Base-modified thymidines capable of terminating DNA synthesis are novel bioactive compounds with activity in cancer cells

Article abstract of DOI:10.1016/j.bmc.2015.01.057

Current FDA-approved chemotherapeutic antimetabolites elicit severe side effects that warrant their improvement; therefore, we designed compounds with mechanisms of action focusing on inhibiting DNA replication rather than targeting multiple pathways. We previously discovered that 5-(α-substituted-2-nitrobenzyloxy)methyluridine-5′-triphosphates were exquisite DNA synthesis terminators; therefore, we synthesized a library of 35 thymidine analogs and evaluated their activity using an MTT cell viability assay of MCF7 breast cancer cells chosen for their vulnerability to these nucleoside derivatives. Compound 3a, having an α-tert-butyl-2-nitro-4-(phenyl)alkynylbenzyloxy group, showed an IC₅₀ of 9 ± 1 μM. The compound is more selective for cancer cells than for fibroblast cells compared with 5-fluorouracil. Treatment of MCF7 cells with 3a elicits the DNA damage response as indicated by phosphorylation of γ-H2A. A primer extension assay of the 5′-triphosphate of 3a revealed that 3aTP is more likely to inhibit DNA polymerase than to lead to termination events upon incorporation into the DNA replication fork.

Full text of DOI:10.1016/j.bmc.2015.01.057

Bioorganic & Medicinal Chemistry 23 (2015) 1869–1881
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Base-modified thymidines capable of terminating DNA synthesis
are novel bioactive compounds with activity in cancer cells
Kayla M. Borland, Safnas F. AbdulSalam, Morwena J. Solivio, Matthew P. Burke, Patrick R. Wolfkiel,
Sean M. Lawson, Courtney A. Stockman, Joel M. Andersen, Skyler Smith, Julia N. Tolstolutskaya,
⇑
Purujit N. Gurjar, Aron P. Bercz, Edward J. Merino, Vladislav A. Litosh
Department of Chemistry, University of Cincinnati, 301 Clifton Ct. ML 0172, Cincinnati, OH 45221-0172, USA
a r t i c l e i n f o
a b s t r a c t
Article history:
Current FDA-approved chemotherapeutic antimetabolites elicit severe side effects that warrant their
improvement; therefore, we designed compounds with mechanisms of action focusing on inhibiting
Received 12 December 2014
Revised 22 January 2015
Accepted 30 January 2015
Available online 14 February 2015
DNA replication rather than targeting multiple pathways. We previously discovered that 5-(a-substitut-
ed-2-nitrobenzyloxy)methyluridine-50-triphosphates were exquisite DNA synthesis terminators; there-
fore, we synthesized a library of 35 thymidine analogs and evaluated their activity using an MTT cell
viability assay of MCF7 breast cancer cells chosen for their vulnerability to these nucleoside derivatives.
Keywords:
Nucleosides
Nucleotides
Antimetabolites
DNA termination
Cancer
Compound 3a, having an
M. The compound is more selective for cancer cells than for fibroblast cells compared with 5-fluor-
ouracil. Treatment of MCF7 cells with 3a elicits the DNA damage response as indicated by phosphorylation
of
-H2A. A primer extension assay of the 50-triphosphate of 3a revealed that 3aTP is more likely to inhibit
a-tert-butyl-2-nitro-4-(phenyl)alkynylbenzyloxy group, showed an IC50 of
9
1 l
c
DNA polymerase than to lead to termination events upon incorporation into the DNA replication fork.
Chemotherapeutics
Ó 2015 Elsevier Ltd. All rights reserved.
1. Introduction
clinically approved antimetabolite drugs elicit deadly side
effects10,11 as they also affect rapidly proliferating normal human
Cancer is one of the most sinister diseases known to mankind,
claiming over half a million lives in the US alone during 2014, with
more than one and a half million new diagnoses.1 In contrast to nor-
mal cells, cancer cells undergo rapid, abnormal, and uncontrolled
division, resulting in a constant requirement for DNA production.
Therefore, tampering with this process preferentially affects them
cells, lymphocytes,12 and sometimes even non-dividing cells, such
as neurons,13 which substantially narrows their therapeutic win-
dows. Additionally, their efficiency is limited to a relatively short
list of malignancies that are predominantly hematological,14
although gemcitabine15 has proven to be effective against several
solid tumors. Consequently, there is a critical need to discover nov-
el anti-cancer chemotherapeutics with higher selectivity towards
cancer cells.
The therapeutic potential of nucleotide species that are routinely
used for termination of polymer chain reaction in DNA sequencing
by synthesis16 remains unexplored, primarily due to their poor
incorporation by natural polymerases, meaning that their use would
requireunacceptably high dosage. In the course of developing termi-
nators for a cyclic reversible termination protocol commonly used in
DNA sequencing, we recently discovered that N6-(2-nitro)benzyl-
20-deoxyadenosine-,17 5-(2-nitro)benzyloxymethylpyrimidine-,18
and 7-deaza-7-benzyloxymethylpurine-19,17 20-deoxy-50-triphos-
phates are incorporated into partial double helix DNA primers by
natural polymerases more efficiently than the corresponding
natural nucleotides, and then terminate further DNA synthesis by
obstructing subsequent nucleotide incorporation. It was also evi-
dent that termination of DNA synthesis occurs only in the presence
and represents a plausible approach to cancer chemotherapy,2
a
major component of cancer treatment, particularly if the tumor is
inoperable or has metastasized.
In the past 50 years, nucleoside analogs having general
antimetabolite mechanisms of action have substantially impacted
cancer treatment. Their structural similarity to physiological
nucleosides allows their passage into cells by nucleoside trans-
porters,3 where they are metabolized into 50-triphosphates,4 the
active species that interfere with a large variety of intracellular tar-
gets. In particular, they inhibit enzymes involved in the synthesis
of nucleic acids5 and nucleotides,6 signal DNA damage upon their
incorporation,7 obstruct DNA repair,8 and trigger apoptosis by
directly affecting mitochondria.9 Problematically, the most active
⇑
Corresponding author. Tel.: +1 513 556 9273; fax: +1 513 556 9239.
E-mail address: Vladislav.Litosh@uc.edu (V.A. Litosh).
http://dx.doi.org/10.1016/j.bmc.2015.01.057
0968-0896/Ó 2015 Elsevier Ltd. All rights reserved.

1870
K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
of a bulky group such as a branched alkyl (e.g., isopropyl or tert-
R2
O
N
O
N
butyl) linked to the a-benzyliccarbon. Considering the high recogni-
tion of the novel thymidine 50-triphosphate DNA terminators by
polymerases, we presumed that they would compete with natural
nucleotides for incorporation into DNA within cells.
NBoc
O
R1
HO
NH
Br
O
i, ii
iii
2v
O
TBSO
O
O
for
Nucleotides are charged at physiological pH; therefore, they
have difficulty penetrating cellular membranes.20 Additionally,
they are susceptible to enzymatic degradation, particularly
dephosphorylation.21 Consequently, nucleoside pro-drugs are
commonly used in therapy rather than the corresponding nucleo-
tides, as the pro-drugs are readily translocated into cells by nucle-
oside transporters3 and intracellularly phosphorylated by kinases
to eventually produce the active species. In particular, thymidine
nucleoside analogs are successfully converted into 50-triphos-
phates22 by nucleotide kinases;23 hence, we hypothesized that
base-modified thymidine derivatives would be metabolized within
cells to become terminators of DNA synthesis that would be incor-
porated into the DNA replication fork, thereby obstructing the sub-
sequent addition of natural nucleotides. Consequently, cell division
will arrest at the restriction checkpoint, preventing the completion
of division, and eventually resulting in apoptosis.24
In this paper, we report the synthesis of 35 thymidine analogs
bearing a 2-nitrobenzyloxymethyl moiety attached at the C-5 of
the uracil nucleobase and evaluate their cytotoxic and cytostatic
activities. The lead compound identified from these structure–ac-
tivity relationship studies was further tested for toxicity to normal
cells, DNA damage signaling, and PCR termination by its corre-
sponding 50-triphosphate. Our contribution to the field of anti-
cancer drug discovery is significant as it facilitates the exploration
of the therapeutic potential of novel base-modified nucleoside spe-
cies. These compounds are unlikely to affect other targets than
replicating DNA, and show promise to have wider therapeutic win-
dows than present antimetabolites.
OTBS
OH
2a-w
1
R3
N N
N
O2N
t-Bu
O
O2N
t-Bu
HO
O
NH
O
NH
O
iv
for 3e
N
O
N
O
HO
O
O
OH
3a-d R3 = TMS
R3 = H
OH
4
ii (for 3d)
3e
Scheme 1. Synthesis of T-nucleoside analogs. Reagents and conditions: (i) appro-
priate alcohol, 110–124 °C, 1–3 h; (ii) n-Bu4NF, THF, 0 °C to rt, 2–6 h; (iii) Pd(PPh3)4,
appropriate terminal alkyne, CuI, Et3N, DMF, rt, 6–18 h; (iv) benzyl azide, CuI, Et3N,
MeCN, rt, 4 h.
as neither the bis-isopropyl (2w) nor the bis-tert-butyl (2x) showed
significant activity. Second, the presence of one nitro group on the
phenyl ring is critical for anti-cancer activity, similarly to the bulki-
2. Results
ness of the substituent attached to the benzylic
a-carbon. Conse-
quently, the IC50 values for the non-substituted phenyl derivatives
2d–g are generally much higher compared with the 2-nitro substi-
tuted analogs 2p–s. At the same time, the presence of a 2-nitro
2.1. Synthesis of base-modified nucleosides
The bioactive compounds were obtained by heating
5-bromomethyl-3-N-(tert-butyloxy)carbobyl-30,50-bis-(tert-butyl)-
dimethylsilyl-O-20-deoxyuridine 118 with an appropriate alcohol
under neat, anhydrous conditions (see Supporting information for
details). Formation of HBr as a byproduct resulted in the in situ
elimination of the N3-Boc group, but also in side reactions that made
the purification challenging, which at times resulted in low yields.
Removal of the residual TBS groups using tetra-n-butyl-ammonium
fluoride trihydrate yielded derivatives 2a–w (Scheme 1). The
di-tert-butylcarbinol-oxy-T analog 2x (R1 = R2 = t-Bu) could not be
synthesized by thermal coupling and was therefore made using
mechanochemical conditions.25 From our previous studies,19 the
attachment of a large group to the para-position of the benzyl ring
was known to further improve the DNA synthesis termination
properties of the base-modified nucleotides. Consequently, the
4-iodo-2-nitrobenzyl derivative 2v was used for Sonogashira reac-
tions with various terminal alkynes to form derivatives 3a–d. The
coupling product (trimethylsilyl)acetylene (3d) was exposed to
tetra-n-butylammonium fluoride trihydrate to generate the acetyle-
nyl derivative 3e, which was then ‘clicked’ to benzyl azide to yield
compound 4.
group in 2m–o does not increase the activities of the smaller
stituents (H, Me, i-Pr) compared to the non-substituted analogs 2a–
c. An activity decrease was observed when the -tert-butyl group of
a-sub-
a
the first generation lead compound o-2s was replaced with a less
bulky substituent (2p, o-2q) or moved away from the benzylic
a-carbon by just one CH2 unit (2r), which is consistent with DNA
synthesis terminating properties of their 50-triphosphates.18 Further-
more, neither the replacement of the 2-nitro group with different
substituents such as methyl (2h), cyano (2i), halo (2j–l), or methoxy
(o-2u), nor the introduction of another ortho-nitro group (2t)
improved activity. Third, the electronic characters of the aromatic
substituents and their positions on the aromatic ring appear to be
related. Therefore, for electron-donating groups in the benzene ring,
for example, the methoxy at the ortho- (o-2u) or para- (p-2u) posi-
tions, the activities are lower compared with that of the meta-
isomer (m-2u). Conversely, the ortho- (o-2s, o-2q) and para-
(p-2q) nitro-substituted derivatives are substantially more active
than their meta- counterparts (m-2q, m-2s). Fourth, derivatization
of the initial lead compound o-2s by the attachment of a large group
at the benzyl ring para-position via an acetylene linker substantially
improved the IC50 values, and the (phenyl)alkynyl derivative 3a was
identified as the second generation lead compound.
2.2. Cytotoxicity in MCF7 breast cancer cells: elucidation of
structure–activity relationship
2.3. Evaluation of selectivity for novel bioactive compound 3a
The MTT bioassay results26 for the derivatives are summarized in
Table 1, and they reveal four important trends in the SAR. First, the
presence of at least one phenyl group as either R1 or R2 is required,
To evaluate selectivity of the lead compound 3a, we assessed its
toxicity using normal fibroblast cells and compared it to that in

K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
1871
Table 1
IC50 values determined by MTT assays using base-modified T-nucleoside analogs and MCF7 breast cancer cells
R1
R2
Compd IC50
M)
R1
R2
Compd IC50
M)
R1
R2
Compd IC50
M)
(
l
(
l
(l
MeO
H
2a
2b
2c
2d
2e
>170
>200
>150
H
2m
2n
>200
>150
>150
m-2u
p-2u
2v
66 10
NO2
NO2
NO2
NO2
NO2
NO2
Me
Me
150 20
MeO
I
2o
56
4
NO2
88
6
2p
74
50
5
2w
>200
>110
>150
o-2q
5
6
2x
2f
123
9
2r
62
42
3a
3b
9
1
NO2
Ph
NO2
2g
188 11
o-2s
6
74
7
3
NO2
OMe
O
O2N
O2N
Me
2h
121
3
m-2s
>180
>180
NO2
(7-O-coumarin)
3c
16
2i
2j
132 23
80 12
m-2q
p-2q
5-Fluoro-20-deoxyuridine
38
29
5
3
CN
Cl
57
96
88
6
3d
3e
4
O2N
NO2
Me3Si
H
NO2
2k
2l
72
60
7
7
2t
7
6
90 10
Br
Cl
NO2
NO2
Cl
o-2u
19
1
NO2
OMe
N
Ph
N
N
MCF7 breast cancer cells (Fig. 1). The IC50 value of 3a for fibroblast
cells was 55 M, showing a selectivity ratio of 6.3 1.6, whereas
the selectivity of 5-fluorouracil, the FDA-approved drug used for
treating breast cancer, was 1.8 0.5. Therefore, our second-
generation lead compound 3a could potentially have a significantly
wider therapeutic window than the current chemotherapeutic drug.
8
l
100
60
20
2.4. Evaluation of activity for novel bioactive compound 3a in
other cancer cells
1
10
100
[3a], uM
The NCI-60 human tumor cell line screen based on the SRB
Figure 1. Selectivity of 3a. Viability of MCF7 cancer cells (black) and fibroblasts
(grey) in the presence of 3a. Selectivity is greater than 5-fold.
assay gave a growth inhibition of 58% for compound 3a at 10
in MCF7 cells, which is consistent with the IC50 value of 9
l
l
M
M
1

1872
K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
Table 2
SRB cellular protein content assay of 3a
O2N
t-Bu
HO
O
N
NH
O
O
O
OH
Cancer cell line
10 lM GI (%)
Leukemia K-562
Leukemia MOLT-4
38
30
51
34
31
36
34
31
27
30
26
30
42
58
Figure 2. Addition of compound 3a leads to the activation of the DNA damage
response. (inset) Representative Western blot showing a 1.78 0.22 increase after
20 h (p >0.03).
Leukemia RPMI-8226
Leukemia RPMI-8226
Non-small cell lung A549/ATCC
Non-small cell lung EKVX
Non-small cell lung H460
Non-small cell lung NCI-H522
Central nervous system U251
Melanoma UACC-62
Renal A489
Renal UO-31
Prostate PC-3
Breast MCF-7
obtained from the MTT assay. Additionally, the lead compound also
showed significant activity against leukemia, prostate, renal, mela-
noma, central nervous system, and non-small lung cancer cell lines
(Table 2).
Figure 3. Primer extension assay studies of 3a triphosphate. Left to right: no
polymerase, 3aTP at 0, 0.125, 0.25, 0.5, 1, 2 mM, no terminating nucleotide, acyclo
A, C, G (2 mM each), acylco T at 2, 1, 0.5, 0.125 mM.
2.5. Activation of DNA damage response
We next confirmed that 3a elicits a DNA damage response. Most
polymerization fork halting events lead to the activation of double
strand break repair, a key marker for which is phosphorylation of
the histone protein H2A.27 MCF7 cells were treated with 10
lM
3. Conclusions
3a, after 20 h of incubation their nuclei were isolated and used for
a quantitative western blot analysis28 to determine gamma-H2AX
levels (Fig. 2). Total protein contents were normalized using the
Bradford assay, and the nuclear envelope protein Lamin A served
as a loading control. Treatment with 3a led to a 1.78 0.22 increase
We have synthesized a library of thymidine derivatives bearing
a modified moiety attached to the 5-methyl group. Studies of the
structure–activity relationship regarding the cytotoxicity of these
base-modified T-nucleosides in MCF7 cancer cells have revealed
a lead compound. The DNA damage signaling elicited by the active
nucleoside 3a is consistent with its cellular uptake and 50-triphos-
phorylation into the active species 3aTP that interferes with DNA
synthesis. PCR studies using 3aTP support a mechanism of action
that inhibits DNA polymerase rather than being incorporated into
the DNA replication fork and blocking nucleotide addition as ini-
tially hypothesized, which warrants future studies of polymerase
activity affected by these species.
Importantly, this novel anti-cancer bioactive compound is less
toxic to normal cells compared with the FDA-approved T-nucle-
obase analog 5-fluorouracil, which is currently used against breast
cancer. Furthermore, we have produced an analog (3e) that can
undergo click reactions with various azides, facilitating the
synthesis of large libraries of diverse triazole compounds that
are analogous to 4. This opportunity offers: (a) the potential for
further improvement of cytotoxic activity, particularly in the light
of the positive influence of a large substituent when attached at
the para-position of the benzene ring, and (b) the attachment of
imaging modalities for further investigation of intracellular
metabolism.
in the level of c-H2AX after twenty-four hours, indicating that the
addition of 3a leads to the termination of DNA synthesis.
2.6. DNA synthesis termination by 50-triphosphate of 3a
To gain insight into the mechanism of action of 3a, we synthe-
sized its 50-triphosphate (3aTP) as described in our previous work18
and examined its incorporation into DNA under conditions
approximating the intracellular environment.29 We performed a
primer extension assay using exo-Vent polymerase, a random
51-mer template, a fluorescently labeled primer, a 100 lM cocktail
of all four natural dNTPs, and various concentrations of acyclo-NTPs
as positive control or 3aTP. Following extension (Fig. 3), it is obvi-
ous that 3aTP inhibits DNA polymerase rather than terminates
DNA synthesis as evidenced by the fact that acyclo-TTP showed ter-
mination at nucleotide positions 26, 30, 31, 37, and 41, while termi-
nation was not observed for 3aTP. Furthermore, primer extension
was halted entirely when the concentration of 3aTP was increased
from 1 to 2 mM, but this was not observed for any of the acyclo
nucleotide triphosphates at these concentrations.

K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
1873
after purification 20 mg (30%) of product as 1:1 mixture of diastere-
omers. 1H NMR (400 MHz, CD3OD) for diastereomers: d 7.96 and
7.95 (s, 1H), 7.33 (br m, 5H), 6.27 (m, 1H), 4.54 (m, 1H), 4.38 (m,
1H), 4.10 (m, 2H), 3.92 (m, 1H), 3.75 (m, 2H) 2.26 (m, 1H), 2.19
(m, 2H), 1.42 (m, 3H). 13C NMR (400 MHz, CD3OD) for diastere-
omers: d 165.06 and 165.03 (C), 152.09 (C), 144.91 and 144.82
(C), 140.55 and 140.52 (CH), 129.53 (CH), 128.58 and 128.56 (CH),
127.32 and 127.28 (CH), 112.75 and 112.71 (C), 88.93 (CH), 86.50
(CH), 79.42 and 79.34 (CH), 72.22 and 72.18 (CH), 64.41 and
64.22 (CH2), 62.84 and 62.81 (CH2), 41.37 and 41.32 (CH2), 24.53
and 24.42 (CH3). HRMS (ESI) for [MH]+ C18H23N2O6 calculated:
363.15506, observed: 363.15516; for [MNa]+ C18H22N2O6Na calcu-
lated: 385.13701, observed: 385.13712.
4. Materials and methods
4.1. Synthesis
All chemicals, reagents, and solvents were purchased from
Sigma–Aldrich Inc., TCI, and Fisher Scientific, Inc., and used as
received unless stated otherwise. All reactions were carried out
under an atmosphere of dry argon in oven-dried glassware. Indi-
cated reaction temperatures refer to those of the reaction bath,
while room temperature is noted as 25 °C. Pure reaction products
were typically dried under high vacuum in the presence of phos-
phorus pentoxide. Analytical thin layer chromatography (TLC)
was performed with glass backed silica plates (5 ꢀ 20 cm, 60 Å,
250 lm). Visualization was accomplished using a 254 nm UV lamp.
4.1.1.3. 5-[1-(Phenyl)-2-(methyl)-1-propoxymethyl]-20-deoxyur-
1H and 13C NMR spectra were recorded on either a Bruker Avance
400 MHz spectrometer or Bruker DPX 500 MHz spectrophotometer
using solutions of samples in either of the deturated solvents:
chloroform, methanol, acetonitrile, or water. Chemical shifts are
reported in ppm with tetramethylsilane as a standard. Data are
reported as follows: chemical shift, number of protons, multiplicity
(s = singlet, d = doublet, dd = doublet of doublet, t = triplet,
q = quartet, br = broad, m = multiplet, ab = AB pattern), and cou-
pling constants. High resolution mass spectral data were collected
on a Shimadzu Q-TOF 6500. All novel compounds were character-
ized by 1H, 13C, DEPT 13C, 31P (3aTP) NMR spectroscopy and high
resolution mass spectrometry. The identity of previously made
nucleoside derivatives was confirmed comparison of their 1H
NMR to the published data (reference provided). HPLC analysis of
final products was performed on an Agilent 1200 HPLC with UV
detection. Compounds biologically tested were at least 95% pure
as judged by 1H NMR and HPLC.
idine (2c). Heating 1 (250 mg, 0.385 mmol) with
a-isopropylben-
zyl alcohol (2-methyl-1-phenyl-1-propanol) (1.16 g, 7.70 mmol)
for 2 h at 124 °C followed by treatment with TBAF (303 mg,
0.963 mmol) afforded after purification 92 mg (61%) of product as
1:1 mixture of diastereomers. 1H NMR (500 MHz, CD3OD) for
diastereomers: d 7.91 (s, 1H), 7.29 (m, 5H), 6.27 (t, 1H, J = 6.7 Hz),
4.39 (m, 1H), 4.05 (m, 3H), 3.93 (m, 1H), 3.75 (m, 2H), 2.27 (m,
1H), 2.18 (m, 1H), 1.91 (m, 1H), 0.99 (m, 3H), 0.72 (m, 3H). 13C
NMR (125 MHz, CD3OD) for diastereomers: d 163.63 (C), 150.72
(C), 141.10 and 141.02 (C), 138.94 (CH), 127.80 (CH), 127.23 (CH),
127.14 (CH), 111.56 (C), 87.69 (CH), 87.54 (CH), 85.14 and 85.06
(CH), 70.94 (CH) and 70.87 (CH), 63.39 and 63.20 (CH2), 61.51
(CH2), 39.93 (CH2), 34.67 and 34.61 (CH), 18.09 (CH3), 18.00
(CH3). HRMS (ESI) for [MH]+ C20H27N2O6 calculated: 391.18636,
observed: 391.18644; for [MNa]+ C20H26N2O6Na calculated:
413.16831, observed: 413.16836.
4.1.1.4. 5-[1-(Phenyl)-1-(cyclohexyl)methoxymethyl]-20-deoxy-
uridine (2d). Heating 1 (97 mg, 0.149 mmol) with a-cyclohexylben-
4.1.1. General procedure for preparation of base-modified
nucleosides 2a–w
N3-tert-butyloxycarbonyl-5-bromomethyl-30,50-bis-O-tert-
butyldimethylsilyl-20-deoxyuridine (1)18 and appropriate alcohol
(4–20 equiv) were heated neat at 110–120 °C for 0.5–3 h under
argon atmosphere. The mixture was cooled down to room
temperature, dissolved in ethyl acetate (ca. 5 mL), and silica (0.5–
1.0 g) was added. The mixture was evaporated, and the solid was
applied onto a silica gel chromatography column (hexane/ethyl
acetate = 15:1 to 2:1, then dichloromethane/methanol = 0:1 to
10:1). Fractions that were not the starting alcohol were collected,
evaporated under reduced pressure, dissolved in tetrahydrofuran
(ca. 5 mL), and to this solution chilled at 0 °C tetra-n-butylammo-
nium fluoride trihydrate (TBAF) was added (2.5 equiv). The reac-
tion mixture was stirred for 2–3 h while gradually warming up
to room temperature. The solvent was removed under reduced
pressure and the residue was purified by silica gel (ethyl acetate/
methanol = 1:0 to 20:1) to afford product as waxy solid.
zyl alcohol (550 mg, 2.890 mmol) for 2.5 h at 132 °C followed by
purification of bis- and mono-TBS products with subsequent treat-
ment with TBAF (103 mg, 0.326 mmol) afforded after purification
22 mg (34%) of product as 1:1 mixture of diastereomers. 1H NMR
(400 MHz, CD3OD) for diastereomers: d 7.90 (s, 1H), 7.28 (m, 5H),
6.26 (m, 1H), 4.39 (m, 1H), 4.06 (m, 3H), 3.93 (m, 1H), 3.75 (m,
2H), 2.28 (m, 1H), 2.17 (m, 1H), 2.04 (m, 1H), 1.73 (m, 1H), 1.60
(m, 3H), 1.05 (m, 6H). 13C NMR (100 MHz, CD3OD) for diastereomers
d 165.00 and 164.98 (C), 154.08 (C), 142.40 (C), 140.29 and 140.26
(CH), 129.15 (CH), 128.64 and 128.57 (CH), 128.48 and 128.46
(CH), 112.92 (C), 88.94 and 88.90 (CH), 88.14 (CH), 86.54 and
86.47 (CH), 72.36 and 72.27 (CH), 64.66 and 64.45 (CH2), 62.94
and 62.90 (CH2), 45.71 and 45.70 (CH), 41.32 (CH2), 30.62 and
30.41 (CH2), 27.65 (CH2), 27.17 and 27.12 (CH2). HRMS (ESI) for
[MH]+ C23H31N2O6 calculated: 431.21766, observed: 431.21781;
[MNa]+ C23H30N2O6Na calculated: 453.19961, observed: 453.19977.
4.1.1.5. 5-[(Diphenyl)methoxymethyl]-20-deoxyuridine (2e). Heat-
4.1.1.1. 5-(Benzyl)oxymethyl-20-deoxyuridine (2a)30. NOTE no
TBAF treatment was necessary. Heating 1 (86 mg, 0.132 mmol)
with benzyl alcohol (286 mg, 2.346 mmol) for 1.5 h at 118 °C after
column chromatography afforded 25 mg (54%) of product. 1H NMR
(400 MHz, CD3OD): d 8.05 7.33 (m, 5H), 6.27 (t, 1H, J = 6.7 Hz), 4.57
(s, 2H), 4.39 (m, 1H), 4.30 (ab d, 1H, J = 12.6 Hz), 4.24 (ab d, 1H,
J = 12.6 Hz), 3.93 (q, 1H, J = 3.5 Hz), 3.78 (ab dd, 1H, J = 12.0,
3.4 Hz), 3.78 (ab dd, 1H, J = 12.0, 3.6 Hz), 2.27 (m, 2H), 2.19 (m,
2H), 1.42 (d, 3H, J = 6.5 Hz).
ing
1 (250 mg, 0.385 mmol) with diphenylmethanol (1.42 g,
7.70 mmol) for 2.5 h at 120 °C followed by treatment with TBAF
(607 mg, 1.925 mmol) afforded after purification 6 mg (3%) of product.
1H NMR (400 MHz, CD3OD) d 7.97 (s, 1H), 7.36 (d, 4H, J = 7.9 Hz), 7.29
(m, 4H), 7.21 (m, 2H), 6.26 (t, 1H, J = 6.7 Hz), 5.51 (s, 1H), 4.37 (q, 1H,
J = 3.5 Hz), 4.29 (ab d, 1H, J = 12.1 Hz), 4.24 (ab d, 1H, J = 12.1 Hz), 3.93
(m, 1H), 3.75 (ab dd, 1H, J = 12.0, 3.5), 3.70 (ab dd, 1H, J = 12.0, 3.9),
2.27 (m, 1H), 2.17 (m, 1H). 13C NMR (100 MHz, CD3OD) d 165.04 (C),
152.06 (C), 143.52 (C), 140.53 (CH), 129.34 (CH), 128.47 (CH), 128.09
(CH), 112.64 (C), 88.91 (CH), 86.56 (CH), 84.76 (CH), 72.22 (CH),
64.84 (CH2), 62.91 (CH2), 41.28 (CH2). HRMS (ESI) for [MH]+
C23H25N2O6 calculated: 425.17071, observed: 425.17082; [MNa]+
C23H24N2O6Na calculated: 447.15266, observed: 447.15276.
4.1.1.2. 5-[1-(Phenyl)ethoxymethyl]-20-deoxyuridine (2b). Heat-
ing
1 (121 mg, 0.186 mmol) with a-methylbenzyl alcohol
(1-phenyl-1-ethanol) (0.228 g, 1.862 mmol) for 1 h at 114 °C
followed by treatment with TBAF (0.303 g, 0.930 mmol) afforded

1874
K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
4.1.1.6. 5-[1-(Phenyl)-3,3-(dimethyl)-1-butoxymethyl]-20-deox-
yuridine (2f). Heating 1 (44 mg, 0.068 mmol) with -neo-pentyl-
benzyl alcohol (3,3-dimethyl-1-phenyl-1-butanol) (41 mg,
2H), 1.01 (s, 9H). 13C NMR (100 MHz, CD3OD) for diastereomers:
d 164.07 (C), 150.86 (C), 145.06 (C), 137.80 (CH), 131.33 (CH),
130.46 (C), 128.57 (CH), 123.06 and 122.93 (CH), 115.25 (CH),
112.98 (C), 91.70 (CH), 87.56 and 87.52 (CH), 85.11 and 85.02
(CH), 71.00 and 70.92 (CH), 61.55 (CH2), 58.09 (CH2), 39.83 (CH2),
35.58 (C), 24.29 (CH3). HRMS (ES+ TOF) for [MH]+ C22H28N3O6 cal-
culated: 430.19870, observed: 430.19700; for [MNa]+ C22H27N3O6-
Na calculated: 452.17970, observed: 452.18040.
a
0.239 mmol) for 2.5 h at 110 °C followed by treatment with TBAF
(53 mg, 0.170 mmol) afforded after purification 12 mg (43%) of
product as 1:1 mixture of diastereomers. 1H NMR (400 MHz, CD3-
OD) for diastereomers: d 7.97 and 7.95 (s, 1H), 7.34 (m, 5H), 6.29
(m, 1H), 4.51 (m, 1H), 4.41 (m, 1H), 4.05 (m, 2H), 3.94 (m, 1H),
3.78 (m, 2H), 2.28 (m, 1H), 2.21 (m, 1H), 1.82 (m, 1H), 1.44 (m,
1H), 0.99 and 0.98 (2s, 9H). 13C NMR (100 MHz, CD3OD) for
diastereomers d 163.60 (C), 150.63 (C), 143.72 (C), 139.23 and
139.06 (CH), 128.13 (CH), 127.00 (CH), 126.28 and 126.21 (CH),
111.47 (C), 86.51 (CH), 85.09 and 84.93 (CH), 80.08 and 79.97
(CH), 70.85 (CH), 62.71 and 62.52 (CH2), 61.52 and 61.49 (CH2),
51.94 and 51.82 (CH2), 40.01 (CH2), 30.01 (C), 29.32 (CH3). HRMS
(ESI) for [MH]+ C22H31N2O6 calculated: 419.21766, observed:
419.21780; [MNa]+ C22H30N2O6Na calculated: 441.19961,
observed: 441.19974.
4.1.1.10. 5-[1-(2-Chlorophenyl)-2,2-(dimethyl)propoxymethyl]-
20-deoxyuridine (2j). Heating
1
(250 mg, 0.385 mmol) with
a-tert-butyl-2-chlorobenzyl alcohol (3,3-dimethyl-1-(2-chloro)phe-
nyl-1-propanol) (540 mg, 2.718 mmol) for 3 h at 118 °C followed
by treatment with TBAF (43 mg, 0.136 mmol) afforded after purifi-
cation 19 mg (11%) of product as 1:1 mixture of diastereomers. 1H
NMR (400 MHz, CD3OD) for diastereomers: d 7.91 and 7.89 (2s,
1H), 7.53 (d, 1H, J = 7.6 Hz), 7.31 (m, 3H), 6.27 (m, 1H), 4.67 (s,
1H), 4.41 (m, 1H), 4.10 (m, 1H), 4.00 (m, 1H), 3.95 (m, 1H), 3.76
(m, 2H), 2.27 (m, 2H), 0.97 and 0.96 (2s, 9H). 13C NMR (100 MHz,
CD3OD) for diastereomers d 163.50 and 163.47 (C), 150.68 (C),
139.10 and 138.68 (CH), 137.28 (C), 134.38 (C), 129.76 and
129.70 (CH), 128.89 and 128.80 (CH), 128.40 and 128.36 (CH),
111.36 and 111.10 (C), 109.90 (CH), 87.57 and 87.52 (CH), 85.24
and 85.07 (CH), 83.89 and 83.36 (CH), 70.97 (CH), 64.20 and
63.72 (CH2), 61.54 (CH2), 39.89 and 39.83 (CH2), 36.37 and 36.33
(C), 25.15 (CH3). HRMS (ESI+) for [MNa]+ C21H2735ClN2O6Na calcu-
lated: 461.14499 observed: 461.14504; for [MNa]+ C21H2737ClN2-
O6Na calculated: 463.14213 observed: 463.14210. HRMS (ESIꢁ)
for [MꢁH]ꢁ C21H2635ClN2O6 calculated: 437.14849 observed:
4.1.1.7. 5-[1-(Phenyl)-2,2-(dimethyl)-1-propoxymethyl]-20-deo-
xyuridine (2g). Heating 1 (250 mg, 0.385 mmol) with
a-tert-
butylbenzyl alcohol (2,2-dimethyl-1-phenyl-1-propanol) (1.26 g,
7.70 mmol) for 2 h at 120 °C followed by treatment with TBAF
(607 mg, 1.925 mmol) afforded after purification 22 mg (21%) of
product as 1:1 mixture of diastereomers. 1H NMR (400 MHz, CD3-
OD) for diastereomers: d 7.93 and 7.92 (2s, 1H), 7.32 (m, 5H), 6.28
(m, 1H), 4.42 (m, 1H), 4.06 (m, 3H), 3.95 (m, 1H), 3.77 (m, 2H), 2.30
(m, 1H), 2.19 (m, 1H), 0.91 (s, 9H). 13C NMR (100 MHz, CD3OD) for
diastereomers: d 163.61 (C), 150.68 (C), 139.42 (C), 138.73 and
138.62 (CH), 128.24 and 128.20 (CH), 127.18 (CH), 126.95 (CH),
111.61 (C), 87.66 and 87.56 (CH), 87.58 and 87.51 (CH), 85.14
and 84.99 (CH), 70.99 and 70.89 (CH), 63.79 and 63.53 (CH2),
61.59 (CH2), 39.94 and 39.87 (CH2), 35.11 (C), 25.38 (CH3). HRMS
(ESI) for [MH]+ C21H29N2O6 calculated: 405.20201, observed:
405.20210; for [MNa]+ C21H28N2O6Na calculated: 427.18396,
observed: 427.18409.
437.14851;
439.14656.
C
21H2637ClN2O6 calculated: 439.14561 observed:
4.1.1.11. 5-[1-(2-Bromomethyl)phenyl-2,2-(dimethyl)propoxy-
methyl]-20-deoxyuridine (2k). Heating 1 (208 mg, 0.320 mmol)
with
a-tert-butyl-2-bromobenzyl alcohol (3,3-dimethyl-1-(2-bro-
mo)phenyl-1-propanol) (389 mg, 1.607 mmol) for 1 h at 112 °C.
Purification afforded 3 mg (2%) of product as 1:1 mixture of
diastereomers. 1H NMR (400 MHz, CD3OD) for diastereomers: d
7.89 and 7.86 (2s, 1H), 7.54 (m, 2H), 7.36 (m, 1H), 7.18 (m, 1H),
6.25 (m, 1H), 4.64 and 4.63 (2s, 1H), 4.40 (m, 1H), 4.04 (m, 2H),
3.92 (m, 1H), 3.75 (m, 2H), 2.24 (m, 2H), 0.97 and 0.96 (s, 9H);
13C NMR (100 MHz, CD3OD) for diastereomers d 165.03 and
164.88 (C), 152.12 (C), 140.55 and 140.08 (CH), 140.36 (C),
140.26 (C), 133.72 and 133.66 (CH), 131.35 and 131.32 (CH),
130.18 and 130.15 (CH), 128.20 and 128.18 (CH), 112.77 and
112.52 (C), 88.97 and 88.94 (CH), 87.64 and 86.54 (CH), 87.10
and 86.71 (CH), 72.41 and 72.39 (CH), 65.50 and 65.10 (CH2),
62.99 and 62.97 (CH2), 41.30 and 41.27 (CH2), 37.92 and 37.88
(C), 26.68 (CH3). HRMS (ESI) for [MH]+ C21H2879BrN2O6 calculated:
483.11307 observed: 483.11264, C21H2881BrN2O6 calculated:
485.11103 observed: 485.11055; for [MNa]+ C21H2779BrN2O6Na
calculated: 505.09502 observed: 505.09452, C21H2781BrN2O6Na
calculated: 507.09297 observed: 507.09212.
4.1.1.8. 5-[1-(2-Methyl)phenyl-2,2-(dimethyl)propoxymethyl]-
20-deoxyuridine (2h). NOTE: no TBAF treatment was necessary.
Heating 1 (125 mg, 0.195 mmol) with a-tert-butyl-2-methybenzyl
alcohol (3,3-dimethyl-1-(2-methyl)phenyl-1-propanol) (174 mg,
0.776 mmol) for 1 h at 112 °C followed by purification afforded
8 mg (10%) of product as 1:1 mixture of diastereomers. 1H NMR
(400 MHz, CD3OD) for diastereomers: d 7.89 and 7.88 (2s, 1H),
7.41 (m, 1H), 7.16 (m, 3H), 6.28 (m, 1H), 4.46 (s, 1H), 4.41 (m,
1H), 4.03 and 4.01 (2s, 2H), 3.95 (m, 1H), 3.76 (m, 2H), 2.38 and
2.37 (2s, 3H), 2.30 (m, 1H), 2.19 (m, 1H), 0.95 (s, 9H). 13C NMR
(100 MHz, CD3OD) for diastereomers d 163.57 (C), 150.67 (C),
138.45 and 138.39 (CH), 136.84 (C), 136.74 (C), 129.76 (CH),
127.76 and 127.72 (CH), 126.71 and 126.66 (CH), 124.97 and
124.93 (CH), 111.82 (C), 87.54 and 87.52 (CH), 85.10 and 85.03
(CH), 83.83 and 83.79 (CH), 71.02 (CH), 63.41 and 63.31 (CH2),
61.59 (CH2), 39.88 and 39.85 (CH2), 36.41 and 36.37 (C), 25.43
(CH3), 19.29 and 19.23 (CH3). HRMS (ES+ TOF) for [MNa]+
C22H30N2O6Na calculated: 441.20020 observed: 441.19960.
4.1.1.12.
ethyl]-20-deoxyuridine (2l). Heating 1 (158 mg, 0.243 mmol) with
a-tert-butyl-2,6-dichlorobenzyl alcohol (3,3-dimethyl-1-(2,6-
5-[1-(2,6-Dichlorophenyl)-2,2-(dimethyl)propoxym-
4.1.1.9. 5-[1-(2-Cyanophenyl)-2,2-(dimethyl)propoxymethyl]-
20-deoxyuridine (2i). Heating
1
(114 mg, 0.176 mmol) with
dichloro)phenyl-1-propanol) (113 mg, 0.486 mmol) for 3.5 h at
102–104 °C followed by treatment with TBAF (77 mg, 0.244 mmol)
afforded after purification 8 mg (7%) of product as 1:1 mixture of
diastereomers. 1H NMR (400 MHz, CD3OD) for diastereomers
(NOTE: due to the presence of two ortho-substituents, there is,
apparently, restricted rotation of the 2,6-dichlorophenyl group
around its 1-C–4-C axis, which thereby makes 3-H non-equivalent
to 5-H): d 7.93 and 7.87 (2s, 1H), 7.43 (d, J = 8.0 Hz, 1H), 7.41 (d,
a-tert-butyl-2-cyanobenzyl alcohol (2,2-dimethyl-1-(2-cyano)-
phenyl-1-propanol) (1.61 g, 7.70 mmol) for 2 h at 120 °C followed
by treatment with TBAF (607 mg, 1.925 mmol) afforded after
purification 14 mg (18%) of product as 1:1 mixture of diastere-
omers. 1H NMR (400 MHz, CD3OD) for diastereomers: d 7.99 and
7.98 (2s, 1H), 7.89 (d, J = 7.7 Hz, 1H), 7.54 (m, 3H), 6.32 (m, 1H),
5.33 (s, 1H), 4.38 (m, 3H), 3.91 (m, 1H), 3.68 (m, 2H), 2.24 (m,

K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
1875
J = 8.5 Hz, 1H), 7.26 (t, J = 8.0 Hz, 1H), 6.30 (m, 1H), 5.08 and 5.06
(2s, 1H), 4.40 (m, 1H), 4.10 (m, 2H), 3.94 (m, 1H), 3.72 (m, 2H),
2.30 (m, 1H), 2.18 (m, 1H), 1.06 (s, 9H). 13C NMR (100 MHz, CD3OD)
for diastereomers (NOTE: due to the presence of two ortho-sub-
stituents, there is, apparently, restricted rotation of the 2,6-dichlor-
ophenyl group around its 1-C–4-C axis, which thereby makes 2-CCl
non-equivalent to 6-CCl, and accordingly, 3-CH non-equivalent to
5-CH) d 163.51 and 163.44 (C), 150.72 (C), 139.16 and 139.11
(CH), 137.26 and 137.19 (C), 134.38 (C), 133.43 (C), 131.06 (CH),
128.96 and 128.93 (CH), 128.62 and 128.57 (CH), 110.94 (C),
87.53 and 87.43 (CH), 85.73 and 85.33 (CH), 85.12 and 84.93
(CH), 71.09 and 71.01 (CH), 63.75 and 63.62 (CH2), 61.67 and
61.64 (CH2), 39.84 and 39.74 (CH2), 38.35 (C), 26.78 (CH3). HRMS
(ESI) [MH]+ C21H2735Cl2N2O6 calculated: 473.12462 observed:
473.12412; for [MNa]+ C21H2635Cl2N2O6Na calculated: 495.10656
observed: 495.10611.
4.1.1.16. 5-[1-(2-Nitro)phenyl-1-(cyclohexyl)methoxymethyl]-
20-deoxyuridine (2p). Heating
(150 mg, 0.231 mmol) with
-cyclohexyl-2-nitrobenzyl alcohol (440 mg, 1.880 mmol) for
1
a
2.5 h at 116 °C followed by purification of bis- and mono-TBS prod-
ucts with subsequent treatment with TBAF (73 mg, 0.231 mmol)
afforded after purification 28 mg (25%) of product as 1:1 mixture
of diastereomers. 1H NMR (400 MHz, CD3OD) for diastereomers: d
7.99 and 7.96 (2s, 1H), 7.89 (d, J = 8.1 Hz, 1H), 7.71 (m, 2H), 7.50
(d, J = 7.6 Hz, 1H), 6.27 (t, J = 6.6 Hz, 1H), 4.78 (m, 1H), 4.42 (m,
1H), 4.12 (m, 3H), 3.94 (m, 1H), 3.77 (m, 2H), 2.28 (m, 1H), 2.22
(m, 1H), 1.87 (m, 1H), 1.70 (m, 2H), 1.30 (m, 4H), 1.17 (m, 4H). 13
C
NMR (100 MHz, CD3OD) for diastereomers d 163.57 (C), 150.65
(C), 149.62 and 149.53 (C), 139.61 and 139.51 (CH), 136.21 (C),
132.48 (CH), 129.11 and 129.05 (CH), 128.02 (CH), 123.65 and
123.59 (CH), 111.02 and 110.86 (C), 87.58 (CH), 85.07 (CH), 80.64
and 80.23 (CH), 70.94 and 70.91 (CH), 64.15 and 63.96 (CH2),
61.50 (CH2), 44.50 and 44.47 (CH), 39.92 and 39.89 (CH2), 29.22
and 29.15 (CH2), 28.05 and 27.98 (CH2), 26.09 (CH2), 25.96 and
25.94 (CH2), 25.78 (CH2). HRMS (ESI) for [MH]+ C23H30N3O8 calculat-
ed: 476.20274, observed: 476.20292; for [MNa]+ C23H29N3O8Na cal-
culated: 498.18469, observed: 498.18486.
4.1.1.13.
5-[1-(2-Nitrobenzyl)oxymethyl]-20-deoxyuridine
(2m)18. NOTE: no TBAF treatment was necessary. Heating 1
(220 mg, 0.339 mmol) with 2-nitrobenzyl alcohol (233 mg,
1.524 mmol) for 20 min at 100–105 °C afforded after purification
21 mg (16%) of product. 1H NMR (400 MHz, CD3OD): d 8.12 (s,
1H), 8.04 (dd, 1H, J = 8.2, 1.1 Hz), 7.84 (d, 1H, J = 7.0 Hz), 7.71 (dt,
1H, J = 7.6, 1.1 Hz), 7.52 (m, 1H), 6.30 (t, 1H, J = 6.7 Hz), 4.93 (s,
2H), 4.43 (m, 1H), 4.39 (ab d, 1H, J = 11.8 Hz), 4.34 (ab d, 1H,
J = 11.8 Hz), 3.95 (q, 1H, J = 3.4 Hz), 3.82 (ab d, 1H, J = 12.0,
3.8 Hz), 3.75 (ab d, 1H, J = 12.0, 3.3 Hz), 2.29 (m, 2H).
4.1.1.17. 5-[{(2-Nitrophenyl)phenyl}methoxymethyl]-20-deox-
yuridine (o-2q). Heating 1 (210 mg, 0.323 mmol) with a-phenyl-
2-nitrobenzyl alcohol (phenyl(2-nitrophenyl)methanol) (361 mg,
1.576 mmol) for 2.5 h at 110–117 °C followed by purification of
bis- and mono-TBS products with subsequent treatment with TBAF
(73 mg, 0.231 mmol) afforded after purification 12 mg (7%) of pro-
duct as 1:1 mixture of diastereomers. 1H NMR (400 MHz, CD3OD)
for diastereomers: d 8.04 and 8.00 (2s, 1H), 7.88 (m, 1H), 7.68
(m, 2H), 7.52 (m, 1H), 7.34 (m, 5H), 6.28 (m, 1H), 6.18 and 6.17
(2s, 1H), 4.42 (m, 1H), 4.30 (m, 3H), 3.94 (m, 1H), 3.78 (m, 2H),
2.28 (m, 2H). 13C NMR (100 MHz, CD3OD) for diastereomers d
163.71 (C), 159.43 (C), 158.87 (C), 150.64 (C), 140.03 and 139.74
(CH), 136.21 and 136.18 (C), 132.60 (CH), 128.13 (CH), 128.11
(CH), 128.09 (CH), 127.58 (CH), 123.92 (CH), 123.87 (CH), 110.71
(C), 87.59 (CH), 85.13 (CH), 78.29 and 78.16 (CH), 70.82 (CH),
64.01 and 63.91 (CH2), 61.48 (CH2), 39.95 (CH2). HRMS (ES+ TOF)
for [MNa]+ C23H29N3O8Na calculated: 492.13820, observed:
492.13830.
4.1.1.14.
(2n)18. Heating
5-[1-(2-Nitrophenyl)ethoxymethyl]-20-deoxyuridine
(152 mg, 0.234 mmol) with -methyl-2-
1
a
nitrobenzyl alcohol (1-(2-nitro)phenyl-1-ethanol) (176 mg,
1.053 mmol) for 1 h at 104 °C afforded after purification 14 mg
(15%) of product as 1:1 mixture of diastereomers. 1H NMR
(400 MHz, CD3OD) for diastereomers: d 8.01 and 8.00 (2s, 1H),
7.93 (m, 1H), 7.85 (m, 1H), 7.72 (t, 1H, J = 7.5 Hz), 6.27 (m, 1H),
5.09 (m, 1H), 4.42 (m, 1H), 4.11 (m, 2H), 3.94 (m, 1H), 3.78 (m,
2H), 2.26 (m, 2H), 1.52 and 1.52 (2 d, 3H, J = 6.3 Hz). 13C NMR
(100 MHz, CD3OD) for diastereomers d 163.63 (C), 150.65 (C),
148.48 (C), 139.71 and 139.68 (CH), 138.99 (C), 133.27 and
133.24 (CH), 128.02 (CH), 127.81 and 127.78 (CH), 123.74 and
123.70 (CH), 110.92 and 110.84 (C), 87.58 and 87.56 (CH), 85.13
and 85.12 (CH), 73.19 and 73.01 (CH), 70.81 and 70.78 (CH),
63.60 and 63.46 (CH2), 61.40 and 61.38 (CH2), 39.99 (CH2), 22.47
(CH3).
4.1.1.18. 5-[{(3-Nitrophenyl)phenyl}methoxymethyl]-20-deox-
yuridine (m-2q). Heating 1 (200 mg, 0.308 mmol) with
a-phe-
nyl-3-nitrobenzyl alcohol (phenyl(3-nitrophenyl)methanol)
(350 mg, 1.673 mmol) for 1 h at 120 °C followed by purification
of bis- and mono-TBS products with subsequent treatment with
TBAF (49 mg, 0.155 mmol) afforded after purification 16 mg
(12%) of product as 1:1 mixture of diastereomers. 1H NMR
(400 MHz, CD3OD) for diastereomers: d 8.25 and 8.25 (2s, 1H),
8.11 (m, 1H), 8.07 (m, 1H), 7.79 (m, 1H), 7.55 (dt, 1H, J = 8.0,
1.3 Hz), 7.42 (m, 2H), 7.35 (m, 2H), 7.28 (m, 1H), 6.26 (m, 1H),
5.68 (s, 1H), 4.39 (m, 1H), 4.32 (m, 2H), 3.94 (q, 1H, J = 3.4 Hz),
3.74 (m, 2H), 2.29 (m, 1H), 2.20 (m, 1H). 13C NMR (100 MHz, CD3-
OD) for diastereomers d 163.69 (C), 150.66 (C), 148.27 (C), 144.96
(C), 141.11 (C), 139.65 (CH), 132.81 and 132.80 (CH), 129.19 (CH),
128.36 (CH), 127.68 (CH), 126.83 and 126.80 (CH), 121.85 (CH),
121.12 and 121.09 (CH), 110.91 (C), 87.65 (CH), 85.21 and 85.19
(CH), 82.08 and 82.03 (CH), 70.87 (CH), 63.79 and 63.68 (CH2),
61.45 (CH2), 40.04 (CH2). HRMS (ESI+) for [MH]+ C23H24N3O8 calcu-
lated: 470.15634, observed: 470.15581; for [MNa]+ C23H23N3O8Na
calculated: 492.13828, observed: 492.13777. HRMS (ESIꢁ) for
[MꢁH]ꢁ C23H22N3O8 calculated: 468.14124, observed: 468.14101.
4.1.1.15.
(2o)18. Heating
5-[1-(2-Nitrophenyl)ethoxymethyl]-20-deoxyuridine
(175 mg, 0.270 mmol) with -isopropyl-2-
1
a
nitrobenzyl alcohol (1-(2-nitro)phenyl-2-methyl-1-propanol)
(400 mg, 2.050 mmol) for 1 h at 105–114 °C afforded after purifica-
tion 16 mg (14%) of product as 1:1 mixture of diastereomers. 1H
NMR (400 MHz, CD3OD) for diastereomers: d 8.01 and 7.98 (2s,
1H), 7.90 (d, 1H, J = 8.5 Hz), 7.77 (m, 1H), 7.51 (m, 1H), 6.27 (m,
1H)H), 4.78 (m, 1H), 4.41 (m, 1H), 4.13 (m, 2H), 3.94 (m, 1H),
3.77 (m, 2H), 2.25 (m, 2H), 1.96 (m, 1H), 0.97 and 0.96 (2d, 3H,
J = 6.7 Hz), 0.88 and 0.86 (2d, 3H, J = 7.0 Hz). 13C NMR (100 MHz,
CD3OD) for diastereomers d 163.63 and 163.56 (C), 150.66 and
150.64 (C), 149.52 (C), 139.66 and 139.50 (CH), 136.52 and
136.51 (C), 132.56 and 132.54 (CH), 129.01 and 128.95 (CH),
128.05 (CH), 123.71 and 123.65 (CH), 111.05 and 110.86 (C),
87.57 (CH), 85.08 and 85.07 (CH), 81.08 and 80.82 (CH), 70.90
(CH), 64.23 and 63.96 (CH2), 61.48 and 61.45 (CH2), 39.95 and
39.90 (CH2), 34.67 (CH), 18.31 and 18.26 (CH3), 16.64 and 16.57
(CH3). HRMS (ESI+) for [MH]+ C20H26N3O8 calculated: 436.17144,
observed: 436.17149; for [MNa]+ C20H25N3O8Na calculated:
458.15339, observed: 458.15342. HRMS (ESIꢁ) for [MꢁH]ꢁ
C20H24N3O8 calculated: 434.15689, observed: 434.15669.
4.1.1.19. 5-[{(4-Nitrophenyl)phenyl}methoxymethyl]-20-deox-
yuridine (p-2q). Heating 1 (150 mg, 0.231 mmol) with
a-phenyl-
3-nitrobenzyl alcohol (phenyl(4-nitrophenyl)methanol) (211 mg,

1876
K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
0.923 mmol) for 20 min at 115 °C followed by treatment with TBAF
(113 mg, 0.358 mmol) afforded after purification 7 mg (6%) of pro-
duct as 1:1 mixture of diastereomers. 1H NMR (400 MHz, CD3OD)
for diastereomers: d 8.14 (d, 2H, J = 8.7 Hz), 8.03 (s, 1H), 7.61 (d,
2H, J = 8.7 Hz), 7.37 (m, 2H), 7.30 (m, 2H), 7.23 (m, 1H), 6.23 (m,
1H), 5.62 (s, 1H), 4.36 (m, 1H), 4.26 (m, 2H), 3.90 (m, 1H), 3.71
(m, 2H), 2.25 (m, 1H), 2.15 (m, 1H). 13C NMR (100 MHz, CD3OD)
for diastereomers d 166.94 and 165.11 (C), 152.09 and 151.34
(C), 148.53 and 148.00 (C), 142.41 (C), 140.96 (CH), 141.11 (C),
129.77 (CH), 129.64 and 129.54 (C), 129.13 (CH), 128.81 (CH),
128.32 and 128.29 (CH), 124.44 (CH), 112.35 (C), 89.06 (CH),
86.61 (CH), 83.61 (CH), 72.23 (CH), 65.11 and 65.05 (CH2), 62.84
(CH2), 41.47 (CH2). HRMS (ESI+) for [MH]+ C23H24N3O8 calculated:
470.15634, observed: 470.15582; for [MNa]+ C23H23N3O8Na calcu-
lated: 492.13828, observed: 492.13780. HRMS (ESIꢁ) for [MꢁH]ꢁ
C23H22N3O8 calculated: 468.14124, observed: 468.14112.
diastereomers. 1H NMR (400 MHz, CD3OD) for diastereomers: d
8.15 (m, 2H), 8.00 (s, 1H), 7.70 (m, 1H), 7.57 (m, 1H), 6.24 (m,
1H), 4.41 (m, 1H), 4.21 and 4.20 (2s, 1H), 4.12 (m, 2H), 3.93 (m,
1H), 3.77 (m, 2H), 2.23 (m, 2H), 0.90 and 0.90 (2s, 9H). 13C NMR
(100 MHz, CD3OD) for diastereomers: d 165.00 (C), 152.02 (C),
149.20 (C), 143.71 (C), 140.95 and 140.92 (CH), 135.94 and
135.89 (CH), 129.81 and 129.79 (CH), 124.13 (CH), 123.28 and
123.25 (CH) 112.54 (C), 89.74 and 89.61 (CH), 89.06 and 89.02
(CH), 86.54 and 86.50 (CH), 72.36 and 72.32 (CH), 65.58 (CH2),
62.86 (CH2), 41.49 and 41.41 (CH2), 36.56 (C), 26.46 (CH3). HRMS
(ESI) for [MH]+ C21H28N3O8 calculated: 450.18709, observed:
450.18711; for [MNa]+ C21H27N3O8Na calculated: 472.16958,
observed: 472.16903; for [MꢁH]ꢁ C21H26N3O8 calculated:
448.17254, observed: 448.17236.
4.1.1.23.
methyl]-20-deoxyuridine (2t). Heating 1 (259 mg, 0.399 mmol)
with -tert-butyl-2,6-dinitrobenzyl alcohol (2,2-dimethyl-1-(2,6-
5-[1-(2,6-Dinitrophenyl)-2,2-(dimethyl)propoxy-
4.1.1.20. 5-[1-(2-Nitrophenyl)-3,3-(dimethyl)butoxymethyl]-20-
a
deoxyuridine (2r). Heating 1 (210 mg, 0.323 mmol) with
a
-neo-
dinitro)phenyl-1-propanol) (342 g, 1.345 mmol) for 10 min at
105 °C followed by treatment with TBAF (314 mg, 0.997 mmol)
afforded after purification 23 mg (12%) of product as 1:1 mixture
of diastereomers. 1H NMR (400 MHz, CD3OD) for diastereomers: d
8.05 (m, 1H), 8.01 and 7.86 (2s, 1H), 7.74 (m, 2H), 6.39 and 6.34
(2t, J = 6.7 Hz, 1H), 5.20 and 5.19 (2s, 1H), 4.44 (m, 1H), 4.25 (m,
2H), 3.94 (m, 1H), 3.74 (m, 2H), 2.33 (m, 2H), 0.87 (s, 9H). 13C
NMR (100 MHz, CD3OD) for diastereomers (NOTE: due to the pres-
ence of two ortho-substituents, there is, apparently, restricted rota-
tion of the 2,6-dinitrophenyl group around its 1-C–4-C axis, which
thereby makes 2-CNO2 non-equivalent to 6-CNO2, and accordingly,
3-CH non-equivalent to 5-CH): d 163.62 and 163.55 (C), 150.89 and
150.74 (C), 151.25 (C), 151.13 (C), 140.62 and 139.45 (CH), 130.13
and 130.04 (CH), 128.06 and 128.01 (CH), 126.26 and 126.16 (CH),
125.47 and 125.32 (C), 109.97 and 109.84 (C), 87.55 and 87.35
(CH), 85.05 and 84.56 (CH), 82.85 and 82.05 (CH), 71.07 and 70.96
(CH), 66.23 and 65.85 (CH2), 61.69 (CH2), 39.82 and 39.50 (CH2),
37.88 and 37.83 (C), 25.72 (CH3). HRMS (ESI) for [MH]+
C21H27N4O10 calculated: 495.17217, observed: 495.17218; for
[MꢁH]ꢁ C21H26N4O10 calculated: 493.15762, observed: 493.15754.
pentyl-2-nitrobenzyl alcohol (3,3-dimethyl-1-(2-nitro)phenyl-1-
butanol) (480 mg, 2.152 mmol) for 2 h at 120 °C followed by
treatment with TBAF (607 mg, 1.925 mmol) afforded after purifica-
tion 18 mg (12%) of product as 1:1 mixture of diastereomers. 1H
NMR (400 MHz, CD3OD) for diastereomers: d 8.02 and 8.00 (2s,
1H), 7.90 (d, 1H, J = 8.2 Hz), 7.82 (m, 1H) 7.70 (t, 1H, J = 7.6 Hz),
7.48 (m, 1H), 6.27 (t, 1H, J = 6.9 Hz), 5.14 (m, 1H), 4.42 (m, 1H),
4.05 (m, 2H), 3.94 (m, 1H), 3.78 (m, 2H), 2.28 (m, 1H), 2.19 (m,
1H), 1.71 (m, 1H), 1.53 (m, 1H), 1.05 and 1.04 (2s, 9H). 13C NMR
(100 MHz, CD3OD) for diastereomers: d 163.55 and 163.51 (C),
150.64 and 150.60 (C), 148.26 and 148.22 (C), 139.90 and 139.66
(CH), 139.16 (C), 137.73 (CH), 133.16 and 133.11 (CH), 128.29
and 127.82 (CH), 123.73 and 123.67 (CH), 111.10 and 110.88 (C),
87.67 and 87.58 (CH), 85.07 and 84.97 (CH), 75.02 and 74.74
(CH), 70.89 (CH), 63.25 and 63.13 (CH2), 61.46 (CH2), 51.05 and
51.01 (CH2), 40.05 and 39.93 (CH2), 30.42 and 30.39 (C), 29.40
and 29.38 (CH3). HRMS (ESI) for [MNa]+ C22H29N3O8Na calculated:
486.18430, observed: 486.18520.
4.1.1.21. 5-[1-(2-Nitrophenyl)-2,2-(dimethyl)propoxymethyl]-
20-deoxyuridine (o-2s)18. Heating 1 (250 mg, 0.385 mmol) with
4.1.1.24.
methyl]-20-deoxyuridine (o-2u). Heating 1 (250 mg, 0.385 mmol)
with -tert-butyl-2-methoxybenzyl alcohol (3,3-dimethyl-1-(2-
5-[1-(2-Methoxyphenyl)-2,2-(dimethyl)propoxy-
a-tert-butyl-2-nitrobenzyl
alcohol
(2,2-dimethyl-1-(2-ni-
tro)phenyl-1-propanol) (1.61 g, 7.70 mmol) for 2 h at 120 °C fol-
lowed by treatment with TBAF (607 mg, 1.925 mmol) afforded
after purification 33 mg (19%) of product as 1:1 mixture of
diastereomers. 1H NMR (400 MHz, CD3OD) for diastereomers: d
8.01 and 7.99 (2s, 1H), 7.81 (m, 2H), 7.68 (m, 1H), 7.51 (m, 1H),
6.28 (t, 1H, J = 6.9 Hz), 4.98 (s, 1H), 4.42 (m, 1H), 4.20 (m, 2H),
3.94 (m, 1H), 3.76 (m, 2H), 2.26 (m, 2H), 0.85 and 0.84 (2s, 9H).
13C NMR (100 MHz, CD3OD) for diastereomers: d 163.60 and
163.55 (C), 150.89 and 150.75 (C), 150.70 (C), 139.80 and 139.41
(CH), 133.81 (C), 131.76 and 131.74 (CH), 129.91 and 129.82
(CH), 128.14 (CH), 123.56 and 123.43 (CH), 111.01 and 110.74
(C), 87.55 (CH), 85.13 and 85.04 (CH), 81.76 and 81.04 (CH),
70.98 and 70.95 (CH), 64.49 and 64.18 (CH2), 61.52 and 61.46
(CH2), 39.86 and 39.78 (CH2), 36.12 and 36.02 (C), 24.84 and
24.82 (CH3). HRMS (ESI+) for [MH]+ C21H28N3O8 calculated:
450.18709, observed: 450.18708; for [MH]+ C21H28N3O8 calculat-
ed: 472.16904, observed: 472.16918. HRMS (ESIꢁ) for [MꢁH]ꢁ
C21H26N3O8 calculated: 448.17254, observed: 448.17258.
a
methoxy)phenyl-1-propanol) (625 mg, 3.460 mmol) for 2.5 h at
114-128 °C followed by treatment with TBAF (303 mg,
0.963 mmol) afforded after purification 94 mg (56%) of product
as 1:1 mixture of diastereomers. 1H NMR (400 MHz, CD3OD) for
diastereomers: d 7.82 and 7.81 (2s, 1H), 7.33 (d, 1H, J = 7.8 Hz),
7.21 (m, 1H), 6.90 (m, 2H), 6.25 (m, 1H), 4.62 and 4.61 (2s, 1H),
4.40 (m, 1H), 4.01 (m, 3H), 3.79 (s, 3H), 3.73 (m, 2H), 2.28 (m,
1H), 2.17 (m, 1H), 0.89 and 0.88 (2s, 9H). 13C NMR (100 MHz, CD3-
OD) for diastereomers d 163.53 (C), 157.92 (C), 150.71 (C), 138.62
and 138.27 (CH), 128.33 (CH), 127.93 (CH), 127.78 (C), 119.65 (CH),
111.82 and 111.56 (C), 109.90 (CH), 87.51 (CH), 85.10 (CH), 81.13
and 80.05 (CH), 71.02 (CH), 63.69 and 63.46 (CH2), 61.62 (CH2),
54.33 (CH3), 39.86 and 39.78 (CH2), 35.78 and 35.74 (C), 25.21
(CH3). HRMS (ESI) for [MH]+ C22H31N2O7 calculated: 435.21258
observed: 435.21261; for [MNa]+ C22H30N2O7Na calculated:
457.19452 observed: 457.19451.
4.1.1.25.
methyl]-20-deoxyuridine (m-2u). Heating
mmol) with -tert-butyl-3-methoxybenzyl alcohol (3,3-dimethyl-
5-[1-(3-Methoxyphenyl)-2,2-(dimethyl)propoxy-
4.1.1.22. 5-[1-(3-Nitrophenyl)-2,2-(dimethyl)propoxymethyl]-
1
(150 mg, 0.231
20-deoxyuridine (m-2s). Heating 1 (223 mg, 0.343 mmol) with
a
a
-tert-butyl-2-nitrobenzyl
alcohol
(2,2-dimethyl-1-(3-
1-(3-methoxy)phenyl-1-propanol) (200 mg, 1.030 mmol) for 2 h
at 120 °C followed by treatment with TBAF (182 mg, 0.578 mmol)
afforded after purification 5 mg (5%) of product as 1:1 mixture of
diastereomers. 1H NMR (400 MHz, CD3OD) for diastereomers: d
nitro)phenyl-1-propanol) (0.575 g, 2.748 mmol) for 45 min at
108–112 °C followed by treatment with TBAF (87 mg, 1.925 mmol)
afforded after purification 19 mg (12%) of product as 1:1 mixture of

K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
1877
7.91 and 7.91 (2s, 1H), 7.22 (m, 1H), 6.85 (m, 3H), 6.27 (m, 1H),
4.42 (2s, 1H), 4.09 (m, 3H), 3.95 (m, 1H), 3.81 and 3.81 (2s, 3H),
3.77 (m, 2H), 2.27 (m, 2H), 0.92 (s, 9H). 13C NMR (100 MHz, CD3OD)
for diastereomers d 159.22 and 159.19 (C), 150.73 and 150.68 (C),
141.36 and 141.17 (C), 138.86 and 138.72 (CH), 128.12 and 128.10
(CH), 120.77 and 120.67 (CH), 115.38 and 115.31 (C), 113.72 and
113.64 (CH), 112.31 (CH), 111.82 and 111.56 (C), 89.60 and 89.45
(CH), 87.59 and 87.52 (CH), 85.15 and 84.98 (CH), 71.00 and
70.90 (CH), 64.07 and 63.66 (CH2), 61.58 and 61.51 (CH2), 54.20
(CH3), 39.94 and 39.89 (CH2), 35.10 and 35.08 (C), 25.45 and
25.43 (CH3). HRMS (ESI+) for [MH]+ C22H31N2O7 calculated:
435.21258 observed: 435.21259; for [MNa]+ C22H30N2O7Na calcu-
lated: 457.19452 observed: 457.19450. HRMS (ESIꢁ) for [MꢁH]ꢁ
C22H29N2O7 calculated: 433.19802 observed: 433.19809.
(CH3). HRMS (ESI) for [MH]+ C17H29N2O6 calculated: 357.20201,
observed: 357.20210; for [MNa]+ C17H28N2O6Na calculated:
379.18396, observed: 379.18400.
4.1.2. N3-tert-Butyloxycarbonyl-5-(di-tert-
butylcarbinol)oxymethyl-30,50-bis-O-tert-butyldimethylsilyl-20-
deoxyuridine
Compound 1 (255 mg, 0.392 mmol) and di-tert-butylcarbinol
(453 mg, 1.140 mmol) were placed in an iron screw-top vial
equipped with a ball followed by vigorous shaking at room tem-
perature for 20 h under argon atmosphere. The contents of the vial
were dissolved in ethyl acetate (1 mL) and mixed with silica (ca.
500 mg). The solvent was evaporated, and the powder was applied
onto a chromatography column (SiO2, hexane/ethyl acetate = 15:1
to 6:1) to afford 50 mg (18%) of crude product. 1H NMR (500 MHz,
CDCl3) d 7.64 (s, 1H), 6.27 (t, 1H, J = 6.7 Hz), 4.49 (m, 1H), 4.44 (m,
2H), 3.95 (q, 2H, J = 3.4 Hz), 3.92 (ab d, 1H, J = 11.0 Hz), 3.75 (ab d,
1H, J = 11.0 Hz), 2.82 (s, 1H), 2.33 (m, 2H), 1.62 (s, 9H), 1.05 (s,
18H), 0.91 (s, 18H), 0.10 (2s, 6H), 0.09 (s, 6H). The product was
not further characterized but introduced into the subsequent
transformation as is.
4.1.1.26.
methyl]-20-deoxyuridine (p-2u). Heating 1 (346 mg, 0.539 mmol)
with -tert-butyl-4-methoxybenzyl alcohol (3,3-dimethyl-1-(4-
5-[1-(4-Methoxyphenyl)-2,2-(dimethyl)propoxy-
a
methoxy)phenyl-1-propanol) (620 mg, 2.150 mmol) for 2.5 h at
120 °C followed by treatment with TBAF (870 mg, 2.762 mmol)
afforded after purification 11 mg (5%) of product as 1:1 mixture
of diastereomers. 1H NMR (400 MHz, CD3OD) for diastereomers:
d 7.89 and 7.87 (s, 1H), 7.19 (d, J = 8.6 Hz, 2H), 6.87 (m, 2H), 6.27
(m, 1H), 4.40 (m, 1H), 4.05 (m, 3H), 3.94 (m, 1H), 3.78 and 3.78
(2s, 3H), 3.76 (m, 2H), 2.28 (m, 1H), 2.18 (m, 1H), 0.88 (s, 9H).
13C NMR (100 MHz, CD3OD) for diastereomers d 163.75 (C),
159.05 (C), 150.80 (C), 138.62 and 138.51 (CH), 131.39 and
131.32 (C), 129.24 and 129.22 (CH), 112.62 (CH), 111.78 and
111.72 (C), 89.28 and 89.16 (CH), 87.57 and 87.49 (CH), 85.15
and 85.00 (CH), 71.01 and 70.91 (CH), 63.62 and 63.38 (CH2),
61.61 and 61.57 (CH2), 54.28 (CH3), 39.93 and 39.83 (CH2), 35.20
(C), 25.38 (CH3). HRMS (ES+ TOF) [MNa]+ C22H30N2O7Na calculated:
457.19510 observed: 457.19490.
4.1.3. 5-(Di-tert-butylcarbinol)oxymethyl-30,50-bis-O-tert-
butyldimethylsilyl-20-deoxyuridine
Intermediate from previous reaction (50 mg, 0.070 mmol) was
placed into a round bottom flask and purged with argon for
10 min. Anhydrous acetonitrile (10 mL) and magnesium perchlo-
rate (2 mg, 0.009 mmol) were added, and the reaction mixture
was stirred at reflux for 2.5 h under argon atmosphere. The solvent
was removed under reduced pressure; the crude product was dis-
solved in ethyl acetate (1 mL) and mixed with silica (ca. 500 mg).
The solvent was evaporated, and the powder was applied onto a
chromatography column (SiO2, hexane/ethyl acetate = 8:1 to 4:1)
to afford 22 mg (51%) of product. 1H NMR (500 MHz, CDCl3) d
8.36 (s, 1H), 7.50 (s, 1H), 6.31 (dd, 1H, J = 7.7, 5.9 Hz), 4.41 (s,
2H), 4.38 (m, 1H), 3.95 (m, 1H), 3.77 (ab dd, 1H, J = 10.6, 4.7 Hz),
3.56 (ab dd, 1H, J = 10.6, 7.0 Hz), 2.80 (s, 1H), 2.32 (m, 1H), 1.90
(m, 1H), 1.03 (s, 18H), 0.90 and 0.89 (2s, 18H), 0.09 and 0.07 (2s,
12H). 13C NMR (125 MHz, CDCl3) d 163.43 (C), 149.85 (C), 135.41
(CH), 107.73 (C), 96.13 (CH), 87.64 (CH), 85.31 (CH), 72.69 (CH),
68.70 (CH2), 63.58 (CH2), 40.04 (CH2), 38.75 (C), 29.45 (CH3),
29.20 (CH3), 25.92 (CH3), 17.98 (C), ꢁ4.70 (CH3), ꢁ5.39 (CH3).
4.1.1.27.
methyl]-20-deoxyuridine (2v). Heating 1 (400 mg, 0.616 mmol)
with -tert-butyl-4-iodo-2-nitrobenzyl alcohol (2,2-dimethyl-1-
5-[1-(4-Iodo-2-nitrophenyl)-2,2-(dimethyl)propoxy-
a
(4-iodo-2-nitro)phenyl-1-propanol) (717 mg, 2.140 mmol) for 2 h
at 120 °C followed by treatment with TBAF (607 mg, 1.925 mmol)
afforded after purification 163 mg (28%) of product as 1:1 mixture
of diastereomers. 1H NMR (400 MHz, CD3OD) for diastereomers: d
8.14 (m, 1H), 8.00 (m, 2H), 7.51 (d, J = 8.4 Hz, 1H), 6.26 (m, 1H),
4.42 (m, 1H), 4.19 (m, 2H), 3.94 (m, 1H), 3.76 (m, 2H), 2.25 (m,
2H), 0.82 and 0.80 (2s, 9H). 13C NMR (100 MHz, CD3OD) for diastere-
omers d 164.98 and 164.92 (C), 152.34 and 152.24 (C), 152.05 (C),
142.25 and 142.21 (CH), 141.38 and 141.11 (CH), 135.01 and
134.97 (C), 133.45 and 133.35 (CH), 133.05 and 132.96 (CH),
112.17 and 111.94 (C), 92.91 (C), 88.95 and 88.94 (CH), 86.62 and
86.48 (CH), 82.93 and 82.36 (CH), 72.34 and 72.27 (CH), 65.91 and
65.66 (CH2), 62.85 and 62.80 (CH2), 41.32 and 41.24 (CH2), 37.45
and 37.36 (C), 26.15 (CH3). HRMS (ESI) for [MH]+ C21H27IN3O8 calcu-
lated: 576.08428, observed: 576.08383; for [MNa]+ C21H26IN3O8Na
calculated: 598.06623, observed: 598.06581.
4.1.4. 5-(Di-tert-butylcarbinol)oxymethyl-20-deoxyuridine (2x)
Intermediate from previous reaction (22 mg, 0.036 mmol) was
dissolved in tetrahydrofuran (2.5 mL) chilled at 0 °C by means of
ice-water bath. Tetra-n-butylammonium fluoride trihydrate
(28 mg, 0.090 mmol) was added, and the reaction mixture was stir-
red for 24 h while gradually warming up to room temperature. The
solvent was removed under reduced pressure; the crude product
was dissolved in dichloromethane/methanol = 10:1 (1 mL) and
was mixed with silica (ca. 200 mg). The solvent was evaporated,
and the powder was applied onto a chromatography column
(SiO2, dichloromethane/methanol = 1:0 to 20:1) to afford 6 mg
(43%) of product. 1H NMR (500 MHz, CD3OD) d 7.93 (s, 1H), 6.32
(t, 1H, J = 6.7 Hz), 4.39 (m, 3H), 3.93 (m, 1H), 3.72 (d, 2H,
J = 4.0 Hz), 2.84 (s, 1H), 2.31 (m, 1H), 2.19 (m, 1H), 1.06 (s, 18H).
13C NMR (125 MHz, CD3OD) d 163.49 (C), 150.77 (C), 137.59
(CH), 112.33 (C), 94.70 (CH), 87.49 (CH), 85.03 (CH), 71.13 (CH),
68.51 (CH2), 61.77 (CH2), 39.71 (CH2), 38.28 (C), 28.35 (CH3). HRMS
(TOF ES+) for [MNa]+ C19H32N2O6Na+ calculated: 407.21580,
observed: 407.21600.
4.1.1.28.
5-[1-(Isopropyl)-2-(methyl)-1-propoxymethyl]-20-
deoxyuridine (2w). Heating 1 (250 mg, 0.385 mmol) with 2,
4-dimethyl-3-pentanol (0.894 g, 7.70 mmol) for 2 h at 124 °C
followed by treatment with TBAF (303 mg, 0.963 mmol) afforded
after purification 33 mg (24%) of product. 1H NMR (400 MHz, CD3-
OD) d 8.03 (s, 1H), 6.30 (t, 1H, J = 6.7 Hz), 4.40 (m, 1H), 4.34 (ab d,
1H, J = 11.7), 4.29 (ab d, 1H, J = 11.7), 3.93 (q, 1H, J = 3.5), 3.76 (ab
dd, 1H, J = 11.9, 3.6), 3.72 (ab dd, 2H, J = 11.9, 3.7), 2.87 (t, 1H,
J = 5.7), 2.29 (m, 1H), 2.23 (m, 1H), 1.84 (m, 2H), 0.94 (m, 12H).
13C NMR (100 MHz, CD3OD) d 163.64 (C), 150.76 (C), 139.02 (CH),
109.98 (C), 90.32 (CH), 87.57 (CH), 85.10 (CH), 70.93 (CH), 67.12
(CH2), 61.54 (CH2), 39.93 (CH2), 30.57 (CH), 19.30 (CH3), 16.73
4.1.5. Sonogashira reactions
4.1.5.1.
5-[1-(4-{2-Phenylacetylenyl}-2-nitrophenyl)-2,2-(dim-
ethyl)-1-propoxymethyl]-20-deoxyuridine (3a). Treatment of

1878
K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
38 mg (0.067 mmol) of 2v with phenylacetylene (21 mg,
0.201 mmol), diisopropylethylamine (148 mg, 1.145 mmol), cop-
per(I) iodide (2.5 mg, 0.013 mmol), and tetrakis(triphenylphos-
phine)palladium(0) (8 mg, 0.007 mmol) in anhydrous DMF (1 mL)
under argon atmosphere for 24 hours followed by solvent removal
in vacuo and purification using ethyl acetate/methanol = 20:1 sys-
tem yielded 12 mg (33%) of product as 1:1 mixture of diastere-
omers. 1H NMR (400 MHz, CD3OD) for diastereomers: d 8.02 and
8.00 (2s, 1H), 7.93 (m, 1H), 7.77 (m, 2H), 7.55 (m, 2H), 7.39 (m,
2H), 6.27 (m, 1H), 4.95 and 4.94 (2s, 1H), 4.42 (m, 1H), 4.19 (m,
2H), 3.93 (m, 1H), 3.76 (m, 2H), 2.25 (m, 2H), 0.84 and 0.83 (2s,
9H). 13C NMR (100 MHz, CD3OD) for diastereomers: d 164.97 and
164.91 (C), 152.07 (C), 151.95 (C), 141.44 and 141.02 (CH),
135.58 and 135.55 (CH), 135.34 and 135.31 (C), 132.75 (CH),
131.71 and 131.62 (CH), 130.14 (CH), 129.64 (CH), 127.52 and
127.42 (CH), 125.00 (C), 123.58 (C), 112.27 and 112.02 (C), 92.61
(C), 88.96 (CH), 87.63 (C), 86.61 and 86.50 (CH), 83.06 and 82.47
(CH), 72.35 and 72.29 (CH), 65.97 and 65.70 (CH2), 62.87 and
62.83 (CH2), 41.31 and 41.23 (CH2), 37.66 and 37.57 (C), 26.24
(CH3). HRMS (ESI+) for [MH]+ C29H32N3O8 calculated: 550.21856,
observed: 550.21839; for [MNa]+ C29H31N3O8Na calculated:
572.20034, observed: 572.20050. HRMS (ESIꢁ) for [MꢁH]ꢁ
C29H30N3O8 calculated: 548.20384, observed: 548.20335.
H2O), 0.82 and 0.81 (2s, 9H). 13C NMR (100 MHz, CD3CN) for
diastereomers: d 162.34 and 162.32 (C), 160.66 and 160.51 (C),
155.69 (C), 150.56 (C), 150.34 (C), 150.23 (C), 143.69 (CH),
139.44 and 139.28 (CH), 134.82 and 134.79 (CH), 130.59 and
130.53 (CH), 129.41 (CH), 126.74 and 126.69 (CH), 122.09 (C),
115.80 (C), 115.62 and 115.51 (C), 113.39 and 113.36 (CH),
112.65 (CH), 110.68 and 110.52 (C), 101.99 (CH), 87.34 (CH),
85.77 (C), 85.10 and 84.99 (CH), 84.70 (C), 81.53 and 81.14 (CH),
70.89 and 70.83 (CH), 64.54 and 64.40 (CH2), 61.59 (CH2), 56.69
(CH2), 39.80 (CH2), 36.34 and 36.29 (C), 25.01 (CH3). HRMS (ESI)
for [MNa]+ C33H33N3O11Na calculated: 670.20130, observed:
670.20310.
4.1.5.4. 5-[1-(4-{Trimethylsilyl}acetylenyl-2-nitrophenyl)-2,2-
(dimethyl)-1-propoxymethyl]-20-deoxyuridine (3d). Treatment of
87 mg (0.152 mmol) of 2v with (trimethylsilyl)acetylene (60 mg,
0.607 mmol), diisopropylethylamine (157 mg, 1.124 mmol), cop-
per(I) iodide (5.6 mg, 0.030 mmol), and tetrakis(triphenylphos-
phine)palladium(0) (17 mg, 0.015 mmol) in anhydrous DMF (3 mL)
for 4.5 hours under argon atmosphere followed by removal of the
solvent in vacuo and purification using ethyl acetate/methanol = 1:0
to 100:1 system yielded 32 mg (38%) of product as 1:1 mixture of
diastereomers. 1H NMR (400 MHz, CD3OD) for diastereomers: d
8.01 and 8.00 (2s, 1H), 7.84 (m, 1H), 7.74 (ab d, J = 8.1 Hz, 1H),
7.68 (m, 1H), 6.26 (m, 1H), 4.93 and 4.92 (2s, 1H), 4.40 (m, 1H),
4.18 (m, 2H), 3.92 (m, 1H), 3.74 (m, 2H), 2.24 (m, 2H), 0.83 and
0.82 (2s, 9H), 0.26 (s, 9H). 13C NMR (100 MHz, CD3OD) for diastere-
omers: d 165.00 and 164.95 (C), 152.10 and 152.00 (C), 151.86 (C),
141.14 and 141.14 (CH), 135.86 and 135.75 (CH), 131.73 and
131.63 (CH), 129.91 (C), 127.84 and 127.74 (CH), 124.83 (C),
112.22 and 111.98 (C), 103.33 (C), 97.79 (C), 89.01 (CH), 86.61 and
86.51 (CH), 83.02 and 82.42 (CH), 72.38 and 72.31 (CH), 66.00 and
65.70 (CH2), 62.88 and 62.84 (CH2), 41.33 and 41.25 (CH2), 37.66
and 37.56 (C), 26.20 (CH3), -0.25 (CH3). HRMS (ESI) for [MH]+ C26H36
N3O8Si calculated: 546.22717, observed: 546.22670; [MNa]+ C26H35
N3O8SiNa calculated: 568.20911, observed: 568.20911.
4.1.5.2. 5-[1-(4-{3-Methoxy}proyn-1yl-2-nitrophenyl)-2,2-(dim-
ethyl)-1-propoxymethyl]-20-deoxyuridine (3b). Treatment of
24 mg (0.042 mmol) of 2v with methyl propargyl ether (15 mg,
0.209 mmol), diisopropylethylamine (38 mg, 0.294 mmol), cop-
per(I) iodide (1.5 mg, 0.008 mmol), and tetrakis(triphenylphos-
phine)palladium(0) (5 mg, 0.004 mmol) in anhydrous DMF (1
mL) under argon atmosphere for 72 hours followed by solvent
removal in vacuo and purification using dichloromethane/metha-
nol = 1:0 to 30:1 system yielded 10 mg (64%) of product as 1:1
mixture of diastereomers. 1H NMR (400 MHz, CD3OD) for diastere-
omers: d 8.02 and 8.00 (2s, 1H), 7.87 (m, 1H), 7.76 (ab d, J = 8.2 Hz,
1H), 7.70 (m, 1H), 6.25 (m, 1H), 4.94 (s, 1H, note: overlapped with
HDO), 4.40 (m, 1H), 4.35 (s, 2H), 4.17 (m, 2H), 3.92 (m, 1H), 3.75
(m, 2H), 3.44 (s, 3H), 2.25 (m, 2H), 0.84 and 0.82 (2s, 9H). 13C
NMR (100 MHz, CD3OD) for diastereomers: d 163.62 and 163.56
(C), 150.68 (C), 140.02 and 139.71 (CH), 137.15 and 138.83 (C),
134.37 and 134.33 (CH), 134.26 and 134.21 (C), 130.35 and
130.25 (CH), 126.22 and 126.22 (CH), 126.03 (CH), 110.81 and
110.56 (C), 87.60 and 87.34 (CH), 85.18 and 85.07 (CH), 83.21
(C), 81.61 and 81.03 (CH), 80.99 (C), 70.97 and 70.90 (CH), 64.58
and 64.30 (CH2), 61.47 and 61.43 (CH2), 59.42 (CH2), 56.60 (CH3),
39.92 and 39.84 (CH2), 36.24 and 36.14 (C), 24.80 (CH3). HRMS
(ESI) for [MH]+ C25H32N3O9 calculated: 518.21385, observed:
518.21342; for [MNH4]+ C25H35N4O9 calculated: 535.24040,
observed: 535.23993; [MNa]+ C25H31N3O9Na calculated:
540.19580, observed: 540.19529.
4.1.6. 5-[1-(4-Acetylenyl-2-nitrophenyl)-2,2-(dimethyl)-1-pro-
poxymethyl]-20-deoxyuridine (3e)
Compound 3d (114 mg, 0.209 mmol) was dissolved in tetrahy-
drofuran (4 mL) followed by addition of tetra-n-butylammonium
fluoride trihydrate (90 mg, 0.314 mmol). The reaction mixture
was stirred for 6 h, then concentrated under reduced pressure,
and the residue was purified by column chromatography on silica
gel using ethyl acetate/methanol = 100:1 to afford 73 mg (74%) of
product as 1:1 mixture of diastereomers. 1H NMR (400 MHz, CD3-
OD) for diastereomers: d 8.02 and 8.00 (2s, 1H), 7.90 (m, 1H), 7.76
(ab d, J = 8.2 Hz, 1H), 7.65 (m, 1H), 6.26 (m, 1H), 4.94 and 4.93 (2s,
1H), 4.40 (m, 1H), 4.18 (m, 2H), 3.92 (m, 1H), 3.74 (m, 3H), 2.24 (m,
2H), 0.84 and 0.82 (2s, 9H). 13C NMR (100 MHz, CD3OD) for
diastereomers: d 163.60 and 163.55 (C), 150.69 and 150.61 (C),
150.48 (C), 140.01 and 139.91 (CH), 134.73 and 134.52 (CH),
130.94 and 130.26 (CH), 128.46 (C), 126.71 and 126.61 (CH),
122.79 (C), 110.82 and 110.57 (C), 87.61 (CH), 85.20 and 85.10
(CH), 81.61 and 81.01 (CH), 80.48 (C), 80.17 (CH), 70.97 and
70.90 (CH), 64.57 and 64.30 (CH2), 61.47 and 61.43 (CH2), 39.93
and 39.86 (CH2), 36.93 and 36.14 (C), 24.78 (CH3). HRMS (ESI) for
[MH]+ C23H28N3O8 calculated: 474.18764, observed: 474.18715;
4.1.5.3. 5-[1-(4-{3-(7-Coumarin)oxy}proyn-1-yl-2-nitrophenyl)-
2,2-(dimethyl)propoxymethyl]-20-deoxyuridine (3c). Treatment
of 68 mg of 2v with 7-(propargyl)oxycoumarin (48 mg,
0.239 mmol), triethylamine (62 mg, 0.617 mmol), copper(I) iodide
(3 mg, 0.016 mmol), and tetrakis(triphenylphosphine)palladium(0)
(9 mg, 0.008 mmol) in anhydrous DMF (2 mL) for 4.5 hours under
argon atmosphere followed by removal of the solvent in vacuo and
purification using dichloromethane/methanol = 1:0 to 10:1 system
yielded 33 mg (64%) of product as 1:1 mixture of diastereomers. 1H
NMR (400 MHz, CD3CN) for diastereomers: d 9.07 (br s, 1H), 7.88 (s,
1H), 7.84 and 7.81 (2 d, J = 9.5 Hz, 1H), 7.70 (m, 2H), 7.58 (d,
J = 8.4 Hz, 1H), 7.04 (m, 1H), 7.01 and 6.89 (2 d, J = 2.6 Hz, 1H),
6.26 (d, J = 9.5 Hz, 1H), 6.17 (m, 1H), 5.10 (s, 2H), 4.90 and 4.89
(2s, 1H), 4.35 (m, 1H), 4.07 (m, 3H), 3.86 (m, 1H), 3.66 (m, 2H),
3.45 (br s, 1H), 3.16 (br s, 1H), 2.20 (m, 2H, overlapped with
[MNa]+
496.16915.
C23H27N3O8Na
calculated:
496.16958,
observed:
4.1.7. 5-[1-{4-(1-Benzyl-1,2,3-triazo-4-yl)-2-nitrophenyl}-2,2-
(dimethyl)propoxymethyl]-20-deoxyuridine (4)
Compound 3e (3.8 mg, 0.008 mmol) was dissolved in acetonitrile
(2 mL) followed by addition of benzyl azide (2 mg, 0.014 mmol),
diisopropylethylamine (10 mg, 0.08 mmol) and copper(I) iodide

K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
1879
(0.1 mg, 0.0008 mmol). The reaction mixture was stirred for 2 h
under argon atmosphere at room temperature. The reaction mix-
ture was then concentrated under reduced pressure and the resi-
due was purified by column chromatography on silica gel using
dichloromethane/methanol = 1:0 to 30:1 to afford 3.7 mg (76%)
of product as 1:1 mixture of diastereomers. 1H NMR (400 MHz,
CD3OD) for diastereomers: d 8.49 (s, 1H), 8.27 (m, 1H), 8.07 (m,
1H), 8.01 and 7.99 (2s, 1H), 7.82 (d, 1H, J = 8.3 Hz), 7.37 (m, 5H),
6.24 (m, 1H), 5.66 (s, 2H), 4.96 and 4.95 (2s, 1H), 4.39 (m, 1H),
4.20 (m, 2H), 3.91 (m, 1H), 3.73 (m, 2H), 2.24 (m, 2H), 0.85 and
0.84 (2s, 9H). 13C NMR (100 MHz, CD3OD) for diastereomers:
d 165.03 and 164.96 (C), 152.63 and 152.48 (C), 152.09 (C),
146.82 (C), 141.34 and 141.05 (CH), 136.62 (C), 134.85 (C),
134.42 and 134.40 (C), 132.16 and 132.06 (CH), 133.10 (CH),
129.75 (CH), 129.69 (CH), 129.19 (CH), 123.32 (CH), 121.67 and
121.55 (CH), 112.32 and 112.06 (C), 88.97 (CH), 86.48 and 86.36
(CH), 83.11 and 82.47 (CH), 72.36 and 72.32 (CH), 65.98 and
65.67 (CH2), 62.90 and 62.84 (CH2), 55.18 (CH2), 41.29 and 41.20
(CH2), 37.63 and 37.53 (CH), 26.26 (CH3). HRMS (ESI) for [MH]+
C30H35N6O8 calculated: 607.25164, observed: 607.25119; for
was added to each well. Plates were incubated for 3 h. The MTT
solution was removed and 500 L of DMSO was added to each well.
l
Cells were imaged using GS 800 Bio Rad scanner with Quality One
Software or BioTek plate reader with Gene5 software. IC50 curves
were determined by plotting viability verses compound concentra-
tion. Kaleidagraph software was used to calculate the R value for
each logarithmic curve fitting. The results are outlined in Table 1,
and the IC50 curves are in the Supplementary material.
4.3. Detecting double-strand break marker
cells treated with 3a
c-H2AX in MCF7
4.3.1. Protein extraction
Confluent MCF7 cells were treated with 3a at a concentration
equal to the IC50 value for 24 h and nuclear protein extracted using
a NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Scienti-
fic) using three independent replicates. Vehicle controls were
simultaneously prepared by treatment with DMSO. In detail, cells
were harvested by trypsin–EDTA and centrifuged at 500ꢀg for
5 min. The cells were washed to remove traces of trypsin by
suspending in 1ꢀ PBS, followed by centrifugation at 500ꢀg for
2–3 min. The supernatant was removed leaving the cell pellet as
[MNa]+
629.23311.
C30H34N6O8Na
calculated:
629.23358,
observed:
dry as possible. A 200 lL volume of ice-cold cytoplasmic extraction
4.1.8. Tetra-triethylammonium 5-[(R/S)-1-(4-{2-phenylace-
tylenyl}-2-nitrophenyl)-2,2-(dimethyl)-1-propoxymethyl]-20-
deoxyuridine-50-triphosphate (3aTP)
reagent I (CER-I), treated Halt™ Protease & Phosphatase Inhibitor
Cocktail (Thermo Scientific), was added to the pellet. The cell pellet
was suspended by vortexing vigorously for 15 s and then incubated
Standard procedure was used as previously described.18 POCl3
on ice for 10 min. The mixture is then treated with 11 lL of
(15
l
L, 0.163 mmol) was added to a solution of 3a (19 mg,
ice-cold cytoplasmic extraction reagent II (CER-II) and mixed by
vortexing on the highest setting for 5 s followed by incubation on
ice of one minute to allow complete release of cytoplasmic
contents. The mixture is then vortexed for 5 s followed by cen-
trifugation for 5 min at maximum speed (ꢂ16,000ꢀg) in a micro-
centrifuge. The supernatant, containing the cytoplasmic extract is
immediately transferred to a pre-chilled tube and placed on ice
until storage. The insoluble pellet, containing the nuclei is sus-
pended in ice-cold nuclear extraction reagent (NER), similarly trea-
ted with Halt™ Protease & Phosphatase Inhibitor Cocktail (Thermo
Scientific). The mixture is vortexed for 15 s at the highest setting
and placed on ice for 10 min, with the process repeated every
10 min for a total of 40 min. It is then centrifuged at maximum
speed in a microcentrifuge for 10 min. The supernatant, containing
the nuclear extract is immediately transferred to a pre-chilled
microcentrifuge tube and placed on ice until storage at ꢁ80 °C.
All centrifugation steps were performed at 4 °C and all cell samples
and extracts were kept on ice. Protein concentration in each sam-
ple and control was determined by Bradford Assay using Coomas-
sie PlusTM (Bradford) Assay Kit (Thermo Scientific), applying the
0.035 mmol) and proton sponge (30 mg, 0.140 mmol) in
trimethylphosphate (0.7 mL) at 0 °C and stirred for two hours
under argon atmosphere. Reaction progress was monitored by
HPLC and reverse-phase TLC (C18). Additional POCl3 (10 lL,
0.111 mmol) was added, and the mixture was stirred for another
one hour. A solution of tri-n-butylammonium pyrophosphate
(200 mg, 0.366 mmol) and tri-n-butylamine (95 lL) in anhydrous
DMF (1.0 mL) was added. After five minutes of stirring, triethy-
lammonium bicarbonate buffer (1 M, pH 7.5; 8 mL) was added
and then stirred at room temperature for one hour. The reaction
was lyophilized to dryness, and the residue was dissolved in water
(5 mL), filtered, and purified by reverse phase chromatography
using triethylammonium bicarbonate buffer as eluent. Fractions
containing the triphosphate (identified by HRMS) were combined
and lyophilized to give product in ca 4 mg (10%) as a solid. 1H
NMR (400 MHz, D2O) for diastereomers: d 7.90 and 7.89 (2s, 1H),
7.82 (m, 1H), 7.73 (m, 2H), 7.52 (m, 2H), 7.40 (m, 2H), 6.21 (m,
1H), 4.88 and 4.88 (2s, 1H), 4.38 (m, 1H), 4.29 (m, 2H), 3.92 (m,
1H), 3.72 (m, 2H), 2.53 (m, 24H), 1.44 (m, 24H), 1.27 (m, 24H),
0.89 (t, 36H, J = 7.3 Hz), 0.79 and 0.77 (2s, 9H). 31P NMR
(162 MHz, D2O): d ꢁ3.53 (d, J = 17.8 Hz), ꢁ14.63 (d, J = 17.8 Hz),
ꢁ25.32 (m). HRMS (ESI-TOF): For [MꢁH]ꢁ C29H33N3O17P3
calculated: 788.10283, observed: 788.10272.
manufacturer0s instruction. In detail, 1000–25
lg/mL concentra-
tions of Albumin Standard by diluting a 2.0 mg/mL stock solution
in deionized water, accordingly. The samples were diluted 2ꢀ prior
to the assay. A volume of 10 lL standard or unknown sample were
pipetted into the appropriate wells in a 96-well plate. A volume of
4.2. Cell cytotoxicity assay (MTT)
250 L of the Coomassie Plus Reagent was added to each well and
l
mixed by shaking in a plate shaker for 30 s followed by incubation
for 10 min at rt. The absorbance is then measured at 595 nm using
a Synergy 4 plate reader (Biotek). The 595 nm measurement for the
blank (0 lg/mL protein) was subtracted from the measurements of
all other individual standards and unknown sample measurements.
A standard curve is prepared by plotting the Blank-corrected mea-
surement for each BSA standard versus its concentration in lg/mL.
The standard curve is used to determine the protein concentration
of each unknown sample.
MCF7 cells were grown in RPMI 1640 media supplemented with
10% fetal bovine serum, 1% penicillin, 10 nM estrogen and 1 mM
insulin. Cells were trypsinized and resuspended at a density of
2.2 ꢀ 104 cells per mL. 500
lL of this suspension was added to each
well in a 24 well plate. The plates were incubated at 37 °C and 5%
CO2 atmosphere overnight. The media was changed, and plates
were dosed in triplicate with compound dissolved in DMSO (DMSO
concentration not exceeding 0.5%). Cells were dosed to a final con-
centration of 200, 100, 50, 25, and 6.25 lM of compound. 5-Fluo-
rouracil was used as a positive control31 and dosed in the same
manner. Plates were incubated for 65 h prior to the addition of
4.3.2. Western blot analysis
For Western blot analysis, 20
lg protein from the nuclear
MTT solution. 500 lL of a 193 lg/mL MTT and media solution
extract of each sample and control is loaded in a 10% ExpressPlus™

1880
K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
SDS–PAGE mini-gel (GenScript) and electrophoresed for 1 h to
separate the component proteins. The proteins are then transferred
into a PVDF membrane using the iBlot Dry Blotting system, con-
ducted at 20 V and 7 min run time. Following transfer, the gel is
treated with Coomassie Blue to ensure complete transfer of pro-
teins. The PVDF membrane was wetted in PBS for several minutes.
The blocking step was conducted by immersing the membrane in
10 mL Odyssey Blocking Buffer (Licor), with continuous shaking
for 1 h. A 1:1000 dilution of the primary antibodies, Rabbit
Anti-Histone H2A.X Ab (Cell Signalling Technology) and Mouse
Anti -Actin Ab (GenScript), are prepared in 7 mL Odyssey Blocking
Buffer. b-Actin, which is present in cells in high levels is used as the
loading control, the signal of which is used to normalize the signal
of the protein of interest. The membrane is incubated in the diluted
primary antibody solution for one hour, with shaking. Following
incubation, the membrane is washed 4ꢀ for 5 min each at rt in
15 mL PBS + 0.1% Tween 20 (Fisher Scientific) with gentle shaking.
The fluorescently labeled secondary antibodies, IRDye 800CW Goat
anti-Rabbit antibody (1:15,000 dilution) and IRDye 680RD Goat
anti-Mouse Antibody (1:20,000 dilution) are prepared in 10 mL
Odyssey Blocking buffer with 0.1% Tween 20 and 0.01% SDS (Fisher
Scientific), ensuring minimal exposure to light. After washing with
PBS, the membrane was incubated in the secondary antibody solu-
tion for 30 min at rt with gentle shaking. The membrane is then
washed 4ꢀ for 5 min each with 15 mL PBS + 0.1% Tween 20, with
gentle shaking and protected from light. To remove residual Tween
20, the membrane is washed with PBS prior to imaging. The mem-
brane is scanned using the Odyssey Infrared Imager (Licor) using
the 700 nm channel to detect for b-Actin and the 800 nm channel
funds to Prof. Litosh, and the NIH-NCI award (R21CA185370) to
Prof. Merino. We also acknowledge the National Cancer Institute
Developmental Therapeutics Program for performing compound
screening in a variety of cancer cell lines. Additionally, we would
like to thank Prof. James Mack for granting access to his
mechanochemistry facilities, making it possible to synthesize a
key control compound that was inaccessible by conventional syn-
thetic methods.
Supplementary data
Detailed experimental procedures for synthesis of novel a-sub-
stituted benzyl alcohols, NCI-60 human tumor cell line screen full
report, DNA synthesis termination data, spectral characterization
of molecules (1H, 13C, DEPT 13C, HRMS, HPLC) and the results of
MTT assays. This material is available free of charge. Supplemen-
tary data associated with this article can be found in the online ver-
sion, at http://dx.doi.org/10.1016/j.bmc.2015.01.057.
References and notes
1. Siegel, R.; Ma, J.; Zou, Z.; Jemal, A. CA Cancer J. Clin. 2014, 64, 9.
2. Takimoto, C. H.; Calvo, E. Cancer Management: A Multidisciplinary Approach in
Principles of Oncologic Pharmacotherapy, 11th Ed.; Wiley and Sons, 2008.
Chapter 3.
3. Zhang, J.; Visser, F.; King, K. M.; Baldwin, S. A.; Young, J. D.; Cass, C. E. Cancer
Metastasis Rev. 2007, 26, 85.
4. Eriksson, S. Cell. Mol. Life Sci. 2002, 59, 1327.
5. (a) Chen, L. S.; Plunkett, W.; Gandhi, V. Leukemia Res. 2008, 32(10), 1573; (b)
Kuchta, R. D.; Ilsley, D.; Kravig, K. D.; Schubert, S.; Harris, B. Biochemistry 1992,
31, 4720; (c) Parker, W. B.; Shaddix, S. C.; Chang, C.-H.; White, E. L.; Rose, L. M.;
Brockman, R. W.; Shortnacy, A. T.; Montgomery, J. A.; Secrist, J. A.; Bennett, L. L.
Cancer Res. 1991, 51, 2386.
to detect for c-H2AX. The intensity of each band was measured using
the ImageQuant 5.0 software. All experiments are conducted at n = 2.
6. (a) Peters, G. J.; van der Wilt, C. L.; van Groeningen, C. J.; Smid, K.; Meijer, S.;
Pinedo, H. M. J. Clin. Oncol. 1994, 12, 2035; (b) Hill, D. L.; Bennett, L. L.
Biochemistry 1969, 8, 122.
4.4. DNA synthesis termination studies
7. Fairchild, C. R.; Maybaum, J.; Kennedy, K. A. Biochem. Pharmacol. 1986, 35, 3533.
8. Swann, P. F.; Waters, T. R.; Moulton, D. C.; Xu, Y.-Z.; Zheng, Q.; Edwards, M.;
Mace, R. Science 1996, 273, 1109.
9. Genini, D.; Adachi, S.; Chao, Q.; Rose, D. W.; Carrera, C. J.; Cottam, H. B.; Carson,
D. A.; Leoni, L. M. Blood 2000, 96, 3537.
Primer extension experiments were performed using a 51-mer
nucleotide dsDNA, synthesized from pUC19 plasmid vector (New
England Biolabs). A 19-nucleotide forward primer, 50CACGACGTT
GTAAAACGAC30 was used as a template 50CACGACGTTGTAAAAC
10. Lolkema, M. P.; Arkenau, H.-T.; Harrington, K.; Roxburgh, P.; Morrison, R.;
Roulstone, V.; Twigger, K.; Coffey, M.; Mettinger, K.; Gill, G.; Evans, T. R. J.; de
Bono, J. S. Clin. Cancer Res. 2011, 17, 581.
11. (a) Wang, W.-S.; Tzeng, C.-H.; Chiou, T.-J.; Liu, J.-H.; Hsieh, R.-K.; Yen, C.-C.;
Chen, P.-M. Jpn. J. Clin. Oncol. 1997, 27, 154; (b) Cannas, G.; Pautas, C.; Raffoux,
E.; Quesnel, B.; de Botton, S.; de Revel, T.; Reman, O.; Gardin, C.; Elhamri, M.;
Boissel, N.; Fenaux, P.; Michallet, M.; Castaigne, S.; Dombret, H.; Thomas, X.
Leuk. Lymphoma 2012, 53, 1068.
GACGGCCAGTGAATTCGAGCTCGGTACCCGGGGAT30 (representing
370-420 of pUC 19). The primer was fluorescently-labeled with
IRDye700. The oligonucleotide was purified using a Cycle Pure
Kit (Omega BioTek). Master mix was made at 2ꢀ with a concentra-
tion of final in PCR tube reaction of 0.5
l
M template, 1ꢀ ThermoPol
M primer. 100
12. Krishna, I. V.; Vanaja, G. R.; Kumar, N. S. K.; Suman, G. Cancer Biomarker 2009, 5,
261.
reaction buffer, 0.05 U/ L Vent (exo-), and 0.75
l
l
lM
dNTP with varying concentration of Acylco TTP and 3aTP were
added with the master mix. Sequencing reactions were conducted
13. (a) Besirli, C. G.; Deckwerth, T. L.; Crowder, R. J.; Freeman, R. S.; Johnson, E. M.,
Jr Cell Death Differ. 2003, 10, 1045; (b) Koros, C.; Kitraki, E. Toxicol. Lett. 2009,
189, 215; (c) Cordier, P.-Y.; Nau, A.; Ciccolini, J.; Oliver, M.; Mercier, C.;
Lacarelle, B.; Peytel, E. Cancer Chemother. Pharmacol. 2011, 68, 823.
14. (a) Lennard, L. Eur. J. Clin. Pharmacol. 1992, 43, 329; (b) Tallman, M. S. Best Pract.
Res. Clin. Haematol. 2006, 19, 311.
15. Hertel, L. W.; Boder, G. B.; Kroin, J. S.; Rinzel, S. M.; Poore, G. A.; Todd, G. C.;
Grindey, G. B. Cancer Res. 1990, 50, 4417.
16. Metzker, M. L. Genome Res. 2005, 15, 1767.
17. Wu, W.; Stupi, B. P.; Litosh, V. A.; Mansouri, D.; Farley, D.; Morris, S.; Metzker,
S.; Metzker, M. L. Nucleic Acids Res. 2007, 35, 6339.
18. Litosh, V. A.; Wu, W.; Stupi, B. P.; Wang, J.; Morris, S. E.; Hersh, M. N.; Metzker,
M. L. Nucleic Acids Res. 2011, 39, e39.
19. Litosh, V. A.; Hersh, M. N.; Stupi, B. P.; Wu, W.; Metzker, M. L., U.S. Patent
#8148503 Pub#20100041041.
20. Wagner, C. R.; Iyer, V. V.; McIntee, E. J. Med. Res. Rev. 2000, 20, 417.
21. Jordheim, L. P.; Cros, E.; Galmarini, C. M.; Dumontet, C.; Bretonnet, A.-S.;
Krimm, I.; Lancelin, J.-M.; Gagnieu, M.-C. Nucleosides Nucleotides Nucleic Acids
2006, 25, 289.
using 10
a final PCR reaction concentration of 2 mM and 100
tively, followed by the addition of 10 l master mix. For sequenc-
ing the labels on the gel correspond to the sequence produced by
l
L of a solutions containing acyclo-dNTP and dNTP having
lM, respec-
l
the 51-mer template. 10
PAGE denaturing load dye. After heating at 95 °C for 5 min, 5
l
L PCR product was mixed with 17
l
l
L
L
of the resulting solution was loaded into each well containing a
12% denaturing PAGE gel, which was subsequently run at constant
18 Watts for 35 min. The gel was visualized using the Odyssey
Infrared Imaging System (LiCor) with 169 lm resolution and the
700-channel laser source which has a solid-state laser diode at
680 nm and ImageQuant 5.0 software was used to determine
density measurements. Experiments were performed in triplicate,
and standard errors were calculated.
22. Magnani, M.; Casabianca, A.; Fraternale, A.; Brandi, G.; Gessani, S.; Williams, R.;
Giovine, M.; Damonte, G.; De Flora, A.; Benatti, U. Proc. Natl. Acad. Sci. U.S.A.
1996, 93, 4403.
23. Olivero, O. A.; Vazquez, I. L.; Cooch, C. C.; Ming, J.; Keller, E.; Yu, M.; Borojerdi, J.
P.; Braun, H. M.; McKee, E.; Poirier, M. C. Toxicol. Sci. 2010, 115, 109.
24. Ji, H. J.; Rha, S. Y.; Jeung, H. C.; Yang, S. H.; An, S. W.; Chung, H. C. Breast Cancer
Res. Treat. 2005, 93, 227.
Acknowledgments
We gratefully acknowledge the University of Cincinnati start-up
and the University of Cincinnati Individual Faculty Research Grant
25. Vogel, P.; Figueira, S.; Muthukrishnan, S.; Mack, J. Tetrahedron Lett. 2009, 50, 55.

K. M. Borland et al. / Bioorg. Med. Chem. 23 (2015) 1869–1881
1881
26. Bell-Horwath, T. R.; Vadukoot, A. K.; Thowfeik, F. S.; Li, G.; Wunderlich, M.;
Mulloy, J. C.; Merino, E. J. Bioorg. Med. Chem. Lett. 2013, 23, 2951.
27. (a) Banáth, J. P.; Olive, P. L. Cancer Res. 2003, 63, 4347; (b) Muslimovic, A.;
Ismail, I. H.; Gao, Y.; Hammarsten, O. Nat. Protoc. 2008, 3, 1187.
28. Jones, A. R.; Bell-Horwath, T. R.; Li, G.; Rollmann, S. M.; Merino, E. J. Chem. Res.
Toxicol. 2012, 25, 2542.
30. Abdel Megied, A.; Ali, O.; Kofoed, T.; Pedersen, E. Nucleosides Nucleotides Nucleic
Acids 2001, 20, 1.
31. Hernández-Vargas, H.; Ballestar, E.; Carmona-Saez, P.; von Kobbe, C.; Bañón-
Rodríguez, I.; Esteller, M.; Moreno-Bueno, G.; Palacios, J. Int. J. Cancer 2006, 119,
1164.
29. Vadukoot, A. K.; AbdulSalam, S. F.; Wunderlich, M.; Pullen, E. D.; Landero-
Figueroa, J.; Mulloy, J. C.; Merino, E. J. Bioorg. Med. Chem. 2014, 24, 6885.