Synthesis and biological evaluation of imidazo[1,2-a]pyrimidines and imidazo[1,2-a]pyridines as new inhibitors of the Wnt/β-catenin signaling

Article abstract of DOI:10.1016/j.ejmech.2014.05.071

Wnt/β-catenin signaling plays an important role in the regulation of embryonic development and tumorigenesis. Since its deregulation results in severe human diseases, especially cancer, the Wnt signaling pathway constitutes a promising platform for pharmacological targeting of cancer. In this study we synthesized a series of imidazo[1,2-a]pyrimidines and imidazo[1,2-a]pyridines and identified some derivatives that were able to inhibit the Wnt/β-catenin signaling pathway in a luciferase reporter assay and cell proliferation in selected cancer cell lines, endowed with APC or β-catenin gene mutations. The most active compounds significantly downregulate the expression of Wnt target genes such as c-myc and cyclin D1. Further studies indicated that these compounds function independently of GSK-3β activity. More importantly, in vivo experiments, carried out on a Wnt-reporter zebrafish model indicate, in particular for compounds 4c and 4i as the most active compounds, an activity comparable to that of the reference compound IWR1, suggesting their potential use not only as small molecule inhibitors of the Wnt/β-catenin signal in Wnt driven cancers, but also in other Wnt-related diseases.

Full text of DOI:10.1016/j.ejmech.2014.05.071

Accepted Manuscript
Synthesis and biological evaluation of imidazo[1,2-a]pyrimidines and
imidazo[1,2-a]pyridines as new inhibitors of the Wnt/β-catenin signaling
Barbara Cosimelli , Sonia Laneri , Carmine Ostacolo , Antonia Sacchi , Elda Severi ,
Elena Porcù , Elena Rampazzo , Enrico Moro , Giuseppe Basso , Giampietro Viola
PII:
S0223-5234(14)00503-0
10.1016/j.ejmech.2014.05.071
EJMECH 7029
DOI:
Reference:
To appear in: European Journal of Medicinal Chemistry
Received Date: 27 January 2014
Revised Date: 19 May 2014
Accepted Date: 30 May 2014
Please cite this article as: B. Cosimelli, S. Laneri, C. Ostacolo, A. Sacchi, E. Severi, E.
Porcù, E. Rampazzo, E. Moro, G. Basso, G. Viola, Synthesis and biological evaluation of
imidazo[1,2-a]pyrimidines and imidazo[1,2-a]pyridines as new inhibitors of the Wnt/β-catenin signaling,
European Journal of Medicinal Chemistry (2014), doi: 10.1016/j.ejmech.2014.05.071.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT
Synthesis and biological evaluation of imidazo[1,2-
a]pyrimidines and imidazo[1,2-a]pyridines as new
inhibitors of the Wnt/β-catenin signaling
a,
a
a
a
Barbara Cosimelli *, Sonia Laneri , Carmine Ostacolo , Antonia Sacchi ,
a
b
b
c
Elda Severi , Elena Porcù , Elena Rampazzo , Enrico Moro , Giuseppe
b
b,
Basso , Giampietro Viola *
a
Dipartimento di Farmacia, Università di Napoli Federico II, Via D. Montesano 49, 80131 Napoli
(Italy)
b
Dipartimento di Salute della Donna e del Bambino, Università di Padova, Via Giustiniani 3,
5128 Padova, (Italy)
3
c
Dipartimento di Scienze Biomediche, Università di Padova, Viale G. Colombo 3, 35121
Padova, (Italy)
Corresponding authors: B. C. Phone: (+39) 081678614; Fax: (+39) 081678107. E-mail:
barbara.cosimelli@unina.it. G. V. Phone: (+39) 0498211451; Fax: (+39) 0498211462. E-mail:
giampietro.viola.1@unipd.it
1

ACCEPTED MANUSCRIPT
ABSTRACT:
Wnt/β-catenin signaling plays an important role in the regulation of embryonic development and
tumorigenesis. Since its deregulation results in severe human diseases, especially cancer, the
Wnt signaling pathway constitutes a promising platform for pharmacological targeting of cancer.
In this study we synthesized a series of imidazo[1,2-a]pyrimidines and imidazo[1,2-a]pyridines
and identified some derivatives that were able to inhibit the Wnt/β-catenin signaling pathway in
a luciferase reporter assay and cell proliferation in selected cancer cell lines, endowed with APC
or β-catenin gene mutations. The most active compounds significantly downregulate the
expression of Wnt target genes such as c-myc and cyclin D1. Further studies indicated that
these compounds function independently of GSK-3β activity. More importantly, in vivo
experiments, carried out on a Wnt-reporter zebrafish model indicate, in particular for
compounds 4c and 4i as the most active compounds, an activity comparable to that of the
reference compound IWR1, suggesting their potential use not only as small molecule inhibitors
of the Wnt/β-catenin signal in Wnt driven cancers, but also in other Wnt-related diseases.
Keywords: Wnt signaling; β-catenin; signal transduction; colorectal cancer; imidazo[1,2-
a]pyrimidines; imidazo[1,2-a]pyridines.
2

ACCEPTED MANUSCRIPT
Abbreviations:
APC (Adenomatous Polyposis Coli)
CBP (Cyclic AMP response element-Binding Protein)
DAPI (4',6-diamidino-2-phenylindole)
GFP (Green Fluorescent Protein)
LEF (Lymphoid Enhancing Factor)
MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide)
TCF (T-Cell Factor)
3

ACCEPTED MANUSCRIPT
1
. Introduction
Wnt signaling pathway is a highly conserved system which has a crucial role in embryogenesis
of all metazoan, in tissue regeneration in adult organisms and in many other processes [1],
including cellular proliferation, differentiation, migration and polarity [2]. Wnt ligands are a large
family of secreted, hydrophobic glycoproteins which have many receptors on a variety of cell
types [3]. Three different pathways have been described as signaling cascades activated upon
the binding of Wnts to the receptor: the canonical Wnt/β-catenin pathway, the non-canonical
2+
planar cell polarity (PCP) cascade, and the Wnt/Ca pathway [4]. This work is focused on the
best understood canonical pathway. Downstream effect of activation of this cascade is
transcription of a new set of genes through the β-catenin-T cell factor (TCF) complex, which
regulates cell proliferation and differentiation [5]. In canonical pathway, when Wnts are
associated to their cell-surface receptor Frizzled, signal cascade is active and stable β-catenin
forms a complex with TCF in the nucleus, recruiting transcriptional coactivators like cyclic AMP
response element-binding protein (CBP). Such complex activates the transcription of Wnt target
genes. If Wnt ligands are not associated to Frizzled, the cytoplasmic complex APC–Axin2
provides a scaffold for GSK-3β which phosphorylates β-catenin [6]. Phosphorylation is a
destabilizing process for β-catenin which is rapidly degraded through the ubiquitin-proteasome
pathway. Wnts and Frizzled interaction induces Dishevelled phosphorylation which, in that form,
triggers GSK-3β inhibition [7,8]. Subsequently the balance between Axin2 and β-catenin
favorites the latter protein and Wnt signaling is turned on [9]. A critical role of canonical cascade
has been described in regulation of stem cells, and in many tissues impairment of Wnt signaling
is associated with cancer [10]. Wnt involvement in human cancer is not surprising given its
fundamental role in homeostasis in adult tissue [11], and it has since been buttressed by the
identification of mutations in genes coding for the Wnt pathway components Axin2,
Adenomatous polyposis coli (APC), and β-catenin [12]. Indeed, loss of function of Wnt
components (such as the inactivation of the APC gene) or activating mutations of β-catenin are
4

ACCEPTED MANUSCRIPT
believed to be the critical initiating steps in malignant transformation [13]. Specific genetic hit
mutations in a series of oncogenes and tumor-suppressor genes (APC, KRAS, SMAD2/4,
TP53) give rise to colorectal carcinomas through a series of well-characterized histopathological
changes [14]. Particularly, deregulation of canonical Wnt/β-catenin signaling through mutations
in APC was recognized to be an initiating event in colon carcinogenesis [15,16]. However,
despite the presence of constitutively activating mutations in APC or β-catenin, most colorectal
cancers show cellular heterogeneity when β-catenin localization is analyzed, indicating a more
complex regulation of Wnt signaling [17]. Anyway, the Wnt/β-catenin signaling pathway could be
qualified as one of the promising target for innovative treatment strategies of colorectal cancer
[
18]. Moreover, given the fact that Wnt/β-catenin signaling is tightly regulated at multiple cellular
levels, the pathway itself offers ample targeting nodal points for cancer drug development [19].
Recently, several Wnt inhibitors were identified in high-throughput screening that target the
upstream signaling of β-catenin in order to promote β-catenin degradation [20]. Although these
agents efficiently inhibit Wnt signaling in normal cells and some APC-mutated colon cancer cells,
they may not be effective in cells containing β-catenin mutations [21]. Despite in the last years
many advances have been achieved in that field, the majority of patients relapses and the
survival with metastatic disease remains approximately two years, indicating the need for new
therapies that may produce dramatic improvements [22]. As just noted, high-throughput
screening of synthetic compounds libraries was used to identify several Wnt inhibitors [20, 23,
2
4], as well as agonists [25,26]. This method efforts several structures all characterized by a
pyrimidine ring decorated with a large variety of substituents or, also, condensed with other
heterocycle rings (see as example compounds reported into Chart 1).
Chart 1 near here
5

ACCEPTED MANUSCRIPT
In the past years we have been engaged in the synthesis of pyrimidines derivatives [27],
imidazo[1,2-a]pyrimidines [28] and imidazo[1,2-a]pyridines [29], now we used our knowledge in
the synthesis of these heterocycles to prepare a small library of 2,4,6-substituted pyrimidines
and a small library of imidazo[1,2-a]pyrimidines and imidazo[1,2-a]pyridines that resemble
geometry or functional groups of the known active compounds; indeed it has been reported that
some NSAIDs are potential Wnt pathway therapeutics [30], and the imidazo[1,2-a]pyridine
derivatives are often compared to indomethacin [31,32] that is active on Wnt pathway [33]. The
molecules reported in Chart 2 were then evaluated for their biological activity on WNT pathway.
Chart 2 near here
2
. Chemistry
The derivatives 1e and 1f were synthesized as previously described [27]. A similar method
Scheme 1) was performed to obtain compounds 1a-d, and 2a-d. Starting from the
(
commercially available 4-amino-6-hydroxy-2-mercaptopyrimidine monohydrate (5), first of all
was allowed the alkylation of the sulfur atom in 2-position by reaction with benzylbromide in
NaOH 1M to give compound 6 [27] which was collected by filtration and resulted sufficiently
pure to be used in the next step without further purification. As known [27], the second step, i.e.
the alkylation of the derivative 6, always gave, due to the keto-enol equilibrium of the
pyrimidinone scaffold, a mixture of the isomeric products 1a,1c and 2a,2c, respectively. The
experimental conditions were extensively studied with regards to solvent (DMF, acetonitrile,…),
base quantities, temperature, and time of reaction. The best results were obtained when the
reaction was carried out in aqueous DMF in the presence of K CO as base and a threefold
2
3
excess of haloalkane. The isomers were then easily isolated by flash-chromatography and
characterized. The final step was the conversion of the amino group of 1a,1c or 2a,2c, into the
amide group of 1b,1d or 2b,2d by reaction with acetyl chloride in THF.
6

ACCEPTED MANUSCRIPT
Scheme 1 near here
The synthetic method used to prepare imidazo[1,2-a]pyridine and pyrimidine compounds is
based on the reaction of an heteroarylamine with an α-haloacetophenone: in this case, the
reaction of the opportune 2-aminopyrimidine with 4-nitrobromoacetophenone in ethanolic
solution afforded (Scheme 2) the required new 5,7-disubstituted 2-(4-nitrophenyl)imidazo[1,2-
a]pyridimidine derivative 3a and successively the reaction with SnCl in DMF of 3a gave the
2
required 3b. Compound 3b and iodomethane (ratio 2:1) in CHCl and DMAP gave the desired
3
3
c; whereas the reaction of 3b and benzylbromide (ratio 1:3) in the same conditions gave the
required derivatives 3d and 3e (Scheme 2).
Scheme 2 near here
The similar compounds 3f [34], 4a [29], 4b [29], 4e [29], 4f [35], and 4g [35,36] have been
previously reported in literature.
Benzyl bromide was allowed to react with 3f [34], (molar ratio = 1:2) in a solution of CHCl and
3
DMAP to give the new 3g (Scheme 3).
Scheme 3 near here
From aminopyrimidines 4b [29], or 4g [35,36] and benzyl bromide (molar ratio = 1:3) we
obtained, in the usual conditions, the derivatives 4c and 4d or 4h and 4i, respectively (Scheme
4
):
Scheme 4 near here
7

ACCEPTED MANUSCRIPT
Finally, the amide 4j was obtained by 4g [35,36] and phthalic anhydride (ratio 1:2) in dioxane
solution (Scheme 5):
Scheme 5 near here
3
. Results and Discussion
3
.1. Newly synthesized compounds impaired TCF/LEF transcriptional activity
In order to evaluate the effect of the new compounds on the Wnt/β-catenin signaling cascade,
we used a luciferase-reporter system. After liposomal transfection to insert into HT-29 cells the
BAT-LUX vector, containing luciferase gene downstream the TCF/LEF promoter [37], we
treated the transfected cells with our derivatives for 24 hours. Then, the cells were assayed for
the β-catenin/TCF mediated activity. The data are depicted in Table 1 in which the IC values
50
represent the concentrations that cause 50% inhibition of β-catenin transcriptional activity. Two
known inhibitors of the Wnt signaling response were used as reference compounds: IWR1, an
Axin stabilizer [23], and ICG001 which is endowed with an effect downstream the β-catenin
degradation complex, disrupting the CBP-β-catenin interaction [38]. Pyrimidine derivatives 1a-d
and 2a-2d were inactive or moderately active. Among the imidazo[1,2-a]pyridine derivatives
compounds 4c, 4d, 4h and 4i showed a good activity, similar to that of the two reference
compounds. The most active compound 4a has a p-nitrophenyl while the activity decrease in 4b
where an aminophenyl is present. Interestingly, 4f, that is the isomer of 4a, had reduced activity
pointing out that the position of methyl group has an important role in modulating the activity. On
the contrary 4g, the isomer of 4b, have has similar efficacy.
Table 1 near here
8

ACCEPTED MANUSCRIPT
The 5,7-dimethoxy-2-(4-nitrophenyl)imidazo[1,2-a]pyridimidine derivatives 3a, 3c, 3d and 3e
were inactive except 3b whereas 5-(hydroxyl)-7-methyl-2-(4-nitrophenyl)imidazo[1,2-
a]pyrimidine (3f) and 5-(benzyloxy)-7-methyl-2-(4-nitrophenyl)imidazo[1,2-a]pyrimidine (3g)
exhibit a value of IC lower than both IWR1 and ICG001.
50
3
.2. Biological in vitro activity: antiproliferative studies
All derivatives were tested in a panel of four human cancer cell lines to determine their
antiproliferative activity after 72 hours of treatment. We used two human colon adenocarcinoma
cell lines, HT-29 and LoVo, with mutated APC gene and the liver hepatocellular carcinoma
HepG2 cell line, endowed with endogenously mutated β-catenin gene. In addition, the
pulmonary epithelial cancer cells A549, endowed with high levels of Wnt2 were also used. All of
the reported mutations result in an upregulated Wnt signaling [39,40]. As shown in Table 2, GI50
values in all cell lines ranging from 5.7 to more than 100 ꢀM, and the more active compounds
against all cell lines are 4i and 4c which exhibited a lower GI values in comparison to the
50
reference compounds IWR1 and ICG001, in the two colon adenocarcinoma cell lines (HT-29
and LoVo). Compound 4i on HepG2 and A549 cells presented an higher activity respect to
IWR1 but slightly lower than ICG001. On the other hand, 4c was ineffective in HepG2 and was
endowed with a higher value of GI in A549 cells. Interestingly, some of the most active
50
compounds (3f, 4c, 4h, 4i) exhibited a lower activity or were ineffective in a primary cell line of
human fibroblast, in which the Wnt/β-catenin signaling status is inactive (Supporting Information,
Table 1SI), suggesting that these compounds are selectively toxic to cell lines harboring
deregulation of the Wnt/β-catenin pathway. On the basis of the results obtained both in the
luciferase-based assay and in the antiproliferative studies, we selected five molecules (3f, 4a,
4
c, 4e, 4i), within the more active compounds that induce antiproliferative effects and antagonist
action to β-catenin transcriptional activity, that were further evaluated for their ability to decrease
the expression of Wnt target genes in HT-29 cell line.
9

ACCEPTED MANUSCRIPT
Table 2 near here
3
.3. β-catenin transcriptional activity was modulated independently by GSK-3β.
To evaluate on which step of Wnt/β-catenin signaling these compounds act, we treated HT-29
cells transfected with BAT-LUX plasmid, with selected compounds in the presence or absence
of LiCl, a GSK-3β inhibitor. LiCl avoids β-catenin degradation by GSK-3β enzyme, thus the
effect on luciferase activity resulted independent by this enzyme. As reported in Figure 1, LiCl
increased the TCF/LEF transcriptional activity by four times respect to the untreated cells, while
the selected compounds, at the concentration of 25 ꢀM, remarkably reduced luciferin
luminescence both in absence and in presence of LiCl, after 24 hours of treatment, indicating
that their effect did not depend on GSK-3β activity.
Figure 1 near here
Moreover, as shown in Figure 2, the mRNA expression of Axin2 was generally upregulated in
particular by 4i and 3f as well as the reference compounds, confirming an inhibitory effect on
Wnt pathway. In this context, it is worthwhile to note that new molecules have been described
as Axin2 inducers or stabilizers [23], given its role as Wnt signaling repressor. On the other
hand Axin2 itself is also a direct target of the Wnt signaling and regulates the pathways through
a negative feedback loop. Its upregulation after treatment with our compounds, suggest that a
repressive mechanism on Wnt pathway has been activated.
Figure 2 near here
3
.4. Upstream β-catenin modulators were differently regulated by selected compounds.
1
0

ACCEPTED MANUSCRIPT
We investigated if the most active compounds alter the expression of the main molecules of the
canonical Wnt pathway, that trigger β-catenin translocation into the nucleus. Immunoblot
analysis depicted in Figure 3, shows that total levels of β-catenin protein were not modified after
treatment. On the other hand we observed β-catenin dephosphorylation in S33/37/T41 induced
by 4e, 4i and particularly 4c. Interestingly, treatment with the new compounds led to
modifications in β-catenin localization, mainly sited into the cytoplasm in its inactive form (shown
in red, Figure 4 and Supporting Information 1SI).
Figure 3 near here
Figure 4 near here
None of the tested compounds impaired GSK-3α/β phosphorylation in Ser21/Ser9. T-cell
Factors (TCF) have essential nuclear functions, they consist in several isoforms, and the major
transducers of Wnt signaling in the intestine and the oncogenic drivers of colon cancer are TCF-
1
and TCF-4 [41]. It is also known that TCF-1 expression is regulated by APC and β-catenin–
TCF-4 [42]. As shown in Figure 3, it appears that 3f, 4c and 4e induced an increased TCF-1
protein level, but on the contrary, 4i particularly reduced TCF-1, preventing its co-activation
effect on β-catenin. Moreover, all the selected compounds remarkably reduced the mRNA
expression of TCF4 (Figure 2), being the more effective compound 4i. Altogether these effects
contributed to make 4i one of the most active compounds in the antiproliferative assay.
3
.5. 4c and 4i compounds negatively modulated the downstream Wnt/β-catenin targets cyclin
D1, cyclin B1 and c-myc.
Cyclin D1 is a β-catenin direct target gene, required for G1/S transition, in cell cycle regulation,
and involved in proliferation process. We investigated its regulation through Western blot
analysis (Figure 3), and we observed a strong impairment in protein levels after 3f, 4c, and 4i
1
1

ACCEPTED MANUSCRIPT
treatment. Cyclin B1 is highly expressed in the majority of colorectal cancers [43], may promote
carcinogenesis and later metastasis to lymph nodes [44]. It is essential for the transition from
G2 phase to mitosis and it is linked to a high rate of cell proliferation. Also in this case a strong
downregulation of cyclin B1 expression was noted by 3f, 4c, and 4i. In this way, both inhibition
of cyclin D1 and cyclin B1 could contribute to reduce cell growth induced by the compounds. To
further evaluate the consequence of cyclins downregulation we analyzed the effect of the
compounds on cell cycle in HT-29 cells. As showed in Figure 5, compound 4i but not 3f and 4c,
induced a significant accumulation in G1 along with a reduction of both S and G2/M phase.
These results are in well agreement with the reduction of cyclin D1 and the remarkable increase
of p21 (see Figure 3).
Another important gene directly transcribed by β-catenin after Wnt signaling activation is c-myc,
an oncogenic transcription factor. As shown in Figure 2, mRNA expression was not significantly
modified by the selected compounds. On the contrary, in Western blot (Figure 3), the c-myc
protein migrated as two bands. The upper band is probably the phosphorylated and inactive
form whereas the lower band is the unphosphorylated and activated form of the protein [45].
Interestingly, with 4i, 4c and 3f, the lower band disappeared while the upper band remain
substantially unmodified except for 4i in which we observed a slight increase.
Figure 5 near here
3
.5. 4c and 4i acted as WNT inhibitors in vivo zebrafish models.
We investigated the effects on Wnt/β-catenin pathway also in vivo, using a Wnt-reporter
zebrafish model, in order to explore the TCF/LEF functions [46]. These transgenic animals
expressed a fluorescent reporter (GFP) under the control of Wnt-responsive promoters, and
they showed high levels of signal in embryonic head and intestine. Therefore Wnt/β-catenin
signaling deregulation is easily detectable by fluorescence reduction. At 96 hours post
1
2

ACCEPTED MANUSCRIPT
fertilization, zebrafish were maintained in E3 medium in which the compounds were solubilized
and treated for 7 days at different concentrations, to determine the survival rate. As shown in
Figure 6 (panel A) compounds 2d and 4c showed high toxicity in the concentration range 5-25
µM while at 1 µM they did not appear toxic. On the contrary, compound 4i, showed high
mortality only at the highest concentration used (25 µM). On the basis of these results we set
the concentration at which we investigated the GFP signal after 72 hours of treatment. The
representative images concerning these experiments are reported in Figure 6 (panels B-C). In
well agreement with Wnt inhibitory activity in BAT-LUX system 4c and 4i represent the most
active compounds in vivo, and they strongly reduced the TCF/LEF transcription, in the intestinal
zone. In Figure 6 (panel B), bright field images demonstrated as larvae treated with 4i
compound developed pericardial edema and dysmorphic craniofacial features. These
peculiarities were described in embryos carrying null mutations in LEF1/TCF4 [47] and they are
typical in cases where WNT/β-catenin cascade is inhibited. Moreover, as reported in the
magnified fluorescence images of intestine (Figure 6 panel B), 2d reduced the expression of
TCF/LEF green signal, and the intestine resulted thinner than control, and in 4i treated, Wnt
signal totally disappeared. A GFP signal quantification is depicted in Figure 6 (panel C) in which
we can observe that 4i strongly reduced the fluorescence signal comparable to that of IWR1.
Figure 6 near here
3
.7. Proposed mechanism of action for compound 4i.
4
i compound was the most antiproliferative compound in tested cell lines, and it was able to
inactivate c-myc. Moreover, after 4i treatment, AP4 mRNA is strongly reduced and p21 is highly
expressed, as shown in Figure 2 and Figure 3 respectively. Therefore 4i compound inhibits
Wnt/β-catenin cascade, leading not only to cyclin D1 repression, but also to c-myc inactivation,
and consequently to AP4 inhibition and p21 upregulation. This hypothesis is supported by the
1
3

ACCEPTED MANUSCRIPT
findings of Jung and Hermeking [48] which reported that c-myc directly regulates the expression
of AP4, a transcription factor which binds to recognition motifs located in the vicinity of the p21
promoter mediating transcriptional repression of p21 itself [49]. The resulting event is an
impairment of cellular proliferation. Finally cyclin D1 and p21 stimulated cell cycle arrest in G1
and an antiproliferative effect, confirmed by S phase reduction (Figure 5).
The hypothetical molecular pathway deregulated after 4i treatment is summarized in Figure 7.
Figure 7 near here
4
. Conclusion
Among the synthesized compounds, we found that 4i repressed Wnt signaling downstream of
β-catenin and efficaciously inhibited the proliferation of selected cancer cell lines. The
remarkable inhibition of our compounds on Wnt/β-catenin targets suggests that these
derivatives may downregulate Wnt signaling independently by β-catenin levels. Nevertheless
Wnt target genes activation, like c-myc and cyclin D1, is severely impaired after treatment,
leading to a reduced proliferation. Preliminary results have also indicated that these compounds
are ineffective in normal cells suggesting that they could be selective toward cancer cells
endowed with deregulation of the Wnt pathway. The Wnt-reporter zebrafish model provides an
excellent experimental mean to test the ability of a compound to modulate Wnt signaling in vivo.
The results obtained in this model clearly showed that our compounds are strongly inhibitors of
the Wnt signaling, with an activity comparable to that of reference compound IWR1, suggesting
that these compounds hold promise for potential use in the therapy of Wnt driven cancers but
also for other Wnt related diseases. We are currently focusing on 4i effects on colon cancer
cells, by trying to outline its specific mechanism of action. Particularly we aim to understand how
4
i is able to inhibit cell proliferation and to arrest cell cycle, investigating the upstream pathway
1
4

ACCEPTED MANUSCRIPT
of AP4-p21 axes. Moreover, we are studying the effects on the transcription factor TCF4,
strongly downregulated by the treatment, and on its regulatory proteins.
5
. Experimental Section
5
.1. Chemistry
Evaporation was performed in vacuo (rotary evaporator). Analytical TLC were carried out on
Merck 0.2 mm precoated silica gel aluminum sheets (60 F-254). Silica gel 60 (230-400 mesh)
was used for column flash-chromatography. Melting points were determined using a Büchi
apparatus B 540 and are uncorrected. Routine nuclear magnetic resonance spectra were
recorded on a Varian Mercuryplus 400 spectrometer operating at 400 MHz for the proton and 100
MHz for the carbon in [D ]DMSO solution. ESI-MS spectra were performed on an Applied
6
Biosystems API 2000 instrument. All compounds showed ≥ 95% purity. All starting chemicals as
well as solvents were purchased by Sigma-Aldrich or CarloErba. Compounds 1e [27], 1f [27], 3f
[
34], 4a [29], 4b [29], 4e [29], 4f [35], 4g [35,36], and 6 [27], were synthesized as previously
described. Spectroscopic data and elemental analysis results are reported in Supporting
Information.
5
3
1
.1.1. Synthesis of 2-(benzylthio)-6-isobutoxypyrimidin-4-amine 1a and 6-amino-2-(benzylthio)-
-isobutylpyrimidin-4(3H)-one (2a)
-Iodo-2-methylpropane (1.5 mL; 13.0 mmol) was added dropwise into a suspension of
compound 6 (1.0 g; 4.3 mmol) in DMF (15 mL), H O (1.5 mL), and K CO (4.3 mmol). The
2
2
3
reaction mixture was warmed, under stirring, to reflux for 1-2 h (TLC analysis). After cooling, the
solution was diluted with a mixture of ice/water (15 mL), and extracted with ethyl acetate (4x20
mL). The combined organic phases were dried on Na SO and evaporated in vacuo. The
2
4
1
5

ACCEPTED MANUSCRIPT
residue was purified by flash-chromatography (ethyl acetate/petroleum ether=4:1, v/v as eluent);
the faster running band gave pure 1a (57%; white crystals, mp: 88.3-89.0 °C from ethyl
acetate/n-hexane), the slower one gave compound 2a (12%; white crystals, mp: 161.9-162.9 °C
from ethyl acetate/ n-hexane).
5
.1.2. Synthesis of 6-(benzyloxy)-2-(benzylthio)pyrimidin-4-amine 1c and 6-amino-3-benzyl-2-
(benzylthio)pyrimidin-4(3H)-one (2c)
Operating as above benzylbromide gave 1c (40%; white crystals, mp: 109.3-110.3 °C from ethy l
acetate/n-hexane) and 2c (11%; white crystals, mp: 163.0-164.0 °C from ethy l acetate/n-
hexane) using ethyl acetate/petroleum ether=2:1, v/v as eluent for flash-chromatography.
5
.1.3. General Procedure for the Synthesis of acetamides (1b,d) and (2b,d)
Acetyl chloride (0.02 mL, 27 mmol) was added to a solution of the appropriate amine 1a, 1c, 2a,
or 2c (4 mmol) in anhydrous THF (80 mL). After stirring for 2 h, the reaction mixture was
refluxed for two additional hours. After cooling at room temperature, the mixture was poured in
ice/water (20 mL) treated with a saturated solution of NaHCO until basic pH and finally
3
extracted with chloroform (3x30 mL). The combined organic phases were dried on Na SO .
2
4
Removal of the solvent under reduced pressure gave the crude acetamide, which was purified
by chromatography. An analytical sample was obtained by crystallization.
5
.1.3.1. N-[2-(Benzylthio)-6-isobutoxypyrimidin-4-yl]acetamide (1b). Ethyl
acetate/cyclohexane=1:3, v/v as eluent; 58%; white crystals, mp: 92.0-93.2 °C from n-hexane.
5
.1.3.2. N-[6-(Benzyloxy)-2-(benzylthio)pyrimidin-4-yl]acetamide (1d). Ethyl acetate/petroleum
ether=4:1, v/v as eluent; 64%; white crystals, mp: 134.3-135.3 °C from n-hexane.
1
6

ACCEPTED MANUSCRIPT
5
.1.3.3. N-[2-(Benzylthio)-1-isobutyl-6-oxo-1,6-dihydropyrimidin-4-yl]acetamide (2b). Ethyl
acetate/cyclohexane=1:3, v/v as eluent; 50%; white crystals, mp: 138.1-139.0 °C from ethyl
acetate/petroleum ether.
5
.1.3.4. N-[1-Benzyl-2-(benzylthio)-6-oxo-1,6-dihydropyrimidin-4-yl]acetamide (2d). Ethyl
acetate/petroleum ether=4:1, v/v as eluent; 56%; white crystals, mp: 79.5-80.5 °C from n-
hexane.
5
.1.4. 5,7-Dimethoxy-2-(4-nitrophenyl)imidazo[1,2-a]pyrimidine (3a)
A solution of 4,6-dimethoxypyrimidin-2-amine (1.6 g; 10 mmol) and 2-bromo-4’-
nitroacetophenone (3.7 g; 15 mmol) in 50 mL of anhydrous ethanol was stirred and refluxed for
4
-6 hours. After cooling, ethanol was removed in vacuo and the residue was treated with
NaHCO saturated solution and extracted with CHCl (3x30 mL). The combined organic phases
3
3
were dried on Na SO . Removal of the solvent under reduced pressure gave the crude product
2
4
which was purified by chromatography (diethyl ether/n-hexane=4:1, v/v as eluent, 82%). An
analytical sample was obtained by crystallization from n-hexane (yellow crystals, mp >250 °C
dec.).
5
.1.5. 4-(5,7-Dimethoxyimidazo[1,2-a]pyrimidin-2-yl)aniline (3b)
A solution of 5,7-dimethoxy-2-(4-nitrophenyl)imidazo[1,2-a]pyridine (0.6 g; 2 mmol) and SnCl2
1.9 g; 10 mmol) in DMF (10 mL) was stirred and refluxed at 140 °C for 4h. After cooling,
NaHCO saturated solution was added and the water phase was extracted with CHCl (4x30
(
3
3
mL). The combined organic phases were dried on Na SO , concentrated in vacuo and then
2
4
purified by chromatography (methanol/chloroform=1:9, v/v as eluent, 77%). An analytical
sample was obtained by crystallization from ethyl acetate (white crystals, mp: 214.2-216.5 °C ).
1
7

ACCEPTED MANUSCRIPT
5
.1.6. General Procedure for the Synthesis of N-benzyl 3d, 4c, 4h, and N,N-dibenzyl derivatives
3
e, 4d, 4i
The appropriate amine (4 mmol) was dissolved in anhydrous CHCl (40 mL) and added of
3
dimethylaminopyridine (0.48 g; 4 mmol) and benzyl bromide (2.05 g; 1.4 mL; 12 mmol). The
mixture was stirred and heated at 60 °C for 2 h. Af ter cooling, the mixture was filtered and
added of NaOH 2N until pH=10. The organic phase was collected and the aqueous phase was
extracted with CHCl (3x30 mL). The combined organic phases were dried on Na SO and
3
2
4
evaporated in vacuo. The residue was purified by chromatography (chloroform as eluent); the
faster running band gave pure N,N-dibenzyl derivative whereas the slower one gave pure N-
benzyl derivative.
5
.1.6.1. N-Benzyl-4-(5,7-dimethoxyimidazo[1,2-a]pyrimidin-2-yl)aniline (3d). 51%; white crystals,
mp: 144.9-146.9 °C from ethyl acetate.
5
.1.6.2. N,N-Dibenzyl-4-(5,7-dimethoxyimidazo[1,2-a]pyrimidin-2-yl)aniline (3e). 30%; white
crystals, mp: 123.2-125.4 °C from ethyl acetate.
5
.1.6.3. N-Benzyl-4-(6-methylimidazo[1,2-a]pyridin-2-yl)aniline (4c). 57%. white crystals, mp:
2
32.3-234.1 °C from ethyl acetate.
5
.1.6.4. N,N-Dibenzyl-4-(6-methylimidazo[1,2-a]pyridin-2-yl)aniline (4d). 27%; white crystals,
mp: 117.1-121.5 °C from ethyl acetate.
5
.1.6.5. N-Benzyl-4-(7-methylimidazo[1,2-a]pyridin-2-yl)aniline (4h). 45%; white crystals, mp
1
30.2-131.6 °C from ethyl acetate.
1
8

ACCEPTED MANUSCRIPT
5
.1.6.6. N,N-Dibenzyl-4-(7-methylimidazo[1,2-a]pyridin-2-yl)aniline (4i). 10%; white crystals, mp
2
14.2-216.1 °C from ethyl acetate.
5
.1.7. 4-(5,7-Dimethoxyimidazo[1,2-a]pyrimidin-2-yl)-N-methylaniline (3c)
Compound 3b (1.8 g; 4 mmol) was dissolved in anhydrous CHCl (20 mL) and added of
3
dimethylaminopyridine (0.48 g; 4 mmol) and iodomethane (0.28 g; 0.12 mL; 2 mmol). The
mixture was stirred and heated at 60 °C for 2 h. Af ter cooling, the mixture was filtered and
added of NaOH 2N until pH=10. The organic phase was collected and the aqueous phase was
extracted with CHCl (3x30 mL). The combined organic phases were dried on Na SO ,
3
2
4
concentrated in vacuo and then purified by chromatography (chloroform as eluent, 72%). An
analytical sample was obtained by crystallization from ethyl acetate (white crystals, mp: 182.3-
1
84.5 °C ).
5
.1.8. 5-(Benzyloxy)-7-methyl-2-(4-nitrophenyl)imidazo[1,2-a]pyrimidine (3g)
Operating as above compound 3f gave 3g (81%; yellow crystals, mp >250 °C from ethyl
acetate).
5
.1.9. 2-{[4-(7-Methylimidazo[1,2-a]pyridin-2-yl)phenyl]carbamoyl} benzoic acid (4j)
Compound 4g (0.45 g; 2 mmol) was dissolved in dioxane (20 mL) and added of phthalic
anhydride (0.59 g; 4 mmol). The mixture was stirred at room temperature for 0.5 h. The
obtained solid was collected by filtration and recrystallized from ethyl acetate/methanol (46%,
white crystals, mp: 231 °C dec.).
5
.2 Luciferase reporter gene assay
HT-29 cells were transfected with the luciferase reporter plasmid BAT-LUX (kindly provided by
Prof. Stefano Piccolo, University of Padova) which codified for LEF/TCF transcription factors.
1
9

ACCEPTED MANUSCRIPT
BAT-LUX plasmid constitutes seven repeats of TCF binding element and siamois minimal
4
promoter, cloned upstream of Luciferase gene in pGL3 backbone [50]. Cells (1.4 x 10 ) were
transfected using HiPerFect Transfection Reagent (Qiagen, USA) with 1µg BAT-LUX construct
and 1µg Renilla vector as an internal transfection control, and incubated with various
concentrations of selected compounds at 37 °C . After 24 h, the cells were lysed in 50µl passive
lysis buffer (Promega, USA). Firefly luciferase and Renilla luciferase activity were determined
using the Dual-Glo Luciferase Assay System (Promega, USA). Results are expressed as the
mean of normalized ratios of firefly luciferase activity and Renilla luciferase activity
measurements.
5
.3. Cell proliferation assay
Human colon adenocarcinoma cell lines (HT-29 and LoVo), human liver hepatocellular
carcinoma cell line (HepG2) and human lung adenocarcinoma epithelial cell line (A549) were
grown in DMEM medium (Gibco, Milano, Italy), supplemented with 10% fetal bovine serum
(Invitrogen, Milano, Italy) and 1% penicillin G (Gibco, Milano, Italy), streptomycin (Invitrogen,
3
Milano, Italy) and L-glutamine (Gibco, Milano, Italy). Cells were seeded in 96-well plates (7 x 10
cells/well) and after 24h medium was removed and substituted with the drug solutions,
dissolved in complete medium at scalar concentrations. Each well was incubated at 37 °C in a
humidified 5% CO incubator for 72 h. Cell viability was assayed by the 3-(4,5-dimethylthiazol-2-
2
yl)-2,5-diphenyl tetrazolium bromide (MTT) test, as previously described [51]. The IC was
50
defined as the compound concentration required to inhibit cell proliferation by 50%.
5
.4. Quantitative real-time RT-PCR
To quantify Axin2, TCF4, c-myc, AP4 mRNA levels we designed real-time RT-PCR assays,
using GUS as reference gene. Total RNA was isolated using TRIzol (Invitrogen) from HT-29
cells treated for 24 hours with the compounds. 1µg of RNA was transcribed using the
2
0

ACCEPTED MANUSCRIPT
Superscript II system (Invitrogen-Gibco) in 25 ꢀL final volume according to the manufacturer's
instructions. Quantitative real-time PCR (qRT-PCR) was performed with 1 ꢀL cDNA in 20 ꢀL
using the Sybr Green method (Invitrogen-Gibco) and analyzed on an ABI PRISM 7900HT
Sequence detection system (Applied Biosystems).
The oligonucleotides to amplify mRNA fragments were Axin2 (forward 5’-
CAAGGGCCAGGTCACCAA, reverse 3’-CCCCCAACCCATCTTCGT), TCF4 (forward 5’-
GACGACAAGAAGGATATCAAATCA, reverse 3’-ATCCTCCGCTCCTTCTCAC), c-myc (forward
5
’-AGGACCCGCTTCTCTGAAA, reverse 3’-TTCCTGTTGGTGAAGCTAACG), AP4 (forward 5’-
GAGCCAGCCTGGGATTGTC, reverse 3‘-GTGCTTAAAGGAGAAAGAAGAAAACC) and GUS
forward 5’-GAAAATATTGTGGTTGGAGAGC, reverse 3’-CGAGTGAAGATCCCCTTTTTA).
After normalization on GUS, expression regulation was calculated respect to untreated cells.
(
5
.5. Western blot analysis
HT-29 cells were incubated in the presence of test compounds and, at 24 h, were collected,
centrifuged, and washed twice with ice-cold PBS. Pellet was then resuspended in lysis buffer.
After the cells were lysed on ice for 30 min, lysates were centrifuged at 15 000 g at 4 °C for 10
min. The protein concentration in the supernatant was determined using BCA protein assay
reagents (Pierce, Italy). Equal amounts of protein (10 ꢀg) were resolved by SDS-PAGE (12%
acrylamide) and transferred to PVDF Hybond-p membrane (GE Healthcare). Membranes were
blocked overnight with ECL Advance Blocking Agent (GE Healthcare), under rotation at 4 °C .
Membranes were then incubated with a primary antibody against TCF-1 (rabbit, 1:1000, Cell
Signaling), β-catenin (S33/37/T41) (rabbit, 1:500, Cell Signaling), β-catenin (mouse, 1:1000,
Cell Signaling), GSK-3α/β (S21/9) (rabbit, 1:1000, Cell Signaling), p21 Waf1/Cip1 (DCS60)
(
mouse, 1:1000, Cell Signaling), cyclin D1 (rabbit, 1:1000, Cell Signaling), c-myc (mouse, 1:200,
Calbiochem), cyclin B1 (rabbit, 1:1000, Cell Signaling), or β-actin (mouse, 1:10 000, Sigma) for
h at room temperature. Membranes were next incubated with peroxidase-labeled goat anti-
1
2
1

ACCEPTED MANUSCRIPT
rabbit IgG (1:100 000, Sigma) or peroxidase-labeled goat antimouse IgG (1:100 000, Sigma) for
1
h. All membranes were visualized using ECL Advance (GE Healthcare) and exposed to
Amersham Hyperfilm ECL (GE Healthcare). To ensure equal protein loading, each membrane
was stripped and re-probed with anti-β-actin antibody.
5
.6. Immunofluorescence analysis
Cells were fixed in cold 4% formaldehyde for 15 min, rinsed and stored prior to analysis.
Primary antibody staining was performed for β-catenin (mouse, 1:50, BD Biosciences) After
incubation, cells were washed and incubated with a secondary antibody conjugated to Alexa
dyes (1:2000, Life technologies, Monza, Italy). Cells were counterstained with DAPI (1:10000,
Sigma-Aldrich, Milano, Italy). Images were obtained on a video-confocal microscope (Vico,
Ecliple Ti80, Nikon), equipped with a digital camera, using an objective 60x.
5
.7. Flow cytometric analysis of cell cycle distribution
5
For flow cytometric analysis of DNA content, 1.5 × 10 HT-29 cells in exponential growth were
treated with different concentrations of the test compounds for 24 h. After the incubation, the
cells were collected, centrifuged, and fixed with ice-cold ethanol (70%). The cells were treated
with lysis buffer containing RNase A and 0.1% Triton X-100 and stained with PI. Samples were
analyzed on a Cytomic FC500 flow cytometer (Beckman Coulter). DNA histograms were
analyzed using MultiCycl for Windows (Phoenix Flow Systems).
5
.8. In vivo treatment on zebrafish model
We used wild type zebrafish, raised and maintained under standard conditions, to test our
chemical compounds. Larvae were treated at 72 hours post-fertilization, until 7 days after
treatment, in order to investigate compound toxicity and the survival rate. The compounds were
solubilized in E3 medium, replaced every day with new medium with containing compounds.
2
2

ACCEPTED MANUSCRIPT
The effect on Wnt/β-catenin signaling was investigated using TCF/LEF-GFP reporter zebrafish.
They were treated at 24 hours post-fertilization, for 72 hours. Reporter expression was
visualized using the fluorescent microscope (Nikon SMZ 1500) with a GFP filter and objective
8
X. 40X images were captured by a confocal microscope (Nikon A1R-A1). The quantification of
fluorescence emission was carried out by ImageJ software.
2
3

ACCEPTED MANUSCRIPT
References:
1] A. Klaus, W. Birchmeier, Wnt signalling and its impact on development and cancer, Nat.
Rev. Canc. 8 (2008) 387-398.
2] A.W. Burgess, M.C. Faux, M.J. Layton, R.G. Ramsay, Wnt signaling and colon
tumorigenesis - A view from the periphery, Exp. Cell Res. 317 (2011) 2748-2758.
3] A. Kikuchi, H. Yamamoto, A. Sato, Selective activation mechanisms of Wnt signaling
pathways, Trends Cell Biol. 19 (2009) 119-129.
[
[
[
[
[
4] H. Clevers, Wnt/β-catenin signaling in development and disease, Cell 127 (2006) 469–480.
5] R.H. Giles, J.H. van Es, H. Clevers, Caught up in a Wnt storm: Wnt signaling in cancer,
Biochim. Biophys. Acta. 1653 (2003) 1-24.
6] B.M. McCartney, I.S. Näthke, Cell regulation by the Apc protein, Curr. Opin. Cell Biol. 20
2008) 186-193.
[
(
[
[
[
7] M.M. Taketo, Shutting down Wnt signal-activated cancer, Nat. Genet. 36 (2004) 320-322.
8] C. Gao, Y.G. Chen, Dishevelled: The hub of Wnt signaling, Cell. Signal. 22 (2010) 717-727.
9] R.T. Peterson, Drug discovery: Propping up a destructive regime, Nature 461 (2009) 599-
6
00.
[
[
10]T. Reya, H. Clevers, Wnt signalling in stem cells and cancer, Nature 434 (2005) 843–850.
11]Y. Miyoshi, H. Nagase, H. Ando, A. Horii, S. Ichii, S. Nakatsuru, T. Aoki, Y. Miki, T. Mori, Y.
Nakamura, Somatic mutations of the APC gene in colorectal tumors: mutation cluster region in
the APC gene, Hum. Mol. Genet. 1 (1992) 229-233.
[
[
12]P. Polakis, The many ways of Wnt in cancer, Curr. Opin. Genet. Dev. 17 (2007) 45–51.
13]F. de Sousa E Melo, L. Vermeulen, D. Richel, J.P. Medema, Targeting Wnt Signaling in
Colon Cancer Stem Cells, Clin. Cancer Res. 17 (2011) 647-653.
14]R. Fodde, R. Smits, H. Clevers, APC, signal transduction and genetic instability in colorectal
cancer, Nat. Rev. Canc. 1 (2001) 55-67.
15]M. Bienz, H. Clevers, Linking colorectal cancer to Wnt signaling, Cell 103 (2000) 311-320.
[
[
2
4

ACCEPTED MANUSCRIPT
[
16]H. Suzuki, D.N. Watkins, K.-W. Jair, K.E. Schuebel, S.D. Markowitz, W.D. Chen, T.P.
Pretlow, B. Yang, Y. Akiyama, M. Van Engeland, M. Toyota, T. Tokino, Y. Hinoda, K. Imai, J.G.
Herman, S.B. Baylin, Epigenetic inactivation of SFRP genes allows constitutive WNT signaling
in colorectal cancer, Nat. Genet. 36 (2004) 417-422.
[
17]L. Vermeulen, F. De Sousa E Melo, F. Melo, M. van der Heijden, K. Cameron, J.H. de Jong,
T. Borovski, J.B. Tuynman, M. Todaro, C. Merz, H. Rodermond, M.R. Sprick, K. Kemper, D.J.
Richel, G. Stassi, J.P. Medema, Wnt activity defines colon cancer stem cells and is regulated by
the microenvironment, Nat. Cell Biol. 12 (2010) 468-476.
[
18]B.E. Shan, M.X. Wang, R.Q. Li, Quercetin Inhibit Human SW480 Colon Cancer Growth in
Association with Inhibition of Cyclin D and Survivin Expression through Wnt/β-Catenin
1
Signaling Pathway, Cancer Invest. 27 (2009) 604-612.
[
19]H.H. Luu, R. Zhang, R.C. Haydon, E. Rayburn, Q. Kang, W. Si, J.K. Park, H. Wang, Y.
Peng, W. Jiang, T.C. He, Wnt/β-catenin signaling pathway as novel cancer drug targets, Curr.
Cancer Drug Targets 4 (2004) 653-671.
[
20]S.-M.A. Huang, Y.M. Mishina, S. Liu, A. Cheung, F. Stegmeier, G.A. Michaud, O. Charlat,
E. Wiellette, Y. Zhang, S. Wiessner, M. Hild, X. Shi, C.J. Wilson, C. Mickanin, V. Myer, A. Fazal,
R. Tomlinson, F. Serluca, W. Shao, H. Cheng, M. Shultz, C. Rau, M. Schirle, J. Schlegl, S.
Ghidelli, S. Fawell, C. Lu, D. Curtis, M.W. Kirschner, C. Lengauer, P.M. Finan, J.A. Tallarico, T.
Bouwmeester, J.A. Porter, A. Bauer, F. Cong, Tankyrase inhibition stabilizes axin and
antagonizes Wnt signalling, Nature 461 (2009) 614-620.
[
21]W. Zhang, V. Sviripa, L.M. Kril, X. Chen, T. Yu, J. Shi, P. Rychahou, B. M. Evers, D.S. Watt,
C. Liu, Fluorinated N,N-dialkylaminostilbenes for Wnt pathway inhibition and colon cancer
repression, J. Med. Chem. 54 (2011) 1288-1297.
[
22]W. Chen, M. Chen, L.S. Barak, Development of small molecules targeting the Wnt pathway
for the treatment of colon cancer: a high-throughput screening approach, Am. J. Physiol.
Gastrointest. Liver Physiol. 299 (2010) G293-G300.
2
5

ACCEPTED MANUSCRIPT
[
23]B. Chen, M.E. Dodge, W. Tang, J. Lu, Z. Ma, C.-W. Fan, S. Wei, W. Hao, J. Kilgore, N.S.
Williams, M.G. Roth, J.F. Amatruda, C. Chen, L. Lum, Small molecule-mediated disruption of
Wnt-dependent signaling in tissue regeneration and cancer, Nat. Chem. Biol. 5 (2009) 100-107.
[
24]K. Ewan, B. Pająk, M. Stubbs, H. Todd, O. Barbeau, C. Quevedo, H. Botfield, R. Young, R.
Ruddle, L. Samuel, A. Battersby, F. Raynaud, N. Allen, S. Wilson, B. Latinkic, P. Workman, E.
McDonald, J. Blagg, W. Aherne, T. Dale, A Useful Approach to Identify Novel Small-Molecule
Inhibitors of Wnt-Dependent Transcription, Cancer Res. 70, (2010) 5963-5973.
[
25]J. Liu, X. Wu, B. Mitchell, C. Kintner, S. Ding, P.G. Schultz, A small-molecule agonist of the
Wnt signaling pathway, Angew. Chem. Int. Ed. 44 (2005) 1987–1990.
26]J.C. Pelletier, J.T. Lundquist IV, A.M. Gilbert, N. Alon, F.J. Bex, B.M. Bhat, M.G. Bursavich,
[
V.E. Coleburn, L.A. Felix, D.M. Green, P. Green, D.B. Hauze, Y.P. Kharode, H.-S. Lam, S.R.
Lockhead, R.L. Magolda, J.J. Matteo, J.F. Mehlmann, C. Milligan, R.J. Murrills, J. Pirrello, S.
Selim, M.C. Sharp, R.J. Unwalla, M.D. Vera, J.E. Wrobel, P. Yaworsky, P.V.N. Bodine, (1- (4-
(
Naphthalen-2-yl)pyrimidin-2-yl)piperidin-4-yl) methanamine: A Wingless β-Catenin Agonist That
Increases Bone Formation Rate, J. Med. Chem. 52 (2009) 6962-6965.
27]B. Cosimelli, G. Greco, M. Ehlardo, E. Novellino, F. Da Settimo, S. Taliani, C. La Motta, M.
[
Bellandi, T. Tuccinardi, A. Martinelli; O. Ciampi, M.L. Trincavelli, C. Martini, Derivatives of 4-
Amino-6-hydroxy-2-mercaptopyrimidine as Novel, Potent, and Selective A Adenosine Receptor
3
Antagonists, J. Med. Chem. 51 (2008) 1764-1770.
[
28]S. Laneri, A. Sacchi, E. Abignente, Research on heterocyclic compounds. Part XLII. The
Vilsmeier reaction in the synthesis of imidazo[1,2-a]pyrimidine derivatives, J. Heterocycl. Chem.
7 (2000) 1265-1267.
29]S. Laneri, C. Di Ronza, A. Bernardi, C. Ostacolo, A. Sacchi, C. Cervone, M. D’Amico, C. Di
3
[
Filippo, M.L. Trincavelli, A. Panighini, C. Martini, Synthesis and antihypertensive action of new
imidazo[1,2-a]pyridine derivatives, non peptidic angiotensin II receptor antagonists,
Cardiovascular & Haematological Disorders-Drug Targets 11 (2011) 87-96.
2
6

ACCEPTED MANUSCRIPT
[
30]N. Barker, H. Clevers, Mining the Wnt pathway for cancer therapeutics, Nat. Rev. Drug.
Disc. 5 (2006) 997-1014.
31]Y.K. Marquez-Flores, Ma.E. Campos-Aldrete, H. Salgado-Zamora, J. Correa-Basurto, Ma.E.
Melendez-Camargo, Docking simulations, synthesis, and anti-inflammatory activity evaluation of
-(alkylamino)amino-3-(nitro)imidazo[1,2-a]pyridines, Med. Chem. Res. 21 (2012) 775-782.
32]Y.K. Marquez-Flores, Ma.E. Campos-Aldrete, H. Salgado-Zamora, J. Correa-Basurto, Ma.E.
[
2
[
Melendez-Camargo, Acute and chronic anti-inflammatory evaluation of imidazo[1,2-a]pyridine
carboxylic acid derivatives and docking analysis, Med. Chem. Res. 21 (2012) 3491-3498.
[
33]S. Dihlmann, S. Klein, M. von Knebel Doeberitz, Reduction of β-catenin/T-cell transcription
factor signaling by aspirin and indomethacin is caused by an increased stabilization of
phosphorylated β-catenin, Mol. Cancer Ther. 2 (2003) 509–516.
[
34]T. Pyl, W. Baufeld, Bicyclic heterocyclic compounds with a common nitrogen atom. XI.
Nucleophilic substitutions of 5-chloro-7-methyl-2-phenylimidazo[1,2-a]pyrimidines, J. Lieb. Ann.
Chem. 699 (1966) 112-126.
[
35]R.J. Sundberg, D.J. Dahlhausen, G. Manikumar, B. Mavunkel, A. Biswas, V. Srinivasan, F.
King Jr., P. Waid, Preparation of 2-aryl- and 2-(aryloxymethyl)imidazo[1,2-a]pyridines and
related compounds, J. Heterocyclic Chem. 25 (1988) 129-137.
[
36]T. Takaya, H. Takasugi, Imidazo-heterocyclic compounds, and pharmaceutical composition
comprising them, Eur. Pat. Appl. (1984) EPXXDV EP 120589.
37]E. Rampazzo, L. Persano, F. Pistollato, E. Moro, C. Frasson, P. Porazzi, A. Della Puppa, S.
[
Bresolin, G. Battilana, S. Indraccolo, G. Te Kronnie, F. Argenton, N. Tiso, G. Basso, Wnt
activation promotes neuronal differentiation of Glioblastoma, Cell Death Dis. 4 (2013) e597
(e500).
[
38]Emami KH, Nguyen C, Ma H,Kim DH,Jeong KW, Eguchi M, Moon RT,Teo JL, Kim
HY,Moon SH, Ha JR, Kahn M. A small molecule inhibitor of beta-catenin/CREB-binding protein
transcription. Proc. Natl. Acad. Sci. 2004, 101(34), 12682-12687.
2
7

ACCEPTED MANUSCRIPT
[
39]J. Li, Y. Mizukami, X. Zhang, W.-S. Jo, D.C. Chung, Oncogenic K-ras stimulates Wnt
signaling in colon cancer through inhibition of GSK-3β, Gastroenterology 128 (2005) 1907-1918.
40]E.C. Pacheco-Pinedo, A.C. Durham, K.M. Stewart, A.M. Goss, M.M. Lu, F.J. DeMayo, E.E.
[
Morrisey, Wnt /β-catenin signaling accelerates mouse lung tumorigenesis by imposing an
embryonic distal progenitor phenotype on lung epithelium, J Clin Invest. 121 (2011) 1935–1945.
[
41]A. Gregorieff, H. Clevers, Wnt signaling in the intestinal epithelium: From endoderm to
cancer, Genes Dev. 19 (2005) 877-890.
42]J. Roose, G. Huls, M. van Beest, P. Moerer, K. van der Horn, R. Goldschmeding, T.
[
Logtenberg, H. Clevers, Synergy between tumor suppressor APC and the β-catenin-Tcf4 target
Tcf1, Science 285 (1999) 1923-1926.
[
43]A. Wang, N. Yoshimi, N. Ino, T. Tanaka, H. Mori, Overexpression of cyclin B1 in human
colorectal cancers, J Cancer Res Clin Oncol. 123 (1997) 124-127.
44]J.Q. Li, A. Kubo, F. Wu, H. Usuki, J. Fujita, S. Bandoh, T. Masaki, K. Saoo, H. Takeuchi, S.
[
Kobayashi, K. Imaida, H. Maeta, T. Ishida, S. Kuriyama. Cyclin B1, unlike cyclin G1, increases
significantly during colorectal carcinogenesis and during later metastasis to lymph nodes, Int J
Oncol. 22 (2003) 1101-1110.
[
45]L Tao, PM Kramer, W Wang, S Yang, RA Lubet, VE Steele, MA Pereira.Altered expression
of c-myc, p16 and p27 in rat colon tumors and its reversal by short-term treatment with
chemopreventive agents.Carcinogenesis. 23 (2002) 1447-54.
[
46]E. Moro, G. Ozhan-Kizil, A. Mongera, D. Beis, C. Wierzbicki, R.M. Young, D. Bournele, A.
Domenichini, L.E. Valdivia, L. Lum, C. Chen, J.F. Amatruda, N. Tiso, G. Weidinger, F. Argenton,
In vivo Wnt signaling tracing through a transgenic biosensor fish reveals novel activity domains,
Dev Biol. 366 (2012) 327-340.
[
[
47]R.R. Doshi, A.S. Patil, A role of genes in craniofacial growth, IIOAB J. 3 (2012) 19-36.
48]P. Jung, H. Hermeking, The c-MYC-AP4-p21 cascade, Cell Cycle 8 (2009) 982-989.
2
8