Chemical genetics-based discovery of indole derivatives as HCV NS5B polymerase inhibitors

Article abstract of DOI:10.1016/j.ejmech.2014.01.062

In order to identify the inhibitors of hepatitis C virus (HCV) replication with a novel scaffold via a mechanistically unbiased approach, we screened our in-house library composed of ～6000 compounds with various chemical structures by using the renilla lu

Full text of DOI:10.1016/j.ejmech.2014.01.062

European Journal of Medicinal Chemistry 75 (2014) 413e425
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Original article
Chemical genetics-based discovery of indole derivatives as HCV NS5B
polymerase inhibitors
,
,
Guanghai Jin a 1, Sungjin Lee a 1, Moonju Choi a, Seohyun Son a, Geon-Woo Kim b,
Jong-Won Oh b, Choongho Lee a , Kyeong Lee
,
a,
*
*
a College of Pharmacy, Dongguk University-Seoul, 410-820 Goyang, Republic of Korea
b Department of Biotechnology and Translational Research Center for Protein Function Control, Yonsei University, 120-749 Seoul, Republic of Korea
a r t i c l e i n f o
a b s t r a c t
Article history:
In order to identify the inhibitors of hepatitis C virus (HCV) replication with a novel scaffold via a
mechanistically unbiased approach, we screened our in-house library composed of w6000 compounds
with various chemical structures by using the renilla luciferase-linked genotype 2a reporter virus, and
we identified a series of compounds containing an indole moiety that were active against HCV repli-
cation. Based on this result, we further synthesized three groups of indole derivatives and evaluated their
inhibitory effects on HCV replication. In the present structureeactivity relationship study of these indole
derivatives, we discovered that compound 12e was the most potent inhibitor of HCV replication with
Received 17 July 2013
Received in revised form
24 January 2014
Accepted 30 January 2014
Available online 31 January 2014
Keywords:
Hepatitis C virus (HCV)
Chemical genetics
HCV replication inhibitors
Indole derivatives
Structureeactivity relationship (SAR) study
NS5B RNA polymerase inhibitor
minimal cytotoxicity (EC50 ¼ 1.1
m
M, EC90 ¼ 2.1
m
M, and CC50 ¼ 61.8
mM). We also confirmed that
compound 12e caused a dose- and time-dependent reduction of viral RNA as well as viral protein levels
in both genotype 2a J6/JFH1 RNA-transfected cells and genotype 1b Bart79I subgenomic replicon cells.
Finally, a genetic mapping study of mutant viruses resistant to compound 12e revealed that NS5B RNA
polymerase was the potential target. This finding was further validated by demonstration of inhibition of
NS5B RNA polymerase in vitro by compound 12e (IC50 ¼ 292 nM). Compound 12e may serve as a valuable
candidate for the development of a new class of HCV NS5B RNA polymerase inhibitors in the future.
Ó 2014 Elsevier Masson SAS. All rights reserved.
1. Introduction
(Telaprevir and Boceprevir), the current standard of care for HCV
infection still relies on combined treatment with pegylated inter-
Hepatitis C is an inflammatory liver disease caused by infection
of hepatocytes with a hepatotropic single-stranded RNA virus,
hepatitis C virus (HCV). Around 170 million people are estimated to
be infected with HCV worldwide [1]. Once infected, 70e80% of
HCV-positive carriers progress to chronic infection, and they have a
high risk of developing chronic liver diseases including liver
cirrhosis and hepatocellular carcinoma over the next 15e20 years
time period [2,3]. HCV infection is the leading cause of liver
transplantation in the United States, accounting for approximately
40e45% of all liver transplants [4]. Morbidity and mortality asso-
ciated with HCV infection is a great burden on the health care
system of affected countries. In spite of the improved antiviral ef-
ficacy of two recently approved NS3 protease inhibitor drugs
feron-a and ribavirin [5]. Therefore, their undesirable side effects
such as flu-like symptoms, anemia, depression, and suicidal
thoughts continue to occur in patients. In order to develop a more
effective and safer interferon-free regimen for treatment of HCV
infection in the future, a new class of anti-HCV therapeutics with a
novel mechanism of action is urgently needed.
HCV is a member of Flaviviridae family of viruses with a positive
single-stranded RNA as its viral genome. Following entry into a host
hepatocyte, an IRES (internal ribosome entry site)-dependent
translation of its RNA genome results in the formation of a
w3000 amino acid-long polyprotein, which is subsequently
cleaved into 10 individual viral proteins through host and virus
protease-mediated digestion [6,7]. While viral structural proteins
including E1, E2, and core constitute a mature virion, viral
nonstructural (NS) proteins including NS2, NS3, NS4A, NS4B, NS5A,
and NS5B form a functional replication complex in order to
generate copies of its own viral RNA genome [8e10]. Due to the
central role of HCV replication in the viral life cycle, it has been
regarded as an attractive target for designing antiviral inhibitors. A
* Corresponding authors.
E-mail addresses: choongholee@dongguk.edu (C. Lee), kaylee@dongguk.edu
(K. Lee).
1
These two authors contributed equally on this work.
0223-5234/$ e see front matter Ó 2014 Elsevier Masson SAS. All rights reserved.
http://dx.doi.org/10.1016/j.ejmech.2014.01.062

414
G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
variety of small molecules targeting non-structural viral proteins
that exert HCV replication-related functions including NS3 protease
[11]/helicase [12], NS4B [13,14], NS5A [15,16], and NS5B poly-
merases [17] are in various stages of clinical development.
(Carbethoxyethylidene)triphenylphosphorane to give the ethyl
ester, which was then hydrolyzed to provide the key intermediate,
5aej. Uronamide 6 was synthesized from carboxylic acid 5a by the
reaction with ammonium chloride in the presence of EDC/HOBt,
whereas compound 7 was synthesized by the reaction of carboxylic
acid 5a with methylamine in the presence of 50% PPAA. Addition-
ally, carboxylic acid 5a was further coupled with a variety of
amines, such as 4-tert-Butylaniline, 2-Furylmethanamine, 3-(1H-
Recently, an HCV NS5A inhibitor with a potent clinical effect was
identified by a group of researchers by using chemical genetics
strategy, and it is progressing successfully through the final stages
of clinical trials [18,19]. Using a chemical genetic approach, a large
number of compounds were first screened based on their effect on
HCV infection without any clue regarding the mechanism of action.
Then, mutant HCVs resistant to the identified compounds were
generated by taking advantage of the error-prone nature of the HCV
NS5B polymerase and analyzed to identify their potential viral
target by sequencing resistant mutant HCV genomes. Therefore,
unlike the conventional approach which needs to define the mo-
lecular targets like NS3 protease, helicase, and NS5B polymerase in
the first place, a chemical genetics approach is free from target
identification and can identify other unexplored viral or host tar-
gets as long as they are essential components of HCV life cycle.
Discovery of an HCV NS5A inhibitor by a chemical genetics strategy
proves the usefulness and applicability of this bias-free approach.
In order to identify a new chemical scaffold that is a suitable
template for obtaining anti-HCV agents targeting HCV replication
via a mechanistically unbiased chemical genetics approach, we
screened our in-house library composed of w 6000 compounds by
using the renilla luciferase-linked genotype 2a J6/JFH1 reporter
virus and identified a series of compounds containing an indole
structure that were inhibitors of HCV replication (Fig. 1). After
synthesis and evaluation of three structurally different groups of
indole derivatives, we discovered that (E)-N-(4-tert-Butylphenyl)-
3-(5-cyano-1H-indole-3-yl)-2-methylacrylamide (12e) was the
most potent inhibitor of HCV replication with minimal cytotoxicity.
Finally, a genetic mapping study of mutant viruses resistant to
compound 12e demonstrated that the NS5B RNA polymerase was
the potential target, and this finding was further validated by
demonstration of inhibition of NS5B RNA polymerase in vitro by
compound 12e. Here, we present the chemical and anti-viral data of
compound 12e, and we propose that compound 12e is a valuable
candidate for the development of a new class of HCV replication
inhibitors in the future.
Imidazol-1-yl)-1-propanamine,
N1,N1-Dimethyl-1,2-
ethylenediamine, and 4-(Trifluoromethyl)aniline, in the presence
of HBTU/DIPEA to give the amide derivatives 8e11, and 12a.
Substituted indole 2-methylacrylamide analogs 12bej, 13, and 14
were also prepared from acid 5bej in a similar fashion as shown in
Scheme 2.
2.2. Biological evaluation studies
Huh7.5 hepatocarcinoma cells, which were transfected with
renilla luciferase-linked J6/JFH1 RNAs (Huh7.5/Rluc-J6/JFH1), were
used for library screening [20]. The luciferase activity was used as a
surrogate measure for HCV RNA replication levels. A total of w6000
compounds with various chemical structures from our in-house
synthetic library were first tested at a single concentration of
10
mM for 72 h with clemizole, which is an NS4B inhibitor with an
EC50 of 8
mM, as a positive control [21]. An MTT-based cell viability
assay was also conducted in parallel to rule out cytotoxicity-
induced anti-viral effects. Among the tested compounds, com-
pound 2a, an indole acrylamide consistently produced the highest
ratio of 28.6 of cell viability (60.1%) to HCV replication (2.1%) at a
concentration of 10 mM compared to DMSO (Table 1). Then, the
structurally related compounds 2bee from our chemical library
were selected for a doseeresponse study. The concentration of the
compound that inhibits virus replication by 50% (EC50) as well as
the concentration of the compound that reduces host cell viability
by 50% (CC50) were derived from the doseeresponse curves. These
values in turn allowed us to calculate the selectivity index
(SI ¼ CC50/EC50), a measure for the therapeutic potential of the
compound in the assay system. As shown in Table 2, we first
examined the effects of amide portion by comparing compounds
2aee, which corresponded to N-(4-tert-Butylphenyl), N-Isopropyl,
N-(3,4-Dimethoxybenzyl), N,N-Diethyl, or substituted piperazine
moiety, respectively. While compounds 2b and 2d exhibited poor
inhibition ability against HCV replication and cytotoxicity, com-
pounds 2c and 2e showed moderate inhibitory activity
2. Results and discussion
2.1. Chemistry
(EC50 ¼ 12.9
mM and 15.6 mM, respectively). It was observed that
compound 2c was much less cytotoxic than compound 2a, and thus
showed a slightly better selectivity index (6.9 vs. 5.2) (Table 2). It
was noted that acrylamides derived from primary amines exhibited
a better ability to inhibit HCV replication, as shown by compounds
2aec, than amides derived from secondary amines (compounds
A series of indole acrylamide analogs were synthesized as out-
lined in Schemes 1 and 2 trans-3-Indole acrylic acid or 3-
Indolepropionic acid was coupled with a variety of amines using
HBTU/DIPEA to provide the corresponding amide derivatives, 2aef
(Scheme 1). The amines included 4-tert-Butylaniline, 3,4-
Dimethoxybenzylamine, Isopropylamine, Diethylamine, and 1-[4-
(Trifluoromethyl)benzyl]piperazine. For preparation of Indole 2-
methylacrylamide analogs, various indole aldehydes were used as
starting materials for the Wittig reaction. As shown in Scheme 2,
2dee). The propanamide compound 2f (CC50 ¼ 13.6
similar cytotoxicity with compound 2a, but showed a little less
M) than the cor-
mM) exhibited
potent inhibition of HCV replication (EC50 ¼ 6.1
m
responding acrylamide 2a. Overall, compound 2a containing the N-
(4-tert-Butylphenyl) group, displaying the highest ability to inhibit
the
substituted
aldehyde,
3aej
was
reacted
with
HCV replication and showing moderate cytotoxicity (EC50 ¼ 1.9
mM,
CC50 ¼ 10.1 M, and SI ¼ 5.2) among the tested compounds was
m
chosen as a hit compound for the following structureeactivity
relationship (SAR) study.
O
We then synthesized indole 2-methylacrylate analogs for
further study as listed in Table 2. N-(4-tert-Butylphenyl) derivative,
compound 12a, exhibiting an extra methyl group in the double
R2
R
R1
N
H
bond portion, was found to show a similar activity (EC50 ¼ 2.2
mM)
against HCV replication as that of its acrylamide version, compound
Fig. 1. Structure of the indole acrylamide derivative.
2a. Of interest, compound 12a exhibited lower cytotoxicity

G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
415
O
O
a
OH
R
N
H
N
H
2a-f
1a = double bond
1b = single bond
OCH3
OCH3
2b: R =
2e: R =
2a: R =
, double bond
2c: R =
N
H
, double bond
CF3
N
, double bond
N
H
H
N
2d: R =
N
, double bond
, single bond
N
, double bond 2f: R =
N
H
Scheme 1. Reagents and Conditions: a) Amine, HBTU, DIPEA, DMF, CH2Cl2.
(CC50 ¼ 17.3
m
M) than compound 2a, indicating that compound 12a
similar selectivity index within the range 5.5e5.7. It was interesting
to note that the 6-isopropyl indole analog, compound 12i
has a better selectivity index (SI ¼ 7.9). In order to define phar-
macophore requirements for HCV replication inhibition, we further
explored the amide part of compound 12a by replacing ester, acid
or amide with different amines. Ester 4a and carboxylic acid 5a
exhibited poor inhibition, suggesting the importance of the amide
(EC50 ¼ 1.5
m
M, CC50 ¼ 24.8 M, and SI ¼ 17) showed a better activity
m
profile than the corresponding 6-methyl indole analog, compound
12g, suggesting the importance of the presence of a lipophilic group
at the 6-position. It was particularly noteworthy that the 5-cyano
indole analog, compound 12e was found to have a significantly
enhanced inhibitory activity against HCV and cytotoxicity among
group.
Trifluoromethylphenyl) derivative, compound 8 containing an
electronegative trifluoromethyl group showed markedly
decreased inhibitory activity. Compounds 9-11, linked through one
carbon (EC50 ¼ 11.3 M), two carbon (EC50 ¼ 64.2 M) and three
carbon chains (EC50 ¼ 33.7 M) in the amide portion, respectively,
In
comparison
to
compound
12a,
N-(4-
a
the series (EC50 ¼ 1.1
When Rluc-J6/JFH1 RNA-transfected cells were treated with com-
pound 12e at a concentration of 10 M for different time periods, the
m
M, CC50 ¼ 61.8 M, and SI ¼ 56.9) (Fig. 2A).
m
m
m
m
m
length of time required for reducing the luciferase activity by half
(T1/2) was 16.4 h (Fig. 2A). On the other hand, although compounds
12c and 12feh showed good inhibitory activity against HCV repli-
cation and compound 12j was better than compound 12e in terms of
cytotoxicity, compound 12e was the best in terms of the selectivity
index. By retaining the indole ring at the 5-CN substitution and by
changing the para position of the amide group on the benzene ring
with that of methyl or isopropyl groups, compounds 13 and 14
caused a marked decrease in HCV replication activity; however,
compound 14 exhibited good cytotoxicity. The impact of modifica-
tion of the indole 2-methylacrylamide derivatives is interesting in
the light of the results of the SAR study, which suggests that double
bond methylation or amide group at this position is optimal for
inhibition of HCV replication. Further derivatization mostly resulted
in a significant loss of activity.
demonstrated moderate to poor ability to inhibit HCV replication.
Based on the leading compound 12a, we synthesized a series of
substituted indole derivatives for a further structureeactivity rela-
tionship study (Table 3). Modification of the indole ring by substi-
tution at 4, 5 or 6 positionyielded compounds 12bej,13 and 14, with
retention of the 2-methylacryl and N-(4-tert-Butylphenyl) amide
portions. Among the methoxy indole analogs, 5-OMe indole deriv-
ative, compound 12d exhibited the most potent inhibition of HCV
replication (EC50 ¼ 3.0
compound 12b or the 6-OMe indole derivative, compound 12h
M and 8.8 M, respectively); however, compound 12d
mM) than the 4-OMe indole derivative,
(EC50 ¼ 17.6
m
m
exhibited less potent inhibition of HCV replication than compound
12a. In the case of methyl substituted indole analogs, it was found
that the 6-substituted indole analog, compound 12g (EC50 ¼ 4.5
mM)
showed a slightly better ability to inhibit HCV replication than the 5-
In order to rule out any artificial effects of the inserted renilla
luciferase on HCV replication, we decided to test the effect of
substituted indole analog, compound 12c (EC50 ¼ 6.7
mM) with a
R3
O
O
O
O
b
d
N
H
R2
H
a
OEt
R
R
R
R
N
N
H
N
H
N
H
H
12a-j: R3 = C(Me)3
4a-j
3a-j
5a-j: R2 = OH
13: R = 5-CN, R3 = Me
c
R =
14
: R = 5-CN, R3 = CH(Me)2
a: H, b:4-OMe, c:5-Me, d: 5-OMe
e: 5-CN, f: 5-NO2, g:6-Me, h: 6-OMe
i: 6-Isopropyl, j: 6-Br
6-11: R2
=
NH2
NHMe
NH
CF3
O
NHCH2
NHCH2CH2NMe2
NHCH2CH2CH2
N
N
Scheme 2. Reagents and Conditions: a) (Carbethoxyethylidene)triphenylphosphorane, CH2Cl2 or Toluene; b) For compounds 5aee and 5gej, NaOH, EtOH or MeOH, THF, H2O; For
compound 5f, LiOH, MeOH, THF, H2O; c) For compounds 6, 5a, NH4Cl, EDC, HOBt, DIPEA, DMF; For compounds 7, 5a, CH3NH2$HCl, PPAA, TEA, CH3CN; For compounds 8-11, Amine,
HBTU, DIPEA, DMF, CH2Cl2; d) For compounds 12aej, 5aej, 4-tert-Butylaniline, HBTU, DIPEA, DMF, CH2Cl2; For compounds 13, 5e, p-Toluidine, HBTU, DIPEA, DMF, CH2Cl2; For
compounds 14, 5e, 4-Isopropylaniline, HBTU, DIPEA, DMF, CH2Cl2.

416
G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
Table 1
viral protein levels. For this purpose, J6/JFH1 RNA-transfected Huh7.5
cells were treated with increasing concentrations of compound 12e
Structureeactivity relationships of trans-3-indole acrylate derivatives at a concen-
tration of 10 M.
m
for 120 h. Then, levels of viral core as well as host
were quantitated by Western blot analyses. As shown in Fig. 3A,
similar EC50 as well as T1/2 values (2.0 M and 19.6 h, respectively)
b-actin proteins
O
R2
R
m
R1
N
H
were determined by this protein stability-based method when
compared with those determined by the RNA stability-based method
(1.9 mM and 17.2 h, respectively). When Huh7.5 cells stably main-
Code no.
Structure
HCV
Cell
Cell
taining genotype 1b subgenomic Bart79I RNAs were used to assess
the dose- and time-dependent effects of compound 12e on viral
protein levels, a relatively longer time was necessary to reduce HCV
NS5A protein levels by half (T1/2 ¼ 31.7 h) in spite of a comparable
replication viability viability/HCV
(%)
R
R1 R2
(%)
replication
2a
2b
H
H
H
2.1
60.1
28.6
N
Table 2
H
Structureeactivity relationships of trans-3-indole acrylate derivatives.
O
H
69.0
106.5
1.5
R2
N
H
R1
N
H
2c
H
H
H
H
35.1
72.0
92.2
93.8
2.6
1.3
Code no. Structure
Anti-HCV Cytotoxicity Selectivity
(EC50,
mM) (CC50,
m
M) index
(CC50/EC50)
N
2d
R1 R2
Bond
H
N
2e
H
H
32.4
23.4
81.7
2.5
4.3
2a
2b
H
H
Double
1.9
10.1
5.2
Clemizole [21] N/A N/A N/A
102.1
Double 93.8
>100
>1.1
N
H
compound 12e on the reporter virus-free genotype 2a infectious
clone system (J6/JFH1). For this purpose, first the in vitro-tran-
scribed J6/JFH1 RNAs were transfected into Huh7.5 cells. After 7
days, these cells were treated with a series of increasing concen-
trations of compound 12e for 72 h. Then, the viral as well as host
GAPDH RNA levels were quantitated by a real-time RT PCR analysis.
2c
H
H
Double 12.9
Double 62.7
89.5
98.7
6.9
1.6
N
2d
As shown in Fig. 2B, a similar EC50 value (1.9
mM) was observed in
this system compared with the one (1.1 M) measured previously
using the renilla luciferase-linked reporter virus. In addition, when
J6/JFH1 RNA-transfected cells were treated with a concentration of
m
2e
2f
H
H
Double 15.6
27.9
1.8
2.3
H
N
10 mM for different time periods to determine the length of time
Single
6.1
13.6
25.3
required for reducing HCV RNA levels by half (T1/2), similar kinetic
profiles were observed (T1/2 ¼ 17.2 h in the reporter virus-free ge-
notype 2a infectious clone system (J6/JFH1) vs. T1/2 ¼ 16.4 h in the
renilla luciferase-linked reporter virus system (Rluc-J6/JFH1))
(Fig. 2B). Therefore, we concluded that compound 12e exhibits
comparable antiviral potencies in both systems.
We also wished to test the inhibitory activity of compound 12e
against the clinically more relevant genotype 1b HCV to see if
compound 12e has any cross-genotype antiviral activity. For this
purpose, we used a Bart79I subgenomic replicon system in which
genotype 1b HCV RNAs encoding only the non-structural compo-
nents of stably replicating viral genes under selection pressure of
G418 due to expression of a neomycin phosphotransferase gene
inserted in front of HCV genes. In this system, compound 12e
showed a 3.2-fold higher potency against HCV replication activity
4a
5a
6
Me OEt
Double 22.2
Double >10
Double >10
Double >10
1.1
N/A
N/A
N/A
Me OH
>100
Me NH2
Me NHCH3
>10
>10
7
H
N
F
F
8
Me
Double 43.6
94.9
2.2
F
O
N
9
Me
Double 11.3
Double 64.2
Double 33.7
39.1
3.5
>1.6
>3.0
H
(EC50 ¼ 0.6
m
M) than that in the genotype 2a infectious clone
N
10
11
12a
Me
>100
N
system (EC50 ¼ 1.9
mM); however, compound 12e needed a 1.8-fold
H
longer time period for reducing HCV RNA levels by half (T1/
¼ 31.5 h) than in the genotype 2a infectious clone system (T1/
2
N
N
Me
>100
N
H
¼ 17.2 h) (Fig. 2C). Nonetheless, these data demonstrated the
2
cross-genotype potency of compound 12e against both genotype 1b
and genotype 2a HCV replicons.
H
N
Me
Double
N/A
2.2
8.2
17.3
7.9
4.4
After confirming suppression of HCV replication by compound
12e at the RNA level, we wished to see if this compound 12e-induced
inhibition of HCV replication can also lead to down-regulation of
Clemizole N/A N/A
36.4

G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
417
Table 3
(1.03 mM), suggesting gain of function mutations that confer resis-
Structureeactivity relationships of indole 2-methylacrylamide analogs.
tance against compound 12e (Fig. 4A). Then, total RNAs were
extracted from these colonies, and the entire HCV coding region was
reverse-transcribed, amplified, and sequenced. Several mutations
were identified within the NS5B-encoding region in the resistant
colonies, while no mutations were observed in the untreated repli-
con cells grown in parallel. In particular, all of the variant residues
conferring resistance to compound 12e were located outside of the
known active site of NS5B (Fig. S3). Therefore, we concluded that
compound 12e would block the RNA-dependent RNA polymerase
(RdRp) activity of NS5B via an allosteric inhibitory mechanism.
Based on the previous genetic evidence, we hypothesized that
compound 12e would suppress HCV replication by inhibiting the
RdRp activity of NS5B. In order to test our hypothesis, anti-NS5B
RdRp activity of compound 12e was evaluated by the standard
primer-dependent elongation reaction using poly rA/U12 template-
primer and recombinant HCV NS5B according to previously
described procedures [22]. As shown in Fig. 4B, treatment with
compound 12e at a concentration of 292 nM was able to reduce RdRp
activity of NS5B by half.
O
R2
R
1
N
H
Code no
Structure
Anti-HCV
Cytotoxicity Selectivity
M) index
(CC50/EC50)
(EC50, M) (CC50,
m
m
R1
R2
H
N
12b
12c
12d
12e
12f
12g
12h
12i
4-OMe
5-Me
17.6
6.7
3.0
1.1
6.2
4.5
8.8
1.5
13.0
34.1
28.1
16.4
61.8
23.1
25.6
30.7
24.8
68.8
1.9
4.2
H
N
H
N
5-OMe
5-CN
5.5
H
N
3. Conclusion
56.9
3.7
We have identified a new series of indole acrylamide derivatives
as potential HCV replication inhibitors. Among the synthesized
compounds, compound 12e exhibited the highest antiviral activity in
a cell-based J6/JFH1 reporter assay using Huh7.5 cells. Compound
12e also exhibited a strong inhibitory effect on HCV replication as
well as expression levels of viral proteins in a dose- and time-
dependent manner. The current work provides a valuable platform
for the development of a new class of small molecule inhibitors
targeting the HCV NS5B RNA polymerase in the future.
H
N
5-NO2
6-Me
H
N
5.7
H
N
6-OMe
6-Isopropyl
6-Br
3.5
H
N
4. Experimental section
17.0
5.3
4.1. Chemistry
H
N
4.1.1. General procedure
12j
All of the commercial chemicals were of reagent grade and were
used without further purification. Solvents were dried with stan-
dard procedures. All of the reactions were carried out under an
atmosphere of dry argon in flame-dried glassware. Melting points
were determined on Fisher Scientific (CAT No.: 12-144). The proton
nuclear magnetic resonance (1H NMR) spectra and carbon nuclear
magnetic resonance (13C NMR) spectra were determined on a
Varian (400 MHz) or a Bruker (500 MHz) spectrometer. The
chemical shifts are expressed in parts per million (ppm) downfield
with coupling constants expressed in hertz (Hz). HRMS (EI-MS)
were recorded on a JMS-700 (Jeol, Japan) and HRMS (ESI-MS) were
recorded on a Waters, Xevo, G2, QTof (USA). The products from all
of the reactions were purified by flash column chromatography
using silica gel 60 (230e400 mesh Kieselgel 60) or by preparative
thin layer chromatography using glass-backed silica gel plates
(1 mm in thickness), unless otherwise indicated. Additionally, thin-
layer chromatography on 0.25 mm silica plates (E. Merck, silica gel
60 F254) was used to monitor the progress of reactions. The
chromatograms were visualized using ultraviolet illumination,
exposure to iodine vapors, and staining with PMA or Hanessian’s
solution. The purity of the final products was checked by reversed
phase high-pressure liquid chromatography (RP-HPLC), which was
performed on a Waters Corp. HPLC system equipped with a UV
detector set at 254 nm. The mobile phases used were (A) H2O
containing 0.05% TFA, and (B) CH3CN. The HPLC system consisted of
H
N
13
14
5-CN
5-CN
>100
>100
N/A
H
N
37.7
8.0
137
3.6
4.9
Clemizole N/A
N/A
39.4
antiviral potency (EC50 ¼ 2.5
mM) (Fig. 3B). The Bart79I-YFP HCV
replicon is the same as the Bart79I replicon except that a yellow
fluorescent protein (YFP) is inserted in the middle of NS5A. There-
fore, the fluorescence intensity could be used as the indirect measure
of NS5A protein levels. By performing FACS analysis using Bart79I-
YFP replicon cells, we were also able to confirm the inhibitory ac-
tivity of compound 12e against HCV replication in a dose- and time-
dependent manner (EC50 ¼ 1.03 M and T1/2 ¼ 31.8 h) (Fig. 3C).
m
In order to determine the mechanism of action of compound 12e,
we first sought to obtain genetic evidence that compound 12e might
interact with HCV viral non-structural proteins. Therefore, we
decided to select compound 12e-resistant mutant viruses. For this
purpose, genotype 1b Bart79I subgenomic replicon cells were grown
in the presence of 5 mM of compound 12e for 4 weeks, and resistant
colonies were isolated and propagated. Among them, one repre-
sentative cell line showed an approximately 4.6-fold increased EC50
an YMC Hydrosphere C18 (HS-302) column (5
m particle size, 12 nm
value (4.77 mM) compared with that of parental replicon cell line
pore size) that was 4.6 mm in diameter ꢀ 150 mm in size with a

418
G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
Fig. 2. Effect of compound 12e on HCV replication. (A) A doseeresponse curve was determined by measuring relative cell viabilities as well as luciferase activities in Rluc-J6/JFH1
RNA-transfected Huh7.5 cells treated with increasing concentrations of compound 12e for 72 h. A time-response curve was determined by measuring relative cell viabilities as well
as luciferase activities in Rluc-J6/JFH1 RNA-transfected Huh7.5 cells treated with 10 mM of compound 12e for increasing periods of time. (B) A doseeresponse graph was determined
by measuring relative HCV as well as GAPDH RNA levels via real time qRT-PCR analysis of J6/JFH1 RNA-transfected Huh7.5 cells treated with increasing concentrations of compound
12e for 72 h. A time-response graph was determined by measuring relative HCV as well as GAPDH RNA levels via real time qRT-PCR analysis of J6/JFH1 RNA-transfected Huh7.5 cells
treated with 10
qRT-PCR analysis of Bart79I RNA-transfected Huh7.5 cells treated with increasing concentrations of compound 12e for 72 h. A time-response graph was determined by measuring
relative HCV as well as GAPDH RNA levels via real time qRT-PCR analysis of Bart79I RNA replicon Huh7.5 cells treated with 10 M of compound 12e for increasing periods of time.
Average values from triplicate experiments are depicted. EC50 and T1/2 values were determined based on each response curve. Error bars represent standard deviation values.
mM of compound 12e for increasing periods of time. (C) A doseeresponse graph was determined by measuring relative HCV well as GAPDH RNA levels via real time
m
flow rate of 1.0 mL/min. The compound purity was assessed using
gradient 25% B to 100% B in 35 min.
added and stirred overnight at RT. The excess solvent was evapo-
rated and then diluted with water and EtOAc, and the two layers
were separated. The aqueous solution was extracted with EtOAc.
The combined organic solution was washed with water and brine,
dried over magnesium sulfate, and filtered. The residue was puri-
fied by column chromatography on silica gel using 0e60% EtOAc in
Hexanes as eluant to give the desired products 2ae2f.
4.1.2. General procedure for the coupling reaction for synthesis of
compounds 2ae2f
The round-bottom flask was charged with trans-Indole-3-acrylic
acid (1.0 equiv.) or 3-Indolepropionic acid (1.0 equiv.) and the
resulting mixture of DMF in CH2Cl2 (v:v, 1:3). DIPEA (1.5 equiv.)
followed by HBTU (1.5 equiv.) were added to the solution. After
stirring at room temperature for 30 min, amine (1.0 equiv.) was
4.1.2.1. (E)-N-(4-tert-butylphenyl)-3-(1H-indol-3-yl)acrylamide (2a).
Yellow solid, yield 87%. Mp 285e286 ꢁC; 1H NMR (CD3OD,

G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
419
Fig. 3. Effect of compound 12e on levels of HCV proteins. (A) A doseeresponse was determined by measuring relative levels of HCV core as well as host
b-actin proteins via Western blot
analyses of J6/JFH1 RNA-transfected Huh7.5 cells treated with increasing concentrations of compound 12e for 120 h. A time-response was determined by measuring relative levels of HCV
core as well as host -actin proteins via Western blot analyses of J6/JFH1 RNA-transfected Huh7.5 cells treated with 10 M of compound 12e for increasing periods of time. (B) A dosee
response was determined by measuring relative levels of HCV NS5A as well as host -actin proteins via Western blot analyses of Bart79I replicon Huh7.5 cells treated with increasing
concentrations of compound 12e for 120 h. A time-response was determined by measuring relative levels of HCV NS5A as well as host -actin proteins via Western blot analyses of Bart79I
replicon Huh7.5 cells treated with 10 M of compound 12e for increasing periods of time. Numbers below -actin blots represent relative quantitation of intensity of viral protein after
normalization to levels of -actin proteins. (C) A doseeresponse was determined by measuring relative percentages of HCV NS5A-YFP-positive cells via FACS of Bart79I-YFP replicon Huh7.5
cells treated with increasing concentrations of compound 12e for 120 h. A time-response curve was determined by measuring relative levels of HCV NS5A-YFP-positive cells via FACS of
Bart79I-YFP replicon Huh7.5 cells treated with 10 M of compound 12e for increasing periods of time. EC50 and T1/2 values were determined based on each response curve.
b
m
b
b
m
b
b
m

420
G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
Fig. 4. Development of mutant HCVs resistant to compound 12e and suppression of the NS5B RdRp activity by compound 12e (A) Effect of compound 12e on wild type or compound
12e-resistant HCV replicons. A doseeresponse graph was determined by measuring relative HCV as well as GAPDH RNA levels via real time qRT-PCR analysis of either wild type or
compound 12e-resistant Bart79I replicon-containing Huh7.5 cells treated with increasing concentrations of compound 12e for 72 h. EC50 values were determined based on each
response curve. (B) Inhibition of the NS5B RdRp activity by compound 12e. In vitro RdRp activity of NS5B was measured in the presence of compound 12e at increasing con-
centrations. IC50 value was determined based on each response curve.
500 MHz)
d
7.96 (d, J ¼ 7.4 Hz, 1H), 7.88 (d, J ¼ 15.6 Hz, 1H), 7.61 (s,
4.1.2.4. (E)-N,N-diethyl-3-(1H-indol-3-yl)acrylamide
(2d).
1H), 7.57 (d, J ¼ 8.5 Hz, 2H), 7.44 (d, J ¼ 7.4 Hz, 1H), 7.36 (d,
Yellow solid, yield 23%. Mp 125e126 ꢁC; 1H NMR (CD3OD, 500 MHz)
J ¼ 8.6 Hz, 2H), 7.17e7.23 (m, 2H), 6.77 (d, J ¼ 15.6 Hz, 1H), 1.31 (s,
d
7.87 (d, J ¼ 15.3 Hz, 1H), 7.82 (d, J ¼ 7.1 Hz, 1H), 7.64 (s, 1H), 7.42 (d,
9H); 13C NMR (CD3OD, 100 MHz)
d
168.56, 147.94, 139.29, 137.81,
J ¼ 7.4 Hz, 1H), 7.16e7.21 (m, 2H), 6.88 (d, J ¼ 15.3 Hz, 1H), 3.60 (q,
J ¼ 7.0 Hz, 2H), 3.50 (q, J ¼ 6.9 Hz, 2H), 1.32 (t, J ¼ 6.6 Hz, 3H), 1.19 (t,
137.14, 131.31, 126.68, 126.64, 123.72, 121.88, 121.18, 120.93, 116.16,
114.19, 113.11, 35.23, 31.86; MS (EI) m/z 318 (Mþ); HRMS (EI) m/z
calcd for C21H22N2O 318.1732, found: 318.1732; Purity > 99.9% (as
determined by RP-HPLC, tR ¼ 17.5 min).
J ¼ 6.7 Hz, 3H); 13C NMR (CD3OD, 100 MHz)
d 168.08, 137.73, 136.99,
129.42, 125.31, 122.22, 120.45, 119.25, 112.82, 111.67, 110.69, 42.29,
41.02, 13.70, 12.17; MS (EI) m/z 242 (Mþ); HRMS (EI) m/z calcd for
C15H18N2O 242.1419, found: 242.1420; Purity > 99.9% (as deter-
mined by RP-HPLC, tR ¼ 10.2 min).
4.1.2.2. (E)-3-(1H-indol-3-yl)-N-isopropylacrylamide
Yellow solid, yield 51%. Mp 208e209 ꢁC; 1H NMR (CD3OD,
500 MHz)
(2b).
d
7.88 (d, J ¼ 7.8 Hz, 1H), 7.74 (d, J ¼ 15.7 Hz, 1H), 7.55 (s,
4.1.2.5. (E)-3-(1H-indol-3-yl)-1-{4-[4-(trifluoromethyl)benzyl]piper-
azin-1-yl}prop-2-en-1-one (2e). Yellow solid, yield 78%. Mp 95e
1H), 7.40 (d, J ¼ 7.8 Hz, 1H), 7.13e7.20 (m, 2H), 6.56 (d, J ¼ 15.7 Hz,
1H), 4.08e4.13 (m, 1H), 1.20 (d, J ¼ 6.6 Hz, 6H); 13C NMR (CD3OD,
96 ꢁC; 1H NMR (CD3OD, 500 MHz)
d
7.89 (d, J ¼ 7.8 Hz, 1H), 7.82 (d,
100 MHz)
d 169.53, 139.21, 135.88, 130.65, 126.69, 123.59, 121.70,
J ¼ 15.7 Hz, 1H), 7.63 (d, J ¼ 8.2 Hz, 2H), 7.58 (s, 1H), 7.52 (d,
J ¼ 8.1 Hz, 1H), 7.41 (d, J ¼ 7.8 Hz, 1H), 7.14e7.21 (m, 2H), 6.64 (d,
J ¼ 15.7 Hz, 1H), 4.59 (s, 2H); MS (EI) m/z 413 (Mþ); HRMS (EI) m/z
calcd for C23H22F3N3O 413.1715, found: 413.1714; Purity > 99.9% (as
determined by RP-HPLC, tR ¼ 14.1 min).
121.07, 116.21, 114.02, 113.02, 42.46, 30.93; MS (EI) m/z 228 (Mþ);
HRMS (EI) m/z calcd for C14H16N2O 228.1263, found: 228.1263;
Purity > 99.9% (as determined by RP-HPLC, tR ¼ 8.4 min).
4.1.2.3. (E)-N-(3,4-dimethoxybenzyl)-3-(1H-indol-3-yl)acrylamide
(2c). Yellow solid, yield 81%. Mp 98e99 ꢁC; 1H NMR (CD3OD,
500 MHz)
d
8.00 (s, 1H), 7.92 (d, J ¼ 5.0 Hz, 1H), 7.80 (d, J ¼ 15.5 Hz,
4.1.2.6. N-(4-tert-butylphenyl)-3-(1H-indol-3-yl)propanamide (2f).
Pale yellow solid, yield 96%. Mp 136e137 ꢁC; 1H NMR (CD3OD,
1H), 7.59 (s, 1H), 7.43 (d, J ¼ 8.0 Hz, 1H), 7.15e7.22 (m, 4H), 6.66 (d,
J ¼ 16.0 Hz, 1H), 6.57 (d, J ¼ 2.0 Hz, 1H), 6.51 (dd, J ¼ 2.5 Hz, 8.0 Hz,
1H), 4.45 (s, 2H), 3.01 (s, 3H), 2.88 (s, 3H); 13C NMR (CD3OD,
400 MHz)
d
7.59 (d, J ¼ 8.4 Hz, 1H), 7.38e7.41 (m, 2H), 7.30e7.32 (m,
3H), 7.06e7.09 (m, 2H), 6.99 (t, J ¼ 7.2 Hz,1H), 3.14 (t, J ¼ 7.6 Hz, 2H),
100 MHz)
d 170.33, 162.08, 159.92, 139.20, 136.12, 130.82, 130.72,
2.72 (t, J ¼ 7.6 Hz, 2H), 1.29 (s, 9H); 13C NMR (CD3OD, 100 MHz)
126.71, 123.59, 121.72, 121.13, 120.01, 115.91, 114.06, 112.99, 105.26,
99.29, 55.89, 55.80, 39.42; MS (EI) m/z 336 (Mþ); HRMS (EI) m/z
calcd for C20H20N2O3 336.1474, found: 336.1472; Purity > 99.9% (as
determined by RP-HPLC, tR ¼ 11.9 min).
d 174.37, 148.21, 138.19, 137.19, 128.58, 126.53, 123.02, 122.33,121.27,
119.57, 119.35, 115.09, 112.20, 35.20, 31.83; HRMS (ESI) m/z calcd for
C
21H25N2O [(M þ H)þ] 321.1967, found: 321.1962; Purity > 99.9% (as
determined by RP-HPLC, tR ¼ 19.5 min).

G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
421
4.1.3. General procedure for the Wittig reaction
4.1.3.9. (E)-ethyl 3-(6-isopropyl-1H-indol-3-yl)-2-methylacrylate
(4i). White solid, yield 71%. 1H NMR (CDCl3, 500 MHz)
8.35
(brs, 1H), 8.02 (s, 1H), 7.73 (d, J ¼ 8.0 Hz, 1H), 7.44 (d, J ¼ 2.5 Hz, 1H),
7.13 (dd, J ¼ 1.5 Hz, 8.5 Hz,1H), 4.29 (q, J ¼ 7.0 Hz, 2H), 3.01e3.05 (m,
1H), 2.18 (t, J ¼ 1.0 Hz, 3H), 1.37 (t, J ¼ 7.0 Hz, 3H), 1.32 (d, J ¼ 7.0 Hz,
6H); MS (EI) m/z 271 (Mþ).
The mixture of indole aldehyde (1.0 equiv.) and (Carbethox-
yethylidene)triphenylphosphorane (1.3 equiv.) was dissolved in
CH2Cl2 or Toluene. The reaction solution was refluxed for 18 h and
the excess solvent was evaporated under reduced pressure. The
residue was purified by column chromatography on silica gel using
0e40% EtOAc in Hexanes as eluant to give the desired products 4ae
4j.
d
4.1.3.10. (E)-ethyl 3-(6-bromo-1H-indol-3-yl)-2-methylacrylate (4j).
White solid, yield 82%. 1H NMR (CDCl3, 500 MHz)
d 8.49 (brs, 1H),
7.95 (s, 1H), 7.67 (d, J ¼ 8.5 Hz, 1H), 7.57 (d, J ¼ 1.0 Hz, 1H), 7.47 (d,
J ¼ 2.5 Hz, 1H), 7.33 (dd, J ¼ 1.5 Hz, 8.5 Hz, 1H), 4.30 (q, J ¼ 7.0 Hz,
2H), 2.18 (s, 3H), 1.37 (t, J ¼ 7.0 Hz, 3H); MS (EI) m/z 308 (Mþ).
4.1.3.1. (E)-ethyl
3-(1H-indol-3-yl)-2-methylacrylate
(4a).
White solid, yield 65%. Mp 138e139 ꢁC; 1H NMR (CDCl3, 500 MHz)
d
8.50 (brs, 1H), 8.05 (s, 1H), 7.83 (d, J ¼ 7.8 Hz, 1H), 7.51 (d,
J ¼ 2.4 Hz, 1H), 7.42 (d, J ¼ 8.0 Hz, 1H), 7.22e7.30 (m, 2H), 4.31 (q,
J ¼ 7.1 Hz, 2H), 1.38 (t, J ¼ 7.1 Hz, 3H); 13C NMR (CDCl3, 100 MHz)
4.1.4. General synthetic procedure for hydrolysis
Acrylate (1.0 equiv.) was dissolved in Ethanol or Methanol with
THF mixture solvent, and Sodium hydroxide (10.0 equiv.) or
Lithium hydroxide (10.0 equiv.) in water was added at 5 ꢁC. The
solution was then heated in an oil bath and refluxed for 2e4 h
before it was cooled to RT. The solution was then evaporated and
the residue was made acidic (pH w 2) by addition of 2 N HCl. The
precipitate was filtered and concentrated in vacuum to give the
crude products 5ae5j, which were used without further
purification.
d
168.11, 134.40, 128.93, 126.60, 124.54, 122.19, 122.07, 119.69,117.91,
112.22,110.22, 59.61, 14.03,13.43; MS (EI) m/z 229 (Mþ), HRMS (ESI)
m/z calcd for C14H16NO2 [(M þ H)þ] 230.1181, found: 230.1178;
Purity >99.9% (as determined by RP-HPLC, tR ¼ 16.5 min).
4.1.3.2. (E)-ethyl 3-(4-methoxy-1H-indol-3-yl)-2-methylacrylate
(4b). White solid, yield 67%. 1H NMR (CDCl3, 400 MHz)
d 8.61 (s,
1H), 8.47 (brs,1H), 7.39 (d, J ¼ 2.8 Hz,1H), 7.16 (t, J ¼ 8.0 Hz,1H), 7.01
(d, J ¼ 8.4 Hz, 1H), 6.60 (d, J ¼ 8.0 Hz, 1H), 4.28 (q, J ¼ 6.8 Hz, 2H),
3.97 (s, 3H), 2.15 (s, 3H), 1.37 (t, J ¼ 7.2 Hz, 3H); MS (ESI) m/z 260
(M þ H)þ, 258 (M ꢂ H)ꢂ.
4.1.4.1. (E)-3-(1H-indol-3-yl)-2-methylacrylic
acid
(5a). White
solid, yield 61%. Mp 237e238 ꢁC; 1H NMR (acetone-d6, 500 MHz)
d
10.84 (brs, 1H), 8.10 (s, 1H), 7.79 (d, J ¼ 8.0 Hz, 1H), 7.50 (d,
J ¼ 8.0 Hz, 1H), 7.16e7.24 (m, 3H), 2.17 (d, J ¼ 1.0 Hz, 3H); 13C NMR
4.1.3.3. (E)-ethyl 2-methyl-3-(5-methyl-1H-indol-3-yl)acrylate (4c).
White solid, yield 68%. 1H NMR (CDCl3, 500 MHz)
d 8.36 (b,1H), 8.02
(CD3OD, 100 MHz)
d 172.91, 137.47, 132.35, 129.20, 127.99, 123.60,
121.33, 119,10, 113.40, 112.62, 15.19; MS (EI) m/z 201 (Mþ); HRMS
(EI) m/z calcd for 12H11NO2 201.0790, found: 201.0791;
(s, 1H), 7.60 (s, 1H), 7.46 (d, J ¼ 2.5 Hz, 1H), 7.30 (d, J ¼ 8.0 Hz, 1H),
7.10 (d, J ¼ 8.5 Hz, 1H), 4.30 (q, J ¼ 7.0 Hz, 2H), 2.49 (s, 3H), 2.18 (t,
J ¼ 1.0 Hz, 3H), 1.38 (t, J ¼ 7.0 Hz, 3H); MS (EI) m/z 243 (Mþ).
C
Purity > 99.9% (as determined by RP-HPLC, tR ¼ 7.9 min).
4.1.3.4. (E)-ethyl 3-(5-methoxy-1H-indol-3-yl)-2-methylacrylate
4.1.4.2. (E)-3-(4-methoxy-1H-indol-3-yl)-2-methylacrylic acid (5b).
(4d). White solid, yield 99%. 1H NMR (CDCl3, 400 MHz)
d
8.38
Yellow solid, yield 93%. 1H NMR (CDCl3, 400 MHz)
d 8.70 (s, 1H),
(brs, 1H), 7.99 (s, 1H), 7.48 (d, J ¼ 2.8 Hz, 1H), 7.30 (d, J ¼ 8.8 Hz, 1H),
7.23 (d, J ¼ 2.4 Hz, 1H), 6.93 (dd, J ¼ 2.4, 8.4 Hz, 1H), 4.30 (q,
J ¼ 7.2 Hz, 2H), 3.90 (s, 3H), 2.19 (s, 3H), 1.38 (t, J ¼ 7.2 Hz, 3H); MS
(ESI) m/z 260 (M þ H)þ, 258 (M ꢂ H)ꢂ.
8.45 (brs, 1H), 7.45 (d, J ¼ 2.4 Hz, 1H), 7.18 (t, J ¼ 8.0 Hz, 1H), 7.01 (t,
J ¼ 8.0 Hz, 1H), 6.63 (d, J ¼ 8.4 Hz, 1H), 3.99 (s, 3H), 2.16 (s, 3H); MS
(ESI) m/z 232 (M þ H)þ, 230 (M ꢂ H)ꢂ.
4.1.4.3. (E)-2-methyl-3-(5-methyl-1H-indol-3-yl)acrylic acid (5c).
Light yellow solid, yield 72%. 1H NMR (CD3OD, 500 MHz)
d 8.06 (s,
4.1.3.5. (E)-ethyl 3-(5-cyano-1H-indol-3-yl)-2-methylacrylate (4e).
White solid, yield 99%. 1H NMR (CD3OD, 400 MHz)
d 8.15 (s, 1H),
1H), 7.58 (s, 1H), 7.49 (s, 1H), 7.29 (d, J ¼ 8.3 Hz, 1H), 7.03 (d,
J ¼ 8.3 Hz, 1H), 2.44 (s, 3H), 2.14 (d, J ¼ 0.7 Hz, 3H); MS (EI) m/z 215
(Mþ); HRMS (EI) m/z calcd for C13H13NO2 215.0946, found:
215.0948; Purity > 99.9% (as determined by RP-HPLC, tR ¼ 9.6 min).
7.98 (s, 1H), 7.81 (s, 1H), 7.58 (d, J ¼ 8.0 Hz, 1H), 7.49 (d, J ¼ 8.4 Hz,
1H), 4.28 (q, J ¼ 6.0 Hz, 2H), 2.18 (s, 3H), 1.37 (t, J ¼ 8.0 Hz, 3H); MS
(ESI) m/z 255 (M þ H)þ, 253 (M ꢂ H)ꢂ.
4.1.4.4. (E)-3-(5-methoxy-1H-indol-3-yl)-2-methylacrylic acid (5d).
4.1.3.6. (E)-ethyl 2-methyl-3-(5-nitro-1H-indol-3-yl) acrylate (4f).
White solid, yield 78%. 1H NMR (CDCl3, 400 MHz)
d 8.43 (brs, 1H),
Orange solid, yield 22%. 1H NMR (CD3OD, 400 MHz)
d 8.69 (d,
8.12 (s, 1H), 7.54 (d, J ¼ 2.8 Hz, 1H), 7.31 (d, J ¼ 8.8 Hz, 1H), 7.24 (d,
J ¼ 2.4 Hz,1H), 6.94 (dd, J ¼ 2.4, 8.8 Hz,1H), 3.90 (s, 3H), 2.21 (s, 3H);
MS (ESI) m/z 232 (M þ H)þ.
J ¼ 2.0 Hz, 1H), 8.14 (dd, J ¼ 2.0, 8.8 Hz, 1H), 8.02 (s, 1H), 7.86 (s, 1H),
7.57 (d, J ¼ 9.2 Hz, 1H), 4.30 (q, J ¼ 7.2 Hz, 2H), 2.19 (s, 3H), 1.38 (t,
J ¼ 7.2 Hz, 3H); MS (ESI) m/z 275 (M þ H)þ.
4.1.4.5. (E)-3-(5-cyano-1H-indol-3-yl)-2-methylacrylic acid (5e).
Brown solid, yield 99%. 1H NMR (DMSO-d6, 400 MHz)
d 12.21 (brs,
4.1.3.7. (E)-ethyl 2-methyl-3-(6-methyl-1H-indol-3-yl)acrylate (4g).
White solid, yield 99%. 1H NMR (CDCl3, 400 MHz)
d 8.36 (brs, 1H),
1H), 8.27 (s, 1H), 7.9 (d, J ¼ 16.0 Hz, 2H), 7.60 (d, J ¼ 8.8 Hz, 1H), 7.52
(d, J ¼ 8.4 Hz, 1H), 2.08 (s, 3H); MS (ESI) m/z 227 (M þ H)þ.
8.02 (s, 1H), 7.69 (d, J ¼ 8.4 Hz, 1H), 7.43 (d, J ¼ 2.8 Hz, 1H), 7.20 (s,
1H), 7.06 (d, J ¼ 8.4 Hz, 1H), 4.29 (q, J ¼ 7.2 Hz, 2H), 2.48 (s, 3H), 2.18
(s, 3H), 1.37 (t, J ¼ 7.2 Hz, 3H); MS (ESI) m/z 244 (M þ H)þ, 242
(M ꢂ H)ꢂ.
4.1.4.6. (E)-2-methyl-3-(5-nitro-1H-indol-3-yl)acrylic acid (5f).
Orange solid, yield 96%. 1H NMR (DMSO-d6, 400 MHz)
d 12.82 (brs,
1H), 9.06 (s, 1H), 8.50 (d, J ¼ 9.2 Hz, 1H), 8.42 (s, 1H), 8.33 (s, 1H),
4.1.3.8. (E)-ethyl 3-(6-methoxy-1H-indol-3-yl)-2-methylacrylate
8.06 (d, J ¼ 9.2 Hz, 1H), 2.52 (s, 3H); MS (ESI) m/z 245 (M ꢂ H)ꢂ.
(4h). White solid, yield 53%. 1H NMR (CDCl3, 400 MHz)
d 8.34
(brs, 1H), 7.99 (s, 1H), 7.68 (d, J ¼ 9.6 Hz, 1H), 7.39 (d, J ¼ 2.4 Hz, 1H),
6.88e6.90 (m, 2H), 4.29 (q, J ¼ 7.2 Hz, 2H), 3.86 (s, 3H), 2.17 (s, 3H),
1.37 (t, J ¼ 7.2 Hz, 3H); MS (ESI) m/z 260 (M þ H)þ, 258 (M ꢂ H)ꢂ.
4.1.4.7. (E)-2-methyl-3-(6-methyl-1H-indol-3-yl)acrylic acid (5g).
White solid, yield 91%. 1H NMR (CDCl3, 400 MHz)
d
8.39 (brs, 1H),
8.17 (s, 1H), 7.72 (d, J ¼ 8.0 Hz, 1H), 7.50 (d, J ¼ 2.8 Hz, 1H), 7.22 (s,

422
G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
1H), 7.09 (d, J ¼ 7.6 Hz,1H), 2.49 (s, 3H), 2.21 (s, 3H); HRMS (ESI) m/z
calcd for C13H14NO2 [(M þ H)þ] 216.1025, found: 216.1028.
4.1.6. General procedure for preparation of indole 2-
methylacrylamide analogs
The round-bottom flask was charged with (E)-3-(1H-Indol-3-
yl)-2-methylacrylic acid (5a) (1.0 equiv.) and mixture of DMF in
CH2Cl2 (v:v, 1:3). DIPEA (1.5 equiv.) followed by HBTU (1.5 equiv.)
were added to the solution. After stirring at room temperature for
30 min, Amine (1.0 equiv.) was added and stirred overnight at room
temperature. The excess solvent was evaporated under reduced
pressure, and the residue was purified by column chromatography
on silica gel to give compounds 8e11, and 12a.
4.1.4.8. (E)-3-(6-methoxy-1H-indol-3-yl)-2-methylacrylic acid (5h).
Brown solid, yield 94%. 1H NMR (DMSO-d6, 400 MHz)
d 12.00 (brs,
1H), 11.51 (brs, 1H), 7.83 (s, 1H), 7.57 (d, J ¼ 2.8 Hz, 1H), 7.54 (d,
J ¼ 8.4 Hz, 1H), 6.91 (d, J ¼ 2.0 Hz, 1H), 6.75 (dd, J ¼ 2.4 Hz, 8.8 Hz,
1H), 3.76 (s, 3H), 2.04 (s, 3H); HRMS (ESI) m/z calcd for C13H14NO3
[(M þ H)þ] 232.0974, found: 232.0976.
4.1.6.1. (E)-3-(1H-indol-3-yl)-2-methyl-N-(4-(trifluoromethyl)
phenyl)acrylamide (8). Yellowish solid, yield 70%. Mp 145e146 ꢁC;
4.1.4.9. (E)-3-(6-isopropyl-1H-indol-3-yl)-2-methylacrylic acid (5i).
Yellowish solid, yield 93%. 1H NMR (CD3OD, 500 MHz)
d 8.06 (s, 1H),
1H NMR (CDCl3, 400 MHz)
d 8.76 (brs, 1H), 8.53 (s, 1H), 8.10 (d,
7.62 (d, J ¼ 8.2 Hz, 1H), 7.57 (s, 1H), 7.26 (s, 1H), 7.06 (dd, J ¼ 1.3 Hz,
8.3 Hz, 1H), 2.97e3.02 (m, 1H), 2.14 (d, J ¼ 0.9 Hz, 3H), 1.30 (d,
J ¼ 6.9 Hz, 6H); MS (EI) m/z 243 (Mþ); HRMS (EI) m/z calcd for
J ¼ 9.2 Hz, 1H), 7.89 (d, J ¼ 7.6 Hz, 1H), 7.72 (d, J ¼ 3.2 Hz, 1H), 7.42e
7.57 (m, 4H), 7.28e7.36 (m, 2H), 2.39 (s, 3H); 13C NMR (CD3OD,
100 MHz)
d 164.78, 143.19, 136.39, 136.15, 129.19, 128.99, 128.65,
C
15H17NO2 243.1259, found: 243.1256; Purity > 99.9% (as deter-
127.71, 124.97, 122.79, 120.80, 119.21, 117.67, 114.08, 111.83, 108.71,
14.07; HRMS (ESI) m/z calcd for C19H16N2OF3 [(M þ H)þ] 345.1215,
found: 345.1227; Purity > 99.9% (as determined by RP-HPLC,
tR ¼ 18.0 min).
mined by RP-HPLC, tR ¼ 12.7 min).
4.1.4.10. (E)-3-(6-bromo-1H-indol-3-yl)-2-methylacrylic acid (5j).
White solid, yield 34%. 1H NMR (CD3OD, 500 MHz)
d 8.00 (s, 1H),
7.63 (s, 1H), 7.62 (d, J ¼ 8.5 Hz, 1H), 7.58 (d, J ¼ 1.6 Hz, 1H), 7.24 (dd,
J ¼ 1.7 Hz, 8.5 Hz, 1H), 2.14 (d, J ¼ 1.0 Hz, 3H); MS (EI) m/z 279 (Mþ);
HRMS (EI) m/z calcd for C12H10BrNO2 278.9895, found: 278.9894;
Purity > 99.9% (as determined by RP-HPLC, tR ¼ 11.2 min).
4.1.6.2. (E)-N-(furan-2-ylmethyl)-3-(1H-indol-3-yl)-2-
methylacrylamide (9). Yellowish oil, yield 99%. 1H NMR (CD3OD,
400 MHz)
d
7.74 (d, J ¼ 8.0 Hz, 1H), 7.69 (s, 1H), 7.54 (s, 1H), 7.43 (d,
J ¼ 0.8 Hz, 1H), 7.40 (d, J ¼ 7.6 Hz, 1H), 7.17 (t, J ¼ 7.6 Hz, 1H), 7.11 (t,
J ¼ 7.6 Hz, 1H), 6.35 (s, 1H), 6.27 (d, J ¼ 3.2 Hz, 1H), 4.50 (s, 2H), 2.81
(s, 3H); 13C NMR (CD3OD, 100 MHz)
d 171.46, 152.28, 141.67, 135.97,
4.1.5. Procedure for preparation of compounds 6 and 7
127.73, 126.21, 125.52, 124.75, 121.96, 119.55, 117.91, 111.77, 111.04,
109.93, 106.45, 36.26, 14.11; MS (EI) m/z 280 (Mþ); HRMS (EI) m/z
calcd for C17H16N2O2 280.1212, found: 280.1211; Purity > 99.9% (as
determined by RP-HPLC, tR ¼ 12.2 min).
The round-bottom flask was charged with (E)-3-(1H-Indol-3-
yl)-2-methylacrylic acid (5a) (1.0 equiv.) in DMF. NH4Cl
(1.5 equiv.), EDC (1.2 equiv.), HOBt (1.2 equiv.), and DIPEA
(2.5 equiv.) were added to the solution and stirred overnight at
room temperature. The mixture was quenched by water and
extracted with EtOAc. The organic layer was dried over MgSO4 and
filtered. The residue was purified by column chromatography on
silica gel using 0e60% EtOAc in Hexanes as eluant to give the
desired product 6.
4.1.6.3. (E)-N-[2-(dimethylamino)ethyl]-3-(1H-indol-3-yl)-2-
methylacrylamide (10). Pale yellow oil, yield 81%. 1H NMR (CD3OD,
400 MHz)
d
7.75 (t, J ¼ 4.0 Hz, 1H), 7.65e7.69 (m, 1H), 7.56 (s, 1H),
7.41 (d, J ¼ 8.0 Hz, 1H), 7.23e7.28 (m, 1H), 7.18 (t, J ¼ 7.6 Hz, 1H), 7.12
(t, J ¼ 7.6 Hz, 1H), 3.59 (t, J ¼ 6.4 Hz, 2H), 3.34 (s, 3H), 2.97e2.99 (m,
2H), 2.68 (s, 6H); 13C NMR (CD3OD, 100 MHz)
d 173.69, 137.45,
129.21, 128.18, 127.18, 125.57, 125.21, 125.07, 123.50, 121.08, 119.27,
118.72, 113.16, 112.58, 112.50, 59.35, 44.55, 37.37, 15.44; MS (EI) m/z
271 (Mþ); HRMS (EI) m/z calcd for C16H21N3O 271.1685, found:
271.1684; Purity > 99.9% (as determined by RP-HPLC, tR ¼ 3.1 min).
4.1.5.1. (E)-3-(1H-indol-3-yl)-2-methylacrylamide (6). Yellow solid,
yield 85%. Mp 208e209 ꢁC; 1H NMR (CD3OD, 400 MHz)
d 7.76 (d,
J ¼ 8.8 Hz, 2H), 7.57 (s, 1H), 7.41 (d, J ¼ 8.4 Hz, 1H), 7.18 (t, J ¼ 7.2 Hz,
1H), 7.12 (t, J ¼ 8.0 Hz, 1H), 2.17 (s, 3H); 13C NMR (CD3OD, 100 MHz)
d
175.49, 137.43, 129.23, 128.45, 127.14, 125.53, 123.47, 121.06,
4.1.6.4. (E)-N-[3-(1H-imidazol-1-yl)propyl]-3-(1H-indol-3-yl)-2-
119.38, 113.27. 122.51, 15.56; HRMS (ESI) m/z calcd for C12H13N2O
[(M þ H)þ] 201.1028, found: 201.1028; Purity > 99.9% (as deter-
mined by RP-HPLC, tR ¼ 6.3 min).
methylacrylamide (11). Yellow solid, yield 88%. Mp 61e62 ꢁC; 1H
NMR (CD3OD, 400 MHz)
d
7.75 (d, J ¼ 8.0 Hz,1H), 7.71 (s,1H), 7.67 (s,
1H), 7.54 (s, 1H), 7.40 (d, J ¼ 7.6 Hz, 1H), 7.16e7.19 (m, 2H), 7.11 (t,
J ¼ 7.6 Hz, 1H), 6.97 (s, 1H), 4.11 (t, J ¼ 7.2 Hz, 2H), 3.35 (t, J ¼ 7.2 Hz,
2H), 2.16 (s, 3H), 2.06e2.13 (m, 2H); 13C NMR (CD3OD, 100 MHz)
The round-bottom flask was charged with (E)-3-(1H-indol-3-
yl)-2-methylacrylic acid (5a) (1.0 equiv.) in CH3CN. 50% PPAA
(1.2 equiv.), and TEA (1.2 equiv.) were added to the solution. After
stirring at room temperature for 30 min, Methylamine hydrochlo-
ride (1.2 equiv.) was added and stirred overnight at room temper-
ature. After concentration, the residue was purified by column
chromatography on silica gel using 0e60% EtOAc in Hexanes as
eluant to give the desired product 7.
d
173.30, 138.47, 137.44, 129.19, 128.79, 127.44, 126.95, 126.30,
123.43, 121.02, 120.80, 119.36, 113.22, 112.53, 45.98, 38.23, 32.20,
15.57; MS (EI) m/z 308 (Mþ); HRMS (EI) m/z calcd for C18H20N4O
308.1637, found: 308.1636; Purity > 99.9% (as determined by RP-
HPLC, tR ¼ 3.5 min).
4.1.6.5. (E)-N-(4-tert-butylphenyl)-3-(1H-indol-3-yl)-2-
4.1.5.2. (E)-3-(1H-indol-3-yl)-N,2-dimethylacrylamide (7). Pale yel-
low solid, yield 57%. Mp 199e200 ꢁC; 1H NMR (CD3OD, 400 MHz)
methylacrylamide (12a). Yellowish solid, yield 77%. Mp 178e179 ꢁC;
1H NMR (CD3OD, 400 MHz)
d
7.80 (d, J ¼ 8.4 Hz, 1H), 7.76 (s, 1H),
7.60 (s, 1H), 7.54 (d, J ¼ 7.2 Hz, 2H), 7.37e7.43 (m, 3H), 7.13e7.19 (m,
3H), 2.26 (s, 3H), 1.33 (s, 9H); 13C NMR (CD3OD, 100 MHz)
146.82,
d
7.74 (d, J ¼ 8.0 Hz, 2H), 7.67 (s, 1H), 7.53 (s, 1H), 7.4 (d, J ¼ 8.0 Hz,
1H), 7.11e7.18 (m, 2H), 2.64 (s, 3H), 2.16 (s, 3H); 13C NMR (CD3OD,
100 MHz) 173.71, 137.44, 129.21, 127.26, 126.82, 126.31, 123.39,
d
d
136.13, 136.00, 127.73, 126.32, 125.73, 125.08, 122.00, 120.81, 119.61,
117.99, 111.91, 111.08, 33.78, 30.41, 14.43; MS (EI) m/z 332 (Mþ);
HRMS (EI) m/z calcd for C22H24N2O 332.1889, found: 332.1888;
Purity > 99.9% (as determined by RP-HPLC, tR ¼ 21.2 min).
120.98, 119.35,113.23, 112.49, 27.05, 15.49; HRMS (ESI) m/z calcd for
C
13H15N2O [(M þ H)þ] 215.1184, found: 215.1185; Purity > 99.9% (as
determined by RP-HPLC, tR ¼ 7.4 min).

G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
423
4.1.7. General procedure for the preparation of substituted indole 2-
methylacrylamide analogs
128.61, 125.69, 122.32, 118.79, 117.01, 115.59, 112.89, 35.27, 31.88,
15.89; HRMS (ESI) m/z calcd for C22H24N3O3 [(M þ H)þ] 378.1818,
found: 378.1816; Purity > 99.9% (as determined by RP-HPLC,
tR ¼ 21.4 min).
The round-bottom flask was charged with substituted (E)-3-
(1H-Indol-3-yl)-2-methylacrylic acid (1.0 equiv.) and mixture of
DMF in CH2Cl2 (v:v, 1:3). DIPEA (1.5 equiv.) was added to the so-
lution followed by HBTU (1.5 equiv.). After stirring at room tem-
perature for 30 min, Amine (1.0 equiv.) was added and stirred
overnight at RT. The excess solvent was evaporated and then
diluted with water and EtOAc, and the two layers were separated.
The aqueous solution was extracted with EtOAc. The combined
organic solution was washed with water and brine, dried over
magnesium sulfate, and filtered. The residue was purified by col-
umn chromatography on silica gel using 0e60% EtOAc in Hexanes
as eluant to give the desired products 12bej, 13, and 14.
4.1.7.6. (E)-N-(4-tert-butylphenyl)-2-methyl-3-(6-methyl-1H-indol-
3-yl)acrylamide (12g). Yellow solid, yield 82%. Mp 182e183 ꢁC; 1H
NMR (CDCl3, 400 MHz)
d 8.33 (brs, 1H), 7.68 (s, 1H), 7.66 (d,
J ¼ 8.0 Hz, 1H), 7.58 (s, 1H), 7.54 (d, J ¼ 8.8 Hz, 2H), 7.39 (s, 2H), 7.37
(s, 1H), 7.22 (s, 1H), 7.06 (d, J ¼ 8.4 Hz, 1H), 2.49 (s, 3H), 2.27 (s, 3H),
1.33 (s, 9H); 13C NMR (CDCl3, 100 MHz)
d 168.24, 147.09, 135.92,
135.69, 133.01, 127.65, 125.85, 125.79, 125.32, 124.33, 122.45, 119.86,
118.51, 112.79, 111.20, 34.39, 31.39, 21.70, 15.60; HRMS (ESI) m/z
calcd for C23H27N2O [(M þ H)þ] 347.2123, found: 347.2120; Purity
97.7% (as determined by RP-HPLC, tR ¼ 22.4 min).
4.1.7.1. (E)-N-(4-tert-butylphenyl)-3-(4-methoxy-1H-indol-3-yl)-2-
methylacrylamide (12b). Yellow solid, yield 25%. Mp 212e213 ꢁC;
4.1.7.7. (E)-N-(4-tert-butylphenyl)-3-(6-methoxy-1H-indol-3-yl)-2-
1H NMR (CDCl3, 400 MHz)
d
8.39 (brs, 1H), 8.15 (s, 1H), 7.66 (s, 1H),
methylacrylamide (12h). Yellow solid, yield 10%. Mp 169e170 ꢁC; 1H
7.55 (d, J ¼ 9.2 Hz, 2H), 7.36e7.40 (m, 3H), 7.18 (t, J ¼ 8.0 Hz, 1H),
NMR (CDCl3, 400 MHz)
d
8.31 (brs, 1H), 7.64 (d, J ¼ 9.2 Hz, 1H),
7.03 (d, J ¼ 8.0 Hz, 1H), 6.61 (d, J ¼ 7.6 Hz, 2H), 3.97 (s, 3H), 2.24 (s,
7.53e7.56 (m, 3H), 7.38 (d, J ¼ 8.4 Hz, 2H), 7.35 (d, J ¼ 2.4 Hz, 1H),
3H), 1.33 (s, 9H); 13C NMR (CDCl3,100 MHz)
d 168.81, 155.08,146.84,
6.88e6.90 (m, 2H), 3.87 (s, 3H), 2.27 (s, 3H), 1.33 (s, 9H); 13C NMR
137.09, 135.97, 127.75, 125.84, 123.85, 123.84, 119.67, 116.82, 113.45,
(CDCl3, 100 MHz) d 168.16, 157.15, 147.11, 136.27, 135.67, 127.91,
104.55, 100.98, 55.39, 34.38, 31.40, 15.26; HRMS (ESI) m/z calcd for
C
(as determined by RP-HPLC, tR ¼ 20.8 min).
125.86, 125.67, 123.73, 121.71, 119.85, 119.54, 112.92, 110.55, 94.63,
55.68, 34.39, 31.38, 15.57; HRMS (ESI) m/z calcd for C23H27N2O2
[(M þ H)þ] 363.2073, found: 363.2062; Purity > 99.9% (as deter-
mined by RP-HPLC, tR ¼ 20.7 min).
23H27N2O2 [(M þ H)þ] 363.2073, found: 363.2069; Purity > 99.9%
4.1.7.2. (E)-N-(4-tert-butylphenyl)-2-methyl-3-(5-methyl-1H-indol-
3-yl)acrylamide (12c). Yellow solid, yield 25%. Mp 183e184 ꢁC; 1H
4.1.7.8. (E)-N-(4-tert-butylphenyl)-3-(6-isopropyl-1H-indol-3-yl)-2-
NMR (CD3OD, 400 MHz)
d
7.75 (s, 1H), 7.60 (s, 1H), 7.55 (d,
methylacrylamide (12i). Yellow solid, yield 53%. Mp 126e127 ꢁC; 1H
J ¼ 8.0 Hz, 3H), 7.38 (d, J ¼ 8.4 Hz, 2H), 7.30 (d, J ¼ 8.0 Hz, 1H), 7.03
NMR (CDCl3, 400 MHz)
d
8.40 (brs, 1H), 7.68 (d, J ¼ 6.8 Hz, 2H), 7.58
(d, J ¼ 8.0 Hz, 1H), 2.81 (s, 3H), 2.45 (s, 3H), 1.33 (s, 9H); 13C NMR
(s, 1H), 7.54 (d, J ¼ 8.8 Hz, 2H), 7.40 (d, J ¼ 2.4 Hz, 1H), 7.38 (d,
(CD3OD, 100 MHz)
d 172.01, 148.24, 137.62, 135.78, 130.36, 129.47,
J ¼ 8.4 Hz, 2H), 7.13 (d, J ¼ 8.4 Hz, 1H), 2.27 (s, 3H), 1.33 (s, 9H), 1.31
127.97, 127.27, 126.69, 126.52, 125.07, 122.27, 119.10, 112.96, 112.21,
35.24, 31.88, 21.78, 15.86; HRMS (ESI) m/z calcd for C23H27N2O
[(M þ H)þ] 347.2123, found: 347.2119; Purity 95% (as determined by
RP-HPLC, tR ¼ 22.3 min).
(s, 6H); 13C NMR (CDCl3, 100 MHz)
d 168.23, 147.10, 144.45, 135.84,
135.69, 127.62, 125.88, 125.86, 125.65, 124.51, 120.15, 119.86, 118.63,
112.82, 108.43, 34.39, 34.31, 31.40, 24.45, 24.40, 15.58; HRMS (ESI)
m/z calcd for C25H31N2O [(M þ H)þ] 375.2436, found: 375.2433;
Purity 98% (as determined by RP-HPLC, tR ¼ 24.8 min).
4.1.7.3. (E)-N-(4-tert-butylphenyl)-3-(5-methoxy-1H-indol-3-yl)-2-
methylacrylamide (12d). Yellow solid, yield 61%. Mp 160e161 ꢁC;
4.1.7.9. (E)-3-(6-bromo-1H-indol-3-yl)-N-(4-tert-butylphenyl)-2-
1H NMR (CD3OD, 400 MHz)
d
7.74 (s, 1H), 7.53e7.57 (m, 3H), 7.39 (d,
methylacrylamide (12j). Yellowish solid, yield 62%. Mp 220e221 ꢁC;
J ¼ 8.4 Hz, 2H), 7.31 (d, J ¼ 8.4 Hz, 2H), 6.84 (dd, J ¼ 2.4, 8.4 Hz, 1H),
1H NMR (CDCl3, 400 MHz)
d
8.54 (brs, 1H), 7.62 (d, J ¼ 8.4 Hz, 2H),
3.86 (s, 3H), 2.25 (s, 3H), 1.33 (s, 9H); 13C NMR (CD3OD, 100 MHz)
7.58 (d, J ¼ 3.2 Hz, 1H), 7.53 (d, J ¼ 8.4 Hz, 2H), 7.42 (d, J ¼ 3.2 Hz,
1H), 7.38 (d, J ¼ 8.4 Hz, 2H), 7.32 (dd, J ¼ 1.6, 8.8 Hz,1H), 2.26 (s, 3H),
d
171.95, 156.10, 148.28, 137.60, 132.50, 129.79, 127.96, 127.74,
126.54, 122.34, 113.83, 113.27, 101.20, 56.21, 35.26, 31.88, 15.84;
1.33 (s, 9H); 13C NMR (CDCl3, 100 MHz)
d 167.96, 147.32, 136.26,
HRMS (ESI) m/z calcd for C23H27N2O2 [(M þ H)þ] 363.2073, found:
135.50, 128.65,126.34,125.89,125.20,125.14,123.95,120.21,120.03,
116.58, 114.26, 113.02, 34.41, 31.38, 15.58; HRMS (ESI) m/z calcd for
363.2068; Purity
>
99.9% (as determined by RP-HPLC,
tR ¼ 20.4 min).
C22H24N2OBr 411.1072, found: 411.1065; Purity 97.5% (as deter-
mined by RP-HPLC, tR ¼ 23.5 min).
4.1.7.4. (E)-N-(4-tert-butylphenyl)-3-(5-cyano-1H-indol-3-yl)-2-
methylacrylamide (12e). Yellow solid, yield 25%. Mp 268e269 ꢁC;
4.1.7.10. (E)-3-(5-cyano-1H-indol-3-yl)-2-methyl-N-p-tolylacryla-
1H NMR (CD3OD, 400 MHz)
d
8.18 (s, 1H), 7.68 (s, 1H), 7.60 (s, 1H),
7.45e7.49 (m, 3H), 7.39 (dd, J ¼ 1.6, 8.4 Hz, 1H), 7.29 (d, J ¼ 8.4 Hz,
2H), 2.16 (s, 3H), 1.24 (s, 9H); 13C NMR (CD3OD, 100 MHz)
171.48,
mide (13). Yellow solid, yield 35%. Mp 280e281 ꢁC; 1H NMR
(DMSO-d6, 400 MHz)
d 12.25 (s, 1H), 9.91 (s, 1H), 8.54 (s, 1H), 7.99
d
(d, J ¼ 2.8 Hz, 1H), 7.68e7.74 (m, 4H), 7.63 (d, J ¼ 8.4 Hz, 2H), 7.23 (d,
148.47, 139.23, 137.48, 130.00, 129.30, 129.06, 126.57, 126.22, 125.83,
125.58, 122.28, 121.63, 114.15, 113.87, 103.84, 35.27, 31.88, 15.87;
HRMS (ESI) m/z calcd for C23H24N3O [(M þ H)þ] 358.1919, found:
J ¼ 8.4 Hz, 2H), 2.37 (s, 3H), 2.24 (s, 3H); 13C NMR (DMSO-d6,
100 MHz)
d 168.37, 137.81, 137.42, 132.50, 129.33, 129.03, 129.00,
127.69, 125.19, 124.00, 121.04, 120.86, 113.55, 112.63, 102.07, 20.94,
16.00; HRMS (ESI) m/z calcd for C20H18N3O [(M þ H)þ] 316.1450,
found: 316.1443; Purity > 99.9% (as determined by RP-HPLC,
tR ¼ 15.9 min).
358.1922; Purity
tR ¼ 20.1 min).
>
99.9% (as determined by RP-HPLC,
4.1.7.5. (E)-N-(4-tert-butylphenyl)-2-methyl-3-(5-nitro-1H-indol-3-
yl)acrylamide (12f). Yellow solid, yield 25%. Mp 134e135 ꢁC; 1H
4.1.7.11. (E)-3-(5-cyano-1H-indol-3-yl)-N-(4-isopropylphenyl)-2-
NMR (DMSO-d6, 400 MHz)
d
12.30 (s, 1H), 9.90 (s, 1H), 8.88 (s, 1H),
methylacrylamide (14). Yellow solid, yield 21%. Mp 278e279 ꢁC; 1H
8.08 (dd, J ¼ 8.8 Hz, 1H), 7.96 (s, 1H), 7.70 (s, 1H), 7.60e7.64 (m, 3H),
NMR (CD3OD, 400 MHz) d 8.28 (s, 1H), 7.78 (s, 1H), 7.69 (s, 1H),
7.34 (d, J ¼ 8.4 Hz, 2H), 2.16 (s, 3H), 1.27 (s, 9H); 13C NMR (CD3OD,
7.54e7.59 (m, 3H), 7.49 (dd, J ¼ 1.6, 8.4 Hz, 1H), 7.23 (d, J ¼ 8.4 Hz,
100 MHz)
d 171.36, 148.45, 143.35, 140.45, 137.45, 130.25, 130.22,
2H), 2.25 (s, 3H), 1.26 (d, J ¼ 7.2 Hz, 6H); 13C NMR (DMSO-d6,

424
G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
100 MHz)
d
206.96, 168.37, 143.67, 137.09, 137.72, 129.00, 127.69,
incubated for 3 h at 37 ꢁC in the presence of EZ-CYTOX (10%
tetrazolium salt; Dogen) reagent to assess the cytotoxicity. Renilla
luciferase activities were measured by using a luciferase reagent
(1 mM coelenterazine in Methanol-HCl; Goldbio). A time-response
curve was also determined by measuring renilla luciferase activities
as well as cell viabilities at 24, 48, 72 h after treating HCV RNA-
126.63, 125.19, 124.98, 124.03, 121.03, 120.90, 113.54, 112.63, 102.08,
33.50, 31.14, 24.50, 16.00; HRMS (ESI) m/z calcd for C22H22N3O
[(M þ H)þ] 344.1763, found: 344.1756; Purity > 99.9% (as deter-
mined by RP-HPLC, tR ¼ 18.9 min).
4.2. Biological assay
transfected cells with 10 mM of the compound.
4.2.1. Cell culture
Cells of the human hepatoma cell line Huh7.5 were cultured in
monolayers as described previously [23,24], with media consisting
of DMEM (Sigma) supplemented with 1% L-glutamine (Hyclone), 1%
penicillin-streptomycin (Hyclone), 1% Non-Essential-Amino Acid
4.2.6. Quantitative real-time RT-PCR (qRT-PCR) analysis
3 ꢀ 105 cells (Huh7.5-J6/JFH1 or Bart79I) were plated onto a 6-
well plate (Costar 3610) and supplemented with DMSO or com-
pound 12e at the indicated concentrations. At 3 days after incu-
bation, total cellular RNA was extracted using the RNeasyÒ mini kit
(Qiagen) in accordance with the manufacturer’s instructions. The
yield of extracted RNA was assessed spectrophotometrically. The
expression of HCV subgenomic RNA and cellular RNA was
measured by quantitative real-time reverse-transcription poly-
merase chain reaction (qRT-PCR) analysis as previously described.
Each sample was normalized using the endogenous reference gene
glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The cDNA
quantification was performed by the CFX384 real-time PCR detec-
tion system (Bio-Rad, US). The primers used for the qRT-PCR re-
actions were as follows: FW-J6/JFH1-CTCCGCCATGAATCACTC, RV-
(Hyclone), and 10% fetal bovine serum (JR Scientific).
4.2.2. Plasmids
Rluc-J6/JFH1 (FL-J6/JFH-50C19Rluc2AUbi) [20] is
a mono-
cistronic, full-length HCV genome that expresses renilla luciferase
and was derived from the previously described infectious genotype
2a HCV genome J6/JFH1 [25]. Bart79I is a high-efficiency bicistronic
subgenomic replicon of HCV derived from the HCV genotype 1b
Con1 sequence that harbors the neomycin phosphotransferase
gene in the first cistron and the HCV nonstructural proteins in the
second cistron under the translational control of an EMCV IRES [24].
This plasmid also has an adaptive mutation (S2204I) in NS5A,
which increases the replication efficiency. Bart79I-YFP was made by
removal of amino acids 2209 to 2254 in Bart79I and insertion of
PCR-amplified YFP sequence from pEFYP-C1 (Clonetech, USA) using
a flanking NotI site by direct cloning into NS5A of Bart79I. FL-J6/
JFH-50C19Rluc2AUbi and Bart79I were gifts from Dr. Charles Rice of
Rockefeller University.
J6/JFH1-
ACGACACTCATACTAACGC,
FW-Bart79I-
AGAGCCATAGTGGTCT, RV-Bart79I- CCAAATCTCCAGGCATTGAGC,
FW-GAPDH-TGGTCTCCTCTGACTTCA, and RV-GAPDH- CGTTGTCA-
TACCAGGAAATG. A time-response curve was also determined by
measuring renilla luciferase activities as well as cell viabilities at 24,
48, 72 h after treating HCV RNA-transfected cells with 10 mM of
compound 12e.
4.2.7. Western blot analysis
4.2.3. In vitro transcription for production of HCV RNA genomes
In vitro transcription for production of HCV RNA genomes was
performed as previously described [26]. Briefly, Wild type Bart79I,
Bart79I-YFP, J6/JFH1, or RLuc-J6/JFH1 plasmids were linearized by
ScaI for Bart79I or XbaI for J6/JFH1 (NEB) digestion. The T7
promoter-driven in vitro transcription of the digested plasmid was
performed to produce the wild type HCV RNA genomes by using a
MEGAscript kit (Ambion).
1.5 ꢀ 105 cells (Huh7.5-J6/JFH1 or Bart79I) were plated onto a 6-
well plate (Costar 3610) and supplemented with DMSO or com-
pound 12e at the indicated concentrations. At 5 days after incu-
bation, whole-cell extracts were prepared in RIPA buffer (150 mM
NaCl, 1% Triton X-100, 1% deoxycholic acid sodium salt, 0.1% sodium
dodecyl sulfate, 50 mM TriseHCl, pH 7.5, 2 mM EDTA; genDEPOT)
containing a cocktail of protease inhibitors (Complete, Roche
Diagnostic at a final concentration of 1 tablet per 50 ml RIPA buffer)
and quantitated by the Bradford assay (Bio-Rad). Equal amounts of
protein were electrophoresed on an SDSepolyacrylamide gel,
subsequently transferred to a polyvinylidene difluoride membrane
(Immobilon-P; Millipore, Bedford), and probed with a mouse anti-
Core or anti-NS5A monoclonal antibodies (1:1000, 1868 for Core
and 1:1000, 1877 for NS5A, Virostat). A timeeresponse curve was
also determined by performing similar Western blot analyses at 24,
4.2.4. Generation of stable HCV replicon cell lines
The establishment of Huh7.5 cells stably maintaining a Bart79I
subgenomic replicon in the presence of G418 selection has been
described elsewhere [14]. Briefly, in vitro-transcribed Bart79I RNAs
were transfected into Huh7.5 cells by using a lipofectamine 2000
transfection reagent. The transfected cells were supplemented with
G418 at a final concentration of 750
mg/ml. This selection medium
48, 72 h after treating cells with 10 mM of compound 12e.
was replaced every 3 days for 3 weeks. The establishment of Huh7.5
cells stably maintaining a Bart79I-YFP subgenomic replicon in the
presence of G418 selection was performed similarly. The estab-
lishment of Huh7.5 cells stably maintaining a J6/JFH1 infectious
clone was performed by transfecting in vitro-transcribed J6/JFH1
RNAs into Huh7.5 cells by using a lipofectamine 2000 transfection
reagent. The establishment of Huh7.5 cells stably maintaining an
Rluc-J6/JFH1 clone was also performed similarly.
4.2.8. FACS analysis
Huh7.5-Bart79I-YFP cells were plated onto a 6-well plate (Costar
3516) and supplemented with DMSO or compound 12e at the
indicated concentrations. At 5 days after incubation, cells were
washed and resuspended in 1ꢀ Phosphate-Buffered-Saline
(Hyclone). FACS analysis was performed by the FACSAria 3 system
(BD, US). A time-response curve was also determined by perform-
ing similar FACS analyses at 24, 48, 72 h after treating cells with
4.2.5. Cell viability and anti-HCV replication analysis using a
luciferase assay
10 mM of compound 12e.
In vitro transcribed RLuc-J6/JFH1 RNAs were transfected into
Huh7.5 cells by using a lipofectamine 2000 transfection reagent
(Invitrogen) as described by the manufacturer. Transfected cells
were plated onto a white 96-well plate (Costar 3610) and supple-
4.2.9. Analysis of resistant mutants
Huh7.5-Bart79I cells stably harboring a subgenomic genotype
1b HCV replicon were cultured in T150 flasks with standard Huh7.5
media containing 5 mM of compound 12e and 750 mg/mL of G418 for
mented with DMSO or 1 nM, 10 nM, 100 nM, 1
mM, 10
mM, and
4 weeks. Colonies were picked and propagated until growth had
100 M of the compounds. At 3 days after incubation, cells were
m
exceeded a T25 flask, at approximately 1e2 weeks. Cells were then

G. Jin et al. / European Journal of Medicinal Chemistry 75 (2014) 413e425
425
[8] D. Moradpour, F. Penin, C.M. Rice, Replication of hepatitis C virus, Nature
Reviews 5 (2007) 453e463.
[9] K.J. Blight, A.A. Kolykhalov, C.M. Rice, Efficient initiation of HCV RNA
replication in cell culture, Science (New York, N.Y.) 290 (2000) 1972e
1974.
[10] V. Lohmann, F. Korner, J. Koch, U. Herian, L. Theilmann, R. Bartenschlager,
Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line,
Science (New York, N.Y.) 285 (1999) 110e113.
trypsinized and lysed in Trizol. RNA was isolated according to the
manufacturer’s instructions. HCV replicon RNA was reverse-
transcribed and amplified with Superscript II (Invitrogen), using
10 sets of primers covering the entire non-structural regions of
Bart79I. The PCR products were sequenced, and compared to wild-
type Bart79I sequence.
[11] H. Dvory-Sobol, K.A. Wong, K.S. Ku, A. Bae, E.J. Lawitz, P.S. Pang, J. Harris,
M.D. Miller, H. Mo, Characterization of resistance to the protease inhibitor GS-
4.2.10. HCV NS5B RdRp assay
9451 in hepatitis
C virus-infected patients, Antimicrobial Agents and
Recombinant HCV NS5B protein with an N-terminal hexa-
histidine tag was expressed in Escherichia coli and purified, as
described previously [27]. In vitro RNA polymerase activity assays
were performed with 50 ng of recombinant HCV NS5B lacking the
Chemotherapy 56 (2012) 5289e5295.
[12] S. Gemma, S. Butini, G. Campiani, M. Brindisi, S. Zanoli, M.P. Romano,
P. Tripaldi, L. Savini, I. Fiorini, G. Borrelli, E. Novellino, G. Maga, Discovery
of potent nucleotide-mimicking competitive inhibitors of hepatitis C virus
NS3 helicase, Bioorganic & Medicinal Chemistry Letters 21 (2011) 2776e
2779.
C-terminal 21 hydrophobic amino acids (NS5B
D21), as described
[13] P.D. Bryson, N.J. Cho, S. Einav, C. Lee, V. Tai, J. Bechtel, M. Sivaraja,
C. Roberts, U. Schmitz, J.S. Glenn, A small molecule inhibits HCV replication
and alters NS4B’s subcellular distribution, Antiviral Research 87 (2010) 1e
8.
[14] N.J. Cho, H. Dvory-Sobol, C. Lee, S.J. Cho, P. Bryson, M. Masek, M. Elazar,
C.W. Frank, J.S. Glenn, Identification of a class of HCV inhibitors directed
against the nonstructural protein NS4B, Science Translational Medicine 2
(2010) 15e16.
previously [22,27,28]. Briefly, the reaction was performed in 25
m
l of
RdRp reaction buffer [50 mM TriseHCl, pH 7.5, 50 mM NaCl,
100 mM potassium glutamate, 2 mM MgCl2, 1 mM dithiothreitol
(DTT), 20 units of RNase inhibitor (Promega, Madison, WI, USA)]
containing 1
m
g of poly(A) RNA template and 10 pmol oligo(U)20
,
6
mM UTP, and 5
m
Ci [
a-
32P]UTP (3000 Ci/mmol, Amersham Phar-
[15] C. Lee, Discovery of hepatitis C virus NS5A inhibitors as a new class of anti-
HCV therapy, Archives of Pharmacal Research 34 (2011) 1403e1407.
[16] C. Lee, H. Ma, J.Q. Hang, V. Leveque, E.H. Sklan, M. Elazar, K. Klumpp, J.S. Glenn,
The hepatitis C virus NS5A inhibitor (BMS-790052) alters the subcellular
localization of the NS5A non-structural viral protein, Virology 414 (2011) 10e
18.
[17] W.J. Watkins, A.S. Ray, L.S. Chong, HCV NS5B polymerase inhibitors, Current
Opinion In Drug Discovery & Development 13 (2010) 441e465.
[18] M. Gao, R.E. Nettles, M. Belema, L.B. Snyder, V.N. Nguyen, R.A. Fridell,
M.H. Serrano-Wu, D.R. Langley, J.H. Sun, D.R. O’Boyle 2nd, J.A. Lemm, C. Wang,
J.O. Knipe, C. Chien, R.J. Colonno, D.M. Grasela, N.A. Meanwell, L.G. Hamann,
Chemical genetics strategy identifies an HCV NS5A inhibitor with a potent
clinical effect, Nature 465 (2010) 96e100.
[19] S. Pol, R.H. Ghalib, V.K. Rustgi, C. Martorell, G.T. Everson, H.A. Tatum,
C. Hezode, J.K. Lim, J.P. Bronowicki, G.A. Abrams, N. Brau, D.W. Morris,
P.J. Thuluvath, R.W. Reindollar, P.D. Yin, U. Diva, R. Hindes, F. McPhee,
D. Hernandez, M. Wind-Rotolo, E.A. Hughes, S. Schnittman, Daclatasvir for
previously untreated chronic hepatitis C genotype-1 infection: a randomised,
parallel-group, double-blind, placebo-controlled, dose-finding, phase 2a trial,
The Lancet Infectious Diseases 12 (2012) 671e677.
macia Biotech, Piscataway, NJ, USA). The reaction mixture was
incubated for 2 h at 25 ꢁC. Reaction products were resolved on a
denaturing 5% polyacrylamide gel containing 8 M urea. After elec-
trophoresis, gels were dried and then exposed to X-ray film for
autoradiography. The amount of radio-labeled RNA was quantified
using a Phosphorimager.
Acknowledgments
This work was supported by the GRRC program of Gyeonggi
province. [(GRRC-DONGGUK2011-A01), Study of control of viral
diseases] [(GRRC-DONGGUK2011-B02), Development and discov-
ery of new therapeutic target modulators] and a NRF grant
(2012M3A9C1053532) from South Korea. This research was also
supported by Basic Science Research Program through the National
Research Foundation of Korea (NRF) funded by the Ministry of
Education, Science and Technology (2013R1A1A1011851).
[20] D.M. Tscherne, C.T. Jones, M.J. Evans, B.D. Lindenbach, J.A. McKeating,
C.M. Rice, Time- and temperature-dependent activation of hepatitis
C
virus for low-pH-triggered entry, Journal of Virology 80 (2006) 1734e
1741.
Appendix A. Supplementary data
[21] S. Einav, D. Gerber, P.D. Bryson, E.H. Sklan, M. Elazar, S.J. Maerkl, J.S. Glenn,
S.R. Quake, Discovery of a hepatitis C target and its pharmacological in-
hibitors by microfluidic affinity analysis, Nature Biotechnology 26 (2008)
1019e1027.
[22] S.J. Kim, J.H. Kim, J.M. Sun, M.G. Kim, J.W. Oh, Suppression of hepatitis C virus
replication by protein kinase C-related kinase 2 inhibitors that block phos-
phorylation of viral RNA polymerase, Journal of Viral Hepatitis 16 (2009) 697e
704.
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.ejmech.2014.01.062.
References
[23] E.H. Sklan, K. Staschke, T.M. Oakes, M. Elazar, M. Winters, B. Aroeti, T. Danieli,
J.S. Glenn, A Rab-GAP TBC domain protein binds hepatitis C virus NS5A and
mediates viral replication, Journal of Virology 81 (2007) 11096e11105.
[24] K.J. Blight, J.A. McKeating, C.M. Rice, Highly permissive cell lines for sub-
genomic and genomic hepatitis C virus RNA replication, Journal of Virology 76
(2002) 13001e13014.
[25] B.D. Lindenbach, M.J. Evans, A.J. Syder, B. Wolk, T.L. Tellinghuisen, C.C. Liu,
T. Maruyama, R.O. Hynes, D.R. Burton, J.A. McKeating, C.M. Rice, Complete
replication of hepatitis C virus in cell culture, Science (New York, N.Y.) 309
(2005) 623e626.
[26] C. Lee, Interaction of hepatitis C virus core protein with Janus kinase is
required for efficient production of infectious viruses, Biomolecules and
Therapeutics 21 (2013) 97e106.
[27] S.J. Kim, J.H. Kim, Y.G. Kim, H.S. Lim, J.W. Oh, Protein kinase C-related kinase 2
regulates hepatitis C virus RNA polymerase function by phosphorylation, The
Journal of Biological Chemistry 279 (2004) 50031e50041.
[1] C.W. Shepard, L. Finelli, M.J. Alter, Global epidemiology of hepatitis C virus
infection, The Lancet Infectious Diseases 5 (2005) 558e567.
[2] M.J. Alter, D. Kruszon-Moran, O.V. Nainan, G.M. McQuillan, F. Gao, L.A. Moyer,
R.A. Kaslow, H.S. Margolis, The prevalence of hepatitis C virus infection in the
United States, 1988 through 1994, The New England Journal of Medicine 341
(1999) 556e562.
[3] A.M. Di Bisceglie, Natural history of hepatitis C: its impact on clinical man-
agement, Hepatology (Baltimore, Md) 31 (2000) 1014e1018.
[4] S. Mukherjee, M.F. Sorrell, Controversies in liver transplantation for hepatitis
C, Gastroenterology 134 (2008) 1777e1788.
[5] K.J. Wilby, N. Partovi, J.A. Ford, E. Greanya, E.M. Yoshida, Review of boceprevir
and telaprevir for the treatment of chronic hepatitis C, Canadian Journal Of
Gastroenterology ¼ Journal Canadien De Gastroenterologie 26 (2012) 205e
210.
[6] A. Grakoui, D.W. McCourt, C. Wychowski, S.M. Feinstone, C.M. Rice, A second
hepatitis C virus-encoded proteinase, Proceedings of the National Academy of
Sciences of the United States Of America 90 (1993) 10583e10587.
[7] A. Grakoui, C. Wychowski, C. Lin, S.M. Feinstone, C.M. Rice, Expression and
identification of hepatitis C virus polyprotein cleavage products, Journal of
Virology 67 (1993) 1385e1395.
[28] Ahn, D.G., Shim, S.B., Moon, J.E., Kim, J.H., Kim, S.J., Oh, J.W. Interference of
hepatitis C virus replication in cell culture by antisense peptide nucleic acids
targeting the X-RNA. Journal of Viral Hepatitis, 18, e298e306.