. The solvent is re-
moved under reduced pressure and the residue is purified by silica gel
chromatography (2:1 hexanes/ethyl acetate). The silica gel chromato-
graphy step is repeated using toluene to remove traces of a colored
impurity. This gives 29 (0.44 g) as an off-white solid. 1H NMR (CDCl3,
400 MHz) δ 2.6 (s, 6H), 8.0 (t, 2H), 8.1 (s, 2H), 8.17 (dd, 2H,
J = 1.1 Hz, 7.9 Hz), 8.23 (dd, 2H, J = 1.1 Hz, 7.6 Hz); 13C NMR (CDCl3,
100 MHz) δ 20.6, 119.4, 123.6, 125.8, 125.9, 126.4, 127.6, 131.2,
136.7, 168.3 ppm. As needed, the diacetate groups were removed as
described above for 5d.
Activation of PhdF. PhdF is active when the cells are lysed, but loses
activity when left overnight or passed through a column. Hence, kinetic
analysis required activation (because the enzyme was purified), but
product isolation did not (because the enzyme was used as crude ly-
sate). To activate PhdF, ascorbate (4 mM final), FeCl2 (2 mM final) and
acetone (5% final) were added to aliquots (~500 μL) of protein (1 mg/
mL final concentration) purified as described above [19,20]. The re-
sulting mixture was incubated on ice for 30 min. The sample was cen-
trifuged for 5 min at 20,800 × g and exchanged into Buffer B using a
PD-10 column. Activity decreases within 8 h of activation so protein is
activated and assayed on the same day. PhdI did not require activation.
Incubation of PhdI and PhdF with Various Substrates. Aliquots of PhdI
or PhdF were incubated with 1,2-dihydroxynaphthalene (in ethanol), 1-
hydroxy-2-naphthoate (32, in ethanol), 5a,c,d, 6a,b, 7a,b (Scheme 2),
3-methylcatechol (34, Scheme 7A), and 2,3-dihydroxybiphenyl (35,
Scheme 7B) in 1 mL of 20 mM HEPES buffer, pH 7.0. Reactions were
generally followed up to 30 min, but the rapid non-enzymatic oxidation
of some substrates limited the incubation times. With the exception of
the incubation mixture of PhdI and 32, PhdF and 5c, (see supporting
information for representative UV/Vis traces), 34, and 35, no change in
absorbance other than that caused by non-enzymatic oxidation was
observed. These reactions were subjected to kinetic and product ana-
lysis.
Construction of the Expression Vectors for PhdI and PhdF.
Amplification of the desired genes was achieved through two rounds of
PCR. In the first round, two overhang PCR primers that annealed within
100 bp around the desired gene were used (For PhdI: overhang forward
primer, CCCAAGAGGTCAGCTCAGTG, and overhang reverse primer,
GGAGGGCGTAGGGATAATGC; for PhdF: overhang forward primer,
TGGGCCGCACTCCAGCAGCGCTAT, and overhang reverse primer,
TTAGGAACCGGATCGCCATTTCAC). In the second round, the desired
gene flanked with appropriate restriction sites was isolated (PhdI:
BamHI and EcoRI and PhdF: EcoRI and HindIII). For PhdI, the forward
and reverse primers were TAGCCAGGATCCTCCACCGCC and GAATC
GGAATTCTCAGCGGGC, respectively, where the restriction sites are
underlined. For PhdF, the forward and reverse primers were GGACAG
CACGAATTCTTGGTGAA and GCCGTCGAGAAGCTTTCATGTTG, re-
spectively, where the restriction sites are underlined. The amplification
reaction (100 μL) contained template DNA (15 ng), dNTPs (0.4 mM),
MgCl (2 mM), primers (0.4 μM), 1 × buffer, and Vent Polymerase (1
unit). The PCR amplification protocol consisted of a 5 min denaturation
step at 94 °C followed by 35 cycles of 94 °C for 1 min, 55 °C for 1 min,
and 72 °C for 3 min and ended with a 10 min elongation step at 72 °C.
The PCR reaction product size was confirmed on a 1% agarose gel and
isolated using the GenElute gel extraction kit and elution into water
(60 μL). The PCR products were inserted into pET 32 between appro-
priate restriction sites using digestion and ligation procedures reported
elsewhere [23]. An aliquot of the individual ligation mixtures (30 μL) of
Reaction of PhdI with 1-Hydroxy-2-naphthoate (32). Aliquots of PhdI
(1–10 μL, 6–60 nM final concentration) and 32 (2–80 μM final con-
centration in ethanol) were added to 1 mL of 20 mM HEPES buffer (pH
7.0) and the reaction was monitored by UV/Vis spectroscopy for 30 s.
The trace showed a clear decrease in absorbance at 250 nm with a
concomitant increase in absorbance at 300 nm. A sample trace is found
in the supporting information (Fig. S1A).
Reaction of PhdF with 3,4-Dihydroxyphenanthrene (5c). Aliquots of
PhdF (21–500 nM final concentration) and 5c (1–20 μM final con-
centration in ethanol) were added to 1 mL of 20 mM HEPES buffer (pH
7.0) and the reaction was monitored by UV/Vis spectroscopy for 30 s.
The trace showed a clear decrease in absorbance at 245 nm. Product
absorbance overlaps with substrate absorbance so there is not an ob-
vious increase in absorbance concomitant with the decrease at 245 nm.
A sample trace is found in the supporting information (Fig. S2A).
Kinetic Analysis of PhdI and 32. An aliquot of PhdI (2 μL of a
7

K.L. Erwin, et al.
ArchivesofBiochemistryandBiophysics673(2019)108081
0.55 mg/mL solution) was added to 20 mM HEPES buffer (1 mL, pH
7.0) to give a final concentration of 19 nM. Assays were initiated by the
addition of aliquots of a stock solution of 32 in ethanol (34 mM). The
final substrate concentration ranged from 3 to 270 μM. The reaction
was monitored by following the increase in absorbance at 300 nm
(ε = 8637 M−1cm−1). Initial rates were determined from the first 30 s
of the reaction, plotted versus substrate concentration, and fit to the
equation to calculate the steady-state parameters kcat and KM using
Grafit [24]. The Michaelis-Menten plot is shown in the Supporting In-
formation (Fig. S1B).
parameters could only be estimated because the enzyme was saturated
at all concentrations of substrate (11–570 μM) that could be measured
within the limits of the spectrophotometer. Hence, the observed rate is
assumed to be Vmax and the Km is estimated to be less than 11 μM (as
reported in Table 1).
Product Analysis for the Reaction of PhdF and 34. PhdF was used to
generate the ring-opened product for 3-methylcatechol (34). PhdF was
expressed in E.coli C41(DE3) cells as described above, and the cells
were resuspended in Buffer A at a concentration of 1 g/30 mL. The cells
were disrupted via sonication and the resulting solution was cen-
trifuged for 30 min at 17,700 × g and 4 °C. The clarified supernatant
was mixed with 34 and the presumed product (36, Scheme 7A) was
converted into the picolonic acid derivative (37) for isolation and
purification. Briefly, 80 tubes containing 2 mL Buffer A, 100 μL of
clarified supernatant, and 34 (40 μL of a 22 mg/mL solution in ethanol)
were incubated at room temperature for ~20 min. Ammonium sulfate
(2 mL of 4 mM stock solution) was added to each tube and the tubes
were combined and extracted with methanol. The extract was mixed
with silica, concentrated in vacuo, washed with 10% methanol in
chloroform, and the product was recovered using chlor-
oform:methanol:acetic acid (9:3:1). The solution was evaporated to
dryness and the product resuspended in ~0.6 mL of deuteriated buffer
and placed in an NMR tube. 37: 1H NMR (,0.6 mL of NaD2PO4, pH 7.3
with 30 μL of DMSO-d6, 300 MHz) δ 2.4 (3H, s), 7.2 (1H, d, J = 8.1 Hz),
7.5 (1H, d, J = 7.8 Hz), 7.7 (1H, t); 13C NMR (0.6 mL of NaD2PO4, pH
7.3 with 30 μL of DMSO‑d)6, 125 MHz) δ 24.58, 122.60, 127.40,
140.35, 154.39, 159.60, 174.69 ppm; HRMS (ESI-TOF) m/z 138.0550
(M + H)+ calcd for C7H8NO2, found 138.0552.
The extinction coefficient for 33 was determined as follows. A stock
solution of 32 (34 mM) was made up and aliquots were removed and
added to 1 mL of HEPES buffer (pH 7.0) containing a large amount of
PhdI. The final concentrations of 32 ranged from 2.6 to 270 μM. The
final concentration of product was assumed to be the same as substrate.
Absorbance readings were taken at each concentration and plotted vs
the concentration. The slope is the reported extinction coefficient.
Product Analysis for the Reaction of PhdI and 32. PhdI was expressed
as described above in E.coli C41(DE3) cells, and the cells (~1.2 g) were
suspended in 20 mM HEPES buffer (40 mL, pH 7.0), lysed by sonication,
and the resulting solution was centrifuged for 30 min at 17,700 × g and
4 °C. The supernatant was diluted to 150 mL with 20 mM HEPES buffer
(pH 7.0) and 1-hydroxy-2-naphthoate (25 mg in 1.5 mL ethanol) was
added dropwise to the supernatant, which was stirring on ice. Aliquots
(1 mL) of the solution were removed every 5 min, centrifuged at 20,800
× g for 2 min, and the clarified supernatant was monitored by UV
spectroscopy until the reaction was complete (30 min) as determined by
no further increase in absorbance at 300 nm. The reaction was cen-
trifuged at 10,000 × g and 4 °C for 20 min. The pH of the clarified
supernatant was adjusted to 8.0 using drops of 10 M KOH. Protein was
removed using an Amicon stirred cell concentrator equipped with an
ultrafiltration membrane (10,000 Da cutoff). The protein-free flow-
through was concentrated in vacuo to 1.5 mL and loaded onto a
Sephadex G-25 column. The column was washed with water and the
eluate monitored using UV spectroscopy (294 nm). The product-con-
taining fractions (~10 mL) were combined and dried in vacuo. The
product was resuspended in ~0.6 mL of NaD2PO4, pH 7.3, placed in an
NMR tube, and a 1H NMR spectrum was obtained. The 1H NMR spec-
trum matched that of an authentic sample of trans-o-carbox-
ybenzylidenepyruvate (33, Scheme 6B) [21].
Product Analysis for the Reaction of PhdF with 2,3-Dihydroxybiphenyl
(35) or 3,4-dihydroxyphenanthrene (5c). The E.coli C41(DE3) cells con-
taining the PhdF expression vector were grown as indicated above.
Subsequently, the cells were centrifuged at 17,700 × g for 30 min.. The
cell pellet was washed 3 times by resuspension in Buffer A (OD600 = 0.5
for 10 μL suspension in 1 mL buffer) and then centrifuged (17,700 × g for
30 min). The pellet was then resuspended in Buffer A to an OD600 of 0.5
(10 μL in 1 mL of buffer). The final volume was 100 mL (for 35) or 300 mL
(for 5c). Stock solutions (50 mg/mL) were prepared in ethanol im-
mediately before use. An aliquot of the stock substrate (2 mL) was added
to the cell suspension, which was stirring on ice, over the course of 5 min
to a final concentration of 1 mg/mL (for 35) or 0.33 mg/mL (for 5c).
Every 5 min, aliquots (500 μL) were removed, centrifuged at 20,800 × g
for 2 min, and the cell free supernatant monitored by UV spectroscopy
until the reaction was complete (~30 min) as determined by no further
change in absorbance. The reactions were monitored by following the
increase in absorbance at 434 nm (35) or decrease in absorbance at
245 nm (5c). The reaction was centrifuged at 17,700 × g for 20 min and
the cell-free supernatant acidified to a pH of 2.25 using drops of 10 M HCl.
The acidic solutions were extracted using 2.5 vol of ether and the ether
layers were collected and dried over anhydrous Mg(SO4)2. The unstable
reaction product was methylated using CH2N2 generated from a Diazald
kit, following the manufacturer's instructions. The methyl esters were
purified by silica gel chromatography using hexane:ethyl acetate (2:1) for
39 or (4:1) for 40. The product-containing fractions, as determined by
TLC, were combined and evaporated to dryness. The products were dis-
solved in CDCl3 (~0.6 mL) and placed in NMR tubes. 39: 1H NMR (CDCl3,
300 MHz) δ 3.9 (3H, s), 6.4 (1H, dd, J = 0.6 Hz, 11.7 Hz), 6.5 (1H, s), 7.1
(1H, dd, J = 0.6 Hz, 15.3 Hz), 7.5 (3H, m), 7.9 (1H, dd, J = 11.7 Hz,
15.3 Hz), 7.9 (2H, m); 13C NMR (CDCl3, 75 MHz) δ 53.5, 109.4, 127.2,
128.45, 128.6, 132.8, 137.0, 138.0, 144.7, 165.1, 190.5 ppm; HRMS (ESI-
TOF) m/z 255.0633 (M + Na)+ calcd for C13H12O4Na, found 255.0628.
40: 1H NMR (CDCl3, 300 MHz) δ 3.9 (3H, s), 6.4 (1H, dd, J = 0.7 Hz,
11.7 Hz), 7.1 (1H, dd, J = 0.6 Hz, 15.3 Hz), 7.5 (2H, m), 7.58 (1H, m),
7.87 (1H, dd, J + 11.7 Hz, 15.3 Hz), 7.97 (2H, m); 13C NMR (CDCl3,
75 MHz) δ 169.8, 145.8, 134.9, 127.8, 127.6, 127.0, 126.0, 124.7, 124.5,
122.0, 121.8, 117.7, 113.6, 94.0, 54.1 ppm; HRMS (ESI-TOF) m/z
279.0633 (M + Na)+ calcd for C15H12O4Na, found 279.0636.
Kinetic Analysis of PhdF using 3,4-dihydroxyphenanthrene (5c), 3-
methylcatechol (34), or 2,3-dihydroxybiphenyl (35). Aliquots of PhdF
(10–510 nM final concentration) were added to 20 mM HEPES buffer
(1 mL, pH 7.0). The reaction was initiated by the addition of substrate
(1–20 μL) in ethanol from stock solutions of 3,4-dihydroxyphenan-
threne (5c, final concentration 1–9 μM), 3-methylcatechol (34, final
concentration 6–580 μM) or 2,3-dihydroxybiphenyl (35, final con-
centration 11–570 μM). For 5c, the decrease in absorbance at 245 nm
(ε = 25,800 M−1 cm−1) was monitored; for 34, the increase in absor-
bance at 388 nm (ε = 13,800 M−1 cm−1) was monitored; and for 35,
the increase in absorbance at 434 nm (ε = 21,700 M−1 cm−1) was
monitored. The extinction coefficients were determined as follows. For
5c, 34, and 35, stock solutions were made up in ethanol (10.3, 59.6,
and 2.15 mM, respectively), aliquots removed (0.5–32, 0.5–2.5, and
2–20 μL, respectively) and added to 1 mL of 20 mM HEPES buffer (pH
7.0) to give final concentrations of 5.2–330.9 μM for 5c, 29.8–149 μM
for 34, and 4.3–43 μM for 35. For 5c, absorbance readings were taken
at each concentration and plotted vs the concentration. The slope is the
reported extinction coefficient. The extinction coefficients for the pro-
ducts of the reaction with 34 and 35 (36 and 38, respectively) were
determined as described for 33 above.
Initial rates were determined from the first 15 s of the reaction,
plotted versus substrate concentration, and fit to the Michaelis-Menten
equation to calculate the steady-state parameters kcat, KM, and Ki using
Grafit [24]. The Michaelis-Menten plot is shown in the Supporting In-
formation (Fig. S2B). For the reaction of PhdF and 35, the kinetic
8

K.L. Erwin, et al.
ArchivesofBiochemistryandBiophysics673(2019)108081
4. Conclusions
References
Eight dihydroxy PAH derivatives were successfully synthesized and
characterized (4 dihydroxyphenanthrenes, 2 dihydroxyfluoranthenes,
and 2 dihydroxypyrenes) as the dimethoxy or diacetate derivatives.
Two putative dioxygenases (PhdI and PhdF) in the phenanthrene de-
gradative pathway in M. vanbaalenii PYR-1 were purified and examined
for ring opening activity with 3,4-dihydroxyphenanthrene and two di-
hydroxypyrenes. The dihydroxypyrenes were not processed, but 3,4-
dihydroxyphenanthrene was a substrate for PhdF, thereby confirming
its role in the pathway. The product was identified by 1H NMR analysis.
The reaction of PhdI and 1-hydroxy-2-naphthoate was confirmed by
kinetic and product analysis. This is the first biochemical evidence for
these reactions in M. vanbaalenii PYR-1 and the first evidence for the
reaction of PhdF with 3,4-dihydroxyphenanthrene. Both results are
consistent with the presence of the genes for the other enzymes in the
proposed phenanthrene degradative pathway in M. vanbaalenii PYR-1
[8,11]. Two additional substrates (3-methylcatechol and 2,3-dihy-
droxybiphenyl) were examined with PhdF and the products character-
ized in order to develop methodology for future work.
[1] P.E.T. Douben (Ed.), PAHs: an Ecotoxicological Perspective, John Wiley & Sons,
Ltd, 2003.
[2] T.M. Penning, M.E. Burczynski, C.-F. Hung, K.D. McCoull, N.T. Palackal,
L.S. Tsuruda, Dihydrodiol dehydrogenases and polycyclic aromatic hydrocarbon
activation: generation of reactive and redox active o-quinones, Chem. Res. Toxicol.
12 (1998) 1–18.
[3] A. Tuvikene, Responses of fish to polycyclic aromatic hydrocarbons (PAHs), Ann.
Zool. Fenn. 32 (1995) 295–309.
[4] A. Ramesh, S.A. Walker, D.B. Hood, M.D. Guillen, K. Schneider, E.H. Weyand,
Bioavailability and risk assessment of orally ingested polycyclic aromatic hydro-
carbons, Int. J. Toxicol. 23 (2004) 301–333.
[5] R.M. Atlas, T.C. Hazen, Oil biodegradation and bioremediation: a tale of the two
worst spills in U.S. history, Environ. Sci. Technol. 45 (2011) 6709–6715.
[6] R.W. Eaton, P.J. Chapman, Bacterial metabolism of naphthalene: construction and
use of recombinant bacteria to study ring cleavage of 1,2-dihydroxynaphthalene
and subsequent reactions, J. Bacteriol. 174 (1992) 7542–7755.
[7] O. Kweon, S.-J. Kim, R.D. Holland, H. Chen, D.-W. Kim, Y. Gao, L.-R. Yu, S. Baek,
D.-H. Baek, H. Ahn, C.E. Cerniglia, Polycyclic aromatic hydrocarbon metabolic
network in Mycobacterium vanbaalenii PYR-1, J. Bacteriol. 193 (2011) 4326–4337.
[8] R.L. Stingley, A.A. Khan, C.E. Cerniglia, Molecular characterization of a phenan-
threne degradation pathway in Mycobacterium vanbaalenii PYR-1, Biochem.
Biophys. Res. Commun. 322 (2004) 133–146.
[9] I. Kelley, C.E. Cerniglia, The metabolism of fluoranthene by a species of
Mycobacterium, J. Ind. Microbiol. 7 (1991) 19–26.
[10] I. Kelley, J.P. Freeman, F.E. Evans, C.E. Cerniglia, Identification of metabolites from
the degradation of fluoranthene by Mycobacterium sp. strain PYR-1, Appl. Environ.
Microbiol. 59 (1993) 800–806.
Funding
[11] S.J. Kim, O. Kweon, R.C. Jones, J.P. Freeman, R.D. Edmondson, C.E. Cerniglia,
Complete and integrated pyrene degradation pathway in Mycobacterium vanbaalenii
PYR-1 based on systems biology, Biodegradation 19 (2008) 859–881.
[12] F.B. Mallory, M.J. Rudolph, S.M. Oh, Photochemistry of stilbenes. 8. Eliminative
photocyclization of o-methoxystilbenes, J. Org. Chem. 54 (1989) 4619–4626.
[13] C. Che, J. Xiang, G.-X. Wang, R. Fathi, J.-M. Quan, Z. Yang, One-pot synthesis of
quinolone-based tetracycles by a tandem three-component reaction, J. Comb.
Chem. 9 (2007) 982–989.
This work was supported by the National Institutes of Health
(GM41239), National Institutes of Health S0 OD021508-01 (Bruker
AVANCE III 500 MHz spectrometer), and The Robert A. Welch
Foundation Grant F-1334.
ABBREVIATIONS
[14] J. Chodowska-Palicka, M. Nilsson, Decarboxylation of 2-nitrobenzoic acids, Acta
Chem. Scand. 24 (1970) 3353–3361.
DMSO
DEAE
dimethyl sulfoxide
diethyl-aminoethyl
[15] T. Malkin, M. Nierenstein, The acetylation of ortho-hydroxy aldehydes, J. Am.
Chem. Soc. 53 (1931) 239–242.
[16] M. Yamaguchi, M. Higuchi, K. Tazawa, K. Manabe, Three-step synthesis of fluor-
anthenes through Pd-catalyzed inter- and intramolecular C-H arylation, J. Org.
Chem. 81 (2016) 3967–3974.
ESI-TOF electrospray ionization time-of-flight
HMW
HRMS
HEPES
IBX
high-molecular-weight
high resolution mass spectrometry
4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid
o-iodoxybenzoic acid
[17] A. Wu, Y. Duan, D. Xu, T.M. Penning, R.G. Harvey, Regiospecific oxidation of
polycyclic aromatic phenols to quinones by hypervalent iodine reagents,
Tetrahedron 66 (2010) 2111–2118.
[18] J.C. Walsh, K.-L.M. Williams, D. Lungerich, G.J. Bodwell, Synthesis of pyrene-4,5-
dione on a 15 g scale, Eur. J. Org. Chem. (2016) 5933–5936.
LMW
LB
low-molecular-weight
[19] Y. Wang, J. Li, A. Liu, Oxygen activation by mononuclear nonheme iron dioxy-
genases involved in the degradation of aromatics, J. Biol. Inorg. Chem. 22 (2017)
395–405.
Luria−Bertani
Ni-NTA nickel-nitrolotriacetic acid
NMR
dNTP
PAH
PhdF
PhdI
PCR
nuclear magnetic resonance
[20] S. Fetzner, Ring-Cleaving dioxygenases with a cupin fold, Appl. Environ. Microbiol.
78 (2012) 2505–2514.
deoxyribose nucleotide triphosphates
polycyclic aromatic hydrocarbons
3,4-dihydroxyphenanthrene 2,3-dioxygenase
1-hydroxy-2-naphtolate 1,2-dioxygenase
polymerase chain reaction
[21] J.A. LeVieux, B. Medellin, W.H. Johnson Jr., K. Erwin, W. Li, Y.J. Zhang,
C.P. Whitman, Structural characterization of the hydratase-aldolases, NahE and
PhdJ: implications for specificity, catalysis, and the N-acetylneuraminate lyase
subgroup of the aldolase superfamily, Biochemistry 57 (2018) 3524–3536.
[22] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of
bacteriophage T4, Nature 227 (1970) 680–685.
SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
[23] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram
quantities of proteins utilizing the principle of protein-dye binding, Anal. Biochem.
72 (1976) 248–254.
TLC
thin-layer chromatography
[24] K.A. Johnson, R.S. Goody, The original Michaelis constant: translation of the 1913
Michaelis-Menten paper, Biochemistry 50 (2011) 8264–8269.
Appendix A. Supplementary data
[25] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual,
second ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989.
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.abb.2019.108081.
9