Ligand efficiency driven design of new inhibitors of mycobacterium tuberculosis transcriptional repressor EthR using fragment growing, merging, and linking approaches

Article abstract of DOI:10.1021/jm500422b

Tuberculosis remains a major cause of mortality and morbidity, killing each year more than one million people. Although the combined use of first line antibiotics (isoniazid, rifampicin, pyrazinamide, and ethambutol) is efficient to treat most patients, the rapid emergence of multidrug resistant strains of Mycobacterium tuberculosis stresses the need for alternative therapies. Mycobacterial transcriptional repressor EthR is a key player in the control of second-line drugs bioactivation such as ethionamide and has been shown to impair the sensitivity of the human pathogen Mycobacterium tuberculosis to this antibiotic. As a way to identify new potent ligands of this protein, we have developed fragment-based approaches. In the current study, we combined surface plasmon resonance assay, X-ray crystallography, and ligand efficiency driven design for the rapid discovery and optimization of new chemotypes of EthR ligands starting from a fragment. The design, synthesis, and in vitro and ex vivo activities of these compounds will be discussed.

Full text of DOI:10.1021/jm500422b

Article
pubs.acs.org/jmc
Ligand Efficiency Driven Design of New Inhibitors of Mycobacterium
tuberculosis Transcriptional Repressor EthR Using Fragment
Growing, Merging, and Linking Approaches
Baptiste Villemagne,†,‡,§,∥,⊥ Marion Flipo,†,‡,§,∥,⊥ Nicolas Blondiaux,†,§,∥,⊥,#,∇,○ Celine Crauste,†,‡,§,∥,⊥
́
Sandra Malaquin,†,‡,§,∥,⊥ Florence Leroux,†,‡,§,∥,⊥ Catherine Piveteau,†,‡,§,∥,⊥ Vincent Villeret,†,§,◆
Priscille Brodin,†,§,∥,#,∇,○ Bruno O. Villoutreix,▲,◇ Olivier Sperandio,▲,◇ Sameh H. Soror,+,△
Alexandre Wohlkonig,+ Rene Wintjens,□,◆ Benoit Deprez,*,†,‡,§,∥,⊥ Alain R. Baulard,†,§,∥,⊥,#,∇,○
́
̈
and Nicolas Willand*,†,‡,§,∥,⊥
†Universite
́
Lille Nord de France, F-59044 Lille, France
‡Biostructures and Drug Discovery, INSERM U761, F-59006 Lille, France
§UDSL, F-59000 Lille, France
∥Institut Pasteur de Lille, F-59019 Lille, France
⊥PRIM, F-59006 Lille, France
#INSERM U1019, F-59019 Lille, France
∇CNRS UMR8204, F-59021 Lille, France
○Center for Infection and Immunity of Lille, F-59019 Lille, France
◆IRI, USR 3078 CNRS, F-59658 Villeneuve d’Ascq, France
¶Laboratory of Molecular Virology, IBBM, Universite
+Structural Biology Brussels and Molecular and Cellular Interactions, VIB, Brussels, Belgium
□Laboratoire de Chimie Gen
erale, Institut de Pharmacie, Universite Libre de Bruxelles, Brussels, Belgium
́
Libre de Bruxelles, 6041 Gosselies, Belgium
́
́
́
▲INSERM, UMRS 973, MTi, F- 75013 Paris, France
◇Univ Paris Diderot, F-75205 Paris, France
S
* Supporting Information
ABSTRACT: Tuberculosis remains a major cause of mortality and
morbidity, killing each year more than one million people.
Although the combined use of first line antibiotics (isoniazid,
rifampicin, pyrazinamide, and ethambutol) is efficient to treat most
patients, the rapid emergence of multidrug resistant strains of
Mycobacterium tuberculosis stresses the need for alternative
therapies. Mycobacterial transcriptional repressor EthR is a key
player in the control of second-line drugs bioactivation such as
ethionamide and has been shown to impair the sensitivity of the
human pathogen Mycobacterium tuberculosis to this antibiotic. As a
way to identify new potent ligands of this protein, we have
developed fragment-based approaches. In the current study, we
combined surface plasmon resonance assay, X-ray crystallography, and ligand efficiency driven design for the rapid discovery and
optimization of new chemotypes of EthR ligands starting from a fragment. The design, synthesis, and in vitro and ex vivo
activities of these compounds will be discussed.
(XDR) strains of Mycobacterium tuberculosis, there is an urgent
need to complete this arsenal using alternative strategies. In
antibacterial research and especially in tuberculosis, target-
based high-throughput screening (HTS) approaches have not
INTRODUCTION
■
Tuberculosis (TB) remains a major cause of mortality and
morbidity, killing each year about 1.3 million people.1 The
pipeline of new antitubercular drugs developed to stop the
progression of the epidemic has been enriched with new
chemical entities in the last 10 years,2−4 however, with the
emergence of multidrug (MDR) and extensively drug-resistant
Received: March 18, 2014
Published: May 12, 2014
© 2014 American Chemical Society
4876
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
Figure 1. (A) X-ray structure representation of the ligand-binding pocket of EthR filled with compound 1 (PDB ID 3Q0V). (B) X-ray structure
representation of the ligand-binding pocket of EthR filled with compound 2 (PDB ID 4DW6). Surface of ligand binding domain is highlighted.
Hydrogen bonds with Asn179 and Asn176 are represented with dotted lines. Colors legend: blue (compound) or green (EthR) = carbon, dark blue
= nitrogen, red = oxygen, yellow = sulfur. Images were generated with Pymol.
fully succeeded in delivering a substantial quantity of lead
compounds to enrich the pipeline.5,6 In parallel, fragment-based
drug design (FBDD) has become an established approach in
medicinal chemistry to discover hits and lead compounds in
many areas7,8 and particularly in infectious diseases, where
conventional techniques may have failed. FBDD strategies were
used for the discovery of inhibitors of M. tuberculosis proteins
such as the tyrosine phosphatases PtpA9,10 and PtpB,11
pantothenate synthetase,12 antigen 85C,13 and CYP121.14,15
However, none of these examples led to compounds showing
whole cellular activities. More recently, Tran et al. discovered
and optimized aromatic fragment-based inhibitors of type II
dehydroquinase that inhibit the growth of M. tuberculosis in the
low-micromolar range.16 Finally, Surade et al. used a structure-
guided fragment linking strategy to discover an EthR ligand
able to boost ethionamide activity when tested at 1 μM.17
One of the major advantages to use fragments as starting
molecules relies on their small size (usually less than 17 non-
hydrogen atoms) and low molecular weight (MW < 300 g·
mol−1). They exhibit therefore better physicochemical proper-
ties, especially solubility, than lead-like or drug-like compounds.
Because M. tuberculosis is an intracellular pathogen, these
properties make fragments ideal tools to favor their penetration
into the phagosomes of macrophages that harbor the bacteria
and eventually through the waxy and thick M. tuberculosis cell
wall itself.18 This fundamental advantage compensates for low
affinity and activity of initial hit fragments which can be
optimized in a second round of synthesis, keeping molecular
weight and size as low as possible while improving ligand
efficiency.
In the present study, we searched for new potent chemical
series of EthR ligands and ethionamide boosters using
fragment-based approaches. Ethionamide is a second-line
drug used to treat MDR-TB that is resistant to both first-line
drugs isoniazid and rifampicin. It is a prodrug bioactivated by
the M. tuberculosis flavin-containing monooxygenase EthA that
triggers the formation of an ethionamide−NAD adduct.19 This
active ethionamide−NAD adduct inhibits InhA and thus the
synthesis of mycolic acids. EthR, a transcriptional repressor of
the TetR family that inhibits the expression of EthA, was
identified as the major factor of the mycobacterial molecular
mechanism contributing to intrinsic ethionamide low activ-
ity.20,21 Recently, we demonstrated that EthR is a valuable
target to boost ethionamide bioactivation. We identified potent
drug-like EthR ligands that boost in vitro and in vivo
ethionamide activity using structure-based design22−24 and
high-throughput screening.25 We ended up with two distinct
families of ligands, one bearing an acylated 1,2,4-oxadiazolylpi-
peridinyl scaffold and the second one presenting a N-
phenylphenoxyacetamide motif. Representative members of
4877
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
the two series, compounds 1 (BDM31369)23 and 2
(BDM31827),25 were successfully cocrystallized with EthR at
a resolution of 2.0 Å. The two ligands occupy the same region
of the ligand binding domain and are both H-bonded to
Asn179. Compound 2 also binds to the side chain of Asn176
(Figure 1). This structural information was used to further
explore the ligand binding domain of EthR. Starting from a
small EthR ligand and using a combination of X-ray
crystallography, in silico screening, as well as fragment-growing,
merging, and linking approaches, we discovered a new chemical
family of potent EthR ligands. We succeeded in improving by
400-fold activity of our initial fragment thanks to key
modifications. This work led to the rapid discovery of
compound 19 (BDM43266), which displays high efficacy
through a new binding mode.
than 3 H-bond acceptor and H-bond donor atoms, a calculated
logP less than 3, 14 heavy atoms, and a low molecular weight
(<300 g·mol−1) without taking the mass of iodine atom into
account. Interestingly, it also displayed a very high solubility
(>200 μM).
Moreover, the compound 3 was confirmed as a weak binder
of EthR. Using the thermal shift assay developed earlier to
evaluate the affinity of ligands to EthR, we measured a shift of
temperature between holo and apo-EthR, expressed as ΔTm, of
0.1 °C.26 Its capacity to inhibit EthR−DNA interaction,
measured by surface plasmon resonance assay (SPR),24 was
not negligible as it showed an IC50 equal to 160 μM. More
importantly, the binding mode of the compound 3 to EthR was
revealed by cocrystallization with the protein. The structure of
the complex was determined at a resolution of 2.0 Å. X-ray
analysis of the crystal structure revealed the presence of two
copies of the compound 3 embedded in each binding pocket of
the homodimeric structure of EthR (Figure 2).
The binding domain filled by the two molecular entities
adopts a “Y-like” shape with three distinct subdomains called
D1, D2, and D2′. D1 represents the “known binding domain”,
where all described EthR ligands have been shown to fit.22−24
This hydrophobic pocket is lined with backbones of Phe110,
Phe114, Met142, Ile107, and Trp207, and displays at the
bottom a gate formed by the side chains of Trp138 and
Phe184. These two residues have been shown to delimit a
secondary pocket of the protein accessible to longer
ligands.17,25,26 In this D1 domain, the compound 3 is
sandwiched between Trp207 and Phe110, while its sulfonamide
group is H-bonded to Asn179. The newly occupied subpocket
D2 is defined by backbones of Met102, Trp103, Val152, and
Tyr148 that is H-bonded to the sulfonamide moiety of the
second molecule of the compound 3. The sulfonamide nitrogen
of the fragment also participates in water-mediated interactions
with Leu90 and Asn93. Finally, a third subpocket D2′
composed by Pro94, Thr105, Ala95, and Leu90 is invaded by
the acetylenic tail. The original binding of the compound 3 in
two distinct pockets of the ligand binding domain of EthR was
RESULTS AND DISCUSSION
■
4-Iodo-N-prop-2-ynylbenzenesulfonamide (compound 3) is a
small molecule that was discovered while probing the flexibility
of the long and linear ligand binding domain of EthR using in
situ click-chemistry.26 The compound 3 can be considered as a
fragment as it follows the “rule of 3” (Table 1),27,28 with less
Table 1. Physicochemical Properties of Compound 3
MW (g·mol−1
H-Acc
)
194.2 (+ 126.9 for iodine)
2
H-Don
1
cLogP
2.26
3
Nrot
PSA (A2)
54.55
14
non-hydrogen atoms
solubility (μM)
>200
Figure 2. Simplified view of the compound 3 cocrystallized in two distinct regions of the ligand binding domain of EthR. Black dashed lines indicate
the hydrogen bond interactions of the ligand with the backbone residues and with water molecules. Images were generated with Pymol.
4878
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
Figure 3. Fragment-growing strategy: from virtual design and selection to in vitro validation.
a nice opportunity to optimize this small fragment, either by
starting a growing strategy or by linking two scaffolds together.
The fragment-growing strategy was focused on pocket D1 and
initiated with a fragment evolution using the synthesis of a
virtual library based on the arylsufonamide scaffold to allow the
introduction of a broad diversification of the starting molecule.
On the basis of structural data, rational chemical modifications
were performed and compounds were validated throughout the
optimization process as EthR ligands using SPR. Impacts of
modifications on binding mode were confirmed by X-ray
diffraction of crystals of holo-protein complexes. In parallel,
fragment merging and linking strategies were performed to
design compounds that not only bind to subpocket D1 but also
interact with new defined subpockets D2 and D2′.
Fragment Growing Strategy. Following the identification
of the compound 3, we performed its chemical optimization
using a fragment growing approach with the aim of improving
ligand efficiency. As we knew from past studies that anchoring
via H-bond to Asn179 and occupancy of the ligand binding
domain near Gly106 is crucial for EthR inhibition, we focused
our growing-based optimization on the design of molecules that
could target the D1 pocket. To guide the design of potent
analogues, we built a virtual library of 976 members based on
arylsulfonamide framework, the key molecular feature that
allows compound 3 to interact in the D1 pocket. As this ligand
binding domain is thin and linear, the chemical diversity was
introduced in two opposite directions. We virtually modified
the nature of the sulfonamide chain by introducing small
hydrophobic substituents, and we allowed larger modifications
at the para position of the phenyl ring. The library was
synthesized in silico by coupling 16 small amines (MW > 100 g·
mol−1) with 61 commercially available 4-substituted arylsul-
fonyl chlorides using the Accelrys software Pipeline Pilot
(Figure 3).
We then developed an in silico docking procedure that took
into account the previously acquired knowledge on interactions
between EthR and its ligands. The occupancy of pockets D2
and D2′ by the compound 3 (EthR-3) was a yet undescribed
structural feature, whereas the occupation of D1 has been
described for high affinity ligands cocrystallized previously. This
was for example the case for compound 1 (EthR-1, PDB code
3Q0V, Figure 1A), which showed a favorable occupancy of the
D1 pocket. To take advantage of these two structures, which
collectively allowed an optimized occupancy of the EthR
binding pocket for the newly designed compounds of our
virtual library, we performed docking on each cocrystal
structures of EthR and combined the results. Using the
software Surflex 2.415, we docked the 976 members of the
virtual library on the two unoccupied conformations of EthR,
and we eventually filtered out compounds having a score below
a predicted pKi of 8. We obtained 142 ligands coming from the
docking on EthR-1 and 148 ligands issued from the docking on
EthR-3. We selected from the two lists the 75 ligands that were
able to accommodate both conformations of the protein, and
we finally inspected manually the docking poses of each
fragment to select among the 75 ligands those having favorable
protein−ligand contacts such as hydrogen bonds (mainly with
the side chain of Asn179) and hydrophobic contacts. Among
4879
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
the 75 compounds, 10 (1% of the whole library) resulted from
sulfonylation of isopentylamine (Figure 3). The docking
simulations proposed that the substituted aliphatic chain
would fit perfectly at the bottom of D1, which is in agreement
with our previous work.23
Table 2. Activities of Compounds 3−14
These 10 compounds (5−14) were selected and synthesized,
according to Scheme 1, from the reaction of 10 different
Scheme 1. Synthesis of Sulfonamide and Amide Compounds
a
for Structure−Activity Relationships (SAR) Studies
a
b
ΔTm data were obtained using thermal shift assay. EC50 represents
the concentration of ligand that allows ethionamide at 0.1 μg/mL
(normal MIC/10) to inhibit 50% of M. tuberculosis growth in
c
macrophages. HA = number of non-hydrogen atoms.
a
contrary, the replacement of iodine (compound 4) by 2-
methylthiazol-4-yl (compound 8) shifted melting temperature
by 4.2 °C. Lower increases were observed with the introduction
of hydrophobic aliphatic chain (compound 12) or hydrophilic
alkyl ester and ether chains (compounds 13 and 11). Addition
of a bulkier aromatic ring (compounds 5, 6, and 10) was less
tolerated. To evaluate the ability of these compounds to cross
biological membranes and to reach their target in a cellular
assay, the 10 EthR ligands were tested in vitro on M. tuberculosis
infected macrophages. The assay was performed in the
presence of subactive concentrations of ethionamide (0.1 μg/
mL of ethionamide = MIC/10), which allows determination of
a compound’s efficacy to boost antibiotic activity (expressed as
EC50).23 Moreover, we used this assay to confirm that the
compounds alone were inactive and not toxic for macrophages.
Ligand efficiency index (LE) was used to compare compounds
and expressed using the following equation LE = ((1.37 ×
pEC50)/(HA) where HA is the number of heavy atoms.29,30
At this stage, three compounds (8, 12, and 13) had EC50
ranging between 5 and 10 μM. Compound 8, the most active
analogue in both assays (ΔTm = 6.1 °C, EC50 = 5.7 μM), was
successfully cocrystallized with EthR, and the structure was
Reagents and reaction conditions: (i) 3-methylbutan-1-amine (1.0
equiv), sulfonyl chloride (1 equiv), 4-methylmorpholine (3 equiv),
anhydrous DMF, RT, 2 h; (ii) 4-(2-methylthiazol-4-yl)benzene-1-
sulfonyl chloride (1 equiv), amine (1−1.5 equiv), 4-methylmorpholine
(NMP, 5 equiv), anhydrous DMF, RT, 2 h; (iii) 3,3,3-trifluoropropyl-
amine hydrochloride (1.1 equiv), O-benzotriazole-N,N,N′,N′-tetra-
methyl-uronium-hexafluoro-phosphate (HBTU, 1.2 equiv), N-hydrox-
ybenzotriazole (HOBt, 1.5 equiv), N,N-diisopropylethylamine (DIEA,
3 equiv), DMF, RT, 2 h.
arylsulfonyl chlorides with 3-methylbutan-1-amine in the
presence of 4-methylmorpholine at room temperature in
anhydrous N,N-dimethylformamide (DMF). 4-Iodo-N-isopen-
tylbenzenesulfonamide (compound 4), the direct analogue of
compound 3, with an isopentyl tail, was synthesized to evaluate
the impact of this substitution on in vitro activity. Compounds
3−14 were screened against EthR using the thermal shift assay
(Table 2). In agreement with in silico docking, the replacement
of the propargyl chain (compound 3) by isopentyl (compound
4) increased melting temperature by 1.8 °C. The replacement
of iodine by oxazole, pyrazole, or pyrrolidinone (compounds 7,
9, and 14) did not increase affinity to the target. On the
4880
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
Figure 4. (A) X-ray structure of compound 8 (green) cocrystallized with EthR (B). Docked pose of compound 8 (magenta) with X-ray structure of
EthR. The root-mean-square deviation (RMSD) between the docked pose and the experimental bioactive conformation of the compound 8 is equal
to 1.15 Å. (PDB ID 4M3F) Pivotal hydrogen bonds between the compound 8 and Asn179 are respectively 2.84 and 2.99 Å.
Table 3. Activities of Compounds 15−19
a
b
ΔTm were obtained using thermal shift assay. IC50 were determined by SPR and represents the concentration of ligand that inhibits 50% of the
c
interaction of EthR with its promoter EC50 represents the concentration of ligand that allows ethionamide at 0.1 μg/mL (normal MIC/10) to
inhibit 50% of M. tuberculosis growth in macrophages. HA = number of non-hydrogen atoms. LE = −1.37log(EC50)/HA. Solubilities were
determined at pH 7.4.
d
e
f
determined at a resolution of 2.0 Å (Figure 4A). X-ray
diffraction data revealed that as predicted by docking (Figure
4B), the sulfonamide group was H-bonded to the side chain of
Asn179. The phenyl scaffold was facing Trp207 and Phe110,
while the thiazole ring was surrounded by Trp103, Tyr148,
Val152, and Leu87. The methyl substituent was pointing to
Met102, which had flipped to occupy the subpocket D2′. We
also observed that the ligand fitted well the bottom of the
ligand binding domain as expected.
To improve ligand efficiency, we explored chemical
modifications specifically designed to impact weakly on the
molecular weight. We kept the 2-methylthiazol-4-yl moiety, and
we first replaced the isopentyl chain of the compound 8 by a
more substituted 3,3-dimethylbutyl chain or by trifluoroalky-
lated linear chains (compounds 15−18, Table 3). Increase of
steric hindrance in the bottom of the D1 pocket by the
introduction of a tert-butyl group led to a loss of activity
(compound 15, ΔTm = 2.3 °C and EC50 > 20 μM).
Substitution of the isopentyl chain by a trifluoropropyl chain
leading to compound 17 increased significantly the affinity
(ΔTm = 8.5 °C) and by 20-fold the efficacy (EC50 = 0.29 μM,
LE = 0.41). Moreover, the fluorinated compound 17 also
exhibited an improved solubility (14.5 μg/mL) compared to
compound 8 (6.6 μg/mL), in agreement to what was already
observed with previous identified EthR ligands or in the
literature.23,24,31 Shorter (compound 16) or longer (compound
18) trifluoromethylated analogues were less active (EC50 > 2.5
μM). Compound 17 was 9 times more potent than the
4881
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
Figure 5. X-ray structures representation of the ligand-binding pocket of the repressor EthR occupied by compounds 17 (A) (PDB ID 4M3G) and
19 (B) (PDB ID 4M3B). The surface of the ligand binding domain is highlighted and hydrogen bond with residue side chains are represented with
pink dashed lines. Colors legend: blue (compound) or yellow (EthR) = carbon, dark blue = nitrogen, red = oxygen, yellow = sulfur, white = fluor.
Images were generated with Pymol.
Figure 6. (A) Structures of the two compounds (20 and 21) designed by superimposition of X-ray structures of the compound 19 and the upper
copy of the compound 3 in complex with EthR. Key residues interacting with the two ligands are labeled. (B) X-ray structure of the compound 20
(PDB ID 4M3E). (C) X-ray structure of the compound 21 (PDB ID 4M3D).
compound 8 in SPR assay (IC50 = 0.55 vs 4.9 μM). The X-ray
crystal structure of the complex of 17 with EthR was
determined at a resolution of 2.20 Å. While the aromatic
moiety of the molecule conserves the same binding mode as
4882
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
a
Scheme 2. Synthesis of Merging and Linking Compounds 20 and 21
a
Reagents and reaction conditions: (i) 3,3,3-trifluoropropylamine hydrochloride (1 equiv), HBTU (1.2 equiv), HOBt (0.1 equiv), DIEA (4 equiv),
DMF, RT, 2 h; (ii) trimethylphenylammonium tribromide (1 equiv), DCE/MeOH (5/2), 50 °C, 3 h; (iii) N-benzyloxycarbonylglycine thioamide (1
equiv), THF, 70 °C, 3 h; (iv) 25% HBr in acetic acid, RT, 1 h; (v) propane1-sulfonyl chloride (1.5 equiv), NMP (4 equiv), DCM, RT, 1 h; (vi)
propargylamine (1.2 equiv), DIEA (4 equiv), DCM, RT, 2 h; (vii) 3,3,3-trifluoropropylamine hydrochloride (1 equiv), HBTU (1.2 equiv), HOBt
(0.2 equiv), DIEA (4 equiv), DMF, RT, 2 h; (viii) bis(triphenylphosphine)palladium(II) dichloride (PdCl2(PPh3)2, 0.05 equiv), copper iodide (CuI,
0.9 equiv), triethylamine (2.9 equiv), DMF, 80 °C, overnight.
compound 8, the terminal trifluoropropyl chain has slightly
moved to point toward Phe114 at the bottom of the D1
subpocket (Figure 5A).
accommodate the D2 subpocket while keeping the H-bond
interaction with Tyr148 and at the same time maintaining
initial interactions in the D1 pocket with Asn179. Interestingly,
we also noticed that the distance between the sulfur atom and
the terminal carbon atom of the alkyne chain was almost equal
to the distance between the sulfur atom and the C5 carbon of
the thiazole ring (as shown in Figure 6). We thus thought that a
propargylamine linker could be suitable to connect the
phenylsulfonyl function to the para position of 3,3,3-
trifluoropropylbenzamide scaffold without losing its initial
binding mode. This led to the linked compound 21. The two
merging/linking compounds were synthesized according to
Scheme 2.
Compounds 20 and 21 were evaluated in our different assays
(Table 4) and cocrystallized with the protein (respective
resolutions were 2.11 and 1.90 Å). As expected, the H-bond
between the sulfonamide moiety and the hydroxyl group of
Tyr148 was observed for the two analogues (Figure 6B,C).
However, they bound in a different manner. Indeed, compound
20 bound one oxygen atom of its sulfonamide group to the
Tyr148 as the compound 3 did, while the NH group of the
compound 21 is now H-bonded to Tyr148. Moreover, we
observed a new interaction between the compound 20 and
Met102, which slightly moved its side chain to present its sulfur
atom to interact with the NH group of the sulfonamide moiety.
In the bottom of the pocket, the amide group of the two
compounds was also H-bonded to both Asn176 and 179.
Finally, the two compounds 20 and 21 exhibited improved
activities compared to initial fragments. However, these
compounds were found to be poorly soluble and less efficient
To further optimize the potency of our compounds, we
replaced the sulfonamide function by an amide linker. The
compound 19 (Table 3) showed gains in all activities (ΔTm =
11.2 °C and EC50 = 80 nM, LE = 0.47) while keeping equal
solubility (14.7 μg/mL). The IC50 value of the compound 19
was also slightly improved (IC50 = 0.40 μM) compared to 17
(IC50 = 0.55 μM). This increase of activity may be due to the
formation of a new H-bond between the hydrogen atom of the
amide linker and the oxygen atom of Asn176 side chain as
revealed by the X-ray crystal structure of the complex,
determined at a resolution of 2.00 Å (Figure 5B). Importantly,
this result shows for the second time that an EthR ligand can be
stabilized in the EthR pocket by H-bonding to asparagines
Asn179 and Asn176 at the same time.25
Combining in silico and X-ray structure guided optimization
approaches, we rapidly improved the potency of our initial
fragment and identified a very efficient lead compound that
increases by 10-fold the activity of ethionamide in M.
tuberculosis infected macrophages at a concentration of 80 nM.
Fragment-Merging and Linking Strategies. In a further
attempt to probe the ligand binding domain of EthR in D2 and
D2′ subpockets, we superimposed the X-ray structure of the
compound 19 with the one of compound 3 binding to D2 and
D2′ (Figure 6A). As the methyl group of the compound 19 was
found to be 2.3 Å distant from the sulfur atom of the fragment,
we therefore designed the propylsulfonamide analogue 20 as a
merged compound which was supposed to be more flexible and
4883
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
and 20 μM ligand in the EthR buffer (10 mM Tris/HCl, 300 mM
NaCl, pH 7.5, 0.1 mM EDTA). The samples were heated from 37 to
85 °C with a heating rate of 0.04 °C/s. The fluorescence intensity was
measured at Ex/Em: 465/510 nm. The data were obtained using the
algorithmic program Wavemetrics Igor by applying the following
designed procedure: the fluorescence intensity of each well/sample is
plotted as a function of the temperature. Then, the 1D-numerical
derivative of these curves is calculated. At last, the maximum data
values, corresponding to the inflection points (Tm), is extracted to give
Tm in a table and in a graph.
Table 4. Activities of Compounds 20 and 21
IC50 Determination Using Surface Plasmon Resonance (SPR).
Interactions between EthR and the ethA promoter region were
analyzed using “Research Grades Streptavidin-Coated Sensor Chips
(Sensor Chip SA, Biacore Inc.)” on a Biacore 3000 instrument
(Biacore, Uppsala, Sweden). The 106-bp biotinylated DNA fragment
overlapping the ethA/ethR intergenic region was obtained by
polymerase chain reaction (PCR), purified by agarose gel electro-
phoresis, and immobilized onto the SA sensor chip. The biotinylated
DNA fragment was injected in one channel of the chip at 150 ng/mL
to obtain a 75 resonance unit (RU) stable fixation to immobilized
streptavidin. Another channel of the chip was loaded with a
biotinylated double-stranded 113-bp long irrelevant DNA fragment
(+14 to +127 fragment of the Escherichia coli bla gene PCR amplified
using oligonucleotides O-343, TTTCCGTGTCGCCCTTATTCC,
and O-344, CCACTCGTGCACCCAACTGAT, and pUC18 as
substrate). Binding of EthR to the immobilized DNA was performed
at 25 °C in 10 mM Tris-HCl (pH 7.5), 200 mM NaCl, 0.1 mM EDTA,
1 mM DTT, and 1% DMSO at a flow rate of 20 μL/min for 3 min.
Specific interaction (Supporting Information) between EthR and the
106-bp DNA fragment was defined as the signal difference between
both channels. For dose−response curves establishment, the test
compounds were serially diluted in the binding buffer containing 590
nM EthR, incubated 5 min at 37 °C, then injected in the Biacore at a
flow rate of 20 μL/min for 3 min. Supporting Information values were
measured at the end of the injection period and used to calculate the
inhibition of protein−DNA interaction. IC50 values were determined
using GraphPad Prism software.
a
b
ΔTm were obtained using thermal shift assay. IC50 were determined
by SPR and represents the concentration of ligand that inhibits 50% of
the interaction of EthR with its promoter. EC50 represents the
concentration of ligand that allows ethionamide at 0.1 μg/mL (normal
c
MIC/10) to inhibit 50% of M. tuberculosis growth in macrophages.
d
e
HA = number of non-hydrogen atoms. LE = −1.37log(EC50)/HA.
f
Solubility was determined at pH 7.4.
than compound 19, optimized through the growing strategy.
This lack of solubility is probably due to the increase of the
number of hydrophobic atoms, which is unavoidable using
merging and linking strategies with a ligand binding domain
rich in lipophilic residues.
Even if we succeeded in optimizing potencies of the
compounds compared to the initial fragments using the linking
and merging strategies, these two strategies failed in affording
compounds with high ligand efficiency index. In these
strategies, we were facing two problems: a decrease of solubility
while increasing number of atoms and functional groups and a
limitation in the choice of linkers to connect the two scaffolds
while maintaining key interactions. Therefore, in the present
case, the growing strategy was shown to provide more diversity
than linking and merging strategies to explore the rigid ligand
binding domain of this transcriptional regulator.
Intracellular Assay. Raw264.7 macrophages (108 cells) were
infected with H37Rv-GFP suspension at a multiplicity of infection
(MOI) of 1:1 in 300 mL for 2 h at 37 °C with shaking (100 rpm).
After two washes by centrifugation at 1100 rpm for 5 min, the
remaining extracellular bacilli from the infected cells suspension were
killed by a 1 h amikacin (20 μM, Sigma, A2324-5G) treatment. After a
final centrifugation step, 40 μL of M. tuberculosis H37Rv-GFP
colonized macrophages were dispensed with the Wellmate (Matrix)
into 384-well Evotec plates preplated with 10 μL of compound
mixture diluted in cell medium and incubated for 5 days at 37 °C, 5%
CO2. Macrophages were then stained with SYTO 60 (Invitrogen,
S11342) for 1 h followed by plate sealing. Confocal images were
recorded on an automated fluorescent ultrahigh-throughput micro-
scope Opera (Evotec). This microscope is based on an inverted
microscope architecture that allows imaging of cells cultivated in 96- or
384-well microplates (Evotec). Images were acquired with a 20× water
immersion objective (NA 0.70). A double laser excitation (488 and
635 nm) and dedicated dichroic mirrors were used to record green
fluorescence of mycobacteria and red fluorescence of the macrophages
on two different cameras, respectively. A series of four pictures at the
center of each well were taken, and each image was then processed
using dedicated image analysis.32−34 The percent of infected cells, and
the number of cells are the two parameters extracted from images
analysis as previously reported.33 Data of two replicates are average.
Potency Assay of Test Compounds on M. tuberculosis
(Ethionamide Concentration Fixed at 0.1 μg/mL, Serial Dilution
of Test Compounds). Ethionamide (Sigma E6005-5G) is diluted into
DMSO to 10 mg/mL, and aliquots are stored frozen at −20 °C. Test
compounds are suspended in pure DMSO at a concentration of 40
mg/mL in Matrix tubes and then diluted by a 10-fold dilution to 4
mg/mL in Eppendorf tubes. Ten 2-fold serial dilutions of compounds
are performed in DMSO in Greiner 384-well V-shape polypropylene
plates (Greiner, no. 781280). Equal volumes (5 μL) of diluted
CONCLUSION
■
Through three fragment-based approaches, we optimized a
fragment into potent ligands of the mycobacterial transcrip-
tional regulator EthR. This process led to the conversion of a
micromolar affinity fragment into low nanomolar affinity
ligands of EthR and low nanomolar boosters of ethionamide
activity. By combining crystallography studies of the protein−
ligand complexes, in silico design to explore the chemical
diversity of compounds, and eventually determination of ligand
potency by in vitro and cellular assays, we could follow a
rational path of optimization which led to the discovery of
optimal EthR ligands. Of the three approaches, the “growing”
strategy was particularly successful, leading to a new chemical
class of EthR ligands, with compound 19 showing optimized
activity (ΔTm = 11.2 °C, IC50 = 0.40 μM and EC50 = 0.08 μM),
high ligand efficiency (LE = 0.47), and good solubility.
Optimization of the pharmacokinetic properties of the lead to
perform in vivo experiments will be reported in due course.
EXPERIMENTAL SECTION
■
Biology. Thermal Shift Assay (TSA). The fluorescent dye SYPRO
Orange (Invitrogen) was used to monitor protein unfolding. The
thermal shift assay was conducted in a Lightcycler 480 (Roche). The
system contained a heating/cooling device for temperature control and
a charge-coupled device (CCD) detector for real-time imaging of the
fluorescence changes in the wells of the microplate. The final sample
concentrations were 10 μM EthR, 2.5× SYPRO Orange, 1% DMSO,
4884
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
compounds and of ethionamide are transferred to a 384-well low
volume polypropylene plate (Corning, no. 3672). Two independent
replicates were done for each setting. On the day of the experiment,
0.5 μL of compound plate is first transferred by EVOBird platform
(Evotec) to cell assay plates preplated with 10 μL of assay medium.
Solubility. The 10 mM solution (40 μL) in DMSO of the sample
was added to 1.960 mL of MeOH or PBS at pH 7.4. The samples were
gently shaken for 24 h at room temperature, then centrifuged for 5
min and filtered over 0.45 μm filters. An amount equal to 20 μL of
each solution was added to 180 μL of MeOH and analyzed by LC-MS.
The solubility was determined by the ratio of mass signal areas PBS/
MeOH. These experiments were analyzed using a LC-MS-MS triple-
quadrupole system (Varian 1200ws) under SIM or MRM detection
with optimized mass parameters (declustering potential; collision
energy and drying gas temperature).
Crystal Structure Determination of EthR Ligand Complexes. EthR
crystals were produced by the vapor diffusion method as described
previously.35 Crystallization drops were streak seeded. The crystal-
lization buffer contained: 1.4−1.65 M ammonium sulfate (using 0.05
M increment), 15% glycerol, and 0.1 M MES pH 6.7. The EthR ligand
complexes were prepared by mixing 1 μL of ligand (33 mM in 100%
DMSO) and 9 μL of the purified protein (9 mg/mL) and equilibrated
for 30 min at room temperature prior crystallization. Crystals appeared
within 2 days incubation at 20 °C. Crystals were flash frozen in liquid
nitrogen, using mother liquor supplemented with 15% glycerol as
cryoprotectant. The X-ray diffraction data were collected on a Mar
CCD mosaic300 detector using synchrotron radiation on PXIII
beamline (SLS, PSI, Switzerland). EthR crystals belonged to the space
group P41212, with one monomer in the asymmetric unit. Data
collection statistics are summarized in Supporting Information.
Indexing was performed using XDS,36 and scaling and merging were
performed using the CCP4 package.37 Both structures were refined
with the macromolecular refinement program REFMAC5. Initially
ligands were fitted into the density using findligand (CCP4) and then
manually positioned using Coot.38 Six structures were deposited in the
Protein Data Bank (PDB) under the accession codes.
77.8, 72.9, 32.9. MS [M − H]− m/z 320. HRMS (m/z) for
C9H8INO2S [M − H]− calculated, 319.92477; found, 319.92521.
4-Iodo-N-isopentylbenzenesulfonamide (4). To a stirred solution
of 3-methylbutan-1-amine (267 μL, 2.30 mmol) in DMF (14 mL) was
added 4-iodobenzenesulfonyl chloride (696 mg, 2.30 mmol) and N-
methylmorpholine (759 μL, 6.9 mmol). The mixture was stirred at
room temperature for 5 h. Water was added to the reaction mixture
and the aqueous phase extracted 4 times with ethyl acetate. The
combined extracts were washed with brine, dried over magnesium
sulfate, and concentrated in vacuo to give the sulfonamide 4 (502 mg,
62%) as a yellow solid. 1H NMR (300 MHz, CD2Cl2, 25 °C): δ = 7.92
3
3
(d, J(H,H) = 4.7 Hz, 2H), 7.59 (d, J(H,H) = 4.7 Hz, 2H), 4.71 (t,
3J(H,H) = 5.9 Hz, 1H), 2.96 (q, 3J(H,H) = 6.2 Hz, 3J(H,H) = 14.7 Hz,
2H), 1.58 (n, 3J(H,H) = 6.7 Hz, 1H), 1.34 (m, 2H), 0.84 (d, 3J(H,H)
= 6.6 Hz, 6H). MS [M + H]+ m/z 354. HRMS (m/z) for
C11H16INO2S [M − H]− calculated, 351.98737; found, 351.98865.
General Procedure (i) for Compounds 5, 6, 7, 9, 13, and 14. To a
stirred solution of 3-methylbutan-1-amine (69.7 μL, 0.60 mmol) in
anhydrous DMF (4.6 mL) was added 4-methylmorpholine (197.9 μL,
1.80 mmol) and the corresponding sulfonyl chloride (0.60 mmol).
The mixture was stirred at room temperature until the starting material
was no longer detectable by TLC, then 1 M acetic acid was then
added. The precipitate was filtered, washed with water, and dried.
N-Isopentyl-4′-methoxybiphenyl-4-sulfonamide (5). Yield 143 mg
of white powder, 71%. 1H NMR (300 MHz, CD2Cl2, 25 °C): δ = 7.89
3
3
(d, J(H,H) = 9.1 Hz, 2H), 7.74 (d, J(H,H) = 8.5 Hz, 2H), 7.62 (d,
3J(H,H) = 8.5 Hz, 2H), 7.04 (d, J(H,H) = 9.2 Hz, 2H), 4.41 (br s,
3
1H), 3.88 (s, 3H), 3.00 (t, 3J(H,H) = 7.3 Hz, 2H), 1.62 (n, 3J(H,H) =
3
3
6.7 Hz, 1H), 1.38 (q, J(H,H) = 7.4 Hz, 2H), 0.87 (d, J(H,H) = 6.6
Hz, 6H). MS [M + H]+ m/z 334.
4′-Fluoro-N-isopentylbiphenyl-4-sulfonamide (6). Yield 71 mg of
1
a yellowish powder, 37%. H NMR (300 MHz, CD2Cl2, 25 °C): δ =
7.92 (d, 3J(H,H) = 8.3 Hz, 2H), 7.74 (d, 3J(H,H) = 8.8 Hz, 2H), 7.65
3
4
3
(Dd, J1(H,H) = 8.9 Hz, J2(H,F) = 5.3 Hz, 2H), 7.22 (t, J(H,F and
3
H) = 8.8 Hz, 2H), 4.43 (br s, 1H), 3.01 (t, J(H,H) = 7.2 Hz, 2H),
1.61 (n, 3J(H,H) = 6.7 Hz, 1H), 1.38 (q, 3J(H,H) = 7.1 Hz, 2H), 0.87
(d, J(H,H) = 6.2 Hz, 6H). MS [M + H]+ m/z 322.
3
Chemistry. General Information. NMR spectra were recorded on
a Bruker DRX-300 spectrometer. Chemical shifts are in parts per
million (ppm). The assignments were made using one-dimensional
(1D) 1H and 13C spectra and two-dimensional (2D) HSQC and
COSY spectra. Mass spectra were recorded with a LC-MS (Waters
Alliance Micromass ZQ 2000). LC-MS analysis was performed using a
C18 TSK-GEL Super ODS 2 μm particle size column, dimensions 50
mm × 4.6 mm. A gradient starting from 100% H2O/0.1% formic acid
and reaching 20% H2O/80% CH3CN/0.08% formic acid within 10
min at a flow rate of 1 mL/min was used. High-resolution mass spectra
were recorded on a HPLC-MS-TOF (Waters LCT Premier).
Preparative HPLC were performed using a Varian PRoStar system
using an OmniSphere 10 Column C18 250 mm × 41.4 mm Dynamax
from Varian, Inc. A gradient starting from 20% CH3CN/80% H2O/
0.1% formic acid and reaching 100% CH3CN/0.1% formic acid at a
flow rate of 80 mL/min or 20% MeOH/80% H2O/0.1% formic acid
reaching 100% MeOH/0.1% formic acid was used. Purity (%) was
determined by reversed phase HPLC, using UV detection (215 nm),
and all compounds showed purity greater than 95%. All commercial
reagents and solvents were used without further purification.
N-Isopentyl-4-(oxazol-5-yl)benzenesulfonamide (7). Yield 78 mg
1
of a white powder, 44%. H NMR (300 MHz, CD2Cl2, 25 °C): δ =
3
3
8.02 (s, 1H), 7.93 (d, J(H,H) = 8.6 Hz, 2H), 7.84 (d, J(H,H) = 8.6
Hz, 2H), 7.54 (s, 1H), 4.50 (br s, 1H), 3.00 (t, 3J(H,H) = 7.3 Hz, 2H),
1.59 (n, 3J(H,H) = 6.7 Hz, 1H), 1.37 (q, 3J(H,H) = 7.2 Hz, 2H), 0.86
(d, J(H,H) = 6.6 Hz, 6H). MS [M + H]+ m/z 295.
3
N-Isopentyl-4-(1H-pyrazol-1-yl)benzenesulfonamide (9). Yield 90
1
mg of white powder, 51%. H NMR (300 MHz, CD2Cl2, 25 °C): δ =
8.09 (dd, 3J(H,H) = 2.6 Hz, 4J(H,H) = 0.4 Hz, 1H), 7.96 (d, 3J(H,H)
= 9.0 Hz, 2H), 7.91 (d, 3J(H,H) = 9.2 Hz, 2H), 7.78 (d, 3J(H,H) = 1.5
Hz, 1H), 6.57 (dd, 3J(H,H) = 2.6 Hz, 3J(H,H) = 1.8 Hz, 1H), 4.54 (br
3
3
s, 1H), 3.00 (t, J(H,H) = 7.3 Hz, 2H), 1.60 (n, J(H,H) = 6.7 Hz,
1H), 1.37 (q, 3J(H,H) = 7.2 Hz, 2H), 0.86 (d, 3J(H,H) = 6.6 Hz, 6H).
MS [M + H]+ m/z 294.
Ethyl 4-(N-Isopentylsulfamoyl)benzoate (13). Yield 109 mg of
white powder, 60%. 1H NMR (300 MHz, CD2Cl2, 25 °C): δ = 8.20 (d,
3
3J(H,H) = 8.7 Hz, 2H), 7.94 (d, J(H,H) = 8.5 Hz, 2H), 4.46 (br s,
1H), 4.42 (q, 3J(H,H) = 7.1 Hz, 2H), 2.99 (m, 2H), 1.59 (n, 3J(H,H)
= 6.7 Hz, 1H), 1.40 (m, 5H), 0.86 (d, 3J(H,H) = 6.6 Hz, 6H). MS [M
+ H]+ m/z 300.
4-Iodo-N-(prop-2-ynyl)benzenesulfonamide (3). To a stirred
solution of propargylamine (318 μL, 4.96 mmol) and DIEA (2.30
mL, 13.2 mmol) in DCM (30 mL) was added 4-iodobenzene-1-
sulfonyl chloride (1.00 g, 3.31 mmol). The mixture was stirred at room
temperature for 1 h. DCM was then evaporated in vacuo. The solid
was dissolved in AcOEt and washed with water and brine. The organic
layer was then dried over magnesium sulfate and concentrated in
vacuo. Purification of the beige solid by preparative HPLC gave the
N-Isopentyl-4-(2-oxopyrrolidin-1-yl)benzenesulfonamide (14).
1
Yield 83 mg of white powder, 45%. H NMR (300 MHz, CD2Cl2,
25 °C): δ = 7.85−7.84 (m, 4H), 4.39 (br s, 1H), 3.90 (t, 3J(H,H) = 7.0
3
3
Hz, 2H), 2.95 (q, J(H,H) = 6.7 Hz, 2H), 2.63 (t, J(H,H) = 7.7 Hz,
3
3
2H), 2.20 (quint, J(H,H) = 7.6 Hz, 2H), 1.55 (n, J(H,H) = 6.3 Hz,
1H), 1.35 (q, 3J(H,H) = 7.2 Hz, 2H), 0.86 (d, 3J(H,H) = 6.7 Hz, 6H).
MS [M + H]+ m/z 311.
General Procedure (ii) for Compounds 8, 11, and 12. To a stirred
solution of 3-methylbutan-1-amine (69.7 μL, 0.60 mmol) in anhydrous
DMF (4.6 mL) was added 4-methylmorpholine (197.9 μL, 1.80
mmol) and the corresponding sulfonyl chloride (0.60 mmol). The
mixture was stirred at room temperature until the starting material was
no longer detectable by TLC, then 1 M acetic acid and brine were
1
sulfonamide 3 (854 mg, 80%) as a white solid. H NMR (300 MHz,
CD2Cl2, 25 °C): δ = 7.95−7.92 (d, 3J(H,H) = 8.6 Hz, 2H), 7.63−7.60
(d, 3J(H,H) = 8.6 Hz, 2H), 4.88 (br s, 1H), 3.89−3.86 (dd, 3J(H,H) =
4
6.1 Hz J(H,H) = 2.5 Hz, 2H), 2.21−2.19 (t, 4J(H,H) = 2.5 Hz, 1H).
13C NMR (75 MHz, CD2Cl2, 25 °C): δ = 139.5, 138.4, 128.7, 100.2,
4885
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
subsequently added. The compound was extracted with AcOEt.
Organic layers were combined, dried over magnesium sulfate, and
concentrated in vacuo.
1J(C,F) = 276 Hz), 117.1, 37.4 (d, 3J(C,F) = 3.1 Hz), 35.2 (q, 2J(C,F)
= 28 Hz), 18.9; MS [M + H]+ m/z 351. HRMS (m/z) for
C13H13F3N2O2S2 [M − H]− calculated, 349.02978; found, 349.03032.
4-(2-Methylthiazol-4-yl)-N-(4, 4, 4-trifluorobutyl)-
benzenesulfonamide (18). General procedure (iii) with 4,4,4-
trifluorobutylamine (55.7 mg, 0.44 mmol), 100 mg (0.37 mmol) of
sulfonyl chloride, 5 mL of dry DMF, and 198 μL (1.8 mmol) of 4-
methylmorpholine. Yield 75 mg of beige powder, 54%. 1H NMR (300
N-Isopentyl-4-(2-methylthiazol-4-yl)benzenesulfonamide (8).
Yield 67 mg of a pale-yellow powder, 34%. 1H NMR (300 MHz,
CD2Cl2, 25 °C): δ = 8.07 (d, 3J(H,H) = 8.5 Hz, 2H), 7.9 (d, 3J(H,H)
3
= 8.5 Hz, 2H), 7.56 (s, 1H), 4.48 (t, J(H,H) = 5.7 Hz,1H), 2.98 (m,
3
2H), 2.8 (s, 3H), 1.59 (n, J(H,H) = 6.7 Hz, 1H), 1.37 (q, 3J(H,H) =
3
7.2 Hz, 2H), 0.86 (d, 3J(H,H) = 6.8 Hz,, 6H). MS [M + H]+ m/z 325.
HRMS (m/z) for C15H20N2O2S2 [M + H]+ calculated, 325.1039;
found, 325.10369.
MHz, CD3OD, 25 °C): δ = 8.09 (d, J(H,H) = 8.6 Hz, 2H), 7.88 (d,
3J(H,H) = 8.6 Hz, 2H), 7.84 (s, 1H), 2.89 (m, 2H), 2.77 (s, 3H), 1.38
(m, 2H), 0.85 (s, 9H). MS [M + H]+ m/z 365.
4-Butoxy-N-isopentylbenzenesulfonamide (11). Yield 55 mg of a
4-(2-Methylthiazol-4-yl)-N-(3,3,3-trifluoropropyl)benzamide (19).
To a stirred solution of 4-(2-methylthiazol-4-yl)benzoic acid (50.0 mg,
0.23 mmol), 3,3,3-trifluoropropylamine hydrochloride (37.5 mg, 0.25
mmol), HBTU (103 mg, 0.27 mmol), and HOBt (52 mg, 0.34 mmol)
in anhydrous DMF (2.5 mL) was added DIEA (118 μL, 0.68 mmol).
The mixture was stirred at room temperature for 2 h. DMF was then
evaporated in vacuo. The solid was dissolved in EtOAc and washed
successively with saturated K2CO3, HCl 1N, water, and brine. The
organic layer was dried over magnesium sulfate and concentrated in
vacuo to give the amide 19 (66.8 mg, 93%) as a white solid. 1H NMR
(300 MHz, CD3OD, 25 °C): δ = 7.99 (d, 3J(H,H) = 8.5 Hz, 2H), 7.87
(d, J(H,H) = 8.5 Hz, 2H), 7.76 (s, 1H), 3.64 (t, J(H,H) = 7.0 Hz,
2H), 2.76 (s, 3H), 2.54 (qt, 3J(H,F) = 10.6 Hz 3J(H,H) = 6.8 Hz, 2H).
13C NMR (75 MHz, CD3OD, 25 °C): δ = 168.4, 167.1, 153.6, 137.4,
133.1, 127.4, 126.7 (q, 1J(C,F) = 278 Hz),125.9, 114.7, 32.7 (q,
2J(C,F) = 28 Hz), 33.1,17.5. MS [M + H]+ m/z 315. HRMS (m/z) for
1
pale-yellow powder, 30%. H NMR (300 MHz, CD2Cl2, 25 °C): δ =
7.77 (d, 3J(H,H) = 7.8 Hz, 2H), 7.01 (d, 3J(H,H) = 9.4 Hz, 2H), 4.06
3
3
(t, J(H,H) = 8.8 Hz, 2H), 2.93 (t, J(H,H) = 8.1 Hz, 2H), 1.81 (q,
3J(H,H) = 6.3 Hz, 2H), 1.55 (m, 3H), 1.01 (t, 3J(H,H) = 7.9 Hz, 3H),
0.85 (d, J(H,H) = 6.3 Hz, 6H). MS [M + H]+ m/z 300.
3
N,4-Diisopentylbenzenesulfonamide (12). Yield 122 mg of a pale-
1
yellow powder, 62%. H NMR (300 MHz, CD2Cl2, 25 °C): δ = 7.75
3
3
(d, J(H,H) = 8.5 Hz, 2H), 7.37 (d, J(H,H) = 8.1 Hz, 2H), 2.95 (t,
3J(H,H) = 7.4 Hz, 2H), 2.72 (t, 3J(H,H) = 7.9 Hz, 2H), 1.66−1.51 (m,
3
4H), 1.37−1.30 (m, 2H), 0.97 (d, J(H,H) = 6.3 Hz, 6H), 0.84 (d,
3
3
3J(H,H) = 6.6 Hz, 6H). MS [M + H]+ m/z 298.
N-(4′-(N-Isopentylsulfamoyl)biphenyl-4-yl)acetamide (10). A sol-
ution of Na2CO3 (69 mg, 0.60 mmol) in water (0.9 mL) was added to
a solution of 4-iodo-N-isopentylbenzenesulfonamide (4) (141 mg,
0.40 mmol), 4-acetamidophenylboronic acid (109 mg, 0.60 mmol),
and PdCl2dppf (38 mg, 0.040 mmol) in DME (2.3 mL). The flask was
sealed and stirred under microwave irradiation at 115 °C for 30 min.
The mixture was filtered on Celite and concentrated in vacuo.
Purification of the residue by preparative HPLC gave compound 10
C14H13F3N2OS [M + H]+ calculated, 315.07734; found, 315.07662.
4-(2-(Propylsulfonamidomethyl)thiazol-4-yl)-N-(3,3,3-
trifluoropropyl)benzamide (20). To a stirred solution of 4-
acetylbenzoic acid (2.00 g, 12.2 mmol), 3,3,3-trifluoropropylamine
hydrochloride (1.82 g, 12.2 mmol), HBTU (5.08 g, 13.4 mmol), and
HOBt (165 mg, 1.22 mmol) in anhydrous DMF (50 mL) was added
DIEA (8.44 mL, 48.8 mmol). The mixture was stirred at room
temperature for 2 h. DMF is then evaporated in vacuo. The orange oil
was dissolved in EtOAc and washed successively with saturated K2CO3
(2×), HCl 1N (2×), and brine (2×). The organic layer was dried over
magnesium sulfate and concentrated in vacuo. Purification by flash
column chromatography (7:3−6:4 cyclohexane−ethyl acetate) gave 4-
acetyl-N-(3,3,3-trifluoropropyl)benzamide (20a) (2.98 g, 94%) as a
1
(108 mg, 75%) as a yellowish solid. H NMR (300 MHz, CD2Cl2, 25
3
3
°C): δ = 7.90 (d, J(H,H) = 8.5 Hz, 2H), 7.81 (d, J(H,H) = 8.5 Hz,
2H), 7.70 (d, 3J(H,H) = 9.1 Hz, 2H), 7.66 (d, 3J(H,H) = 8.8 Hz, 2H),
3
3
2.90 (t, J(H,H) = 7.3 Hz, 2H), 2.16 (s, 3H), 1.63 (n, J(H,H) = 6.7
3
3
Hz, 1H), 1.35 (q, J(H,H) = 7.2 Hz, 2H), 0.85 (d, J(H,H) = 6.6 Hz,
6H). MS [M + H]+ m/z 361.
General Procedure (iii) for the Synthesis of Compounds 15, 16,
17, and 18. The corresponding amine was added to a solution of 4-(2-
methylthiazol-4-yl)benzene-1-sulfonyl chloride (50 mg, 0.18 mmol)
and 4-methylmorpholine (99 μL, 0.90 mmol) in dry DMF (4 mL).
The mixture was stirred at room temperature for 2 h. DMF was then
evaporated in vacuo. The residue was taken up in AcOEt and washed
twice with water and brine. The organic layer was dried over
magnesium sulfate and concentrated in vacuo.
1
white solid. H NMR (300 MHz, CD2Cl2, 25 °C): δ = 8.02−8.00 (d,
3J(H,H) = 8.6 Hz, 2H), 7.87−7.84 (d, 3J(H,H) = 8.6 Hz, 2H), 6.69 (br
s, 1H), 3.76−3.70 (q, 3J(H,H) = 6.4 Hz, 2H), 2.63 (s, 3H), 2.60−2.45
3
3
(qt, J(H,F) = 10.9 Hz, J(H,H) = 6.6 Hz, 2H). MS [M + H]+ m/z
260.
To a stirred solution of 20a (300 mg, 1.16 mmol) in DCE (15 mL)
and MeOH (6 mL) was added trimethylphenylammonium tribromide
(436.1 mg, 1.16 mmol). The mixture was stirred for 1 h at 50 °C.
Then 88 mg of trimethylphneylammonium tribromide was added, and
the mixture was further stirred for 2 h at 50 °C. DCE and MeOH were
evaporated in vacuo, and the solid was dissolved in EtOAc and washed
with water and brine. The organic layer was then dried over
magnesium sulfate and concentrated in vacuo to give the desired 4-(2-
bromoacetyl)-N-(3,3,3-trifluoropropyl)benzamide 20b (387 mg, 99%)
as a white solid. MS [M + H]+ m/z 340.
To a stirred solution of 20b (500 mg, 1.48 mmol) in THF on
molecular sieve (10 mL) was added N-benzyloxycarbonylglycine
thioamide (332 mg, 1.48 mmol). The mixture was stirred for 3 h at 70
°C. THF was then evaporated in vacuo. The solid was then treated
with a solution of HBr at 25% in acetic acid (5 mL) for 1 h at room
temperature. Diethyl ether (40 mL) was added, and the solution was
cooled to 0 °C. The precipitate was filtered, washed with diethyl ether,
and dried to give a light-brown solid, which was used without any
further purification. Then 75 mg of this solid was added in a 10 mL
round-bottom flask, dissolved in 1.5 mL of DCM, and treated with 4-
methylmorpholine (82 μL) and propane-1-sulfonyl chloride (20 μL,
0.18 mmol). The mixture was stirred at room temperature for 2 h.
Then 20 μL of a new batch of propane-1-sulfonyl chloride was added,
and the mixture was stirred for one additional hour. DCM was
evaporated in vacuo. Purification of the residue by preparative HPLC
N - ( 3 , 3 - D i m e t h y l b u t y l ) - 4 - ( 2 - m e t h y l t h i a z o l - 4 - y l ) -
benzenesulfonamide (15). General procedure (iii) with 3,3-
dimethylbutylamine (38.7 μL, 0.27 mmol). Yield 26.5 mg of beige
1
powder, 44%. H NMR (300 MHz, CD3OD, 25 °C): δ = 8.08 (d,
3J(H,H) = 8.7 Hz, 2H), 7.88 (d, 3J(H,H) = 8.7 Hz, 2H), 7.84 (s, 1H),
2.89 (m, 2H), 2.77 (s, 3H), 1.38 (m, 2H), 0.85 (s, 9H). 13C NMR (75
MHz, CD3OD, 25 °C): δ = 168.7, 154.4, 140.9, 139.5, 128.6, 127.8,
116.9, 44.3, 40.8, 30.5, 29.7, 18.9. MS [M + H]+ m/z 339.
4-(2-Methylthiazol-4-yl)-N-(2, 2, 2-trifluoroethyl)-
benzenesulfonamide (16). General procedure (iii) with 2,2,2-
trifluoroethylamine hydrochloride (24.4 mg, 0.18 mmol). Yield 19.8
1
mg of a beige powder, 31%. H NMR (300 MHz, CD3OD, 25 °C): δ
3
3
= 8.09 (d, J(H,H) = 8.8 Hz, 2H), 7.91 (d, J(H,H) = 8.8 Hz, 2H),
7.85 (s, 1H), 3.68 (q, J(H,F) = 9.0 Hz, 2H), 2.80 (s, 3H). 13C NMR
3
(75 MHz, CD3OD, 25 °C): δ = 168.7, 154.3, 141.2, 139.8, 125.6 (q,
1J(C,F) = 277 Hz),117.1, 45.1 (q, 2J2J(C,F) = 35 Hz), 12.9. MS [M +
H]+ m/z 337.
4-(2-Methylthiazol-4-yl)-N-(3,3,3-trifluoropropyl)-
benzenesulfonamide (17). General procedure (iii) with 3,3,3-
trifluoropropylamine hydrochloride (26.9 mg, 0.18 mmol). Yield
1
26.6 mg of a beige powder, 39%. H NMR (300 MHz, CD3OD, 25
3
3
°C): δ = 8.10 (d, J(H,H) = 8.8 Hz, 2H), 7.90 (d, J(H,H) = 8.8 Hz,
3
2H), 7.86 (s, 1H), 3.12 (t, J(H,H) = 7.3 Hz, 2H), 2.77 (s, 3H), 2.39
(qt, J(H,F) = 10.8 Hz, J(H,H) = 7.3 Hz, 2H). 13C NMR (75 MHz,
3
3
CD3OD, 25 °C): δ = 168.7, 154.3, 140.5, 139.8, 128.6, 127.9, 127.6 (q,
4886
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
1
gave the final compound 20 (54 mg, 76%) as a white solid. H NMR
(300 MHz, MeOD, 25 °C): δ = 8.05−8.02 (d, 3J(H,H) = 8.7 Hz, 2H),
AUTHOR INFORMATION
■
Corresponding Authors
3
7.95 (s, 1H), 7.89−7.86 (d, J(H,H) = 8.7 Hz, 2H), 4.62 (s, 2H),
3
*For N.W.: phone, +33 (0)320 964 991; fax, +33 (0) 320 964
709; e-mail, nicolas.willand@univ-lille2.fr. Websites: U761,
http://www. deprezlab. fr; PRIM, http://www.
drugdiscoverylille.org.
*For B.D.: phone, +33 (0)320 964 924; fax, +33 (0) 320 964
709; e-mail: benoit.deprez@univ-lille2.fr.
3.66−3.62 (t, J(H,H) = 7.0 Hz, 2H), 3.13−3.08 (m, 2H), 2.62−2.46
3
3
(qt, J(H,F) = 11.0 Hz J(H,H) = 7.0 Hz, 2H), 1.89−1.76 (sextuplet,
3J(H,H) = 7.6 Hz, 2H), 1.05−1.00 (t, J(H,H) = 7.5 Hz, 2H). 13C
3
NMR (75 MHz, MeOD, 25 °C): δ = 170.0, 168.4, 154.1, 137.3, 133.2,
127.4, 126.6 (q, 1J(C,F) = 275.9 Hz), 125.9, 115.4, 54.2, 43.7, 33.1 (q,
3J(C,F) = 3.7 Hz), 32.7 (q, J(C,F) = 28.1 Hz), 17.0, 11.8. MS [M −
2
H]− m/z 434. HRMS (m/z) for C17H19O3N3F3S2 [M − H]−
calculated, 434.08434; found, 409.0826.
Present Address
△Center of Excellence, Helwan Structure Biology Research,
Faculty of Pharmacy, Helwan University, Cairo, Egypt.
4-(3-(Phenylsulfonamido)prop-1-ynyl)-N-(3,3,3-trifluoropropyl)-
benzamide (21). In a 25 mL round-bottom flask were subsequently
added DCM (8 mL), benzenesulfonyl chloride (200 μL, 1.57 mmol),
DIEA (1.08 mL, 6.24 mmol), and propargylamine (129 μL, 1.88
mmol). The mixture was stirred at room temperature for 2 h. DCM
was evaporated in vacuo. The residue was dissolved in AcOEt and
washed twice with water and once with brine. The organic layer was
then dried over magnesium sulfate and concentrated in vacuo.
Purification by preparative HPLC gave N-(prop-2-ynyl)-
benzenesulfonamide 21a (238 mg, 78%) as a beige powder.
To a stirred solution of 4-iodobenzoic acid (300 mg, 1.21 mmol),
HOBt (33 mg, 0.24 mmol), HBTU (551 mg, 1.45 mmol), and DIEA
(840 μL, 4.84 mmol) in DMF over a molecular sieve (10 mL) was
added 3,3,3-trifluoropropylamine hydrochloride (181 mg, 1.21 mmol).
The mixture was stirred for 2 h at room temperature. DMF was then
evaporated in vacuo. The residue was dissolved in AcOEt and washed
with HCl 1N, saturated NaHCO3, and brine. The organic layer was
then dried over magnesium sulfate and concentrated in vacuo.
Purification by flash column chromatography (8:2 cyclohexane-ethyl
acetate) gave 4-iodo-N-(3,3,3-trifluoropropyl)benzamide 21b (318
mg, 77%) as a white powder. 1H NMR (300 MHz, CDCl3, 25 °C): δ =
7.80 (d, 3J(H,H) = 8.5 Hz, 2H), 7.47 (d, 3J(H,H) = 8.5 Hz, 2H), 6.34
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
We thank Dr. Zoe
́
Lens for technical assistance. We are grateful
to the institutions that support our laboratory (Inserm),
INSERM-Avenir fellowship to Priscille Brodin, Institut Pasteur
Korea (grants: K204EA000001-08E0100-00100 and
K204EA000001-09E0100-00100), Universite Lille Nord de
France, Institut Pasteur de Lille, CNRS, EU, Reg
Pas de Calais, FEDER (no. 09220019 and 09220020 PRESAGE
31510), ANR (ANR-06-EMPB-033), and PRIM, Pole de
Recherche Interdisciplinaire du Medicament. Rene Wintjens
is Research Associate at the Belgian Fund for Scientific
Research (FNRS). Data management was performed using
Pipeline Pilot from Accelrys. We thank VARIAN Inc. for their
technical support. RMN acquisitions were done at the
LARMN, Lille.
́
ion Nord-
̂
́
́
3
3
(br s, 1H), 3.72 (q, J(H,H) = 6.3 Hz, 2H), 2.47 (qt, J(H,F) = 10.7
ABBREVIATIONS USED
3
■
Hz J(H,H) = 6.4 Hz, 2H). LCMS (m/z) 342 [M − H]−.
AcOEt, ethyl acetate; CH3CN, acetonitrile; DCE, 1,2-dichloro-
ethane; DCM, dichloromethane; DIEA, diisopropylethylamine;
DME, dimethoxyethane; DMF, dimethylformamide; DMSO,
dimethyl sulfoxide; DTT, dithiothreitol; ETH, ethionamide;
FBDD, fragment-based drug design; HAC, heavy atom count;
HBTU, O-benzotriazole-N,N,N′,N′-tetramethyluronium hexa-
fluorophosphate; HOBt, N-hydroxybenzotriazole; HTS, high
throughput screening; MDR-TB, multidrug resistant tuber-
culosis; MeOH, methanol; MIC, minimal inhibitory concen-
tration; NMP, 4-methylmorpholine; PBS, phosphate buffered
saline; RMSD, root-mean-square deviation; SAR, structure−
activity relationships; SPR, surface plasmon resonance; TB,
tuberculosis; TEA, triethylamine; THF, tetrahydrofuran; TLC,
thin layer chromatography; Tm, melting temperature; TSA,
thermal shift assay
In a Schlenk flask were subsequently added 21b (600 mg, 1.75
mmol), 21a (341 mg, 1.75 mmol), PdCl2(PPh3)2 (61.4 mg, 0.087
mmol), CuI (300 mg, 1.58 mmol), dry DMF (7.5 mL), and TEA (874
μL, 5.05 mmol) under argon. The mixture was stirred at 80 °C
overnight, then cooled to room temperature and a AcOEt 1/1
NH4Clsatd mixture (15 mL) was added and stirred at room
temperature for 15 min. The organic layer was washed three times
with NH4Clsatd, then with water and brine. The organic layer was then
dried over magnesium sulfate and concentrated in vacuo. Purification
by flash column chromatography (5:95−10:90 EtOAc−DCM) gave
compound 21 (311 mg, 43%) as a white powder. 1H NMR (300 MHz,
CD3OD, 25 °C): δ = 7.94−7.91 (m, 2H), 7.69 (d, 3J(H,H) = 8.4 Hz,
3
2H), 7.57−7.49 (m, 2H), 7.20 (d, J(H,H) = 8.4 Hz, 2H), 4.06 (s,
3
3
2H), 3.61 (t, J(H,H) = 7.0 Hz, 2H), 2.51 (qt, J(H,F) = 10.9 Hz
3J(H,H) = 7.0 Hz, 2H). 13C NMR (75 MHz, CD3OD, 25 °C): δ =
169.4, 142.3, 134.9, 133.7, 132.6, 130.1, 128.4, 128.1, 127.2, 87.7, 84.0,
34.5 (q, 3J(C,F) = 3.9 Hz), 34.0 (q, 2J(C,F) = 28.2 Hz), 33.9. MS [M
+ H]+ m/z 411. HRMS (m/z) for C19H17F3N2O3S [M − H]−
calculated, 409.08413; found, 409.08404.
REFERENCES
■
(1) Global Tuberculosis Control; World Health Organization: Geneva,
2013.
(2) Koul, A.; Arnoult, E.; Lounis, N.; Guillemont, J.; Andries, K. The
challenge of new drug discovery for tuberculosis. Nature 2011, 469,
483−490.
ASSOCIATED CONTENT
■
S
* Supporting Information
́
(3) Villemagne, B.; Crauste, C.; Flipo, M.; Baulard, A. R.; Deprez, B.;
List of arylsulfonyl chlorides and amines used for in silico
chemical library synthesis and data collection statistics. This
material is available free of charge via the Internet at http://
pubs.acs.org.
Willand, N. Tuberculosis: the drug development pipeline at a glance.
Eur. J. Med. Chem. 2012, 51, 1−16.
(4) Zumla, A.; Nahid, P.; Cole, S. T. Advances in the development of
new tuberculosis drugs and treatment regimens. Nature Rev. Drug
Discovery 2013, 12, 388−404.
Accession Codes
The following codes have been deposited in the Protein Data
Bank: 20, 4M3E; 21, 4M3D; 8, 4M3F; 17, 4M3G; 19, 4M3B.
(5) Payne, D. J.; Gwynn, M. N.; Holmes, D. J.; Pompliano, D. L.
Drugs for bad bugs: confronting the challenges of antibacterial
discovery. Nature Rev. Drug Discovery 2007, 6, 29−40.
4887
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888

Journal of Medicinal Chemistry
Article
(6) Cole, S. T.; Riccardi, G. New tuberculosis drugs on the horizon.
Curr. Opin. Microbiol. 2011, 14, 570−576.
́
Villeret, V.; Christophe, T.; Jeon, H. K.; Locht, C.; Brodin, P.; Deprez,
B.; Baulard, A. R.; Willand, N. Ethionamide boosters: synthesis,
biological activity, and structure−activity relationships of a series of
1,2,4-oxadiazole EthR inhibitors. J. Med. Chem. 2011, 54, 2994−3010.
(24) Flipo, M.; Desroses, M.; Lecat-Guillet, N.; Villemagne, B.;
Blondiaux, N.; Leroux, F.; Piveteau, C.; Mathys, V.; Flament, M.-P.;
(7) Chessari, G.; Woodhead, A. J. From fragment to clinical
candidatea historical perspective. Drug Discovery Today 2009, 14,
668−675.
(8) Congreve, M.; Chessari, G.; Tisi, D.; Woodhead, A. J. Recent
developments in fragment-based drug discovery. J. Med. Chem. 2008,
51, 3661−3680.
Siepmann, J.; Villeret, V.; Wohlkonig, A.; Wintjens, R.; Soror, S. H.;
̈
́
Christophe, T.; Jeon, H. K.; Locht, C.; Brodin, P.; Deprez, B.; Baulard,
A. R.; Willand, N. Ethionamide boosters. 2. Combining bioisosteric
replacement and structure-based drug design to solve pharmacokinetic
issues in a series of potent 1,2,4-oxadiazole EthR inhibitors. J. Med.
Chem. 2012, 55, 68−83.
(9) Manger, M.; Scheck, M.; Prinz, H.; von Kries, J. P.; Langer, T.;
Saxena, K.; Schwalbe, H.; Furstner, A.; Rademann, J.; Waldmann, H.
̈
Discovery of Mycobacterium tuberculosis protein tyrosine phosphatase
A (MptpA) inhibitors based on natural products and a fragment-based
approach. ChemBioChem 2005, 6, 1749−1753.
(25) Flipo, M.; Willand, N.; Lecat-Guillet, N.; Hounsou, C.;
Desroses, M.; Leroux, F.; Lens, Z.; Villeret, V.; Wohlkonig, A.;
̈
(10) Rawls, K. A.; Therese Lang, P.; Takeuchi, J.; Imamura, S.;
Baguley, T. D.; Grundner, C.; Alber, T.; Ellman, J. A. Fragment-based
discovery of selective inhibitors of the Mycobacterium tuberculosis
protein tyrosine phosphatase PtpA. Bioorg. Med. Chem. Lett. 2009, 19,
6851−6854.
Wintjens, R.; Christophe, T.; Kyoung Jeon, H.; Locht, C.; Brodin, P.;
́
Baulard, A. R.; Deprez, B. Discovery of novel N-phenylphenoxyace-
tamide derivatives as EthR inhibitors and ethionamide boosters by
combining high-throughput screening and synthesis. J. Med. Chem.
2012, 55, 6391−6402.
(11) Soellner, M. B.; Rawls, K. A.; Grundner, C.; Alber, T.; Ellman, J.
A. Fragment-based substrate activity screening method for the
identification of potent inhibitors of the Mycobacterium tuberculosis
phosphatase PtpB. J. Am. Chem. Soc. 2007, 129, 9613−9615.
(12) Alvin, W. H.; Silvestre, H. L.; Shijun, W.; Alessio, C.; Tom, L.
B.; Chris, A. Application of fragment growing and fragment linking to
the discovery of inhibitors of Mycobacterium tuberculosis pantothenate
synthetase. Angew. Chem., Int. Ed. 2009, 48, 8452−8456.
(13) Scheich, C.; Puetter, V.; Schade, M. Novel small molecule
inhibitors of MDR Mycobacterium tuberculosis by NMR fragment
screening of antigen 85C. J. Med. Chem. 2010, 53, 8362−8367.
(14) Hudson, S. A.; McLean, K. J.; Surade, S.; Yang, Y.-Q.; Leys, D.;
Ciulli, A.; Munro, A. W.; Abell, C. Application of fragment screening
and merging to the discovery of inhibitors of the Mycobacterium
tuberculosis cytochrome P450 CYP121. Angew. Chem., Int. Ed. 2012,
51, 9311−9316.
(15) Hudson, S. A.; Surade, S.; Coyne, A. G.; McLean, K. J.; Leys, D.;
Munro, A. W.; Abell, C. Overcoming the limitations of fragment
merging: rescuing a strained merged fragment series targeting
Mycobacterium tuberculosis CYP121. ChemMedChem 2013, 8, 1451−
1456.
(16) Tran, A. T.; West, N. P.; Britton, W. J.; Payne, R. J. Elucidation
of Mycobacterium tuberculosis type II dehydroquinase inhibitors using a
fragment elaboration strategy. ChemMedChem 2012, 7, 1031−1043.
(17) Surade, S.; Nancy, T.; Hengrung, N.; Lechartier, B.; Cole, S. T.;
Abell, C.; Blundell, T. L. A structure-guided fragment-based approach
for the discovery of allosteric inhibitors targeting the lipophilic binding
site of transcription factor EthR. Biochem. J. 2014, 458, 387−394.
(18) Chambers, H. F.; Moreau, D.; Yajko, D.; Miick, C.; Wagner, C.;
́
(26) Willand, N.; Desroses, M.; Toto, P.; Dirie, B.; Lens, Z.; Villeret,
V.; Rucktooa, P.; Locht, C.; Baulard, A.; Deprez, B. Exploring drug
target flexibility using in situ click chemistry: application to a
mycobacterial transcriptional regulator. ACS Chem. Biol. 2010, 5,
1007−1013.
(27) Rees, D. C.; Congreve, M.; Murray, C. W.; Carr, R. Fragment-
based lead discovery. Nature Rev. Drug Discovery 2004, 3, 660−672.
(28) Jhoti, H.; Williams, G.; Rees, D. C.; Murray, C. W. The ‘rule of
three’ for fragment-based drug discovery: where are we now? Nature
Rev. Drug Discovery 2013, 12, 644−645.
(29) Hopkins, A. L.; Groom, C. R.; Alex, A. Ligand efficiency: a
useful metric for lead selection. Drug Discovery Today 2004, 9, 430−
431.
(30) Hopkins, A. L.; Keseru, G. M.; Leeson, P. D.; Rees, D. C.;
Reynolds, C. H. The role of ligand efficiency metrics in drug discovery.
Nature Rev. Drug Discovery 2014, 13, 105−121.
(31) Hagmann, W. K. The many roles for fluorine in medicinal
chemistry. J. Med. Chem. 2008, 51, 4359−4369.
(32) Christophe, T.; Jackson, M.; Jeon, H. K.; Fenistein, D.;
Contreras-Dominguez, M.; Kim, J.; Genovesio, A.; Carralot, J.-P.;
Ewann, F.; Kim, E. H.; Lee, S. Y.; Kang, S.; Seo, M. J.; Park, E. J.;
̌
́
Skovierova, H.; Pham, H.; Riccardi, G.; Nam, J. Y.; Marsollier, L.;
Kempf, M.; Joly-Guillou, M.-L.; Oh, T.; Shin, W. K.; No, Z.; Nehrbass,
U.; Brosch, R.; Cole, S. T.; Brodin, P. High content screening identifies
decaprenyl-phosphoribose 2′ epimerase as a target for intracellular
antimycobacterial inhibitors. PLoS Pathog. 2009, 5, e1000645.
(33) Christophe, T.; Ewann, F.; Jeon, H. K.; Cechetto, J.; Brodin, P.
High-content imaging of Mycobacterium tuberculosis-infected macro-
phages: an in vitro model for tuberculosis drug discovery. Future Med.
Chem. 2010, 2, 1283−1293.
Hackbarth, C.; Kocagoz, S.; Rosenberg, E.; Hadley, W. K.; Nikaido, H.
̈
Can penicillins and other beta-lactam antibiotics be used to treat
tuberculosis? Antimicrob. Agents Chemother. 1995, 39, 2620−2624.
(19) Vannelli, T. A.; Dykman, A.; Ortiz de Montellano, P. R. The
antituberculosis drug ethionamide is activated by a flavoprotein
monooxygenase. J. Biol. Chem. 2002, 277, 12824−12829.
(20) Baulard, A. R.; Betts, J. C.; Engohang-Ndong, J.; Quan, S.;
McAdam, R. A.; Brennan, P. J.; Locht, C.; Besra, G. S. Activation of the
pro-drug ethionamide is regulated in mycobacteria. J. Biol. Chem. 2000,
275, 28326−28331.
(34) Brodin, P.; Christophe, T. High-content screening in infectious
diseases. Curr. Opin. Chem. Biol. 2011, 15, 534−539.
(35) Dover, L. G.; Corsino, P. E.; Daniels, I. R.; Cocklin, S. L.;
Tatituri, V.; Besra, G. S.; Futterer, K. Crystal structure of the TetR/
CamR family repressor Mycobacterium tuberculosis EthR implicated in
ethionamide resistance. J. Mol. Biol. 2004, 340, 1095−1105.
(36) Kabsch, W. XDS. Acta Crystallogr., Sect. D: Biol. Crystallogr.
2010, 66, 125−132.
(37) The CCP4 suite: programs for protein crystallography. Acta
Crystallogr., Sect. D: Biol. Crystallogr. 1994, 50, 760−763.
(38) Emsley, P.; Lohkamp, B.; Scott, W. G.; Cowtan, K. Features and
development of Coot. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2010,
66, 486−501.
(21) DeBarber, A. E.; Mdluli, K.; Bosman, M.; Bekker, L. G.; Barry,
C. E., III. Ethionamide activation and sensitivity in multidrug-resistant
Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U. S. A. 2000, 97,
9677−9682.
(22) Willand, N.; Dirie, B.; Carette, X.; Bifani, P.; Singhal, A.;
Desroses, M.; Leroux, F.; Willery, E.; Mathys, V.; Deprez-Poulain, R.;
Delcroix, G.; Frenois, F.; Aumercier, M.; Locht, C.; Villeret, V.;
Deprez, B.; Baulard, A. R. Synthetic EthR inhibitors boost
antituberculous activity of ethionamide. Nature Med. 2009, 15, 537−
544.
(23) Flipo, M.; Desroses, M.; Lecat-Guillet, N.; Dirie,
Leroux, F.; Piveteau, C.; Demirkaya, F.; Lens, Z.; Rucktooa, P.;
́
B.; Carette, X.;
4888
dx.doi.org/10.1021/jm500422b | J. Med. Chem. 2014, 57, 4876−4888