An improvede synthesis of 1-(2-deoxy-β-D-erythro-pentofur-anosyl)quinazoline-2,4(3H)-dione and its incorporation into G-rich triple helix forming oligonucleotides

Article abstract of DOI:10.1080/15257779508014652

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione (6) has been accomplished. The structural conformation of (6) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside (6) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5'd(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3'-5'd(CAGTGACCGGGAAGGAGGA AGGGCCAG AGTC)3' (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.

Full text of DOI:10.1080/15257779508014652

This article was downloaded by: [Thuringer University & Landesbibliothek]
On: 17 December 2014, At: 10:39
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered
office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Nucleosides and Nucleotides
Publication details, including instructions for authors and
subscription information:
http://www.tandfonline.com/loi/lncn19
An Improved Synthesis of
1-(2-Deoxy-β-D-erythro-
pentofuranosyl)quinazoline-2,4(3H)-
dione and Its Incorporation Into G-Rich
Triple Helix Forming Oligonucleotides
Birendra K. Bhattacharya a , Mohan V. Chari b , Ross H. Durland c
& Ganapathi R. Revankar a
a Triplex Pharmaceutical Corporation , 9391 Grogans Mill Road,
The Woodlands, TX, 77380
b Departments of Medicine and Radiology , Baylor College of
Medicine , Texas Medical Center, Houston, TX, 77025
c Gene Medicine , 8080 N. Stadium Dr., Houston, TX, 77054
Published online: 24 Sep 2006.
To cite this article: Birendra K. Bhattacharya , Mohan V. Chari , Ross H. Durland
& Ganapathi R. Revankar (1995) An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-
pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming
Oligonucleotides, Nucleosides and Nucleotides, 14:1-2, 45-63, DOI: 10.1080/15257779508014652
To link to this article: http://dx.doi.org/10.1080/15257779508014652
PLEASE SCROLL DOWN FOR ARTICLE
Taylor & Francis makes every effort to ensure the accuracy of all the information (the
“Content”) contained in the publications on our platform. However, Taylor & Francis,
our agents, and our licensors make no representations or warranties whatsoever as to
the accuracy, completeness, or suitability for any purpose of the Content. Any opinions
and views expressed in this publication are the opinions and views of the authors,
and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content
should not be relied upon and should be independently verified with primary sources
of information. Taylor and Francis shall not be liable for any losses, actions, claims,
proceedings, demands, costs, expenses, damages, and other liabilities whatsoever
or howsoever caused arising directly or indirectly in connection with, in relation to or
arising out of the use of the Content.
This article may be used for research, teaching, and private study purposes. Any
substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,

systematic supply, or distribution in any form to anyone is expressly forbidden. Terms
& Conditions of access and use can be found at http://www.tandfonline.com/page/
terms-and-conditions