Non-nucleoside inhibitors of BasE, an adenylating enzyme in the siderophore biosynthetic pathway of the opportunistic pathogen Acinetobacter baumannii

Article abstract of DOI:10.1021/jm301709s

Siderophores are small-molecule iron chelators produced by bacteria and other microorganisms for survival under iron limiting conditions such as found in a mammalian host. Siderophore biosynthesis is essential for the virulence of many important Gram-negative pathogens including Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Escherichia coli. We performed high-throughput screening against BasE, which is involved in siderophore biosynthesis in A. baumannii, and identified 6-phenyl-1-(pyridin-4- ylmethyl)-1H-pyrazolo[3,4-b]pyridine-4-carboxylic acid 15. Herein we report the synthesis, biochemical, and microbiological evaluation of a systematic series of analogues of the HTS hit 15. Analogue 67 is the most potent analogue with a K_D of 2 nM against BasE. Structural characterization of the inhibitors with BasE reveals that they bind in a unique orientation in the active site, occupying all three substrate binding sites, and thus can be considered as multisubstrate inhibitors. These results provide a foundation for future studies aimed at increasing both enzyme potency and antibacterial activity.

Full text of DOI:10.1021/jm301709s

Article
pubs.acs.org/jmc
Non-Nucleoside Inhibitors of BasE, an Adenylating Enzyme in the
Siderophore Biosynthetic Pathway of the Opportunistic Pathogen
Acinetobacter baumannii
Joao Neres,†,⊥ Curtis A. Engelhart,†,‡ Eric J. Drake,§ Daniel J. Wilson,† Peng Fu,† Helena I. Boshoff,∥
̃
Clifton E. Barry, 3rd,∥ Andrew M. Gulick,§ and Courtney C. Aldrich*,†
†Center for Drug Design, Academic Health Center, University of Minnesota, Minneapolis, Minnesota 55455, United States
‡Department of Medicinal Chemistry, University of Minnesota, Minneapolis, Minnesota 55455, United States
§Hauptman-Woodward Institute and Department of Structural Biology, University at Buffalo, Buffalo, New York 14203-1102, United
States
∥Tuberculosis Research Section, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 20892, United States
S
* Supporting Information
ABSTRACT: Siderophores are small-molecule iron chelators
produced by bacteria and other microorganisms for survival
under iron limiting conditions such as found in a mammalian
host. Siderophore biosynthesis is essential for the virulence of
many important Gram-negative pathogens including Acineto-
bacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa,
and Escherichia coli. We performed high-throughput screening
against BasE, which is involved in siderophore biosynthesis in A.
baumannii, and identified 6-phenyl-1-(pyridin-4-ylmethyl)-1H-
pyrazolo[3,4-b]pyridine-4-carboxylic acid 15. Herein we report the synthesis, biochemical, and microbiological evaluation of a
systematic series of analogues of the HTS hit 15. Analogue 67 is the most potent analogue with a KD of 2 nM against BasE.
Structural characterization of the inhibitors with BasE reveals that they bind in a unique orientation in the active site, occupying
all three substrate binding sites, and thus can be considered as multisubstrate inhibitors. These results provide a foundation for
future studies aimed at increasing both enzyme potency and antibacterial activity.
by the 1980s as a result of their considerable nephrotoxicity.10
INTRODUCTION
■
A. baumannii clinical isolates have been reported that are no
The increase of antibacterial resistance coupled with the lack of
longer susceptible to these antibiotics of last resort.10 It is
new antibiotics is cause for great concern.1,2 This is highlighted
astonishing to think that we may soon enter an era when
by the Gram-negative bacteria Acinetobacter baumannii, an
antibiotic therapy is unavailable for previously treatable
opportunistic organism that has emerged over the past couple
of decades as one of the most insidious pathogens.3 A.
infections.
All bacteria with the exception of Borrelia burgdorferei11
baumannii now accounts for more than 10% of hospital-
require micromolar levels of iron (Fe2+/Fe3+) for growth, since
acquired infections and is the leading cause of wound infections
iron serves as a cofactor in numerous biochemical processes.12
However, the concentration of iron in serum and human body
fluids is approximately 10−24 M. The extraordinarily low
concentration of free iron provides innate immunity to bacterial
infections and is a result of the insolubility of iron(III) under
aerobic conditions and the sequestration of the remaining free
iron by the iron-binding proteins such as transferrin and
lactoferrin. Many pathogens like A. baumannii overcome this
iron limitation via the synthesis of siderophores, which are
small-molecule high-affinity iron chelators secreted by bacteria
and reimported from the external milieu after successfully
chelating non-heme host iron (Figure 1).12−15 The critical role
in soldiers in Iraq and Afghanistan.4,5 Additionally, up to 30% of
A. baumannii isolates in intensive care units are resistant to
almost all known antibiotics including the β-lactams,
fluoroquinolones, aminoglycosides, and tetracyclines.5 Accord-
ing to the MYSTIC susceptibility data from 15 North American
medical centers, Acinetobacter sensitivity is now below 60% for
ceftazidime, cefepime, piperacillin/tazobactam, meropenem,
imipenem, aztreonam, and gentamicin.6 Comparative genomic
studies of A. baumannii identified an unprecedented 86 kb
cluster of 45 resistance genes in one particular strain.7,8 The
prevalence of the multidrug resistance (MDR) phenotype
among Gram-negative pathogens including A. baumannii has
led infectious disease physicians to reintroduce the colistins and
polymyxins.9 These related cationic lipopeptides were first
introduced in the 1950s, but their use had been largely curtailed
Received: November 20, 2012
Published: February 26, 2013
© 2013 American Chemical Society
2385
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
Figure 1. Structures of representative aryl-capped siderophores.
Figure 2. Biosynthesis of acinetobactin. BasE binds 2,3-dihydroxybenzoic acid 8 and ATP and then catalyzes their condensation to form an
intermediate acyl−adenylate 9 that remains tightly bound. In the second half reaction, BasE catalyzes the transfer of the acyl group (blue) onto a
nucleophilic sulfur atom of the aryl carrier domain of BasF to provide the acylated complex 10 with the release of AMP. Further steps are catalyzed
by BasD, BasA, and BasB, incorporating threonine and N-hydroxyhistamine to yield pre-acinetobactin 11. This molecule undergoes a facile
rearrangement to the isoxazolidinone isomer of acinetobactin 1 that is likely promoted via an internal hydrogen bond with the oxazoline nitrogen
atom in conjunction with the proximal imidazole moiety that serves to deprotonate the N-hydroxyamide functional group.
that siderophores play in virulence has been demonstrated in A.
baumannii,16 as well as in numerous other significant Gram-
negative pathogens including Klebsiella pneumoniae,17 Pseudo-
monas aeruginosa,18 and Escherichia coli19 Siderophores are also
critical for the virulence of many Gram-positive bacteria
including Bacillus anthracis,20 Staphylococcus aureus,21 and the
acid fast Mycobacterium tuberculosis.22 Consequently, inhibition
of siderophore biosynthesis represents a promising new strategy
for antibacterial drug development, an approach that is further
bolstered by the observation that many bactericidal antibiotics
ultimately operate through disruption of bacterial iron
homeostasis and generation of reactive oxygen species
(ROS).23,24
A. baumannii produces acinetobactin, a mixed ligand
siderophore containing a catechol and imidazole for iron
coordination.25,26 The biosynthesis of acinetobactin is initiated
by BasE that activates and loads 2,3-dihydroxybenzoic acid
(DHB) onto a nonribosomal peptide synthetase (NRPS)
pathway comprising four other proteins (BasF, BasD, BasA, and
BasB).27,28 This assembly line of proteins condenses DHB, L-
2386
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
threonine, and N-hydroxyhistamine to afford pre-acinetobactin
11, which spontaneously rearranges to acinetobactin 1 (Figure
2).29,30 BasE represents an ideal target, since it does not possess
a mammalian homologue, the protein has been biochemically
and structurally characterized,31 and the functionally related
aminoacyl t-RNA synthetases are validated antibiotic targets
with mupirocin the first in class inhibitor.32 Homologues from
other organisms as shown in Table 1 suggest that inhibitors
may also be useful to combat several significant bacterial
pathogens.
Table 1. Aryl-Capped Siderophores Producing Pathogens
and Corresponding AAAEs
a
organism
siderophore
AAAE
AAAE substrate
Gram-Negative
A. baumannii
E. coli
Figure 3. Inhibitor and probe structures. 5′-O-[N-(Salicyl)sulfamoyl]-
adenosine (Sal-AMS, 12), 5′-O-[N-(2,3-dihydroxybenzoyl)sulfamoyl]-
adenosine (2,3-DHB-AMS, 13), fluorescent probe 14, and HTS hit 6-
phenyl-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]pyridine-4-carbox-
ylic acid (15).
acinetobactin
enterobactin
yersiniabactin
enterobactin
pyochelin
BasE
EntE
YbtE
EntE
PchD
YbtE
YbtE
VibE
VibE1
VibE2
DHB
DHB
DHB
SAL
K. pneumoniae
P. aeruginosa
Y. pestis
DHB
SAL
yersiniabactin
yersiniabactin
vibriobactin
vulnibactin
Y. pseudotuberculosis
V. cholerae
SAL
DHB
DHB
SAL
a stable acylsulfamate isostere. Sal-AMS displays impressive
activity against the acid-fast Gram-positive M. tuberculosis with a
minimum inhibitory concentration (MIC) of 0.39 μM under
iron-deficient conditions. However, the antibacterial potency of
Sal-AMS is more than 100 times weaker against Gram-negative
Y. pestis and Y. pseudotuberculosis under the same conditions,
despite possessing potent nanomolar enzyme inhibition of
YbtE, the respective AAAE from these organisms.35,38 More-
over, Sal-AMS and 2,3-DHB-AMS display no activity against
other Gram-negative organisms including A. baumannii, K.
pneumoniae, E. coli, and P. aeruginosa (unpublished results,
Brian Beck, Laura Celia, ATCC). The reason for such a striking
difference could be that the highly polar (ClogP ≈ −2) and
negatively charged nucleoside derivatives may prevent cellular
uptake, although many other mechanisms of intrinsic resistance
may be involved.
We have recently reported the discovery of a new class of
potent non-nucleoside AAAE inhibitors through high-through-
put screening (HTS) using a fluorescence polarization (FP)
displacement assay with a fluorescent analogue of Sal-AMS (Fl-
Sal-AMS, 14) as a ligand.39 The most potent hit discovered,
pyrazolopyridine 15 (Figure 3), binds BasE with a sub-
micromolar dissociation constant as determined independently
by isothermal titration calorimetry and our FP assay.39 Further
kinetic characterization of 15 reveals that it exhibits competitive
inhibition with respect to both substrates 2,3-DHB and ATP.31
Herein we report the design, synthesis, biochemical, and
biological evaluation of a systematic series of analogues of 15
that comprehensively explores the SAR of this promising
scaffold. Structural information is also reported for the
complexes of BasE with two of the most potent analogues of
15 as well as in vitro data demonstrating that deletion of basE
in A. baumannii impairs growth under iron-deficient conditions.
V. vulnificus
Gram-Positive
B. subtilis
bacillibactin
petrobactin
DhbE
AsbC
DHB
B. anthracis
Acid-Fast
3,4-DHB
M. tuberculosis
mycobactin
MbtA
SAL
a
SAL, salicylic acid; DHB, 2,3-dihydroxybenzoic acid; 3,4-DHB, 3,4-
dihydroxybenzoic acid.
BasE is an aryl acid adenylating enzyme (AAAE) and
catalyzes the condensation of DHB 8 with ATP to form an
acyl−adenylate intermediate 9, whereby the carboxy group is
activated as a mixed anhydride. Following liberation of
pyrophosphate, BasE binds the phosphopantetheinylated aryl
carrier protein (ArCP) domain of BasF to form a ternary
complex and then catalyzes the transfer of the activated DHB
onto the terminal thiol of the pantetheine moiety of BasF to
provide thioester 10 (Figure 2).33 AAAEs are members of the
ANL superfamily of enzymes that contain a large N-terminal
domain and a smaller C-terminal domain with the active site
located at the domain interface.34 AAAEs thus carry out two
reactions, an adenylation and thioesterification, at the same
active site. In the adenylation reaction, a catalytic lysine from
the C-terminal subdomain coordinates the carboxylate
substrate and directs nucleophilic attack on the α-phosphate
of ATP. The enzyme then undergoes a ∼140° rigid body
rotation about a hinge residue (Lys437 in BasE), which allows
the phosphopantetheine arm of the carrier domain to insert
into the active site for thioester formation.34
5′-O-[N-(Salicyl)sulfamoyl]adenosine (Sal-AMS, 12) and
the related 5′-O-[N-(2,3-dihydroxybenzoyl)sulfamoyl]-
adenosine (2,3-DHB-AMS, 13) are the first confirmed AAAE
inhibitors of siderophore biosynthesis with potent nanomolar
apparent Ki values against a range of AAAEs including BasE,
YbtE, and MbtA from A. baumannii, Yersinia sp., and M.
tuberculosis, respectively (Figure 3).31,35−37 Sal-AMS and 2,3-
DHB-AMS mimic the acyl−adenylate intermediate 9 (Figure
2) through replacement of the labile acylphosphate moiety with
RESULTS
■
Chemistry. The structure of 6-phenyl-1-(pyridin-4-ylmeth-
yl)-1H-pyrazolo[3,4-b]pyridine-4-carboxylic acid (15) discov-
ered from high-throughput screening39 can be divided into four
domains for SAR purposes as depicted in Figure 4. This
compound is part of a large compound library supplied by
2387
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
a
Enamine (Ukraine), and there is no literature available
regarding its synthesis or any other properties.
Scheme 2
Figure 4. Dissection of pyrazolopyridine hit 15 into four domains for
SAR analysis.
For the synthesis of 15 and analogues, the key intermediate
ethyl 6-oxo-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]-
pyridine-4-carboxylate 109 was initially prepared, as well as
the p-methoxyphenyl (PMP) analogue 108 (Scheme 1). The
a
Scheme 1
a
Reaction conditions: (a) 2,6-di-tert-butyl-4-methylpyridine, Tf2O,
CH2Cl2, −78 to 0 °C, 4 h, 68%; (b) Pd(PPh3)4, Cs2CO3, PhB(OH)2,
dioxane, 100 °C, 5 h, 96%; (c) TFA, 70 °C, 24 h, 85%; (d) aq NaOH,
THF, rt, 4 h, 84% (average); (e) (CH3)2S·BF3, 0 °C to rt, 18 h, 17%;
(f) Pd(OAc)2, BINAP, Cs2CO3, PhNH2, dioxane, 100 °C, 22 h, 90%.
under standard conditions furnished the intermediate 111.
Cleavage of the PMP group proceeded optimally in neat TFA
at 70 °C to afford compound 112. Alkylation of 112 with 4-
(bromomethyl)pyridine under a variety of conditions was then
attempted. Although the desired product 15 was obtained, the
reaction was not regioselective and alkylation occurred at both
N-1 and N-2 of the pyrazole, leading to poor yields of the
desired product (not shown). The intermediates 111 and 112
were readily hydrolyzed with NaOH in THF−H2O at room
temperature, providing compounds 31 and 36. The p-methoxy
group of 111 was hydrolyzed using boron trifluoride−dimethyl
sulfate complex, yielding the p-hydroxybenzyl analogue 32.
Buchwald−Hartwig coupling of triflate 110 with aniline
followed by hydrolysis of the ethyl ester furnished the
phenylamino analogue 100.
To explore the SAR of the 6-aryl domain of the lead
compound 15, we first attempted to prepare the triflate of 109
using the procedure described for PMP analogue 108.
However, triflation was not successful in this case, probably
because of the presence of the pyridine moiety. We then
explored the conditions developed by Kang and co-workers42
for the PyBroP-mediated activation of tautomerizable hetero-
cycles. Treatment of 109 with PyBroP at room temperature for
2 h resulted in the formation of the activated intermediate 113
as monitored by mass spectrometry that was not isolated but
directed coupled to phenylboronic acid under standard Suzuki
conditions to afford the desired product in a respectable 74%
yield (Scheme 3). Hydrolysis of the ethyl ester and HPLC
purification provided lead compound 15 in 81% yield that
possessed identical 1H NMR, 13C NMR, and HRMS data
compared to the compound obtained from the commercial
vendor Enamine. The success of the Kang protocol for
activation of 109 highlights the chemoselectivity of PyBroP-
mediated activation for highly functionalized heterocycles.
We used parallel synthesis to prepare a systematic series of
54 (hetero)aryl-substituted analogues with substitution at C-6
(Scheme 3). Parallel synthesis was performed on a 0.33 mmol
scale employing 100 mg of pyrazolopyridone 109 in 8 mL
a
Reaction conditions: (a) H2NNH2·H2O, EtOH, rt, 24 h; (b) ArCHO,
0 °C to rt, 2 h; (c) n-BuONa, n-BuOH, 120 °C, 3 h (76%, three steps,
from 101); (d) EtO2C(CO)CH2CO2Et, benzene, 65 °C, 20 h, 48−
63%; (e) glacial AcOH, reflux, 3 h, 78−81%.
methodology devised by Hohn40 was used to synthesize the 1-
aryl-1H-pyrazol-5-amines 104 and 105, through the multi-
component condensation of acrylonitrile 101, hydrazine, and
the appropriate arylaldehydes to afford the intermediate imines
102 and 103. These were not isolated but directly converted to
the corresponding pyrazoles via base-promoted cyclization and
subsequent redox isomerization. Pyridone annulation was
accomplished in a two-step process involving condensation of
104 and 105 with diethyl oxalacetate to provide 106 and 107,
which were then cyclized to the respective 1H-pyrazolo[3,4-
b]pyridones 108 and 109 by refluxing in glacial acetic acid
using the procedure described by Dorn and Muller.41
̈
Elaboration of intermediates 108 and 109 to the final C-6
arylpyrazolopyridines requires activation of the tautomerizable
pyridone carbonyl as a halide or pseudo-halide followed by
Suzuki coupling and ester hydrolysis. We initially began with
PMP analogue 108, since this provides p-hydroxybenzyl and p-
methoxybenzyl analogues 31 and 32, and selective deprotection
of the PMP moiety would allow access to a wide variety of
analogues at N-1 by direct alkylation of the resultant free amino
group. Chlorination (POCl3) of 108 was not successful (not
shown), but the triflate 110 was readily obtained using triflic
anhydride and 2,6-di-tert-butyl-4-methylpyridine as base
(Scheme 2). Suzuki coupling of 110 with phenylboronic acid
2388
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
a
a
Scheme 3
Scheme 4
a
Reaction conditions: (a) PyBroP, Et3N, dioxane, rt, 2 h; (b)
ArB(OH)2 or ArB(OH)2-pinacolate ester, PdCl2dppf, Na2CO3, 5:1
dioxane−H2O, 100 °C, 4 h, 64% (average, two steps, from 109); (c)
aq. NaOH, THF, rt, 4 h, 80% (average); (d) R−CC−B(OH)2 or
respective pinacolate ester, PdCl2(PPh3)2, Na2CO3, 5:1 dioxane−H2O,
100 °C, 4 h, 76−84% (two steps, from 109); (e) BOP, DBU, HNR1R2,
dioxane, 70 °C, 5 h, 22−79%. The structures of 37−59, 61, 62, and
66−90 are shown in Tables 5 and 6.
a
Reaction conditions: (a) (CH3)2S·BF3, DCM, 0 °C to rt, 3.5 h, 37%;
(b) R-Br, Na2CO3, dioxane−H2O, 80 °C, 12 h; (c) NaOH, MeOH, rt,
2 h, 40−70% (two steps, from 42-ethyl ester); (d) (i) PyBrOP, Et3N,
dioxane, rt,
2
h; (ii) R−CC−H, PdCl2(CH3CN)2, 2-
(dicyclohexylphosphino)biphenyl, Cs2CO3, dioxane−H2O, 85 °C, 6
h, 77−87%; (e) TBAF, THF, 0 °C, 3 h, 35%; (f) NaOH, MeOH, rt, 2
h, 41−65%.
sealed vials using a stock solution of all reagents. Extraction of
the products from the reaction mixtures was achieved with
dichloromethane using phase-separation cartridges. The esters
were purified by flash chromatography with an average yield of
64% (range 7−97%), an excellent result considering that a
standard purification method was utilized for all compounds. In
some cases, when halogenated (hetero)arylboronic acids where
used, more than one product was obtained because of a second
Suzuki coupling (compounds 73, 74, and 85; Tables 5 and 6).
Whenever possible, the two products were isolated. Hydrolysis
of the esters was performed with NaOH in THF−H2O with
good yields, affording compounds 15, 37−59, 61, 62, and 66−
90 (structures in Tables 5 and 6), which were purified by
HPLC and lyophilized. The PyBroP-activated intermediate 113
was also used to successfully introduce alkene groups using
similar conditions to provide analogues 91 and 92 after ester
hydrolysis (Scheme 3).
BOP-mediated coupling of the pyrazolopyridone 109 with
three different amines was performed successfully using the
procedure developed by Wan et al.,43 further increasing the
scope of this key intermediate and the range of substituents in
the pyrazolopyridine at C-6 (Scheme 3). Analogues 95−97
were thus obtained following ester hydrolysis. Simple hydrolysis
of the pyrazolopyridone intermediate 109 afforded analogue
98, which lacks a 6-aryl moiety (Scheme 3).
cleavage of the methyl ether and ethyl esters by treatment with
boron trifluoride−dimethyl sulfate complex. We were also
interested in evaluating the impact of increased lipophilicity of
the lead compound 15; hence, a short series of analogues was
synthesized bearing a 4-alkoxyphenyl group with 8-, 12-, and
16-carbon linear alkyl chains (compounds 63−65). This
strategy was successful in our previous SAR studies of Sal-
AMS (12), maintaining or even increasing the respective
inhibitory potency against MbtA, the AAAE from M.
tuberculosis.44 These compounds were synthesized through
alkylation of 42-ethyl ester with the corresponding alkyl
bromides (Scheme 4). The resulting esters were then
hydrolyzed with NaOH to afford compounds 63−65. We
also prepared two alkyne analogues by PyBroP activation of
109 and subsequent palladium-catalyzed Sonogashira with
triethylsilylacetylene and phenylacetylene under copper-free
conditions employing PdCl2(CH3CN)2 and Buchwald’s 2-
(dicyclohexylphosphino)biphenyl ligand to afford 114 and 115
(Scheme 4).45 Notably, standard Sonogashira conditions did
not afford any of the desired product. Deprotection of the
terminal TES group in 114 with TBAF furnished 116.
Saponification of 115 and 116 with NaOH in aqueous THF
provided 94 and 93, respectively.
A further series of C-6 substituted analogues was prepared as
shown in Scheme 4. Analogue 60 incorporating salicylic acid at
C-6 was prepared from 59-ethyl ester through simultaneous
A small series of analogues was prepared as shown in Scheme
5 to study the modification at C-4 of the lead compound 15.
LiAlH4 reduction of 18 provided hydroxy analogue 19. Amides
2389
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
a
118 in 77% yield. All three compounds were subjected to
Suzuki coupling with phenylboronic acid, and the methyl esters
were hydrolyzed to provide the final compounds 16, 17, and
99.
Scheme 5
Direct Binding Studies. The binding of all analogues to
BasE was measured using a fluorescence polarization (FP) assay
that measures displacement of the active-site directed
fluorescent probe Fl-Sal-AMS 14 (see Figure 3) from BasE,
which results in a decrease in polarization.39 Fitting of the
resultant displacement curve following the analysis described by
Wagner and co-workers enables determination of the ligand
dissociation constant.46 We had previously demonstrated that
our direct-binding FP assay agrees closely with results obtained
by isothermal titration calorimetry and a functional steady-state
kinetic assay that measures acylation of the native aryl-carrier
protein domain of BasF.31 Although this manuscript is primarily
focused on A. baumannii and inhibition of BasE, we also
evaluated all compounds against the homologue MbtA from M.
tuberculosis as a means to assess inhibitor specificity toward
other AAAEs. MbtA was selected, since it is a representative
AAAE that utilizes salicylic acid (SAL) instead of 2,3-
dihydroxybenzoic acid (DHB) as the native aryl acid substrate.
Direct binding experiments were performed in a 96-well plate
format in a 100 μL volume containing 20 nM Fl-Sal-AMS 14
and 200 nM BasE or 50 nM MbtA. Fitting of the experimental
data in the form of measured anisotropy (AOBS) versus test
compound concentration (LST) to eqs 1 and 2 (see
Experimental Section) provided the equilibrium dissociation
constant (KD) for each compound. The KD of the lead
compound 15, previously determined as 78 nM against BasE
from a purchased sample,39 was redetermined here as 36 nM
for BasE and 3.7 μM for MbtA for a newly synthesized and
purified sample.
a
Reaction conditions: (a) LiAlH4, THF, 0 °C to rt, 2 h, 48%; (b) (i)
(COCl)2, CH2Cl2, DMF (1 equiv), 0 °C, 1 h; (ii) HNR1R2, DMAP, rt,
1 h, 39% (average); (c) (i) (COCl)2, CH2Cl2−THF (3:1), rt, 4 h; (ii)
NaN3, acetone−H2O (1:1); (iii) TFA, benzene, reflux, 16 h; (iv)
K2CO3, MeOH, rt, 8 h, 31%.
22−25 and 27−28 were synthesized by conversion of 15 to the
corresponding acid chloride, employing oxalyl chloride
followed by aminolysis. Functional group interconversion of
carboxylic acid 15 to amine 21 was achieved by Curtius
rearrangement of the respective acyl azide.
To explore the importance of the N-2 and N-7 atoms of the
pyrazolo[3,4-b]pyridine scaffold, we prepared analogues 16 and
17 from 6-bromo-1H-indazole-4-carboxylate 117 and 6-bromo-
1H-indole-4-carboxylate 118 (Scheme 6). Alkylation of
indazole 117 with 4-(bromomethyl)pyridine hydrobromide
employing Cs2CO3 afforded a mixture of regioisomers 119 and
121 in 31% and 19% yield, respectively, favoring the desired N-
1 alkylated product. Indole 120 was prepared analogously from
The importance of the 1H-pyrazolo[3,4-b]pyridine scaffold
was evaluated with indazole 16 and indole 17 analogues
wherein the N-2 and N-7 atoms are replaced with CH isosteres
(Table 2). Deletion of N-7 in indazole 16 is well tolerated
Table 2. SAR of the Core Heterocycle
a
Scheme 6
KD (nM)
compd
X
Y
BasE
36.1 4.9
MbtA
15
16
17
N
C
C
N
N
C
(3.74 0.41) × 103
(27.6 4.2) × 103
(161 7) × 103
84.8 10.0
(52.2 4.8) × 103
resulting in a 2-fold loss of potency toward BasE. By contrast,
removal of N-2 in indole 17 results in a drastic 1400-fold loss of
affinity toward BasE. A similar trend for 15−17 was observed
for MbtA; however, the relative magnitude differences in
binding affinities were different. These results demonstrate that
the pyrazole N-2 nitrogen atom is essential while the N-7
nitrogen atom is dispensable for potent activity.
Next, the role of the carboxylic acid at C-4 in 15 was assessed
with a series of 12 analogues (Table 3). All modifications to the
carboxylic acid lead to a decrease in binding affinity. Deletion of
the carboxy group in 20 results in a complete loss of affinity,
while ethyl ester 18 is 60-fold less potent. Notably, the neutral
a
Reaction conditions: (a) Cs2CO3, 4-(bromomethyl)pyridine hydro-
bromide, DMF, rt, 3 h, 50−77%; (b) PdCl2dppf, Cs2CO3, PhB(OH)2,
dioxane, 100 °C, 5 h, 63−77% (c) aq NaOH, THF, rt, 4 h, 20−77%.
2390
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
Table 3. SAR at C-4
Table 4. SAR at N-1
carboxamide 22 and hydroxymethyl 19 are the best tolerated of
all modifications, producing a modest 1.8- and 2.8-fold loss in
affinities for BasE. In the amide series (compounds 23−28),
substitution of the amide provides a minor-to-modest decrease
in potency toward BasE when compared to the carboxamide
22, varying from 2.2- to 13.6-fold. However, no clear trend in
steric or electrostatic interactions is observed. Finally,
replacement of the carboxy group with an amino group in 21
is surprisingly well tolerated for BasE, resulting in an
approximately 6-fold loss in potency. Collectively, these results
suggest that a hydrogen-bond donor at C-4 is required (18 and
20 vs 19 and 21), that the electrostatic interaction of the
negatively charged carboxylate is not important (15 vs 22), and
that small alkyl substituents are reasonably tolerated (25−27).
Similar trends were observed with MbtA except that substituted
amides were not accepted.
All modifications performed at N-1 led to either complete
loss in affinity or drastic loss of potency against both BasE and
MbtA (Table 4). Even a minimal change such as transposition
of the pyridine ring nitrogen from the para to the meta position
causes complete loss of affinity against both enzymes. The only
compound in this series that maintains modest activity (a 15-
fold decrease in affinity toward BasE and no activity against
MbtA) is p-hydroxyphenylmethyl 32, which possesses a
hydrogen-bond acceptor moiety at an equivalent position as
the 4-pyridyl substituent in 15.
Extensive SAR studies were then carried out at C-6 of 15, as
it soon became evident that this was the most amenable to
modification. Accordingly, 62 analogues were synthesized, and
the respective results are shown in Table 5 for phenyl
derivatives and in Table 6 for other analogues including
heterocycles, amines, alkenes, and alkynes. The results obtained
in this series are quite promising, as there are 16 compounds
that improved or equaled the potency of the lead compound
15, notably compounds 42, 51, 67, and 79, with KD under 10
nM toward BasE. The actual KD values for these compounds
may be even lower, since these are already at the lower
detection limit of the fluorescence polarization assay.
Thirty-eight analogues (37−74) were synthesized in the C-6
phenyl series (Table 5). Unless explicitly stated the SAR refers
to BasE and the differences in activity are relative to lead
compound 15. A methyl, hydroxy, and chloro scan of the ortho,
meta, and para positions was performed (compounds 37−42
and 44−46) to assess the ability to tolerate substitution at each
position. All substitutions at the ortho position result in a
decrease in affinity ranging from 7- to nearly 70-fold. Both o-
methyl 37 and o-chloro 44 possess a drastic loss in affinity (60-
to 70-fold), whereas the o-hydroxy 40 is only 7-fold less potent,
perhaps because of a possible intramolecular H-bond formed
with the adjacent pyridine nitrogen, which could stabilize the
structure in a favorable conformation. Substitution at both the
meta and para positions is better tolerated. While most
compounds result in a modest decrease in affinity ranging from
3- to 6-fold, p-hydroxy 42 is more than 4-fold more potent than
15. The observed SAR with respect to MbtA has a nearly
identical trend except that p-methyl 39 is the most potent
toward MbtA with a 2.6-fold increase in affinity.
On the basis of the ability to tolerate substitution at the para
position, we prepared a systematic series of 17 analogues with a
range of functional groups (43, 47−62). Among this initial
series p-nitro 51 is the only analogue with substantially
improved potency resulting in a 9-fold increase in affinity.
Several other analogues including p-fluoro 48, p-bromo 47, p-
methylthio 61, p-cyano 56, and p-methylsulfonyl 55 possess a
modest increase in affinity ranging from 1.3- to 2.8 fold.
However, the majority of analogues are less potent resulting in
a modest decrease in affinity from 2.2-fold for p-amino 52 and
p-methoxy 62 to over 20-fold for p-acetylamino 54 and p-
carboxylate 58. The combination of a p-carboxylate and a m-
hydroxy in salicylate 60 is only 4.7-fold less potent, showing
that the additional m-hydroxy is able to partially restore binding
affinity. Overall, no clear trends emerged in regard to steric or
electronic effects. The SAR of this series with respect to MbtA
does not parallel that observed for BasE with p-methylsulfonyl
55 displaying the highest affinity (29-fold greater than 15) and
2391
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
Table 5. SAR of C-6 Phenyl Group
KD (nM)
compd
R1
R2
R3
BasE
36.1 4.9
(2.15 0.11) × 103
158 24
MbtA
15
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
H
H
H
(3.74 0.41) × 103
>100 × 103
Me
H
H
H
Me
H
H
(7.40 0.90) × 103
(1.44 0.15) × 103
(6.50 0.90) × 103
(7.67 1.15) × 103
(3.70 0.50) × 103
(3.70 0.60) × 103
>100 × 103
H
Me
H
212 22
OH
H
H
255 36
OH
H
H
124 17
H
OH
8.85 3.16
H
H
CH2OH
247 33
Cl
H
H
H
(2.48 0.19) × 103
26.0 4.0
Cl
H
H
(4.60 0.50) × 103
953 90
H
Cl
153 21
H
H
Br
20.6 7.0
560 28
H
H
F
28 4.7
(1.89 0.21) × 103
(8.00 0.90) × 103
887 96
F
H
F
42.6 8.3
H
H
CF3
191 27
H
H
NO2
3.91 2.27
78.2 13.2
628 98
202 38
H
H
NH2
(4.08 0.63) × 103
(1.70 0.30) × 103
(4.20 0.80) × 103
130 23
H
H
N(Me)2
NH(CO)Me
SO2Me
CN
H
H
747 65
H
H
13.0 6.1
H
H
22.7 6.2
380 46
H
H
C(O)NH2
COOH
COOH
COOH
SMe
288 45
(1.00 0.30) × 103
(6.10 0.80) × 103
(49.9 3.7) × 103
495 34
H
H
776 119
(1.70 0.15) × 103
169 13.4
23.5 5.5
H
OMe
OH
H
H
H
178 15
H
H
OMe
78.2 13.2
(3.23 0.38) × 103
>50 × 103
H
H
O(CH2)7CH3
O(CH2)11CH3
O(CH2)15CH3
OPh
191 13
H
H
(28.4 3.9) × 103
>50 × 103
a
H
H
n.d.
n.d.
H
H
32.5 6.3
2.14 1.46
44.5 7.7
104 11
19.1 4.9
164 20
187 28
H
H
OCH2Ph
OCH2(p-PhOMe)
C(O)Me
C(O)Ph
H
(5.40 0.90) × 103
(5.80 0.90) × 103
134 22
H
H
H
H
H
H
19.1 2.4
H
Ph
H
(3.60 0.38) × 103
(3.50 0.30) × 103
(19.7 0.9) × 103
>50 × 103
H
Ph
125
9
H
H
p-PhBr
H
181 39
(19.7 0.9) × 103
o-PhCl
H
a
n.d., not determined due to poor solubility.
p-carboxy 58 the lowest affinity (2-fold lower than 15) among
the para-substituted analogues.
affords 4-methoxybenzyloxy 68 that is 21-fold less potent than
67. The overall SAR trends for this series of compounds with
respect to MbtA do not correlate very closely with BasE. p-
Benzoyl 70 is the most potent analogue against MbtA with a KD
of 19 nM, which is an astonishing 197-fold more potent than
the lead compound 15. Among the series of compounds in
Table 5, p-benzyloxy 67 and p-benzoyl 70 emerged as the most
attractive because of their high affinities toward BasE.
Additionally, 70 was deemed particularly interesting as a result
of its balanced activity against both MbtA and BasE.
We next explored bulky hydrophobic groups (63−74) to
define a steric boundary of the active site (Table 5). Long chain
alkoxy groups (compounds 63−65) reduce binding affinity and
result in poor solubility (compound 65 was insoluble in the
assay conditions). Since the bulky phenyl group in p-phenoxy
66 does not adversely affect affinity, we decided to further
explore the SAR with other groups and synthesized p-biphenyl
72 that is 3.5-fold less potent and p-benzoyl 70, which is 2-fold
more potent. Introduction of a CH2 spacer in p-phenoxy 66
provided p-benzyloxy 67 that possesses an impressive 17-fold
increase in affinity. Further addition of a p-methoxy group to 67
We also synthesized a series of 24 analogues 75−98
containing a wide variety of heterocycles, alkenes, alkynes,
and amines at C-6 (Table 6). The five-membered furan and
2392
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
in affinity; however, a 5-fold increase in affinity is conspicuously
observed at position 5 (compound 79). Given the enhanced
affinity of 5-methyl substituted thiophen-2-yl group, we also
evaluated benzothiophene 80, 5-(acetyl)thiophene 81, and 5-
(chloro)thiophene 82, but none of these enhance affinity. All of
the nitrogen-containing heterocyclic analogues including
pyridines 83 and 84, bipyridine 85, isoquinoline 86, indole
87, quinoline 88, pyrimidine 89, and pyrazole 90 result in a loss
of potency ranging from 1.7-fold for indole 87 to 215-fold for
isoquinoline 86. Similarly, alkene and alkyne analogues 91−94
bind with lower affinities ranging from ∼10-fold for phenyl-
ethenyl 92 and phenylethynyl 94 to ∼55-fold for unsubstituted
analogues ethenyl 91 and ethynyl 93. Amino analogues
including benzylamine 95, morpholine 96, and 3-hydroxypro-
pylamine 97 are 40-fold to 68-fold less potent. Analogue 98
lacking an aryl moiety at C-6 is completely inactive (>2800-fold
less potent). Collectively, the results from this series of
analogues demonstrate that a phenyl or isosteric heterocycle
is required at C-6 (91, 93, 95−98) and nonpolar heterocyles
are optimally tolerated (79, 80, 82 vs 89 and 90). Overall, no
improvement in affinity was achieved for 75−98 with BasE.
The SAR of this series for MbtA is markedly different, and
several compounds were identified that are more potent
including benzothiophene 80, 5-(acetyl)thiophene 81, 5-
(chloro)thiophene 82, 6-chloropyridine 84, and bipyridine
85, which possess 12-, 5-, 14-, 4-, and 10-fold higher affinities
relative to 15.
Table 6. SAR at C-6: Substitution with Heterocyles, Alkynes,
Alkenes, and Amines
To complete our cursory SAR studies of 15, we also
evaluated two compounds prepared during the course of our
studies that involve double modifications (Table 7). Com-
Table 7. Miscellaneous SAR
pound 99 containing an indazole core, but with the (4-
pyridyl)methyl group at position 2 instead of position 3, retains
some potency toward MbtA (15.5-fold loss) and a pronounced
1800-fold loss in affinity toward BasE. Compound 100 with
two unfavorable modifications (replacement of the (4-pyridyl)-
methyl group and introduction of an amino group at position
6) displays no affinity toward either BasE or MbtA.
Structural Characterization of Inhibitors with BasE.
The active site of BasE, like all AAAE enzymes, contains three
subsites that are used to bind the nucleotide, the aromatic acid,
and the pantetheine chain of the incoming carrier protein that
is used in the thioesterification reaction.34 The binding pocket
for the nucleotide base is bordered on one side by a conserved
aromatic residue and on the other by main chain interactions.
The aromatic acid binds in a well-defined pocket of the
AAAE.47 Finally, the pantetheine moiety of the cofactor enters
the active site through a long tunnel formed between the larger
N- and smaller C-terminal domain of the adenylating enzyme.
thiophene heterocycles were initially examined with analogues
75 and 76, and these are nearly 10-fold less potent than 15. A
methyl scan in the thiophene ring with compounds 77−79
showed that substitution at positions 3 and 4 (77−78) is not
well tolerated resulting in a respective 9- and 2.4-fold decrease
2393
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
Table 8. Crystallographic Diffraction and Refinement Data
BasE·67
3U16
BasE·70
3U17
PDB accession code
resolution (Å)
space group
unit cell
40.0−2.1
P212121
50.0−2.1
P212121
a (Å)
66.1
65.5
b (Å)
144.8
143.3
c (Å)
148.7
148.8
a
Rmerge (%)
10.2 (54.2)
98.0 (88.4)
11.8
7.0 (34.2)
90.2 (51.9)
10.1
a
completeness (%)
a
I/s
no. observations
365 612
82 980
280 779
74 749
no. reflections
a
Rcryst (overall/highest resolution shell) (%)
18.5 (26.8)
21.9 (31.9)
32.1
19.0 (26.7)
22.1 (31.0)
28.9
a
Rfree (overall/highest resolution shell) (%)
Wilson B-factor (Å2)
average B-factor, protein
A (Å2)
36.6
41.3
B (Å2)
36.8
41.2
average B-factor: ligand, solvent, ions (Å2)
no. of water molecules, ions
rmsd: bond length (Å), angle (deg)
34.4, 39.9, 46.6
511 H2O, 6 Ca2+
0.007, 1.06
34.9, 41.5, 55.5
379 H2O, 1 Ca2+
0.007, 1.05
a
Values for the highest resolution shell are given in parentheses.
This tunnel forms in the related acyl-CoA synthetases through
rotation of the C-terminal domain upon completion of the
initial adenylation reaction to form a conformation that is
competent for thioester formation.31
Gly338. Loss of this interaction results in a reduction of affinity
of 3 orders of magnitude. This interaction is unique to the HTS
ligands, as the amide of Gly338 does not interact with the
DHB-AMS analogue of the adenylate 13. In contrast, the N-7
nitrogen of the pyrazolopyridine makes no interactions with the
BasE active site residues, and therefore, substitution with a
carbon has relatively little impact on binding. The carboxylate
groups of 67 and 70 interact with the side chain of Arg435. The
interaction of compound 67 with Arg435 is different from that
of compounds 15 and 70. However, we note that the electron
density for this residue, which is only two residues from the
hinge that separates the N-terminal domain from the
disordered C-terminal domain, is disordered in one chain in
the asymmetric unit for each protein model; therefore, it is
likely that Arg435 adopts multiple conformations. Nevertheless,
the density is of sufficient quality to be modeled in the second
chain in the asymmetric unit for each complex. In the structure
of BasE bound to 70, the side chain of Arg435 appears to make
a bivalent interaction with the carboxylate. In the model for
BasE bound to 67, the side chain of Arg435 interacts with just a
single oxygen from the carboxylate. Furthermore, in the
previously reported complex with 15, the side chain of
Arg435 does not interact directly with the carboxylate of this
compound; rather this is mediated through a water molecule.
This fact further strengthens our hypothesis of multiple
conformations adopted by this residue and could also justify
the higher affinity to BasE observed for compounds 67 and 70
(direct interaction between Arg435 and the carboxylate) when
compared to 15. SAR with compounds altered in this
carboxylate (18−28, Table 3) illustrates a complicated
relationship of this group to binding affinity. Replacement of
the carboxylate with an alcohol or a carboxamide is reasonably
well tolerated in compounds 19 and 22, resulting in only a 3-
and 2-fold increase in KD. This shows that a strict ionic
interaction is not required with the side chain of Arg435.
The longer hydrophobic moieties present in 67 and 70
continue into the pantetheine tunnel (Figure 5). The phenyl
We have previously reported on the crystal structure of BasE
bound to DHB-AMS 13, a derivative of 13 bearing an aliphatic
chain on the C-2 position of the adenine, and the parent
compound 15.31 The structure of BasE bound to 15 shows that
the pyridine approximates the binding mode of the DHB
substrate. The nitrogen of the pyridine moiety hydrogen-bonds
to the side chain of Asn242, mimicking the binding interaction
of the 2- and 3-hydroxy groups of DHB in the structure of BasE
bound to 13.31 Unexpectedly, the binding of 15 did not utilize
the carboxylate to mimic the adenylate phosphate or occupy
the adenine binding pocket. The phenyl moiety was placed into
the pantetheine tunnel. The binding of the phenyl group in this
tunnel provides room for the larger inhibitors that were
observed to result in higher affinity for BasE. We therefore
determined the crystal structure of BasE bound to 67 and 70 to
examine how the larger aromatic substituent would fill the
pantetheine tunnel.
Crystals of BasE complexes with compounds 67 and 70
diffract well, and the structures were determined by difference
Fourier methods. Data collection and refinement statistics are
presented in Table 8. As with the previous structures of BasE31
and other ANL adenylating enzymes,48,49 the conformationally
dynamic C-terminal domain is disordered and is not included
in the final models.
The two ligands bind in the active site of BasE in a manner
identical to that of 15 reported previously.31 The pyridin-4-yl-
methyl group enters into the DHB binding pocket, forming a
hydrogen bond with the side chain of Asn242. This interaction
is important for binding, as seen in compounds 29−36 (Table
4) where only compound 32 retained some binding affinity.
SAR of the core heterocycle (Table 2) demonstrates the
importance of N-2 of the pyrazole ring. The N-2 of the pyrazole
ring accepts a hydrogen bond from the main chain amine of
2394
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
alanine and leucine, respectively, in MbtA. The replacement of
Ala289 with the bulkier leucine is likely the reason that 67 is
unable to bind in the same manner as observed in the BasE
crystal structure, resulting in the observed micromolar binding
constant. We note, however, that the disordered C-terminal
domain does form a portion of the pantetheine tunnel in which
the aromatic groups bind. Therefore, together with the
differences in residues between BasE and MbtA, the C-
terminus may also contribute to binding of the inhibitors and
be responsible for the different binding affinities observed.
Antibacterial Activity. All of the final compounds 15−100
were evaluated for antibacterial activity against A. baumannii
ATCC 19606 under iron-deficient (1 μM FeCl3 and 200 μM
dipyridyl as chelating agent) and iron-replete conditions (200
μM FeCl3) by broth microdilution in M9 minimal medium
supplemented with casamino acids (see Experimental Section).
However, none of the compounds exhibited antibacterial
activity against this bacterium. Several ester intermediates of
the most potent inhibitors were also tested to assess whether
the higher lipophilicity of these could lead to improved uptake
by the bacterium, assuming that a bacterial esterase would
hydrolyze the esters. Again, no activity was observed for the
esters tested. The resistance of A. baumannii to many
antibiotics is caused by numerous mechanisms including
multidrug efflux pumps and permeability defects due to loss
of porins.50 This could explain the resistance to 15 and its
analogues, but further studies are required to assess this
hypothesis. A small selection of compounds that exhibited
potent activity toward MbtA, namely, 15, 18, 66, 70, and 82
and their ethyl esters, were also tested against M. tuberculosis
H37Rv under iron-deficient and iron-replete conditions (Table
9). While some of these compounds displayed very modest
Figure 5. Structural characterization of inhibitor binding. Ribbon
diagrams are shown for the BasE enzyme bound to (A) inhibitor 67
and (B) inhibitor 70. Superimposed on both panels is the nucleotide
DHB-AMS 13 (yellow) from PDB 3O82, demonstrating the
interaction between Asp420 and the ribose hydroxyls and how the
pyridyl group of the inhibitors mimics the DHB moiety. Arg435, which
is weakly ordered in both chains, interacts with the inhibitor
carboxylate. Residues that form the hydrophobic binding pocket are
shown in side chain representation.
Table 9. MIC99 Determined against M. tuberculosis H37Rv
(μM)
MIC (μM)
iron-deficient
(GAST/−Fe)
MIC (μM)
iron-replete
(GAST/+Fe)
compd
15
18
66
>125
>125
25
>125
125
25
ring shared by 15, 67, and 70 stacks against the side chain of
His241. The benzyloxy group of 67 and the benzoyl ring of 70
adopt different conformations. The ring in 67 is positioned
closer to the pocket formed by Pro266, Val286, and Ala 289,
whereas the ring of 70 is positioned near the top of the groove
near residues Leu109 and Pro238. The binding of the phenyl
group into this hydrophobic pocket helps to explain the affect
of changes at the ortho position in compounds 37 and 44. The
ring is 4.1−4.3 Å from the side chain of Phe243 on one side.
The ortho carbon on the other side points toward the location
of the disordered C-terminal domain, and we cannot determine
if it could be accommodated here. The phenyl ring and the
pyrazolopyridine core are nearly coplanar, with interplanar
torsion angles ranging from 3° to 15° in the three inhibitor
molecules, and the o-hydroxy analogue 40 may be tolerated
because the hydroxyl could hydrogen-bond with the adjacent
N-7 nitrogen from the pyrazolopyridine core.
Interestingly, whereas 70 serves as a potent inhibitor for both
BasE and MbtA, 67 serves as a nanomolar inhibitor for BasE
but is 1000-fold weaker with MbtA (Table 5). Examination of
the binding pockets of the two inhibitor complexes and a
sequence alignment of BasE and MbtA shows that the residues
labeled in Figure 5 are conserved between BasE and MbtA, with
the exception of Pro238 and Ala289, which are replaced by
66-ethyl ester
70
50
100
>125
>125
50
>125
>125
50
70-ethyl ester
82
82-ethyl ester
25
25
activity, the activity under iron-replete conditions suggests
these compounds may operate by a secondary mechanism of
action, since siderophore synthesis in M. tuberculosis is
dispensable under rich conditions.22
Disruption of BasE in A. baumannii. Earlier studies had
rigorously demonstrated the importance of acinetobactin
production for growth under iron limiting conditions by
insertional inactivation of BasD, the cyclase-condensation
didomain NRPS involved in acinetobactin biosynthesis.27,28
On the basis of our inability to obtain antibacterial activity
against A. baumannii ATCC 19606, we hypothesized that BasE
may be functionally redundant, although no other AAAEs are
present in the genome. In order to unequivocally demonstrate
the role of BasE in acinetobactin biosynthesis, we deleted basE
by homologous recombination, replacing it with a kanamycin
resistance gene on the chromosome. The deletion was
2395
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
confirmed by PCR (data not shown). Under iron-deficient
conditions,27 the mutant was severely impaired for growth
(Figure 6A). However, under iron-replete conditions,27 there
DISCUSSION
■
The importance of iron for bacterial pathogenesis has led to an
increasing interest in targeting iron acquisition pathways for
antibacterial development.51−53 The most ubiquitous strategy
employed by bacteria to obtain iron is the synthesis of
siderophores.12 Many bacteria also possess a heme uptake
pathway, but this is only important to support bacteremia or
bloodstream infections.54 However, inhibition of siderophore
biosynthesis is unlikely to provide broad spectrum antibiotics
due to the large number of structurally different siderophores
produced by bacteria.55 Given the alarming rise of antibacterial
resistance and the extreme challenges of developing new classes
of broad-spectrum agents, the synthesis of narrow spectrum
antibiotics is becoming more attractive, particularly for serious
infections like A. baumannii for which there are few other
treatment options.56
Collins and co-workers have shown that bactericidal
antibiotics generate hydroxyl radicals through the Fenton
reaction caused by release of Fe2+ from bacterial iron−sulfur
proteins.23,24 We hypothesize that siderophores may protect
bacteria from ROS by chelating free iron. A recent study
demonstrated that enterobactin (the prototypical aryl-capped
siderophore from E. coli) protected this bacteria from oxidative
stress.57 Thus, inhibition of siderophore biosynthesis may have
the additional benefit of enhancing the bactericidal activity of
existing antibiotics.
Quadri and co-workers were the first to report an inhibitor of
siderophore biosynthesis with the synthesis of Sal-AMS, the
prototypical AAAE inhibitor.35−37 Unfortunately, Sal-AMS and
related nucleoside analogues have only limited activity against
Gram-negative pathogens. We believe this is a result of their
highly polar nature and formal negative charge that likely
prevents uptake across the negatively charged outer lip-
opolysaccharide-rich membrane of Gram-negative organisms.
The confirmed role of aryl-capped siderophores for virulence in
Gram-negative infection including acinetobactin, enterobactin,
and yersiniabactin, coupled with lack of activity of Sal-AMS
toward A. baumannii, K. pneumoniae, P. aeruginosa, and E. coli,
motivated us to search for alternative scaffolds as AAAE
inhibitors.
Figure 6. In vitro growth curves of wild type A. baumannii ATCC
■
●
19606 ( ), ΔbasE::kan mutant ( ), and the ΔbasE::kan mutant
▲
complemented with plasmid pCDD140 ( ). The absorbance at 600
nm is plotted versus incubation time. All strains were inoculated
directly into the indicated medium at an A600 of 0.0003 and were not
preconditioned under iron limitation. (A) Growth under iron-deficient
conditions containing 1 μM FeCl3 and 200 μM dipyridyl in M9
minimal medium. All measurements were performed in triplicate, and
error bars represent the standard deviation. (B) Growth under iron-
rich conditions containing 200 μM FeCl3 in M9 minimal medium.
We identified pyrazolopyridine 15 using a high-throughput
fluorescence polarization assay with BasE from A. baumannii
and performed detailed SAR studies.39 The N-2 nitrogen atom
of the pyrazolopyridine scaffold 15 is essential, while the N-7
nitrogen is not required for potent activity. Analysis of the
cocrystal structures of 15, 67, and 70 shows a hydrogen bond
between N-2 of the pyrazolopyridine and the amide NH of
Gly338 whereas no interaction is observed with N-7. The
pyridylmethyl substituent at N-1 is optimal and binds in the
DHB pocket with the pyridine substituent occupying a position
nearly identical to the native DHB ligand forming a hydrogen
bond to Asn242. The importance of this hydrogen bond was
assessed by isosteric replacement of the pyridine N with a CH,
which resulted in a greater than 2800-fold decrease in binding
affinity that corresponds to a staggering loss of more than 4.8
kcal/mol in binding energy. The carboxylate substituent at C-4
is preferred but can be replaced by neutral isosteres such as a
carboxamido or hydroxymethyl with only a modest 2- to 3-fold
attenuation in potency. Presumably these analogues can
maintain the interaction with Arg435 observed with 15, 67,
and 70. The phenyl substituent at C-6 is the most tolerant to
modification and resulted in the identification of p-hydrox-
was little observable difference between the growth rates
between the wild-type and mutant knockout strain except for a
slight increase in lag time for entry in exponential growth
(Figure 6B). The modest growth observed for the basE mutant
in Figure 6A under iron-deficient conditions is caused by
residual bacterial iron stores present in the initial inoculum. If
the strain is preconditioned under iron-deficient conditions and
then inoculated into iron-deficient medium, it is unable to
grow. Reintroduction of basE on a plasmid was able to partially
complement the deletion phenotype (Figure 6A). The inability
to fully complement the basE knockout strain may be caused by
a polar effect on the downstream pathway. The gene
immediately downstream of basE, basF, may be transcription-
ally coupled to its upstream neighbor because there are only 18
bp between the two genes and there is no easily recognizable
Shine−Dalgarno sequence in this region. Attempts to remove
the kanamycin resistance gene and create a clean deletion of
basE were unsuccessful. In summary, these results in
conjunction with prior genetic studies on acinetobactin
synthesis suggest that BasE is nonreduntant and required for
growth of A. baumannii under iron-restricted conditions with
inorganic iron as the sole source of iron.
2396
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
yphenyl 42, p-nitro 51, p-methylsulfonylphenyl 55, p-
benzyloxyphenyl 67, and p-benzophenone 70, which are up
to 18-fold more potent than 15. Analysis of the cocrystal
structures of 67 and 70 reveals that the larger para substituents
are accommodated in the pantetheine tunnel. Thus, the
pyrazolopyridine analogues are considered multisubstrate
inhibitors, since they occupy the binding sites of all three
BasE substrates (DHB, ATP, and pantetheine cofactor of
BasF).
MbtA was also studied as a representative salicylate
adenylating enzyme, which is found in M. tuberculosis, Yersinia
sp., and K. pneumoniae. The lead compound 15 and its
analogues are generally more active against BasE than MbtA.
Benzophenone 70 is the most potent inhibitor of MbtA with a
KD of 19 nM, a value approximately 200-fold lower than that of
the lead compound 15. Moreover, 70 is equipotent against both
MbtA and BasE, demonstrating the feasibility of identifying an
inhibitor with balanced activity despite differences in the active-
site architecture between these enzymes.
Surprisingly, in spite of the low nanomolar dissociation
constants of some of the BasE inhibitors in the biochemical
assay, they failed to inhibit growth of A. baumannii in vitro. A
selection of compounds was also tested against M. tuberculosis
that encodes for MbtA, a homologue of BasE. Modest
bacteriostatic activity was observed with MICs varying between
25 and 100 μM. However, the MICs were identical under iron-
deficient and iron-replete conditions, indicating that inhibition
of MbtA is not fully responsible for the observed activity.
Further work will be necessary in order to improve and verify
the ability of this series of compounds to penetrate A.
baumannii and reach their enzyme target BasE as discussed
above.
the pyrazolopyridine inhibitors to exhibit whole-cell activity
toward A. baumannii is due to other factors such as limited
accumulation and/or lack of vulnerability of BasE to inhibition
by small molecules. Vulnerability or amount that a target must
be inhibited is another important consideration that cannot be
assessed by a simple knockout strain.
The initial studies of iron acquisition in A. baumannii focused
on strain ATCC 19606 and demonstrated that acinetobactin is
the only siderophore produced by this organism.25 Genome
sequencing of the related strain A. baumannii ATCC 17978
reveals that it encodes for an additional siderophore pathway of
an uncharacterized aryl-capped siderophore.16 As a result,
acinetobactin is dispensable in ATCC 17978.16 Analysis of the
second siderophore gene cluster shows that it encodes for two
2,3-dihydroxybenzoate-AMP ligases (A1S_2573 and
A1S_2574), which we expect can also be inhibited by our
pyrazolopyridine BasE inhibitors.59,61,62 Comparative genomics
studies of six fully sequenced A. baumannii strains and PCR
analysis of 50 clinical isolates were recently described providing
the most detailed picture yet reported of iron acquisition
systems in this pathogen.62 The acinetobactin gene cluster is
highly conserved among clinical isolates. Another prevalent
gene cluster was identified, which encodes for a putative
hydroxamate siderophore. Genes for ferrous uptake and heme
uptake are also observed in virtually all strains. The importance
of these multiple iron acquisition systems for virulence remains
to be evaluated but suggests that this pathogen is capable of
using alternative iron sources for survival under different
environmental conditions.
CONCLUSION
■
A comprehensive analysis of the structure−activity relationships
of the HTS hit 15 was performed that examined the
importance of the pyrazolopyridine heterocycle, the 4-
pyridylmethyl substituent at N-1, the carboxylic acid at C-4,
and the phenyl group at C-6 for binding to BasE and MbtA.
BasE from A. baumannii was the primary focus of the work, and
the initial SAR studies defined the crucial interactions necessary
to maintain potency and also identified sites amenable to
modification. The pyrazolopyridine heterocycle ideally posi-
tions the N-1, C-4, and C-6 substituents into the DHB, ATP,
and pantetheine binding pockets. The N-2 nitrogen of the
pyrazolopyridine forms a key hydrogen bond with the amide
backbone of Gly338, but N-7 is dispensable for potent activity.
The pyridylmethyl substituent at N-1 is crucial, illustrated by
the almost 5 kcal/mol loss in binding affinity by simple deletion
of the nitrogen atom in the pyridine. The carboxylic acid at C-4
is not required and can be replaced with alternative hydrogen-
bond-acceptor moieties including hydroxymethyl and carbox-
amido with only a modest attenuation in binding affinity,
demonstrating that the ionic interaction observed between the
carboxylic acid and Arg435 in the cocrystal structures of BasE
with three different pyrazolopyridine ligands is not critical. The
C-6 phenyl group is most tolerant to substitution, and
hydrophobic (hetero)aryl substituents are preferred. p-
Benzyloxyphenyl 67 was identified as the most potent analogue
toward BasE with a KD of 2 nM. The entire compound series
was also evaluated against MbtA, a representative AAAE that
activates salicylic acid, and similar SAR trends were observed.
HTS hit 15 is considerably less potent toward MbtA with a KD
of only 3.7 μM. However, benzophenone 70 was found to have
balanced activity against both BasE and MbtA with a KD of 19
nM, which represents a nearly 200-fold increase in potency
The structure for acinetobactin was described in 1994 as 11
(Figure 2).25 In 2008 Walsh and Sattely revised the structure of
acinetobactin to 1 based on their astute observation of the
structural dissimilarities of pseudomonine and acinetobactin
despite a common organization of their respective biosynthetic
gene clusters.29,30 The iron-binding properties of acinetobactin
have not been evaluated, but it is expected to possess a
substantially lower affinity for Fe3+ than pre-acinetobactin,
which contains a oxazoline and hydroxamate functions. In
acinetobactin these functional groups rapidly rearrange (t1/2
≈
1 h) to provide the isoxazolidinone in 1 (Figure 2). The revised
structure 1 has been confirmed via total synthesis.26
The importance of acinetobactin for iron acquisition was first
studied in A. baumannii strain ATCC 19606.27,28,58 Insertional
inactivation of basD, which encodes for a didomain protein
responsible for the condensation of the DHB and L-Thr
building blocks in acinetobactin biosynthesis, results in a strain
incapable of producing acinetobactin.28 The basD knockout is
impaired in the ability to replicate under iron-deficient
conditions,27 in human A549 alveolar epithelial cells,59 and in
a mouse sepsis model.60 While these studies clearly
demonstrate the importance of basD for virulence, we wished
to confirm that basE also phenocopies the basD mutant, since
these isogenic mutants will potentially produce different
siderophore intermediates that may partially rescue loss of
acinetobactin. In this study we examined the importance of
basE for virulence of A. baumannii strain ATCC 19606.
Deletion of basE results in a strain unable to replicate under
iron-deficient conditions but that grows at the same rate as the
wild-type strain under iron-replete conditions. These results
confirm BasE as a valid target and suggest that the inability of
2397
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
1-(Pyridin-4-ylmethyl)-1H-pyrazol-5-amine (105). To a solution of
acrylonitrile (4.42 g, 83 mmol, 1.05 equiv) at 0 °C in absolute EtOH
(80 mL) was added hydrazine hydrate (3.93 g, 79 mmol, 1.0 equiv)
dropwise with vigorous stirring over 10 min. The ice bath was
removed, and the mixture was stirred for 24 h at room temperature.
The reaction mixture was cooled to 0 °C. 4-Pyridinecarboxaldehyde
(8.8 g, 82 mmol, 1.04 equiv) was slowly added, and stirring continued
for 2 h at room temperature. The mixture was concentrated. The
residue was dissolved in dry n-butanol (30 mL), and a 16% sodium n-
butoxide solution in n-butanol (100 mL, 167 mmol, 2.1 equiv) was
added. The resulting solution was refluxed for 1 h, cooled to room
temperature, and concentrated. The residue was partitioned between
H2O (150 mL) and EtOAc (3 × 150 mL). The combined organic
layers were dried (MgSO4) and concentrated to afford the title
compound (10.6 g, 76%) as a pale brown solid: Rf = 0.19 (9:1 EtOAc/
toward MbtA. The SAR and structural characterization of
ligands with BasE described herein provide a foundation for
future studies to improve upon the antibacterial activity and
exploit the unique multisubstrate modality of inhibition.
EXPERIMENTAL SECTION
■
Chemistry: General Methods and Materials. All commercial
reagents (Sigma-Aldrich, Acros, Alfa-Aesar) were used as provided.
Boronic acids and boronic acid pinacolate esters were purchased from
Aldrich, Boron Molecular (Research Triangle, NC), and Frontier
Scientific (Logan, UT). Compounds 20, 26, 29, 30, and 33−35 were
purchased from Enamine (Ukraine). Compounds 117 and 118 were
obtained from Sinova (Bethesda, MD). Compounds 104,63 114,45 and
11545 were prepared according to the respective literature procedure.
Purity (≥95%) of all final compounds was confirmed by reverse-phase
HPLC using the indicated method (see Supporting Information). An
anhydrous solvent dispensing system (JC Meyer, Laguna Beach, CA)
using two packed columns of neutral alumina was used for drying
THF, DMF, and CH2Cl2, and the solvents were dispensed under
argon. All reactions were performed under an inert atmosphere of dry
Ar or N2 in oven-dried (150 °C) glassware. Flash chromatography was
performed with an ISCO Combiflash Companion purification system
with prepacked silica gel cartridges supplied by Luknova, with the
indicated solvent system. Preparative HPLC was performed on a
Varian Microsorb MV 100-8 C18 column (41.4 mm × 250 mm, 8 μm
particle size) operating at 40 mL/min with detection at 254 nm in the
conditions described in the Supporting Information. 1H and 13C NMR
spectra were recorded on either a Varian 600 MHz or Bruker Avance
400 MHz spectrometer. Proton chemical shifts are reported in ppm
from an internal standard of residual chloroform (7.26 ppm),
dimethylsulfoxide (2.50 ppm), or methanol (3.31 ppm), and carbon
chemical shifts are reported using an internal standard of residual
chloroform (77.1 ppm), dimethylsulfoxide (39.5 ppm), or methanol
(49.0 ppm). Proton chemical data are reported as follows: chemical
shift, multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, p =
pentet, m = multiplet, br = broad, ovlp = overlapping), coupling
constant, and integration. High-resolution mass spectra were obtained
on an Agilent TOF II TOF/MS instrument equipped with an ESI
interface.
1
MeOH); H NMR (600 MHz, CDCl3) δ 3.43 (br s, 2H, NH2), 5.20
(s, 2H), 5.63 (d, J = 1.8 Hz, 1 H), 7.00 (d, J = 6.0 Hz, 2H), 7.35 (d, J =
1.8 Hz, 1H), 8.54 (d, J = 6.0 Hz, 2H); 13C NMR (150 MHz, CDCl3) δ
50.3, 92.8, 121.7, 139.5, 144.6, 146.0, 150.4; HRMS (ESI+) calcd for
C9H11N4 [M + H]+ 175.0978, found 175.0976 (error 1.1 ppm).
Diethyl 2-(5-Amino-1-(pyridin-4-ylmethyl)-1H-pyrazol-4-yl)-2-hy-
droxysuccinate (107). A solution of diethyl oxalacetate (10.6 g, 56.1
mmol, 1.2 equiv) and 105 (8.1 g, 46.7 mmol, 1.0 equiv) in benzene
(100 mL) was heated at 65 °C for 15 h. The mixture was concentrated
and the residue was recrystallized from EtOH/Et2O to afford the title
compound (10.6 g 48%) as a pale yellow solid: mp 118−120 °C; Rf =
0.61 (7:3 EtOAc/MeOH); 1H NMR (600 MHz, CDCl3) δ 1.27 (ovlp
t, J = 7.2 Hz, 3H), 1.28 (ovlp t, J = 7.2 Hz, 3H), 2.95 (d, J = 16.8 Hz,
1H), 3.35 (d, J = 16.8 Hz, 1H), 4.16 (br s, 2H, NH2), 4.19 (q, J = 7.2
Hz, 2H), 4.26 (q, J = 7.2 Hz, 2H), 5.13 (s, 2H), 7.01 (d, J = 6.0 Hz,
2H), 7.29 (s, 1H), 8.55 (d, J = 6.0 Hz, 2H); 13C NMR (150 MHz,
CDCl3) δ 14.20, 14.25, 43.9, 50.4, 61.3, 62.5, 73.3, 103.2, 121.8, 136.8,
143.6, 145.5, 150.4, 171.3, 173.4; HRMS (ESI+) calcd for C17H23N4O5
[M + H]+ 363.1663, found 363.1668 (error 1.4 ppm).
Ethyl 6-Oxo-1-(pyridin-4-ylmethyl)-6,7-dihydro-1H-pyrazolo[3,4-
b]pyridine-4-carboxylate (109). A suspension of 107 (9.7 g, 26.9
mmol) in glacial acetic acid (60 mL) was refluxed for 4 h. The mixture
was concentrated, and the residue was triturated with isopropanol
(100 mL). The white solid that formed was filtered, washed with
isopropanol/ether, and dried under vacuum to afford the title
compound (6.29 g, 78%) as an off-white solid: Rf = 0.25 (9:1
Compounds from Scheme 1. Diethyl 2-(5-Amino-1-(4-methox-
ybenzyl)-1H-pyrazol-4-yl)-2-hydroxysuccinate (106). A solution of
diethyl oxalacetate (3.46 g, 18.4 mmol, 1.01 equiv) and 10463 (3.7 g,
18.2 mmol, 1.0 equiv) in benzene (40 mL) was heated at 65 °C for 20
h. The mixture was concentrated, and purification by flash
chromatography (3:2 hexanes/EtOAc) afforded the title compound
(4.5 g, 63%) as a yellow oil: Rf = 0.65 (EtOAc); 1H NMR (600 MHz,
CDCl3) δ 1.23−1.27 (m, 6H), 2.92 (d, J = 16.8 Hz, 1H), 3.32 (d, J =
16.8 Hz, 1H), 3.78 (s, 3H), 4.08 (br s, 2H, NH2), 4.16 (q, J = 7.2 Hz,
2H), 4.24 (q, J = 7.2 Hz, 2H), 5.06 (s, 2H), 6.85 (d, J = 8.4 Hz, 2H),
7.10 (d, J = 8.4 Hz, 2H), 7.23 (s, 1H); 13C NMR (150 MHz, CDCl3) δ
14.17, 14.23, 43.9, 51.5, 55.4, 61.2, 62,4, 73.3, 102.7, 114.5, 128.1,
128.5, 135.8, 143.3, 159.4, 171.3, 173.5; HRMS (ESI+) calcd for
C19H26N3O6 [M + H]+ 392.1816, found 392.1825 (error 2.3 ppm).
Ethyl 1-(4-Methoxybenzyl)-6-oxo-6,7-dihydro-1H-pyrazolo[3,4-
b]pyridine-4-carboxylate (108). A suspension of 106 (5.2 g, 13.2
mmol) in glacial acetic acid (40 mL) was refluxed for 3 h. The mixture
was concentrated to approximately half of the volume. Then
isopropanol (100 mL) was added and the solution was cooled to
room temperature. The product crystallized as a white solid (3.5 g,
1
EtOAc/MeOH); H NMR (600 MHz, DMSO-d6) δ 1.39 (t, J = 7.2
Hz, 3H), 4.42 (q, J = 7.2 Hz, 2H), 5.61 (s, 2H), 7.00 (br s, 1H), 7.07
(d, J = 6.0 Hz, 2H), 8.20 (s, 1H), 8.49 (d, J = 6.0 Hz, 2H), 12.10 (br s,
1H); 13C NMR (150 MHz, DMSO-d6) δ 14.0, 49.0, 61.7, 106.4, 109.0,
121.8, 133.6, 134.1, 146.1, 149.8, 163.8, 164.1 (missing 1 C); HRMS
(ESI+) calcd for C15H15N4O3 [M + H]+ 299.1139, found 299.1128
(error 3.7 ppm).
Compounds from Scheme 2. Ethyl 1-(4-Methoxybenzyl)-6-
(trifluoromethylsulfonyloxy)-1H-pyrazolo[3,4-b]pyridine-4-carboxy-
late (110). To a solution of 108 (3.38 g, 10.3 mmol, 1.0 equiv) and
2,6-di-tert-butyl-4-methylpyridine (3.18 g, 15.5 mmol, 1.5 equiv) in
CH2Cl2 (50 mL) at −78 °C was added dropwise a solution of
trifluoromethanesulfonic anhydride (2.98 mL, 17.7 mmol, 1.7 equiv)
in CH2Cl2 (10 mL). The reaction mixture was stirred at 0 °C for 4 h.
The solvent volume was reduced to one-third in vacuo and diluted
with EtOAc (40 mL). The resulting solution was washed consecutively
with saturated aqueous NaHCO3 (3 × 20 mL), H2O (20 mL), 1 M
aqueous HCl (3 × 20 mL), H2O (20 mL), and saturated aqueous
NaCl (20 mL). The organic layer was dried (MgSO4) and
concentrated. Purification by flash chromatography (4:1 hexane/
EtOAc) afforded the title compound (3.2 g, 68%) as a white solid: Rf =
0.43 (4:1 hexane/EtOAc); 1H NMR (600 MHz, CDCl3) δ 1.48 (t, J =
7.2 Hz, 3H), 3.76 (s, 3H), 4.52 (q, J = 7.2 Hz, 2H), 5.59 (s, 2H), 6.84
(d, J = 8.4 Hz, 2H), 7.37 (d, J = 8.4 Hz, 2H), 7.56 (s, 1H), 8.46 (s,
1H); 13C NMR (150 MHz, CDCl3) δ 14.3, 51.3, 55.3, 62.7, 109.1,
1
81%): mp 235−236 °C; Rf = 0.65 (1:1 EtOAc/hexane); H NMR
(600 MHz, DMSO-d6) δ 1.37 (t, J = 7.2 Hz, 3H), 3.70 (s, 3H), 4.40
(q, J = 7.2 Hz, 2H), 5.46 (s, 2H), 6.86 (d, J = 8.4 Hz, 2H), 6.95 (br s,
1H), 7.16 (d, J = 8.4 Hz, 2H), 8.11 (s, 1H), 12.05 (br s, D2O-
exchangeable), 1H); 13C NMR (150 MHz, DMSO-d6) δ 14.0, 49.5,
55.1, 61.7, 113.9, 128.7, 129.1, 133.0, 134.0, 158.7, 163.5, 164.2
(unable to observe three carbons, estimated at 99, 135, and 147 ppm
due to quadrupolar coupling with nitrogen); HRMS (ESI+) calcd for
C19H26N3O6 [M + H]+ 328.1292, found 328.1303 (error 3.4 ppm).
1
113.7, 114.2, 118.8 (q, JC−F = 319 Hz, CF3), 128.0, 130.0, 133.8,
136.3, 148.3, 154.5, 159.7, 163.4; HRMS (ESI+) calcd for
C18H17F3N3O6S [M + H]+ 460.0785, found 460.0762 (error 5.0 ppm).
2398
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
Ethyl 1-(4-Methoxybenzyl)-6-phenyl-1H-pyrazolo[3,4-b]pyridine-
4-carboxylate (111). A mixture of 110 (0.50 g, 1.08 mmol, 1.0 equiv),
Pd(PPh3)4 (62.5 mg, 0.054 mmol, 0.05 equiv), Cs2CO3 (0.704 g, 2.16
mmol, 2.0 equiv), PhB(OH)2 (0.198 g, 1.62 mmol, 1.5 equiv), and
dioxane (20 mL) was stirred at 100 °C for 5 h. The reaction mixture
was cooled to room temperature, filtered through a plug of Celite, and
concentrated. Purification by flash chromatography (7:3 hexanes/
EtOAc) afforded the title compound (0.39 g, 96%) as a white solid: Rf
= 0.49 (7:3 hexanes/EtOAc); 1H NMR (600 MHz, CDCl3) δ 1.50 (t, J
= 7.2 Hz, 3H), 3.76 (s, 3H), 4.53 (q, J = 7.2 Hz, 2H), 5.74 (s, 2H),
6.84 (d, J = 9.0 Hz, 2H), 7.40 (d, J = 9.0 Hz, 2H), 7.49 (t, J = 7.2 Hz,
1H), 7.55 (t, J = 7.2 Hz, 2H), 8.22 (d, J = 7.2 Hz, 2H), 8.25 (s, 1H),
8.39 (s, 1H); 13C NMR (150 MHz, CDCl3) δ 14.5, 50.6, 55.3, 62.0,
112.1, 114.1, 115.4, 127.7, 129.0, 129.3, 129.8, 129.9, 132.0, 133.2,
138.6, 151.6, 156.9, 159.4, 165.4; HRMS (ESI+) calcd for C23H22N3O3
[M + H]+ 388.1656, found 388.1666 (error 2.6 ppm).
temperature for 5 h. The mixture was concentrated and the residue
was purified by preparative reverse-phase HPLC (solvent A consisting
of 10 mM NH4·HCO3, pH 7.5; solvent B consisting of MeCN) using a
linear gradient of 10% B to 40% B over 20 min (see Chemistry:
General Methods and Materials for further details) to afford the title
1
compound (23 mg, 86%) as a white solid: tR = 18.9 min; H NMR
(600 MHz, CD3OD) δ 7.45 (t, J = 7.2 Hz, 1H), 7.51 (t, J = 7.2 Hz,
2H), 8.13 (s, 1 H), 8.15 (d, J = 7.2 Hz, 2H), 8.47 (s, 1H); 13C NMR
(150 MHz, CD3OD) δ 113.8, 115.8, 128.6, 129.8, 130.5, 135.9, 140.7,
142.2, 150.3, 159.9, 172.5; HRMS (ESI−) calcd for C13H8N3O2 [M −
H]−, 238.0622; found 238.0617 (error 2.1 ppm).
1-(4-Methoxybenzyl)-6-(phenylamino)-1H-pyrazolo[3,4-b]-
pyridine-4-carboxylic Acid (100). A mixture of 110 (100 mg, 0.22
mmol, 1.0 equiv), Pd(OAc)2 (5 mg, 0.022 mmol, 0.1 equiv), BINAP
(20.4 mg, 0.033 mmol, 0.15 equiv), Cs2CO3 (107 mg, 0.33 mmol, 1.5
equiv), aniline (30 μL, 0.33 mmol, 1.5 equiv), and dioxane (1.5 mL) in
a pressure vessel was stirred at 100 °C for 22 h. The reaction mixture
was cooled to room temperature, diluted with EtOAc (10 mL), filtered
through a plug of Celite, and concentrated. Purification by flash
chromatography (4:1 hexanes/EtOAc) afforded ethyl 1-(4-methox-
ybenzyl)-6-(phenylamino)-1H-pyrazolo[3,4-b]pyridine-4-carboxylate
(83 mg, 90%) as a light yellow solid: Rf = 0.53 (3:2 hexanes/EtOAc);
1H NMR (600 MHz, CDCl3) δ 1.45 (t, J = 7.2 Hz, 3H), 3.76 (s, 3H),
1-(4-Methoxybenzyl)-6-phenyl-1H-pyrazolo[3,4-b]pyridine-4-car-
boxylic Acid (31). To a solution of 111 (25 mg, 0.065 mmol) in THF
(1 mL) was added 1 N aqueous NaOH (2 mL). The resulting solution
was stirred at room temperature for 3 h. The solvent was partially
evaporated, the reaction mixture diluted with H2O (10 mL) and the
pH adjusted to 4−5 with 1 N aqueous HCl. The resulting suspension
was extracted with EtOAc (3 × 15 mL). The combined organic layers
were washed with saturated aqueous NaCl, dried (MgSO4), and
concentrated to afford the title compound (23 mg, 98%) as a white
4.46 (q, J = 7.2 Hz, 2H), 5.55 (s, 2H), 6.84 (d, J = 8.4 Hz, 2H), 6.87
(br s, 1H, NH), 7.11 (t, J = 7.8 Hz, 1H), 7.22 (s, 1H), 7.33 (d, J = 8.4
Hz, 2H), 7.38 (t, J = 7.8 Hz, 2H), 7.63 (d, J = 7.8 Hz, 2H), 8.18 (s,
1H); 13C NMR (150 MHz, CDCl3) δ 14.5, 50.7, 55.5, 62.1, 107.5,
108.6, 114.2, 120.1, 123.4, 129.4, 129.6, 129.7, 133.2, 133.6, 140.1,
150.9, 155.1, 159.4, 165.4.
1
solid: H NMR (600 MHz, DMSO-d6) δ 3.69 (s, 3H), 5.71 (s, 2H),
6.88 (d, J = 9.0 Hz, 2H), 7.31 (d, J = 9.0 Hz, 2H), 7.53 (t, J = 7.2 Hz,
1H), 7.58 (t, J = 7.2 Hz, 2H), 8.21 (s, 1H), 8.27 (d, J = 7.2 Hz, 2H),
8.37 (s, 1H); 13C NMR (150 MHz, DMSO-d6) δ 49.8, 55.0, 111.9,
113.9, 114.7, 127.3, 129.06, 129.18, 129.25, 130.0, 132.5, 133.3, 137.8,
150.9, 155.9, 158.7, 166.0; HRMS (ESI−) calcd for C21H16N3O3 [M −
H]− 358.1197, found 358.1200 (error 0.8 ppm).
To a solution of ethyl 1-(4-methoxybenzyl)-6-(phenylamino)-1H-
pyrazolo[3,4-b]pyridine-4-carboxylate prepared above (30 mg, 0.074
mmol) in THF (1.0 mL) was added 1 N aqueous NaOH (2 mL). The
resulting solution was stirred at room temperature for 3 h. The mixture
was concentrated, and H2O (10 mL) was added to the residue. The
pH was adjusted to 4−5 with 1 N aqueous HCl and the solution
extracted with EtOAc (3 × 15 mL). The combined organic layers were
dried (MgSO4) and concentrated. Purification by flash chromatog-
raphy (3:7 EtOAc/MeOH) afforded the title compound (19 mg, 69%)
as a yellow solid: 1H NMR (600 MHz, CDCl3) δ 3.72 (s, 3H), 5.47 (s,
2H), 6.83 (d, J = 9.0 Hz, 2H), 6.97 (t, J = 7.8 Hz, 1H), 7.16 (s, 1H),
7.26 (d, J = 9.0 Hz, 2H), 7.29 (t, J = 7.8 Hz, 2H), 7.79 (d, J = 7.8 Hz,
2H), 8.23 (s, 1H); 13C NMR (150 MHz, CDCl3) δ 51.1, 55.7, 108.9,
110.2, 114.9, 120.1, 122.8, 129.7, 130.1, 131.0, 135.0, 141.3, 142.5,
151.9, 157.5, 160.7, 173.2; HRMS (ESI−) calcd for C21H17N4O3 [M −
H]− 373.1306, found 373.1282 (error 6.4 ppm).
1-(4-Hydroxybenzyl)-6-phenyl-1H-pyrazolo[3,4-b]pyridine-4-car-
boxylic Acid (32). To a solution of 111 (20 mg, 0.052 mmol, 1.0
equiv) in CH2Cl2 (2 mL) was added dropwise neat boron trifluoride−
dimethylsulfide complex (55 μL, 0.052 mmol, 1.0 equiv) at 0 °C. Then
the mixture was stirred at room temperature for 18 h. The reaction
mixture was slowly poured over ice cold 0.5 M aqueous HCl (10 mL)
and extracted with EtOAc (3 × 20 mL). The combined organic layers
were washed with saturated aqueous NaHCO3 (10 mL), H2O (10
mL), saturated aqueous NaCl (10 mL), dried (MgSO4), and
concentrated. The residue was dissolved in THF (1.0 mL). Then 1
N aqueous NaOH (1.0 mL) was added, and the resulting solution was
stirred at room temperature for 2 h. The mixture was concentrated and
the residue was purified by preparative reverse-phase HPLC (solvent A
consisting of 10 mM NH4·HCO3, pH 7.5; solvent B consisting of
MeCN) using a linear gradient of 20% B to 100% B over 20 min (see
Chemistry: General Methods and Materials for further details) to
afford the title compound (3.0 mg, 17%) as a white solid: tR = 9.6 min;
1H NMR (600 MHz, CD3OD) δ 5.68 (s, 2H), 6.71 (d, J = 8.4 Hz,
Compounds from Scheme 3. See Supporting Information for
the experimental details and data for 37−41, 43−62, and 66−92,
which were prepared analogously to 15 and 42, whose experimental
details are included below as representative examples.
General Procedure for Suzuki Coupling of 109. To a solution of
109 (100 mg, 0.335 mmol, 1.0 equiv) and triethylamine (141 μL, 1.00
mmol, 3.0 equiv) in dioxane (2.5 mL) in an 8 mL heavy-walled screw-
cap round-bottom vial was added PyBroP (187 mg, 0.402 mmol, 1.2
equiv). The reaction mixture was shaken on a Glas-Col heater/shaker
(Glas-Col LLC, Terre Haute, IN) at room temperature for 2 h. The
desired boronic acid (0.67 mmol, 2.0 equiv), PdCl2dppf (12 mg, 0.05
equiv), and Na2CO3 (0.7 mL of a 0.254 g/mL aqueous solution, 5.0
equiv) were added. The vial was sealed, and the mixture was heated at
100 °C for 4 h with shaking. The reaction mixture was cooled to room
temperature and the solvent removed on a Genevac instrument at 45
°C. The residue was resuspended in H2O (2 mL) and extracted with
CH2Cl2 (3 mL) using a 6 mL Biotage Isolute phase separator cartridge
(Biotage, Charlottesville, VA). The organic layer was concentrated and
the residue purified by flash chromatography (hexanes/EtOAc
gradient) on a Combiflash Companion system, using a 4 g prepacked
silica column, to afford the desired product.
2H), 7.25 (d, J = 8.4 Hz, 2H), 7.49 (t, J = 7.2 Hz, 1H), 7.54 (t, J = 7.2
Hz, 2H), 8.23 (ovlp d, J = 7.2 Hz, 2H), 8.24 (ovlp s, 1 H), 8.40 (s,
1H); 13C NMR (150 MHz, CD3OD) δ 51.4, 113.9, 116.2, 116.3,
128.6, 129.4, 130.0, 130.5, 130.8, 134.3. 134.5, 140.1, 152.7, 158.2,
158.6, 165.2; HRMS (ESI−) calcd for C20H14N3O3 [M − H]
344.1041, found 344.1038 (error 0.9 ppm).
Ethyl 6-Phenyl-1H-pyrazolo[3,4-b]pyridine-4-carboxylate (112).
A mixture of 111 (340 mg, 0.88 mmol) and TFA (4 mL) was heated at
70 °C for 24 h. Evaporation under vacuum followed by purification of
the residue by flash chromatography (7:3 hexanes/EtOAc) afforded
the title compound (199 mg, 85%) as a white solid: Rf = 0.51 (3:2
1
hexanes/EtOAc); H NMR (600 MHz, CDCl3) δ 1.53 (t, J = 7.2 Hz,
3H), 4.57 (q, J = 7.2 Hz, 2H), 7.51 (t, J = 7.2 Hz, 1H), 7.56 (t, J = 7.2
Hz, 2H), 8.16 (d, J = 7.2 Hz, 2H), 8.28 (s, 1H), 8.52 (s, 1H); 13C
NMR (150 MHz, CDCl3) δ 14.5, 62.2, 111.8, 116.2, 127.9, 129.2,
130.1, 132.4, 135.1, 138.6, 153.4, 158.0, 165.3; HRMS (ESI+) calcd for
C15H14N3O2 [M + H]+ 268.1081, found 268.1056 (error 9.3 ppm).
6-Phenyl-1H-pyrazolo[3,4-b]pyridine-4-carboxylic Acid (36). To a
solution of 112 (30 mg, 0.11 mmol) in THF (1.0 mL) was added 1 N
aqueous NaOH (0.6 mL). The resultant solution was stirred at room
General Procedure for Ester Hydrolysis. To a solution of the ester
(typically 50 mg, 1 equiv) in THF (1 mL) in an 8 mL vial was added 1
N aqueous NaOH (5.0 mL, 5 equiv). The resulting cloudy solution
was stirred at room temperature for 4 h. The solvent was removed
2399
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
under vacuum at 45 °C on a Genevac instrument. The residue was
resuspended in H2O (2 mL) and neutralized with 12 N HCl (0.29 mL,
3.5 equiv). Methanol or DMSO were added when necessary to fully
dissolve the products, which were purified by preparative reverse-phase
HPLC using the indicated methods. Lyophilization of the fractions
containing the product afforded the title compounds.
using the general procedure for amination of 109 with benzylamine
(110 μL, 1.01 mmol, 3 equiv). Purification by flash chromatography
afforded the ethyl ester of the title compound (28 mg, 22%) as a white
1
solid: Rf = 0.42 (EtOAc); H NMR (600 MHz, CDCl3) δ 1.44 (t, J =
7.2 Hz, 3H), 4.43 (q, J = 7.2 Hz, 2H), 4.66 (d, J = 6.0 Hz, 2H), 5.50
(ovlp t, J = 6.0 Hz, 1H, NH), 5.52 (ovlp s, 2H), 7.02 (s, 1H), 7.07 (d, J
= 5.4 Hz, 2H), 7.26 (t, J = 7.2 Hz, 1H), 7.29 (t, J = 7.2 Hz, 2H), 7.33
(d, J = 7.2 Hz, 2H), 8.15 (s, 1H), 8.46 (d, J = 5.4 Hz, 2H); 13C NMR
(150 MHz, CDCl3) δ 14.4, 45.9, 49.4, 61.9, 105.1, 108.3, 122.7, 127.5,
127.7, 128.8, 132.9, 134.2, 139.0, 146.3, 150.0, 151.7, 158.0, 165.4.
Ethyl 6-(benzylamino)-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]-
pyridine-4-carboxylate prepared above (20 mg, 0.052 mmol, 1.0 equiv)
was converted to the title compound using the general procedure for
ester hydrolysis. Purification by preparative reverse-phase HPLC using
method 4 afforded the title compound as a white solid (17 mg, 91%):
tR = 10.0 min; 1H NMR (600 MHz, CD3OD) δ 4.60 (s, 2H), 5.51 (s,
2H), 6.92 (s, 1H), 7.10 (d, J = 6.0 Hz, 2H), 7.17 (t, J = 7.2 Hz, 1H),
7.21 (t, J = 7.2 Hz, 2H), 7.31 (d, J = 7.2 Hz, 2H), 8.13 (s, 1H), 8.34 (d,
J = 6.0 Hz, 2H); 13C NMR (150 MHz, DMSO-d6) δ 44.2, 48.5, 104.9,
122.3, 122.5, 127.4, 127.7, 128.0, 128.3, 139.8, 146.4, 149.6, 149.8,
151.2, 158.3, 166.3; HRMS (ESI−) calcd for C20H16N5O2 [M − H]−
358.1309, found 358.1316 (error 2.0 ppm).
Ethyl 6-Phenyl-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]-
pyridine-4-carboxylate (18). The title compound was prepared
using the general procedure for Suzuki coupling of 109 (0.40 g,
1.34 mmol, 1.0 equiv) using phenylboronic acid (327 mg, 2.68 mmol,
2.0 equiv). Purification by flash chromatography afforded the title
1
compound (326 mg, 74%) as a white solid: Rf = 0.39 (EtOAc); H
NMR (600 MHz, CDCl3) δ 1.52 (t, J = 7.2 Hz, 3H), 4.55 (q, J = 7.2
Hz, 2H), 5.82 (s, 2H), 7.22 (d, J = 6.0 Hz, 2H), 7.49 (t, J = 7.2 Hz,
1H), 7.53 (t, J = 7.2 Hz, 2H), 8.17 (d, J = 7.2 Hz, 2H), 8.29 (s, 1H),
8.46 (s, 1H), 8.55 (d, J = 6.0 Hz, 2H); 13C NMR (150 MHz, CDCl3) δ
14.5, 49.8, 62.2, 112.1, 115.8, 122.6, 127.6, 129.0, 130.1, 132.4, 134.0,
138.3, 145.8, 150.3, 151.9, 157.4, 165.2; HRMS (ESI+) calcd for
C21H19N4O2 [M + H]+ 359.1503; found 359.1527 (error 6.7 ppm).
6-Phenyl-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]pyridine-4-
carboxylic Acid (15). Compound 18 (120 mg, 0.324 mmol, 1.0 equiv)
was converted to the title compound using the general procedure for
ester hydrolysis. Purification by preparative reverse-phase HPLC using
method 2 followed by lyophilization of the pooled product fractions
afforded the title compound (87 mg, 81%) as a white solid: tR = 11.0
6-Morpholino-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]pyridine-
4-carboxylic Acid (96). Ethyl 6-morpholino-1-(pyridin-4-ylmethyl)-
1H-pyrazolo[3,4-b]pyridine-4-carboxylate was prepared using the
general procedure for amination of 109 with morpholine (88 μL,
1.01 mmol, 3 equiv). Purification by flash chromatography afforded
the ethyl ester of the title compound (98 mg, 79%) as a pale yellow
1
min; H NMR (600 MHz, CD3OD) δ 5.86 (s, 2H), 7.30 (d, J = 6.0
Hz, 2H), 7.45 (t, J = 7.2 Hz, 1H), 7.50 (t, J = 7.2 Hz, 2H), 8.18 (d, J =
7.2 Hz, 2H), 8.19 (s, 1H), 8.46 (d, J = 6.0 Hz, 2H), 8.53 (s, 1H); 13C
NMR (150 MHz, CD3OD) δ 50.3, 114.7, 116.1, 124.1, 128.6, 129.8,
130.6, 135.9, 140.4, 143.1, 149.3, 150.3, 153.2, 158.9, 172.4; HRMS
(ESI−) calcd for C19H13N4O2 [M − H]− 329.1044, found 329.1040
(error 1.2 ppm).
1
solid: Rf = 0.37 (EtOAc); H NMR (600 MHz, CDCl3) δ 1.48 (t, J =
7.2 Hz, 3H), 3.68 (t, J = 4.8 Hz, 4H), 3.83 (t, J = 4.8 Hz, 4H), 4.49 (q,
J = 7.2 Hz, 2H), 5.56 (s, 2H), 7.12 (d, J = 6.0 Hz, 2H), 7.27 (s, 1H),
8.18 (s, 1H), 8.52 (d, J = 6.0 Hz, 2H); 13C NMR (150 MHz, CDCl3) δ
14.5, 45.8, 49.4, 62.1, 66.8, 105.5, 106.3, 122.6, 133.3, 134.2, 146.4,
150.1, 151.5, 158.9, 165.6.
Ethyl 6-morpholino-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]-
pyridine-4-carboxylate prepared above (98 mg, 0.267 mmol, 1.0
equiv) was converted to the title compound using the general
procedure for ester hydrolysis. Purification by preparative reverse-
phase HPLC using method 4 afforded the title compound (45 mg,
97%) as a pale yellow solid: tR = 6.5 min; 1H NMR (600 MHz,
DMSO-d6) δ 3.62 (t, J = 4.8 Hz, 4H), 3.70 (t, J = 4.8 Hz, 4H), 5.56 (s,
2H), 7.14 (d, J = 6.0 Hz, 2H), 7.26 (s, 1H), 8.10 (s, 1H), 8.48 (d, J =
6.0 Hz, 2H); 13C NMR (150 MHz, CD3OD) δ 45.2, 48.6, 65.9, 105.1,
105.7, 122.4, 133.2, 133.9, 146.4, 149.8, 150.9, 158.6, 166.3; HRMS
(ESI−) calcd for C17H16N5O3 [M − H]− 338.1259, found 338.1262
(error 0.9 ppm).
6-(4-Hydroxyphenyl)-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]-
pyridine-4-carboxylic Acid (42). Ethyl 6-(4-hydroxyphenyl)-1-(pyr-
idin-4-ylmethyl)-1H-pyrazolo[3,4-b]pyridine-4-carboxylate (42-ethyl
ester) was prepared using the general procedure for Suzuki coupling
of 109 with 4-hydroxyphenylboronic acid (92 mg, 0.67 mmol, 2
equiv). Purification by flash chromatography afforded 42-ethyl ester
1
(78 mg, 62%) as a white solid: Rf = 0.22 (EtOAc); H NMR (600
MHz, DMSO-d6) δ 1.44 (t, J = 7.2 Hz, 3H), 4.49 (q, J = 7.2 Hz, 2H),
5.83 (s, 2H), 6.92 (d, J = 8.4 Hz, 2H), 7.19 (d, J = 5.4 Hz, 2H), 8.10
(d, J = 8.4 Hz, 2H), 8.16 (s, 1H), 8.41 (s, 1H), 8.50 (d, J = 5.4 Hz,
2H), 9.98 (s, 1H, OH); 13C NMR (150 MHz, DMSO-d6) δ 14.1, 48.9,
61.8, 110.6, 114.1, 115.9, 122.2, 128.3, 129.0, 131.9, 133.2, 146.1,
149.9, 151.4, 156.4, 159.6, 164.6.
The 42-ethyl ester (50 mg, 0.133 mmol, 1.0 equiv) prepared above
was converted to the title compound using the general procedure for
ester hydrolysis. Purification by preparative reverse-phase HPLC using
method 2 afforded the title compound (43 mg, 93%) as a white solid:
tR = 8.0 min; 1H NMR (600 MHz, CD3OD) δ 5.83 (s, 2H), 6.89 (d, J
= 8.4 Hz, 2H), 7.29 (d, J = 5.4 Hz, 2H), 8.05 (d, J = 8.4 Hz, 2H), 8.11
(s, 1H), 8.46 (d, J = 5.4 Hz, 2H), 8.48 (s, 1H); 13C NMR (150 MHz,
CD3OD) δ 50.2, 113.9, 115.5, 116.7, 124.1, 130.1, 131.5, 142.8, 149.4,
150.3, 153.2, 159.1, 159.4, 160.8, 172.6; HRMS (ESI−) calcd for
C19H13N4O3 [M − H]− 345.0993, found 345.0999 (error 1.7 ppm).
General Procedure for Amination of 109. To a solution of 109
(100 mg, 0.335 mmol, 1.0 equiv) and BOP (193 mg, 0.437 mmol, 1.3
equiv) in dioxane (3 mL) in an 8 mL vial was added DBU (76 μL,
0.504 mmol, 1.5 equiv), and the resulting mixture was stirred for 15
min at room temperature. The desired amine (1.01 mmol, 3 equiv)
was added. The vial was sealed, and the reaction mixture was heated at
70 °C with stirring for 5 h. The reaction mixture was concentrated.
Then the residue was resuspended in H2O (10 mL) and extracted with
EtOAc (3 × 15 mL). The combined organic layers were dried
(MgSO4) and concentrated. Purification by flash chromatography
(hexane/EtOAc gradient) on a Combiflash Companion system, using
a 4 g prepacked silica column, afforded the desired product.
6-(3-Hydroxypropylamino)-1-(pyridin-4-ylmethyl)-1H-pyrazolo-
[3,4-b]pyridine-4-carboxylic Acid (97). Ethyl 6-(3-hydroxypropylami-
no)-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]pyridine-4-carboxylate
was prepared using the general procedure for amination of 109 with 3-
hydroxypropylamine (77 μL, 1.01 mmol, 3 equiv). The crude product
obtained after extraction was converted to the title compound using
the general procedure for ester hydrolysis. Purification by preparative
reverse-phase HPLC using method 4 afforded the title compound (22
mg, 18% over two steps) as a white solid: tR = 8.6 min; 1H NMR (600
MHz, DMSO-d6) δ 1.70 (pent, J = 6.6 Hz, 2H), 3.37 (t, J = 6.6 Hz,
2H), 3.48 (t, J = 6.6 Hz, 2H), 5.50 (s, 2H), 7.01 (s, 1H), 7.15 (d, J =
4.8 Hz, 2H), 7.98 (s, 1H), 8.47 (d, J = 4.8 Hz, 2H); 13C NMR (150
MHz, DMSO-d6) δ 31.9, 38.0, 48.7, 58.7, 99.5, 104.6, 122.6, 132.5,
133.3, 146.8, 149.8, 151.8, 158.8, 166.4; HRMS (ESI−) calcd for
C16H16N5O3 [M − H]− 326.1259, found 326.1260 (error 0.3 ppm).
6-Oxo-1-(pyridin-4-ylmethyl)-6,7-dihydro-1H-pyrazolo[3,4-b]-
pyridine-4-carboxylic Acid (98). Compound 109 (40 mg, 0.134
mmol, 1.00 equiv) was converted to the title compound using the
general procedure for ester hydrolysis. Purification by preparative
HPLC using method 5 afforded the title compound (26 mg, 72%) as a
1
white solid: tR = 8.0 min; H NMR (600 MHz, CD3OD) δ 5.59 (s,
2H), 6.86 (s, 1H), 7.17 (d, J = 6.0 Hz, 2H), 8.21 (s, 1H), 8.44 (d, J =
6.0 Hz, 2H); 13C NMR (150 MHz, CD3OD) δ 50.0, 108.4, 111.5,
123.8, 136.4, 144.9, 149.5, 150.2, 150.9, 169.5, 172.8; HRMS (ESI−)
6-(Benzylamino)-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]-
pyridine-4-carboxylic Acid (95). Ethyl 6-(benzylamino)-1-(pyridin-4-
ylmethyl)-1H-pyrazolo[3,4-b]pyridine-4-carboxylate was prepared
2400
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
calcd for C13H9N4O3 [M − H]− 269.0680, found 269.0682 (error 0.7
ppm).
Compounds from Scheme 4. See Supporting Information for
the experimental details and data for 60 and 64−65, which were
prepared analogously to 43, whose experimentals are included below
as a representative example.
mg, 65%) as a white solid: tR = 11.8 min; 1H NMR (600 MHz,
DMSO-d6) δ 5.77 (s, 2H), 7.10 (d, J = 5.4 Hz, 2H), 7.45−7.50 (m,
3H), 7.68 (dd, J = 7,8, 2.4 Hz, 2H), 7.77 (s, 1H), 8.49 (d, J = 5.4 Hz,
2H), 8.54 (s, 1H); 13C NMR (150 MHz, DMSO-d6) δ 48.9, 89.5, 89.6,
113.7, 121.1, 121.2, 121.9, 128.9, 129.7, 131.9, 134.7, 141.1, 146.4,
149.8, 151.1, 165.8 (missing one aryl carbon); HRMS (ESI−) calcd for
C21H13N4O2 [M − H]− 353.1044, found 353.1035 (error 2.5 ppm).
Compounds from Scheme 5. See Supporting Information for
the experimental details and data for 23−25, 27, and 28, which were
prepared analogously to 22, whose experimental details are included
below as a representative example.
4-Hydroxymethyl-6-phenyl-1-(pyridin-4-ylmethyl)-1H-pyrazolo-
[3,4-b]pyridine (19). A solution of 18 (358 mg, 1.0 mmol, 1.0 equiv)
in THF (2 mL) was slowly added to a suspension of LiAlH4 (57 mg,
1.5 mmol, 1.5 equiv) in THF (8.0 mL) at 0 °C. The reaction mixture
was stirred at 0 °C for 10 min and gradually warmed to 22 °C over 1 h.
After the mixture was stirred for 2 h at 22 °C, the reaction was
quenched with MeOH (5 mL) and the mixture diluted with CH2Cl2
(15 mL). The organic layer was washed consecutively with saturated
aqueous NH4Cl (10 mL), H2O (10 mL), saturated aqueous NaCl (10
mL), then dried (Na2SO4) and concentrated. Purification by flash
chromatography (10:1 to 5:1 CH2Cl2−MeOH) afforded the title
compound 19 (143 mg, 45%) as a white solid: Rf = 0.36 (EtOAc); 1H
NMR (600 MHz, CDCl3) δ 5.09 (s, 2H), 5.75 (s, 2H), 7.15 (d, J = 6.0
Hz, 2H), 7.43 (t, J = 7.2 Hz, 1H), 7.47 (t, J = 7.2 Hz, 2H), 7.65 (s,
1H), 8.08 (d, J = 7.2 Hz, 2H), 8.16 (s, 1H), 8.42 (d, J = 6.0 Hz, 2H);
13C NMR (150 MHz, CDCl3) δ 49.5, 62.7, 111.7, 112.6, 122.8, 127.6,
General Procedure for Alkylation of 42-Ethyl Ester and
Hydrolysis. To a solution of 42-ethyl ester (112.3 mg, 0.30 mmol,
1.0 equiv) and Na2CO3 (63.6 mg, 0.6 mmol, 2.0 equiv) in 1:1
dioxane−H2O (6 mL) was added the respective alkyl bromide (1.2
mmol, 4.0 equiv). The mixture was heated at 80 °C for 12 h and then
cooled to room temperature, and the crude mixture was extracted with
EtOAc (3 × 15 mL). The combined organic layers were washed with
saturated aqueous NaCl (20 mL), dried (MgSO4), and concentrated.
The crude residue was purified by flash chromatography (4:1 EtOAc−
hexane) to afford the ethyl esters of the title compounds. Hydrolysis of
the ethyl esters was accomplished by dissolving the intermediate ethyl
esters (0.30 mmol, 1.0 equiv) in THF (3 mL) followed by the addition
of 1 N aqueous NaOH (3 mL, 3 mmol, 10 equiv). The resulting
solution was stirred at 60 °C for 12 h and then cooled to room
temperature. The pH was adjusted to ∼6 by the addition of 1 N
aqueous HCl, and the crude mixture was extracted with 10:1 EtOAc−
MeOH (5 × 15 mL). The combined organic extracts were washed
with saturated aqueous NaCl (20 mL), dried (MgSO4), and
concentrated. The products were dissolved in EtOAc with a small
amount of MeOH to aid in dissolution and then triturated with
hexane, whereupon the products precipitated as analytically pure white
solids in yields ranging from 40% to 70%.
128.9, 129.7, 132.3, 139.2, 146.2, 146.6, 149.8, 151.3, 157.4; HRMS
(ESI+) calcd for C19H17N4O [M]+ 317.1397, found 317.1395 (error
0.6 ppm).
6-[4-(Octyloxy)phenyl]-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-
b]pyridine-4-carboxylic Acid (63). The title compound was prepared
using the general procedure for alkylation of 42-ethyl ester and
hydrolysis employing octyl bromide (210 μL, 1.2 mmol) to afford the
title compound (38 mg, 28% over two steps) as a white solid: Rf = 0.22
6-Phenyl-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]pyridin-4-
amine (21). Compound 15 (50 mg, 0.168 mmol, 1.0 equiv) was
dissolved in 3:1 CH2Cl2−THF (4 mL), and oxalyl chloride (17.6 μL,
0.205 mmol, 1.2 equiv) was slowly added at room temperature. The
reaction mixture was stirred for 4 h and then concentrated in vacuo.
The residue was dissolved in acetone (5 mL) and added to a solution
of NaN3 (47 mg, 0.73 mmol, 4.3 equiv) in H2O (5 mL). The solution
was immediately extracted with EtOAc (2 × 20 mL). The combined
organic layers were dried (MgSO4), and the solvent was removed
under vacuum. The residue was dissolved in benzene (5 mL). Then
TFA (19 μL, 0.25 mmol, 1.5 equiv) was added, and the solution was
refluxed for 16 h. The solution was concentrated and the residue
redissolved in MeOH (5 mL). Solid K2CO3 (51 mg, 0.37 mmol, 2.2
equiv) was added, and the reaction mixture was stirred vigorously for 8
h at room temperature. The mixture was concentrated and the residue
partitioned between H2O (10 mL) and EtOAc (3 × 15 mL). The
combined organic layers were dried (MgSO4), and the solvent was
removed under vacuum. Purification by flash chromatography
(hexanes/EtOAc gradient) afforded the title compound (16 mg,
31%) as a white solid: Rf = 0.36 (EtOAc); 1H NMR (600 MHz,
CDCl3) δ 4.80 (br s, 2H, NH2), 5.70 (s, 2H), 6.78 (s, 1H), 7.21 (d, J =
4.8 Hz, 2H), 7.41 (t, J = 7.2 Hz, 1H), 7.46 (t, J = 7.2 Hz, 2H), 7.97 (s,
1H), 8.02 (d, J = 7.2 Hz, 2H), 8.54 (br s, 2H); 13C NMR (150 MHz,
CDCl3) δ 49.6, 98.5, 104.7, 122.8, 127.5, 128.7, 129.3, 130.2, 139.9,
146.5, 148.2, 150.1, 152.9, 158.6; HRMS (ESI−) calcd for C18H14N5O
[M − H]− 300.1255, found 300.1255 (error 0 ppm).
General Procedure for the Synthesis of 6-Phenyl-1-(pyridin-4-
ylmethyl)-1H-pyrazolo[3,4-b]pyridine-4-carboxamide Analogues.
To a solution of 15 (15 mg, 0.045 mmol, 1.0 equiv) and DMF (3.5
μL, 0.045 mmol, 1.0 equiv) in dry CH2Cl2 (2 mL) at 0 °C was added
oxalyl chloride (7.7 μL, 0.090 mmol, 2.0 equiv). The mixture was
stirred for 1 h, then concentrated in vacuo. A solution of the desired
amine (2−10 equiv) and DMAP (1.8 mg, 0.015 mmol, 0.3 equiv) in
CH2Cl2 (2.0 mL) was added, and the mixture was stirred for 1 h at
room temperature. The mixture was concentrated and the residue
resuspended in H2O (2 mL). Methanol or DMSO was added if
necessary to fully dissolve the products. Purification by preparative
HPLC using method 2 followed by lyophilization of the pooled
product fractions afforded the title compounds.
1
(1:4 MeOH/EtOAc); H NMR (600 MHz, DMSO-d6) δ 0.86 (t, J =
7.2 Hz, 3H), 1.27−1.32 (m, 8H), 1.41−1.42 (m, 2H), 1.72−1.75 (m,
2H), 4.04 (t, J = 7.2 Hz, 2H), 5.84 (s, 2H), 7.07 (d, J = 8.2 Hz, 2H),
7.20 (d, J = 3.2 Hz, 2H), 8.17−8.19 (m, 3H), 8.41 (s, 1H), 8.50 (d, J =
3.2 Hz, 2H); 13C NMR (150 MHz, DMSO-d6) δ 14.0, 22.1, 25.5,
28.62, 28.65, 28.7, 31.2, 48.9, 67.6, 111.6, 114.3, 114.8, 122.3, 128.8,
130.0, 133.5, 141.5, 146.2, 149.9, 151.4, 156.0, 160.3, 170.4; HRMS
(ESI−) calcd for C27H29N4O3 [M − H]− 457.2245, found 457.2220
(error 5.5 ppm).
6-Ethynyl-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]pyridine-4-
carboxylic Acid (93). A 1.0 M solution of TBAF in THF (0.25 mL, 1.0
equiv) was added to a solution of 11445 (105 mg, 0.25 mmol, 1.0
equiv) in THF (10 mL) at 0 °C and stirred for 3 h. The reaction
mixture was diluted with H2O (10 mL) and extracted with CH2Cl2 (3
× 15 mL). The combined organic layers were dried (MgSO4) and
concentrated. Purification by flash chromatography (hexane−EtOAc
gradient) afforded 116 (27 mg, 35%) as a white solid: Rf = 0.54
1
(EtOAc); H NMR (600 MHz, CDCl3) δ 1.48 (t, J = 7.2 Hz, 3H),
3.32 (s, 1H), 4.52 (q, J = 7.2 Hz, 2H), 5.75 (s, 2H), 7.13 (d, J = 4.8
Hz, 2H), 7.94 (s, 1H), 8.48 (s, 1H), 8.53 (d, J = 4.8 Hz, 2H); 13C
NMR (150 MHz, CDCl3) δ 14.4, 49.8, 62.4, 72.3, 82.7, 113.0, 122.0,
122.6, 132.1, 134.1, 141.5, 145.4, 150.3, 151.3, 164.4.
Compound 116 prepared above (20 mg, 0.065 mmol, 1.0 equiv)
was converted to the title compound using the general procedure for
ester hydrolysis. Purification by preparative reverse-phase HPLC using
method 4 afforded the title compound (7.4 mg, 41%) as an off-white
1
solid: tR = 8.3 min; H NMR (400 MHz, DMSO-d6) δ 4.64 (s, 1H),
5.78 (s, 2H), 7.12 (d, J = 6.0 Hz, 2H), 7.74 (s, 1H), 8.50 (d, J = 6.0
Hz, 2H), 8.51 (s, 1H); 13C NMR (100 MHz, DMSO-d6) δ 49.0, 82.4,
82.8, 99.5, 112.9, 121.0, 122.0, 133.7, 140.7, 145.9, 149.9, 150.8, 165.3;
HRMS (ESI−) calcd for C15H9N4O2 [M − H]− 277.0731, found
277.0736 (error 1.8 ppm).
6-(Phenylethynyl)-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]-
pyridine-4-carboxylic Acid (94). Compound 11545 (60 mg, 0.157
mmol, 1.0 equiv) was converted to the title compound using the
general procedure for ester hydrolysis. Purification by preparative
reverse-phase HPLC using method 2 afforded the title compound (36
2401
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
6-Phenyl-1-(pyridin-4-ylmethyl)-1H-pyrazolo[3,4-b]pyridine-4-
carboxamide (22). The title compound was prepared using the
general procedure for the synthesis of 4-carboxamide analogues from
15, using a 14.8 M ammonium hydroxide solution (34 μL, 0.50 mmol,
10 equiv). Purification by preparative reverse-phase HPLC using
method 2 afforded the title compound (4.9 mg, 30%) as a white solid:
tR = 12.2 min; 1H NMR (600 MHz, CD3OD) δ 5.88 (s, 2H), 7.32 (d, J
= 5.4 Hz, 2H), 7.48 (t, J = 7.2 Hz, 1H), 7.52 (t, J = 7.2 Hz, 2H), 8.17
(s, 1H), 8.23 (d, J = 7.2 Hz, 2H), 8.45 (s, 1H), 8.47 (d, J = 5.4 Hz,
2H); 13C NMR (150 MHz, CD3OD) δ 50.4, 113.2, 114.3, 124.1,
128.7, 130.0, 131.1, 134.7, 138.3, 139.7, 149.0, 150.4, 153.0, 159.1,
169.9; HRMS (ESI+) calcd for C19H16N5O [M + H]+ 330.1349, found
330.1353 (error 1.2 ppm).
8.59 (d, J = 6.0 Hz, 2H); 13C NMR (150 MHz, CDCl3) δ 52.3, 56.5,
119.8, 120.8, 122.1, 122.9, 125.6, 127.4, 127.5, 127.9, 129.1, 139.1,
140.1, 144.7, 150.3, 150.5, 166.6.
Methyl 6-phenyl-2-(pyridin-4-ylmethyl)-2H-indazole-4-carboxylate
(34 mg, 0.099 mmol, 1.0 equiv) prepared above was converted to
the title compound using the general procedure for ester hydrolysis.
Purification by preparative reverse-phase HPLC using method 3
afforded the title compound (25 mg, 77%) as a white solid: tR = 9.0
min; 1H NMR (400 MHz, DMSO-d6) δ 5.82 (s, 2H), 7.24 (d, J = 6.0
Hz, 2H), 7.40 (t, J = 7.2 Hz, 1H), 7.50 (t, J = 7.2 Hz, 2H), 7.77 (d, J =
7.2 Hz, 2H), 8.08 (s, 1H), 8.15 (s, 1H), 8.54 (d, J = 6.0 Hz, 2H), 8.87
(s, 1H); 13C NMR (100 MHz, DMSO-d6) δ 55.1, 119.0, 119.6, 122.5,
124.3, 125.3, 126.3, 127.0, 127.7, 129.1, 137.4, 139.8, 145.6, 149.6,
149.9, 167.0; HRMS (ESI−) calcd for C20H14N3O2 [M − H]−
328.1092, found 328.1084 (error 2.4 ppm).
Methyl 6-Bromo-1-(pyridin-4-ylmethyl)-1H-indole-4-carboxylate
(120). To a solution of methyl 6-bromo-1H-indole-4-carboxylate 118
(50 mg, 0.20 mmol, 1.0 equiv) in DMF (3 mL) was added Cs2CO3
(391 mg, 1.2 mmol, 6.0 equiv), and the resulting suspension was
stirred at room temperature for 30 min. 4-(Bromomethyl)pyridine
hydrobromide (152 mg, 0.6 mmol, 3.0 equiv) was added, and stirring
continued at room temperature for 2 h. The reaction mixture was
diluted with EtOAc (10 mL), filtered through a bed of Celite, and
concentrated. Purification by flash chromatography (hexanes/EtOAc
gradient) afforded the title compound (53 mg, 77%) as a white solid:
Rf = 0.30 (EtOAc); 1H NMR (600 MHz, CDCl3) δ 3.98 (s, 3H), 5.32
(s, 2H), 6.89 (d, J = 5.4 Hz, 2H), 7.20 (d, J = 3.0 Hz, 1H), 7.23 (d, J =
3.0 Hz, 1H), 7.50 (s, 1H), 8.01 (s, 1H), 8.53 (d, J = 5.4 Hz, 2H); 13C
NMR (150 MHz, CDCl3) δ 49.3, 52.2, 104.1, 114.8, 116.9, 121.2,
123.3, 125.5, 127.4, 131.1, 137.8, 145.7, 150.6, 166.7; HRMS (ESI+)
calcd for C16H14BrN2O2 [M + H]+ 347.0213, found 347.0222 (error
2.6 ppm).
Compounds from Scheme 6. Methyl 6-Bromo-1-(pyridin-4-
ylmethyl)-1H-indazole-4-carboxylate (119) and Methyl 6-Bromo-2-
(pyridin-4-ylmethyl)-2H-indazole-4-carboxylate (121). To a solution
of methyl 6-bromo-1H-indazole-4-carboxylate 117 (300 mg, 1.18
mmol, 1.0 equiv) in DMF (10 mL) was added Cs2CO3 (2.3 g, 7.1
mmol, 6.0 equiv), and the resulting suspension was stirred at room
temperature for 30 min. 4-(Bromomethyl)pyridine hydrobromide
(0.89 g, 3.53 mmol, 3.0 equiv) was added, and stirring continued at
room temperature for 3 h. The reaction mixture was diluted with
EtOAc (20 mL), filtered through a bed of Celite, and concentrated.
Purification by flash chromatography (hexanes/EtOAc gradient)
afforded the two title compounds as white solids.
1
Data for 119 (128 mg, 31%): Rf = 0.37 (EtOAc); H NMR (600
MHz, CDCl3) δ 4.01 (s, 3H), 5.58 (s, 2H), 6.98 (d, J = 6.0 Hz, 2H),
7.65 (s, 1H), 8.01 (s, 1H), 8.52−8.54 (m, 3H); 13C NMR (150 MHz,
CDCl3) δ 51.9, 52.7, 116.3, 120.4, 121.7, 122.0, 124.4, 127.9, 135.3,
140.9, 145.1, 150.5, 165.4; HRMS (ESI+) calcd for C15H13BrN3O2 [M
+ H]+ 348.0186, found 348.0176 (error 2.8 ppm).
1
Data for 121 (76 mg, 19%): Rf = 0.19 (EtOAc); H NMR (600
MHz, CDCl3) δ 3.95 (s, 3H), 5.60 (s, 2H), 7.07 (d, J = 6.0 Hz, 2H),
7.97 (s, 1H), 8.09 (s, 1H), 8.47 (s, 1H), 8.57 (d, J = 6.0 Hz, 2H); 13C
NMR (150 MHz, CDCl3) δ 52.5, 56.5, 119.2, 119.3, 122.1, 123.9,
125.5, 126.0, 130.0, 144.3, 150.1, 150.6, 165.5; HRMS (ESI+) calcd for
C15H13BrN3O2 [M + H]+ 348.0186, found 348.0175 (error 3.2 ppm).
6-Phenyl-1-(pyridin-4-ylmethyl)-1H-indazole-4-carboxylic Acid
(16). Methyl 6-phenyl-1-(pyridin-4-ylmethyl)-1H-indazole-4-carboxy-
late was prepared using the general procedure for Suzuki coupling
from 119 (50 mg, 0.144 mmol, 1.0 equiv). Purification by flash
chromatography (hexanes/EtOAc gradient) afforded the methyl ester
of the title compound (28 mg, 57%) as a white solid: Rf = 0.40
6-Phenyl-1-(pyridin-4-ylmethyl)-1H-indole-4-carboxylic Acid (17).
Methyl 6-phenyl-1-(pyridin-4-ylmethyl)-1H-indole-4-carboxylate was
prepared using the general procedure for Suzuki coupling from 120
(50 mg, 0.145 mmol, 1.0 equiv). Purification by flash chromatography
(hexanes/EtOAc gradient) afforded the methyl ester of the title
1
compound (59 mg, 63%) as a white solid: Rf = 0.30 (EtOAc); H
NMR (600 MHz, CDCl3) δ 4.02 (s, 3H), 5.42 (s, 2H), 6.95 (d, J = 6.0
Hz, 2H), 7.25 (d, J = 3.0 Hz, 1H), 7.29 (d, J = 3.0 Hz, 1H), 7.33 (t, J =
7.2 Hz, 1H), 7.43 (t, J = 7.2 Hz, 2H), 7.55 (s, 1H), 7.58 (d, J = 7.2 Hz,
2H), 8.21 (s, 1H), 8.53 (d, J = 6.0 Hz, 2H); 13C NMR (150 MHz,
CDCl3) δ 49.3, 52.0, 103.9, 112.5, 121.3, 122.5, 123.4, 127.3, 127.5,
127.7, 129.0, 131.0, 135.4, 137.7, 141.2, 146.3, 150.5, 167.9.
Methyl 6-phenyl-1-(pyridin-4-ylmethyl)-1H-indole-4-carboxylate
(50 mg, 0.146 mmol, 1.0 equiv) prepared above was converted to
the title compound using the general procedure for ester hydrolysis.
Purification by preparative reverse-phase HPLC using method 7
afforded the title compound (9.4 mg, 20%) as a white solid: tR = 14.5
min; 1H NMR (600 MHz, DMSO-d6) δ 5.54 (s, 2H), 7.07 (d, J = 6.0
Hz, 2H), 7.19 (d, J = 3.0 Hz, 1H), 7.27 (d, J = 3.0 Hz, 1H), 7.33 (t, J =
7.2 Hz, 1H), 7.39−7.43 (m, 3H), 7.64 (d, J = 7.2 Hz, 2H), 7.90 (s,
1H), 8.44 (d, J = 6.0 Hz, 2H); 13C NMR (150 MHz, DMSO-d6) δ
48.1, 104.5, 108.3, 120.7, 121.9, 126.6, 126.9, 128.0, 129.0, 129.6,
133.0, 137.4, 141.9, 148.0, 149.9, 157.0, 170.8; HRMS (ESI−) calcd
for C21H15N2O2 [M − H]− 327.1139, found 327.1145 (error 1.8
ppm).
Enzyme Binding Studies. BasE and MbtA were expressed in E.
coli and purified as described.38,39 Determination of equilibrium
dissociation constants KD for each compound was performed using the
fluorescence polarization assay with Fl-Sal-AMS 14 as ligand in black
flat-bottom 96-well plates (Costar no. 3915) as described.39 A 3-fold
serial dilution of each compound (10 μL) was added to 90 μL of a
solution of 14 (20 nM final concentration) and 200 nM BasE or 50
nM MbtA in 30 mM Tris-HCl, pH 7.5, 1 mM MgCl2, and 0.0025%
Igepal CA-630. The fluorescence anisotropy was measured after a 30
min incubation at 25 °C. The KD of each compound tested was
determined by fitting the displacement curves (AOBS, the exper-
imentally measured anisotropy vs LT, the test compound concen-
1
(EtOAc); H NMR (600 MHz, CDCl3) δ 4.06 (s, 3H), 5.69 (s, 2H),
7.03 (d, J = 6.0 Hz, 2H), 7.40 (t, J = 7.2 Hz, 1H), 7.47 (t, J = 7.2 Hz,
2H), 7.61 (d, J = 7.2 Hz, 2H), 7.63 (s, 1H), 8.22 (s, 1H), 8.54 (d, J =
6.0 Hz, 2H), 8.60 (s, 1H); 13C NMR (150 MHz, CDCl3) δ 51.9, 52.5,
111.6, 121.7, 122.2, 123,7, 125.0, 127.7, 128.2, 129.2, 135.1, 140.1,
140.3, 141.0, 145.6, 150.5, 166.6.
Methyl 6-phenyl-1-(pyridin-4-ylmethyl)-1H-indazole-4-carboxylate
(23 mg, 0.067 mmol, 1.0 equiv) prepared above was converted to
the title compound using the general procedure for ester hydrolysis.
Purification by preparative reverse-phase HPLC using method 3
afforded the title compound (16 mg, 72%) as a white solid: tR = 9.5
min; 1H NMR (400 MHz, DMSO-d6) δ 5.87 (s, 2H), 7.13 (d, J = 6.0
Hz, 2H), 7.42 (t, J = 7.2 Hz, 1H), 7.51 (t, J = 7.2 Hz, 2H), 7.78 (d, J =
7.2 Hz, 2H), 8.08 (s, 1H), 8.29 (s, 1H), 8.48−8.50 (m, 3H); 13C NMR
(100 MHz, DMSO-d6) δ 50.6, 111.4, 121.6, 122.0 (2 C), 123.1, 127.3,
127.9, 129.0, 134.4, 138.4, 139.5, 141.1, 146.4, 149.9, 167.2; HRMS
(ESI−) calcd for C20H14N3O2 [M − H]− 328.1092, found 328.1089
(error 0.9 ppm).
6-Phenyl-2-(pyridin-4-ylmethyl)-2H-indazole-4-carboxylic Acid
(99). Methyl 6-phenyl-2-(pyridin-4-ylmethyl)-2H-indazole-4-carboxy-
late was prepared using the general procedure for Suzuki coupling
from 121 (50 mg, 0.144 mmol, 1.0 equiv). Purification by flash
chromatography (hexanes/EtOAc gradient) afforded the methyl ester
of the title compound (38 mg, 77%) as a white solid: Rf = 0.22
1
(EtOAc); H NMR (600 MHz, CDCl3) δ 3.99 (s, 3H), 5.65 (s, 2H),
7.12 (d, J = 6.0 Hz, 2H), 7.39 (t, J = 7.2 Hz, 1H), 7.48 (t, J = 7.2 Hz,
2H), 7.69 (d, J = 7.2 Hz, 2H), 8.13 (s, 1H), 8.24 (s, 1H), 8.51 (s, 1H),
2402
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
tration) to eqs 1 and 246 using Mathematica 7 (Wolfram Research
Inc.).
TGAGCAGCATATGG, CCTGCAGGATCCATGTGCTC-
TGAAGGACACG). The kanamycin resistance gene (kanR) was
amplified from pCR2.1 TOPO (Invitrogen) using the primers Kan F,
Kan R (CACCACTAGTTAACCGGAATTGCCAGCTGGG,
GCTAGCTCAGAAGAACTCGTCAAG). The three PCR fragments
were cloned into pENTR/TEV/D-TOPO (Invitrogen) for ease of
propagation creating pCDD129, pCDD130, and pCDD131 for the 5′,
KanR, and 3′ fragments respectively. The knockout fragments were
cloned sequentially into pUC18 by first ligating the 5′ fragment after
digesting pCDD129 and pUC18 with SacI and SmaI, creating
pCDD132. The 3′ fragment was added next by ligating SmaI, Sbf I
digested pCDD131, and pCDD132, creating pCDD133. KanR was
removed from pCDD130 by digestion with SpeI, NheI and ligated into
similarly cut pCDD133, creating pCDD134. The knockout cassette
was removed from pCDD134 by digestion with BamHI and cloned
into pKC1139, a Streptomyces/E. coli shuttle vector to create
pCDD135, which will act as a suicide vector in A. baumannii. The
knockout plasmid was transformed into ATCC 19606 using
electroporation as previously described.64,65 Clones resistant to
kanamycin and sensitive to apramycin were confirmed by PCR to
have the correct genome insertion using the primer pairs 5′ confirm
(CACCACGAGGTATTTTGTGCTGGG), KanR, and KanF, 3′
confirm (CACCACGAGGTATTTTGTGCTGGG), creating 19606
ΔbasE.
QFSBAB + (1 − FSB)AF
AOBS
=
1 − (1 − Q)FSB
(1)
(2)
2 (a2 − 3b) cos(θ/3) − a
3KD1 + 2 (a2 − 3b) cos(θ/3) − a
FSB
with
=
a = KD1 + KD2 + LST + LT − RT
b = (LT − RT)KD1 + (LST − RT)KD2 + KD1KD2
c = −KD1KD2RT
⎡
⎢
⎤
⎥
−2a3 + 9ab − 27c
2 (a2 − 3b)3
θ = arccos
⎢
⎣
⎥
⎦
In these equations, Q is the ratio of the fluorescence intensity of the
probe in the bound and free states (1.07 for BasE and 1.02 for
MbtA39), FSB is the fraction of bound 14, AB (0.035) and AF (0.220 for
BasE and 0.308 for MbtA39) represent the anisotropies of bound and
free probe 14, KD1 is the equilibrium dissociation constant of 14 (84.3
nM for BasE and 9.26 nM for MbtA39), LST is the concentration of 14,
RT is the receptor protein concentration, and KD2 is the test
compound’s equilibrium dissociation constant.46
Complementation of 19606 ΔbasE. The E. coli, A. baumannii
shuttle vector pWH1266 (ATCC, Manassas, VA) was used to
complement 19606 ΔbasE. The primers basE comp
F
(CACCGGATCCTTGTTAATCATTTCCAATTTTG) and basE
comp R (GCATGCTTAAGATGTTGTAGATGTATTTAAAATGC)
were used to PCR amplify basE and its promoter region from
ATCC19606. Primers Apr F (CACCAAGCTTTAAGGTTCAT-
GTGCAGCTCCATC) and Apr R (GGATCCTCAGCCAATCGA-
CTGGCG) were used to amplify the apramycin resistance (aprR)
gene from pKC1139. The basE fragment was digested with BamHI
and SphI, and AprR was digested with BamHI and HindIII. Both
fragments were ligated into pWH1266 digested with HindIII and SphI,
creating pCDD140. The final plasmid was transformed into 19606
ΔbasE using the method described above.
Acinetobacter baumannii MIC Assay. A single LB agar plate was
streaked with 19606 WT and grown overnight at 30 °C. The plate was
flooded with 2 mL of medium 1 (M9 minimal medium, 0.2% casamino
acids, 200 μM dipyridyl) and transferred to a 15 mL centrifuge tube.
Cells were spun down at room temperature and washed twice with 10
mL of medium 1 and then resuspended in 2 mL of medium 1. The
A600 was measured, and cells were diluted in medium 1 to an A600 of
1.7−2.0 and then further diluted to 0.0003 in either medium 1
supplemented with 1 μM FeCl3 or medium 2 (M9 minimal media,
0.2% casamino acids) supplemented with 200 μM FeCl3. An amount
of 200 μL of each solution was dispensed in triplicate into a 96-well
plate containing 2 μL of each inhibitor in DMSO for a final
concentration of 100 μM. Tetracycline was used as a positive control
(100 ng/mL), and 1% DMSO was used as a negative control. The
plates were incubated at 30 °C, and the A600 was measured at 15 h.
Mycobacterium tuberculosis H37Rv MIC Assay. Minimum
inhibitory concentrations (MICs) were experimentally determined as
previously described.36 MICs were determined in quadruplicate in
iron-deficient GAST and GAST supplemented with 200 μM FeCl3
according to the broth microdilution method using compounds from
DMSO stock solutions or with control wells treated with an equivalent
amount of DMSO. Isoniazid was used as a positive control, while
DMSO was employed as a negative control. All measurements
reported herein used an initial cell density of 104−105 cells/assay, and
growth was monitored at 10−14 days, with the untreated and DMSO-
treated control cultures reaching an OD620 of 0.2−0.3. Plates were
incubated at 37 °C (100 μL/well), and growth was recorded by
measurement of optical density at 620 nm.
Growth of A. baumannii Strains. LB agar plates were streaked
with 19606 WT, 19606 ΔbasE, or 19606 ΔbasE pCDD140 and grown
overnight at 30 °C. Each plate was flooded with 2 mL of medium 1
(M9 minimal medium, 0.2% casamino acids, 200 μM dipyridyl) and
transferred to a 15 mL centrifuge tube. Cells were spun down at room
temperature and washed twice with 10 mL of medium 1 and then
resuspended in 2 mL of medium 1. The A600 was measured, and cells
were diluted in medium 1 to an A600 of 1.7−2.0 and then further
diluted to 0.0003 in either medium 1 supplemented with 1 μM FeCl3
or medium 2 (M9 minimal mediim, 0.2% casamino acids)
supplemented with 200 μM FeCl3 and placed into a 96-well plate in
six 200 μL replicates. Positive controls for iron limiting and rich
conditions consisted of WT supplemented with 100 ng/mL
tetracycline. The plates were incubated at 30 °C, and the A600 was
measured at 2, 4, 6, 7, 8, 9, 10, 12, 13, and 22 h.
ASSOCIATED CONTENT
■
Protein Crystallography. The BasE enzyme from A. baumannii
strain AB900 for crystallographic studies was produced and crystallized
as previously described.31 BasE was cocrystallized with 67 and 70;
crystals were isomorphic with the prior BasE structures. Data were
collected at SSRL beamline 11-1. Initial phases were provided by
difference Fourier methods using the previous structure of BasE bound
to 15 as an initial refinement model; all non-protein atoms were
removed prior to refinement. The models were refined to completion
as described previously.31
S
* Supporting Information
Synthetic procedures and characterization data for compounds
1
23−25, 27, 28, 37−62, and 64−92 and representative H and
13C NMR spectra for 15−19, 21, 22, 37, 60, 63, 91, 94, and 98.
This material is available free of charge via the Internet at
http://pubs.acs.org.
Insertional Deletion of BasE. Flanking regions of basE from A.
baumannii ATCC 19606 were amplified by PCR using the primers 5′F,
5′R (CACCGAGCTCGGATCCACTGGATGTGGTGAGAAGC,
CCCGGGACTAGTGACATTCTAAATATTCAATTTAATT-
TAATG) and 3′F, 3′R (CACCCGGGCTAGCTAAATAT-
AUTHOR INFORMATION
■
Corresponding Author
*Phone: 612-625-7956. Fax: 612-626-5173. E-mail: aldri015@
umn.edu.
2403
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
Comparative genome sequence analysis of multidrug-resistant
Acinetobacter baumannii. J. Bacteriol. 2008, 190, 8053−8064.
(9) Falagas, M. E.; Kasiakou, S. K. Colistin: the revival of polymyxins
for the management of multidrug-resistant Gram-negative bacterial
infections. Clin. Infect. Dis. 2005, 40, 1333−1341.
(10) Cai, Y.; Chai, D.; Wang, R.; Liang, B.; Bai, N. Colistin resistance
of Acinetobacter baumannii: clinical reports, mechanisms and
antimicrobial strategies. J. Antimicrob. Chemother. 2012, 67, 1607−
1615.
Present Address
⊥
́
For J.N.: Global Health Institute, Ecole Polytechnique
erale de Lausanne, 1015 Lausanne, Switzerland. E-mail:
Fed
́ ́
joao.neres@epfl.ch.
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
(11) Posey, J. E.; Gherardini, F. C. Lack of a role for iron in the lyme
This research was supported by grants from the National
Institutes of Health (Grant AI070219 to C.C.A. and Grant GM-
068440 to A.M.G.) and the Intramural Research Program of
the NIAID in the National Institutes of Health (to C.E.B.). We
thank Dr. Michael Walters (Institute for Therapeutics
Discovery and Development, University of Minnesota) for
assistance with the parallel synthesis and Prof. David H.
Sherman (Life Sciences Institute, University of Michigan) for
plasmids pUC18 and pKC1139.
disease pathogen. Science 2000, 288, 1651−1653.
(12) Miethke, M.; Marahiel, M. A. Siderophore-based iron
acquisition and pathogen control. Microbiol. Mol. Biol. Rev. 2007, 71,
413−451.
(13) Crosa, J. H.; Walsh, C. T. Genetics and assembly line
enzymology of siderophore biosynthesis in bacteria. Microbiol. Mol.
Biol. Rev. 2002, 66, 223−249.
(14) Sandy, M.; Butler, A. Microbial iron acquisition: marine and
terrestrial siderophores. Chem. Rev. 2009, 109, 4580−4595.
(15) Hider, R. C.; Kong, X. Chemistry and biology of siderophores.
Nat. Prod. Rep. 2010, 27, 637−657.
(16) Zimbler, D. L.; Penwell, W. F.; Gaddy, J. A.; Menke, S. M.;
Tomaras, A. P.; Connerly, P. L.; Actis, L. A. Iron acquisition functions
expressed by the human pathogen Acinetobacter baumannii. BioMetals
2009, 22, 23−32.
(17) Lawlor, M. S.; O’Connor, C.; Miller, V. L. Yersiniabactin is a
virulence factor for Klebsiella pneumoniae during pulmonary infection.
Infect. Immun. 2007, 75, 1463−1472.
ABBREVIATIONS USED
■
AAAE, aryl acid adenylating enzyme; ArCP, aryl carrier protein;
BOP, (benzotriazol-1-yloxy)tris(dimethylamino)phosphonium
hexafluorophosphate; DHB, 2,3-dihydroxybenzoic acid; DHB-
AMS, 5′-O-[N-(2,3-dihydroxybenzoyl)sulfamoyl]adenosine; Fl-
Sal-AMS, 2′-O-{2-[2-(2-{[(fluorescein-5-yl)carbonyl]amino}-
ethoxy)ethoxy]ethoxy}-5′-O-[N-(salicyl)sulfamoyl]adenosine;
FP, fluorescence polarization; HPLC, high-performance liquid
chromatography; HTS, high-throughput screening; MDR,
multidrug resistant; MIC, minimum inhibitory concentration;
NRPS, nonribosomal peptide synthetase; PMP, p-methoxy-
phenyl; PyBroP, bromotripyrrolidinophosphonium hexafluor-
ophosphate; ROS, reactive oxygen species; SAL, salicylic acid;
Sal-AMS, 5′-O-[N-(salicyl)sulfamoyl]adenosine; SAR, struc-
ture−activity relationship; TES, triethylsilyl; TFA, trifluoro-
acetic acid
(18) Takase, H.; Nitanai, H.; Hoshino, K.; Otani, T. Impact of
siderophore production on Pseudomonas aeruginosa infections in
immunosuppressed mice. Infect. Immun. 2000, 68, 1834−1839.
(19) Fischbach, M. A.; Lin, H.; Zhou, L.; Yu, Y.; Abergel, R. J.; Liu,
D. R.; Raymond, K. N.; Wanner, B. L.; Strong, R. K.; Walsh, C. T.;
Aderem, A.; Smith, K. D. The pathogen-associated iroA gene cluster
mediates bacterial evasion of lipocalin 2. Proc. Natl. Acad. Sci. U.S.A.
2006, 103, 16502−16507.
(20) Cendrowski, S.; MacArthur, W.; Hanna, P. Bacillus anthracis
requires siderophore biosynthesis for growth in macrophages and
mouse virulence. Mol. Microbiol. 2004, 51, 407−417.
(21) Dale, S. E.; Doherty-Kirby, A.; Lajoie, G.; Heinrichs, D. E. Role
of siderophore biosynthesis in virulence of Staphylococcus aureus:
identification and characterization of genes involved in production of a
siderophore. Infect. Immun. 2004, 72, 29−37.
(22) De Voss, J. J.; Rutter, K.; Schroeder, B. G.; Su, H.; Zhu, Y.;
Barry, C. E., 3rd. The salicylate-derived mycobactin siderophores of
Mycobacterium tuberculosis are essential for growth in macrophages.
Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 1252−1257.
(23) Kohanski, M. A.; Dwyer, D. J.; Hayete, B.; Lawrence, C. A.;
Collins, J. J. A common mechanism of cellular death induced by
bactericidal antibiotics. Cell 2007, 130, 797−810.
(24) Dwyer, D. J.; Kohanski, M. A.; Collins, J. J. Role of reactive
oxygen species in antibiotic action and resistance. Curr. Opin.
Microbiol. 2009, 12, 482−489.
(25) Yamamoto, S.; Okujo, N.; Sakakibara, Y. Isolation and structure
elucidation of acinetobactin, a novel siderophore from Acinetobacter
baumannii. Arch. Microbiol. 1994, 162, 249−254.
(26) Takeuchi, Y.; Ozaki, S.; Satoh, M.; Mimura, K.; Hara, S.; Abe,
H.; Nishioka, H.; Harayama, T. Synthesis of acinetobactin. Chem.
Pharm. Bull. 2010, 58, 1552−1553.
(27) Dorsey, C. W.; Tomaras, A. P.; Connerly, P. L.; Tolmasky, M.
E.; Crosa, J. H.; Actis, L. A. The siderophore-mediated iron acquisition
systems of Acinetobacter baumannii ATCC 19606 and Vibrio
anguillarum 775 are structurally and functionally related. Microbiology
2004, 150, 3657−3667.
REFERENCES
■
(1) Projan, S. J.; Bradford, P. A. Late stage antibacterial drugs in the
clinical pipeline. Curr. Opin. Microbiol. 2007, 10, 441−446.
(2) Wright, G. D. Antibiotics: a new hope. Chem. Biol. 2012, 19, 3−
10.
(3) Peleg, A. Y.; Seifert, H.; Paterson, D. L. Acinetobacter baumannii:
emergence of a successful pathogen. Clin. Microbiol. Rev. 2008, 21,
538−582.
(4) Calhoun, J. H.; Murray, C. K.; Manring, M. M. Multidrug-
resistant organisms in military wounds from Iraq and Afghanistan.
Clin. Orthop. Relat. Res. 2008, 466, 1356−1362.
(5) Lockhart, S. R.; Abramson, M. A.; Beekmann, S. E.; Gallagher, G.;
Riedel, S.; Diekema, D. J.; Quinn, J. P.; Doern, G. V. Antimicrobial
resistance among Gram-negative bacilli causing infections in intensive
care unit patients in the United States between 1993 and 2004. J. Clin.
Microbiol. 2007, 45, 3352−3359.
(6) Rhomberg, P. R.; Jones, R. N. Summary trends for the
Meropenem Yearly Susceptibility Test Information Collection
Program: a 10-year experience in the United States (1999−2008).
Diagn. Microbiol. Infect. Dis. 2009, 65, 414−426.
(7) Vallenet, D.; Nordmann, P.; Barbe, V.; Poirel, L.; Mangenot, S.;
Bataille, E.; Dossat, C.; Gas, S.; Kreimeyer, A.; Lenoble, P.; Oztas, S.;
Poulain, J.; Segurens, B.; Robert, C.; Abergel, C.; Claverie, J. M.;
Raoult, D.; Medigue, C.; Weissenbach, J.; Cruveiller, S. Comparative
analysis of Acinetobacters: three genomes for three lifestyles. PLoS One
2008, 3, e1805.
(28) Mihara, K.; Tanabe, T.; Yamakawa, Y.; Funahashi, T.; Nakao,
H.; Narimatsu, S.; Yamamoto, S. Identification and transcriptional
organization of a gene cluster involved in biosynthesis and transport of
acinetobactin, a siderophore produced by Acinetobacter baumannii
ATCC 19606T. Microbiology 2004, 150, 2587−2597.
(8) Adams, M. D.; Goglin, K.; Molyneaux, N.; Hujer, K. M.;
Lavender, H.; Jamison, J. J.; MacDonald, I. J.; Martin, K. M.; Russo, T.;
Campagnari, A. A.; Hujer, A. M.; Bonomo, R. A.; Gill, S. R.
2404
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405

Journal of Medicinal Chemistry
Article
(29) Sattely, E. S.; Walsh, C. T. A latent oxazoline electrophile for N-
O-C bond formation in pseudomonine biosynthesis. J. Am. Chem. Soc.
2008, 130, 12282−12284.
(30) Wuest, W. M.; Sattely, E. S.; Walsh, C. T. Three siderophores
from one bacterial enzymatic assembly line. J. Am. Chem. Soc. 2009,
131, 5056−5057.
(31) Drake, E. J.; Duckworth, B. P.; Neres, J.; Aldrich, C. C.; Gulick,
A. M. Biochemical and structural characterization of bisubstrate
inhibitors of BasE, the self-standing nonribosomal peptide synthetase
adenylate-forming enzyme of acinetobactin synthesis. Biochemistry
2010, 49, 9292−9305.
(32) Hurdle, J. G.; O’Neill, A. J.; Chopra, I. Prospects for aminoacyl-
tRNA synthetase inhibitors as new antimicrobial agents. Antimicrob.
Agents Chemother. 2005, 49, 4821−4833.
(47) Stachelhaus, T.; Mootz, H. D.; Marahiel, M. A. The specificity-
conferring code of adenylation domains in nonribosomal peptide
synthetases. Chem. Biol. 1999, 6, 493−505.
(48) Auld, D. S.; Lovell, S.; Thorne, N.; Lea, W. A.; Maloney, D. J.;
Shen, M.; Rai, G.; Battaile, K. P.; Thomas, C. J.; Simeonov, A.;
Hanzlik, R. P.; Inglese, J. Molecular basis for the high-affinity binding
and stabilization of firefly luciferase by PTC124. Proc. Natl. Acad. Sci.
U.S.A. 2010, 107, 4878−4883.
(49) Lee, T. V.; Johnson, L. J.; Johnson, R. D.; Koulman, A.; Lane, G.
A.; Lott, J. S.; Arcus, V. L. Structure of a eukaryotic nonribosomal
peptide synthetase adenylation domain that activates a large
hydroxamate amino acid in siderophore biosynthesis. J. Biol. Chem.
2010, 285, 2415−2427.
(50) Gordon, N. C.; Wareham, D. W. Multidrug-resistant
Acinetobacter baumannii: mechanisms of virulence and resistance. Int.
J. Antimicrob. Agents 2010, 35, 219−226.
(51) Quadri, L. E. Strategic paradigm shifts in the antimicrobial drug
discovery process of the 21st century. Infect. Disord. Drug Targets 2007,
7, 230−237.
(52) Frederick, R. E.; Mayfield, J. A.; DuBois, J. L. Iron trafficking as
an antimicrobial target. BioMetals 2009, 22, 583−593.
(53) Ballouche, M.; Cornelis, P.; Baysse, C. Iron metabolism: a
promising target for antibacterial strategies. Recent Pat. Anti-Infect.
Drug Discovery 2009, 4, 190−205.
(54) Cescau, S.; Cwerman, H.; Letoffe, S.; Delepelaire, P.;
Wandersman, C.; Biville, F. Heme acquisition by hemophores.
BioMetals 2007, 20, 603−613.
(55) Budzikiewicz, H. Microbial Siderophores; Spinger-Verlag: Vienna,
Austria, 2010; Vol. 92, p 75.
(56) Fischbach, M. A.; Walsh, C. T. Antibiotics for emerging
pathogens. Science 2009, 325, 1089−1093.
(57) Adler, C.; Corbalan, N. S.; Seyedsayamdost, M. R.; Pomares, M.
F.; de Cristobal, R. E.; Clardy, J.; Kolter, R.; Vincent, P. A. Catecholate
siderophores protect bacteria from pyochelin toxicity. PLoS One 2012,
7, e46754.
(58) Dorsey, C. W.; Tolmasky, M. E.; Crosa, J. H.; Actis, L. A.
Genetic organization of an Acinetobacter baumannii chromosomal
region harbouring genes related to siderophore biosynthesis and
transport. Microbiology 2003, 149, 1227−1238.
(59) Penwell, W. F.; Arivett, B. A.; Actis, L. A. The Acinetobacter
baumannii entA gene located outside the acinetobactin cluster is
critical for siderophore production, iron acquisition and virulence.
PLoS One 2012, 7, e36493.
(60) Gaddy, J. A.; Arivett, B. A.; McConnell, M. J.; Lopez-Rojas, R.;
Pachon, J.; Actis, L. A. Role of acinetobactin-mediated iron acquisition
functions in the interaction of Acinetobacter baumannii strain ATCC
19606T with human lung epithelial cells, Galleria mellonella
caterpillars, and mice. Infect. Immun. 2012, 80, 1015−1024.
(61) Eijkelkamp, B. A.; Hassan, K. A.; Paulsen, I. T.; Brown, M. H.
Investigation of the human pathogen Acinetobacter baumannii under
iron limiting conditions. BMC Genomics 2011, 12, 126.
(62) Antunes, L. C.; Imperi, F.; Towner, K. J.; Visca, P. Genome-
assisted identification of putative iron-utilization genes in Acinetobacter
baumannii and their distribution among a genotypically diverse
collection of clinical isolates. Res. Microbiol. 2011, 162, 279−284.
(63) Misra, R. N.; Rawlins, D. B.; Xiao, H. Y.; Shan, W. F.; Bursuker,
I.; Kellar, K. A.; Mulheron, J. G.; Sack, J. S.; Tokarski, J. S.; Kimball, S.
D.; Webster, K. R. 1H-Pyrazolo[3,4-b]pyridine inhibitors of cyclin-
dependent kinases. Bioorg. Med. Chem. Lett. 2003, 13, 1133−1136.
(64) Higgins, P. G.; Poirel, L.; Lehmann, M.; Nordmann, P.; Seifert,
H. OXA-143, a novel carbapenem-hydrolyzing class D beta-lactamase
in Acinetobacter baumannii. Antimicrob. Agents Chemother. 2009, 53,
5035−5038.
(33) Sikora, A. L.; Wilson, D. J.; Aldrich, C. C.; Blanchard, J. S.
Kinetic and inhibition studies of dihydroxybenzoate-AMP ligase from
Escherichia coli. Biochemistry 2010, 49, 3648−3657.
(34) Gulick, A. M. Conformational dynamics in the Acyl-CoA
synthetases, adenylation domains of non-ribosomal peptide synthe-
tases, and firefly luciferase. ACS Chem. Biol. 2009, 4, 811−827.
(35) Ferreras, J. A.; Ryu, J. S.; Di Lello, F.; Tan, D. S.; Quadri, L. E.
Small-molecule inhibition of siderophore biosynthesis in Mycobacte-
rium tuberculosis and Yersinia pestis. Nat. Chem. Biol. 2005, 1, 29−32.
(36) Somu, R. V.; Boshoff, H.; Qiao, C. H.; Bennett, E. M.; Barry, C.
E.; Aldrich, C. C. Rationally designed nucleoside antibiotics that
inhibit siderophore biosynthesis of Mycobacterium tuberculosis. J. Med.
Chem. 2006, 49, 31−34.
(37) Miethke, M.; Bisseret, P.; Beckering, C. L.; Vignard, D.;
Eustache, J.; Marahiel, M. A. Inhibition of aryl acid adenylation
domains involved in bacterial siderophore synthesis. FEBS J. 2006,
273, 409−419.
(38) Somu, R. V.; Wilson, D. J.; Bennett, E. M.; Boshoff, H. I.; Celia,
L.; Beck, B. J.; Barry, C. E.; Aldrich, C. C. Antitubercular nucleosides
that inhibit siderophore biosynthesis: SAR of the glycosyl domain. J.
Med. Chem. 2006, 49, 7623−7635.
(39) Neres, J.; Wilson, D. J.; Celia, L.; Beck, B. J.; Aldrich, C. C. Aryl
acid adenylating enzymes involved in siderophore biosynthesis:
fluorescence polarization assay, ligand specificity, and discovery of
non-nucleoside inhibitors via high-throughput screening. Biochemistry
2008, 47, 11735−11749.
(40) Hohn, H. Ein neue Verfahren zur Darstellung von 5-
Aminopyrazolen. Z. Chem. 1970, 10, 386−388.
(41) Dorn, H.; Muller, T. Zur direkten (C-4)-substitution von
̈
Amino-Pyrazolen mit β-keto-carbonyl-Verbindungen1-Benzyl-6, 7-
dihydro-4-ethoxycarbonyl-6-oxo-pyrazolo[3,4-b]pyridin. Z. Chem.
1980, 20, 95.
(42) Kang, F. A.; Sui, Z. H.; Murray, W. V. Pd-catalyzed direct
arylation of tautomerizable heterocycles with aryl boronic acids via C-
OH bond activation using phosphonium salts. J. Am. Chem. Soc. 2008,
130, 11300−11302.
(43) Wan, Z. K.; Wacharasindhu, S.; Levins, C. G.; Lin, M.; Tabei, K.;
Mansour, T. S. The scope and mechanism of phosphonium-mediated
S(N)Ar reactions in heterocyclic amides and ureas. J. Org. Chem. 2007,
72, 10194−10210.
(44) Gupte, A.; Boshoff, H. I.; Wilson, D. J.; Neres, J.; Labello, N. P.;
Somu, R. V.; Xing, C.; Barry, C. E.; Aldrich, C. C. Inhibition of
siderophore biosynthesis by 2-triazole substituted analogues of 5′-O-
[N-(salicyl)sulfamoyl]adenosine: antibacterial nucleosides effective
against Mycobacterium tuberculosis. J. Med. Chem. 2008, 51, 7495−
7507.
(45) Shi, C.; Aldrich, C. C. Efficient Pd-catalyzed coupling of
tautomerizable heterocycles with terminal alkynes via C-OH bond
activation using PyBroP. Org. Lett. 2010, 12, 2286−2289.
(46) Roehrl, M. H. A.; Wang, J. Y.; Wagner, G. A general framework
for development and data analysis of competitive high-throughput
screens for small-molecule inhibitors of protein−protein interactions
by fluorescence polarization. Biochemistry 2004, 43, 16056−16066.
(65) Choi, K. H.; Kumar, A.; Schweizer, H. P. A 10-min method for
preparation of highly electrocompetent Pseudomonas aeruginosa cells:
application for DNA fragment transfer between chromosomes and
plasmid transformation. J. Microbiol. Methods 2006, 64, 391−397.
2405
dx.doi.org/10.1021/jm301709s | J. Med. Chem. 2013, 56, 2385−2405