Tetrahedral DNA conjugates from pentaerythritol-based polyazides

Article abstract of DOI:10.1016/j.tet.2016.03.051

Branching points in DNA nanostructures are usually 3- or 4-way junctions maintained by Watson-Crick non-covalent interactions. However, covalently bound DNA stars could improve the diversity, strength and integrity of DNA nanoscale constructions. We report here the convenient synthesis of 3- and 4-fold pentaerythritol-based azides and their use for the assembly of branched conjugates containing the same or different oligonucleotides (ODNs) and/or fluorescent dyes by stoichiometry controlled copper (I) catalyzed azide alkyne cycloaddition (CuAAC) functionalization.

Full text of DOI:10.1016/j.tet.2016.03.051

Accepted Manuscript
Tetrahedral DNA conjugates from pentaerythritol-based polyazides
Anna I. Ponomarenko, Vladimir A. Brylev, Ksenia A. Sapozhnikova, Alexey V.
Ustinov, Igor A. Prokhorenko, Timofei S. Zatsepin, Vladimir A. Korshun
PII:
S0040-4020(16)30180-6
10.1016/j.tet.2016.03.051
TET 27591
DOI:
Reference:
To appear in: Tetrahedron
Received Date: 1 December 2015
Revised Date: 1 March 2016
Accepted Date: 14 March 2016
Please cite this article as: Ponomarenko AI, Brylev VA, Sapozhnikova KA, Ustinov AV, Prokhorenko
IA, Zatsepin TS, Korshun VA, Tetrahedral DNA conjugates from pentaerythritol-based polyazides,
Tetrahedron (2016), doi: 10.1016/j.tet.2016.03.051.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
Graphical Abstract
Tetrahedral DNA conjugates from
pentaerythritol-based polyazides
Anna I. Ponomarenko, Vladimir A. Brylev, Ksenia A. Sapozhnikova, Alexey V. Ustinov, Igor A. Prokhorenko,
Timofei S. Zatsepin, and Vladimir A. Korshun*

1
ACCEPTED MANUSCRIPT
Tetrahedron
journal homepage: www.elsevier.com
Tetrahedral DNA conjugates from pentaerythritol-based polyazides
Anna I. Ponomarenkoa,†, Vladimir A. Bryleva, Ksenia A. Sapozhnikovaa,b, Alexey V. Ustinova,c,
Igor A. Prokhorenkoa,d, Timofei S. Zatsepine,f,g and Vladimir A. Korshuna,d,
aShemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Miklukho-Maklaya 16/10, 117997 Moscow, Russia
bMendeleev University of Chemical Technology, 125047 Moscow, Russia
cLumiprobe LLC, Hallandale Beach, FL 33009, USA
dGause Institute of New Antibiotics, 119021 Moscow, Russia
eCentral Research Institute of Epidemiology, 111123 Moscow, Russia
fDepartment of Chemistry, Lomonosov Moscow State University, 119992 Moscow, Russia
gSkolkovo Institute of Science and Technology, Skolkovo, 143026 Moscow Region, Russia
ARTICLE INFO
ABSTRACT
Article history:
Received
Received in revised form
Accepted
Branching points in DNA nanostructures are usually 3- or 4-way junctions maintained by
Watson-Crick non-covalent interactions. However, covalently bound DNA stars could improve
the diversity, strength and integrity of DNA nanoscale constructions. We report here the
convenient synthesis of three- and four-fold pentaerythritol-based azides and their use for the
assembly of branched conjugates containing the same or different oligonucleotides (ODNs)
and/or fluorescent dyes by stoichiometry controlled copper (I) catalyzed azide alkyne
cycloaddition (CuAAC) functionalization.
Available online
Keywords:
Oligonucleotides
Conjugates
2015 Elsevier Ltd. All rights reserved
.
Branched DNA
Click reaction
Fluorescent dyes
1. Introduction
known approaches to covalent branched DNA conjugates
predominantly used non-nucleoside,4 nucleoside5 or hybrid6
branching phosphoramidite reagents or branched supports.7
The concept of manipulating DNA by simply programming its
strands has been widely used during recent decades with the
possibility of designing nanostructures of desired shapes driving
a tremendous development of DNA nanotechnology and DNA
computing.1 The structural design of DNA-based logical
gates/circuits or dendrimers coupled with various fluorophores
becomes more and more complicated, opening up wide
opportunities for computation and programming as well as signal
amplification for biomedical detection.1 Diverse and complex
three-dimensional DNA structures were assembled and used for
capture and controlled release of therapeutic agents.2
Alternatively,
nucleoside8
or
non-nucleoside9
bis-
phosphoramidites were used for joining growing oligonucleotide
chains. Nevertheless, direct automated synthesis of branched
DNA building blocks is complicated by restrictions coming from
the chemistry of phosphoramidite synthetic cycle. A post-
synthetic approach is another way of assembling branched
oligonucleotide structures; e.g. Richert and coworkers coupled
protected dinucleoside-3′-phosphonate with adamantane-based
branchers.10 At the same time, the use of azide-alkyne click
chemistry,11 proved to be much more reliable for the preparation
of complex and branched oligonucleotide-oligonucleotide
conjugates.12 However, employed organic polyazides were not
always ‘user friendly’. A planar porphyrin-based tetra-azide12n
gave low yield of click products and HPLC-inseparable
regioisomers of bis-adducts. The tetrakis(4-azidophenyl)
methane12o,p used as ‘branching point’ has very short phenylene
linkers, is hydrophobic and therefore gave no desired tetra-adduct
upon ‘click’ in solution. Moreover, arylazides are potentially
photoreactive upon visible light irradiation. To the best of our
knowledge, no controllable and facile preparative technique for
In this aspect, the necessity of branched building blocks
emerges. The approaches to multistrand DNA ligation can be
divided into two large subgroups: 1) non-covalent, implying
Watson-Crick, Hoogsteen and other weak interactions, and 2)
covalent junctions at specific branching point. The first approach,
used for the vast majority of DNA nanostructures, relies
predominantly on ‘immobile’ 3- or 4-way Holliday junctions,3
also referred to as ‘Y-shaped’ and ‘X-shaped’ DNA. Much less
attention is paid to designing covalent junctions assembling
multiple DNA strands at a branching point. Covalently bound
oligonucleotides remain together in denaturing conditions. The
———
Corresponding author. Tel./fax: +7-495-725-6715; e-mail: korshun@ibch.ru
† Present address: Massachusetts Institute of Technology, Cambridge, USA

2
Tetrahedron
ACCEPTED MANUSCRIPT
robust connection of different DNA strands to s single
branching point has been developed to date.
2. Results and discussion
Herein we report synthesis of pentaerythritol (1)-based
branching reagents 6 and 7 which carry three and four azido-
groups, respectively (Scheme 1). The key tetraol 4 was obtained
through the modified three-step synthetic procedure13 (see
Experimental section).14
Fig. 2. Conjugation of T10 ODN alkyne on tetraazide 7 in different
ratios; 19% PAGE.
Azides 6 and 7 easily undergo CuAAC click reaction with
alkyne-modified oligonucleotides in aqueous solution. The
stoichiometry of the resulting building blocks can be tuned by
varying the excess of ODNs in click-reaction with bubsequent
HPLC or electrophoretic separation. In this paper we demonstrate
the unlimited potential of ‘asymmetric’ building block
fabrication using two different oligonucleotides and fluorescent
dyes.
Scheme 1. Synthesis of azide-containing branching reagents.
The alcohol 4 was mesylated in DCM using 3.0 eq. of mesyl
chloride and then treated with an excess of sodium azide in
DMSO to give mixture of azides 5, 6 and 7 (Scheme 1). Column
chromatography separation on silica gel provided pure
compounds 6 (29%) and 7 (26%) together with diazide 5 (8%). In
contrast, the excessive mesylation of tetraol 4 followed by
nucleophilic substitution13b gave tetraazide 7 in 90% yield.15
First, click conditions were studied using T10 as a model
oligonucleotide (ODN). Conjugation of alkyne-modified
oligonucleotide to azide branching points resulted in a pool of
products. The CuAAC reactions with various excesses of ODN
were carried out for both branching points and analyzed in 19%
PAGE (Figures 1, 2).
The products migrate according to the number of
oligonucleotides attached to the branched backbone: the more
oligo units the block contains, the more slowly it moves in the
gel. As seen from gel images, the tris or tetrakis product is
formed at any ODN:’branching point’ ratio. Tri-product from
triazide 6 dominates in the reaction mixture starting from 2:1
ratio and becomes the only product at ratio 3:1 and higher. Tetra-
product from tetraazide 7 becomes the major product at 4:1 ratio.
However, trace amounts of tri-product are always present, even at
higher excesses of ODN.
The isolated yields of products from triazide 6 (2:1 ratio) after
elution from the gel were following: 12% tri-product, 11% di-
product, 5% mono-product, and for tetraazide 7 (3:1 ratio): 8%
tetra product, 11% tri-product, 9% di-product, 3% mono-product.
Since the yields of elution from the gel vary depending on
fragment length from <30% up to >90%,16 the majority of every
product is lost on this step. We suggest that, an electroelution
technique providing high oligonucleotide recovery (>85%)16b
should be used for preparative purposes.
Partial conjugation of ODNs on branching points is more
attractive than full attachment of ODNs on all azido groups
available. The possibility of further modification of residual
azido-groups then leads to fabrication of ‘asymmetric’ blocks.
Fig. 1. Conjugation of T10 ODN alkyne on triazide 6 in different
ratios; 19% PAGE.

3
By lowering the ODN:polyazide ratio from 5 to 2 for 6 and
ACCEPTED MANUSCRIPT
from 7 to 3 for 7, the formation of products with one or more
intact azido-groups is achieved. The separation of reaction
mixture can be achieved using HPLC (Figures 3 and 4) with
significantly higher isolated yields than in PAGE procedure: 32%
tri-product, 52% di-product, 16% mono-product from triazide 6
(2:1 ratio) and 25% tetra-product, 42% tri-product, 28% di-
product, 5% mono-product from tetraazide 7 (3:1 ratio). Each
HPLC peak and PAGE band were isolated and their
compositions were confirmed by LC-MS (see Supporting
Information). The procedure is well suitable for oligonucleotides
of any sequence (e.g., see Supporting Information for the mass
spectrum of conjugate containing three 21-mers D11 and one
azido group).
Scheme 2. Further modification of partially functionalized building
blocks based on triazide 6 (a) and tetraazide 7 (b): preparation of
[2+1] and [3+1] conjugates.
Similar experiments were performed for attachment of alkyne-
modified ODN with different sequences to intact azido groups of
branched T10 blocks. The blocks carrying a single intact azido
group reacted with 3-fold excess of 5′-alkyne-modified
oligonucleotide GGTCGCTTATCTGCACTCGGA (D11) in the
same conditions as in synthesis of initial blocks (Scheme 2). The
study of reaction products was carried out in 15% PAGE (Figure
5). The formation of the ‘asymmetric’ block is proved by the
appearance of a new band migrating more slowly than all others.
1800
1600
1400
N3
1200
OH
HO
1000
N3
N3
OH
800
600
400
200
0
0
5
10
15
20
25
30
35
40
45
Retention Time (min)
Fig. 3. HPLC profile of partial functionalization of triazide
branching point 6 with T10 ODN in ratio 1:2.
Fig. 5. Fabrication of asymmetric blocks by conjugation of D11
ODN on intact azide groups of T10 blocks studied in 15% PAGE:
click of 21-mer ODN D11 on azide group of di-product from triazide
6 (1), initial di-product (2), initial D11 (3), click of D11 on azide
group of tri-product from tetraazide 7 (4), initial tri-product (5).
All blocks including the resulting asymmetric and initial ones
can be well separated in gel and purified for further use. The
estimated yields of asymmetric blocks are 29% for di-product
from triazide 6 and 9% for tri-product from tetraazide 7 after
elution from the gel.
Fig. 4. HPLC profile of partial functionalization of tetraazide
branching point 7 with T10 ODN in ratio 1:3.
The conjugates have a tetrahedral branching point and rather
long and flexible linkers making oligonucleotides well accessible
for hybridization. Our preliminary data evidences that building
blocks comprised of four, three, or two ODNs covalently joined
to one branching point are capable of self-assembly into simple
discrete structures and can act as PCR primers for the synthesis
of long branched DNA (the results will be reported elsewhere).
The presence of loose azido-group(s) opens up wide
opportunities for the synthesis of ‘asymmetric’ building blocks
based on the branched azide structure (Scheme 2). The model
experiments showing that azido-groups are capable of further
conjugation after first CuAAC reaction and HPLC isolation were
performed with fluorescent Cy5 and Cy3 alkyne derivatives. The
reaction gave high yields of dye conjugates.

4
Tetrahedron
The ability to control stoichiometry of building block opens up
recorded using Bruker Maxis Impact q-TOF system as
ACCEPTED MANUSCRIPT
great perspectives for ‘asymmetric’ building blocks synthesis and
assembly into diverse functional nanoconstructions. The
intermediate azide-containing derivatives, as well as cyanine dye-
labelled products, can be easily isolated and purified by HPLC.
In contrast, PAGE is the method of choice for isolation of
oligonucleotide–oligonucleotide conjugates, e.g. [2+1] and [3+1].
prescribed.
4.2. Synthetic procedures13,14
4.2.1. 5,5-Bis(4-cyano-2-oxabutyl)-1,9-dicyano-3,7-
dioxanonane (2)
Pentaerythritol 1 (20.0 g, 147 mmol) was suspended in water
(150 mL) under vigorous stirring; after 15 min, acrylonitrile
(58.5 mL, 46.7 g, 882 mmol) and 40% tetrabutylammonium
hydroxide (4.4 mL) were added and the stirring was continued
for 24 h. A two-phase liquid reaction mixture was obtained. The
crude oily product (lower phase) was separated, and the upper
phase was extracted with ethyl acetate (3×150 mL). Ethyl acetate
extracts and oily product were combined, washed with water
(3×300 mL), brine (100 mL), dried over Na2SO4 and evaporated.
The resulting oil was coevaporated with DCM (100 mL), diluted
with an equal volume of 96% ethanol and cooled at -20°C. The
crystalline precipitate was collected. Evaporation of mother
liquor and recrystallization of residual oil from cold 96% ethanol
gave a second crop of crystals. Desiccation afforded product as
colorless crystals (33.41 g; 96 mmol; 65% yield), mp 44–45oC
3. Conclusions
To conclude, we report the synthesis of two polyazide
‘branching points’ 6 and 7 from pentaerythritol and the approach
to fabrication of branched building blocks comprised from one to
four oligonucleotides by means of CuAAC reaction.
‘Asymmetric’ [2+1] and [3+1] conjugates were prepared via
further modification of products isolated from partial
functionalization by conjugating a different oligonucleotide or
Cy3 and Cy5 dye alkynes on residual azido-groups. The products
are easily isolated using HPLC or gel electrophoresis. The
combined blocks reported herein could appear useful for rapidly
developing DNA nanotechnology as building blocks for
nanoscale objects self-assembly, staples for DNA origami etc.
1
(EtOH), lit.13a mp 44–46°C. H NMR (500 MHz; DMSO-d6): δ
3.58 (t; 8H; J 5.9 Hz), 3.39 (s, 8H), 2.74 (t, 8H, J 5.9 Hz); 13C
NMR (500 MHz; DMSO-d6) δ 119.26, 68.42, 65.63, 45.21,
17.97. IR (KBr) νmax 3501, 2975, 2914, 2876, 2251, 1495, 1370,
1267, 1173, 1108, 853 cm-1.
4. Experimental section
4.1. General methods
DMSO was used freshly distilled from CaH2 under reduced
pressure. Dichloromethane, chloroform and acetonitrile were
used freshly distilled from CaH2. All other solvents (hexane,
ethyl acetate, ethanol, acetone) were purified by distillation.
Tetrahydrofuran was absolutized by distillation with sodium-
benzophenone ketyl. Pentaerythritol (98%) was purchased from
4.2.2. 6,6-Bis(4-carboxy-2-oxabutyl)-4,8-
dioxaundecane-1,11-dicarboxylic acid (3)
The mixture of 5,5-bis(4-cyano-2-oxabutyl)-1,9-dicyano-3,7-
dioxanonane 2 (50 g, 143.5 mmol) and 36% hydrochloric acid
(130 mL) was stirred and heated to 80°C in an oil bath. After
30 min white solid starts to precipitate, and after 3 h of heating
the reaction mixture was cooled initially in cold water, and then
in a refrigerator (-20°C). The precipitate of NH4Cl was filtered
and washed with acetone (2×50 mL). The filtrate was evaporated
in vacuum to give a mixture of solid and oily compounds. A
portion of acetone (200 mL) was added to dissolve crude
tetracarboxylic acid 5, and white precipitate (the residual NH4Cl)
was removed by filtration. The filtrate was evaporated in vacuum
to give crude 5 which was recrystallized from dry acetonitrile (70
mL). After removing of the obtained crystals the filtrate was
evaporated and the residue was repeatedly recrystallized from
acetonitrile. (The product crystallizes from acetonitrile very
slowly therefore the solution was left at -20°C overnight.) Two
portions of solid products were combined to one and desiccation
of it in vacuum of oil pump afforded product as white crystals
(58.0 g; 137 mmol; 95% yield), mp 99–101°C (MeCN), lit.13a mp
Sigma-Aldrich;
methanesulfonyl
chloride
and
tetrabutylammonium hydroxide (40% aq.) were from Fluka. 500
1
MHz H and 125.7 MHz 13C NMR spectra were recorded on a
Bruker DRX-500 or Bruker Avance 500 spectrometers and
referenced to DMSO-d6 (2.50 ppm for H and 39.5 ppm for 13C)
1
or CDCl3 (7.26 ppm for H and 77.16 ppm for 13C). H NMR
coupling constants are reported in hertz (Hz) and refer to
apparent multiplicities. IR spectra were recorded on a Bruker
ALPHA FT-IR spectrometer. Samples were measured either as
KBr pellets or as thin films between KBr plates. Electrospray
ionization high resolution mass spectra (ESI HRMS) of low
molecular weight compounds were recorded using Thermo
Scientific Orbitrap Exactive mass spectrometer in positive ion
mode. Analytical thin layer chromatography was performed on
Kieselgel 60 F254 precoated aluminum plates (Merck); spots were
visualized with “chromic acid”. Silica gel column
chromatography was performed using Merck Kieselgel 60 0.040–
0.063 mm. HPLC was carried out on Agilent 1100 instrument
using Sunfire C18 column 4.6×250 mm, linear gradient from 0 to
40% MeCN in gradient of NH4OAc from 0.05M to 0.03M for
24min, linear gradient from 40 to 80% MeCN in gradient of
NH4OAc from 0.03 M to 0.01 M for 3 min, linear gradient from
0.01 M to 0 of NH4OAc in 80% MeCN, linear gradient from 80
to 100% MeCN. Oligonucleotides were assembled in an ABI
3400 DNA synthesizer by the phosphoramidite method according
to the manufacturer's recommendations. Protected 2′-
1
1
1
104–106°C, lit.13b mp 107–109°C. H NMR (500 MHz; DMSO-
d6) δ 12.08 (br. s, 4H), 3.53 (t, 8H; J 6.3 Hz), 3.24 (s, 8H), 2.4 (t,
8H, J 6.3 Hz); 13C NMR (500 MHz; DMSO-d6) δ 172.63, 69.03,
66.75, 45.10, 34.68.
4.2.3. 6,6-Bis(5-hydroxy-2-oxapentyl)-4,8-
dioxaundecane-1,11-diol (4)
An oven dried 1 L three-necked round-bottomed flask,
equipped with overhead stirrer, condenser (with CaCl2-tube) and
septum was purged with argon and charged with absolute THF
(200 mL) and BMS (borane dimethylsulfide) (61.5 mL; 648.6
mmol; d 0.801 g/mL). The obtained solution was heated to 50°C
in an oil bath and stirred. The septum was exchanged with the
500 mL pressure-equalizing dropping funnel, which was charged
deoxyribonucleoside
3′-phosphoramidites,
Unylinker-CPG
(500Å) and S-ethylthio-1H-tetrazole were purchased from
ChemGenes; 5′-alkyne phosphoramidite, Cy3 and Cy5 alkynes
were from Lumiprobe LLC. Oligonucleotides were cleaved from
the support and deprotected using AMA – 1:1 (v/v) conc. aq.
ammonia and 40% aq. methylamine for 2 h at room temperature.
ESI-MS spectra for oligonucleotide building blocks were
with
a
solution
of
6,6-bis(4-carboxy-2-oxabutyl)-4,8-
dioxaundecane-1,11-dicarboxylic acid 3 (55 g; 129.7 mmol) in
absolute THF (400 mL). The solution of acid was added
dropwise to the stirred solution of BMS. After the addition was

5
complete, the reaction mixture was stirred and heated for 1 h and
then cooled. Aqueous NaOH solution (25%; 150 mL) was added
dropwise to the vigorously stirred reaction mixture. Organic layer
was removed and the residual crude product was extracted from
alkaline solution with THF (2×100 mL). Organic layers were
combined, dried with Na2SO4 and the solvent was evaporated in
vacuum (STENCH!). The obtained crude product was
chromatographed on silica gel in CHCl3–EtOH (gradient
10%→20% EtOH). The composition of fractions was controlled
by TLC (20% EtOH in CHCl3). The fractions containing product
were combined and evaporated to give pure tetraol 4 (32.02 g;
86.9 mmol; 67% yield) as a colorless oil, lit.13b colorless viscous
mmol) in dry DCM (50 mL). The reaction was controlled by
ACCEPTED MANUSCRIPT
TLC (10% EtOH in CHCl3, the intermediate tetramesylate has Rf
0.79). After the consumption of all starting material the reaction
mixture was washed with distilled water (2×50 mL) and dried
over Na2SO4. Evaporation of the solvent in vacuum gave off-
white crude solid mesylate. It was dissolved in dry DMSO (30
mL), and sodium azide (7.0 g, 108 mmol) was added under
magnetic stirring. After 48 h the reaction mixture was diluted
with water (30 mL). Product was extracted from aqueous layer
with EtOAc (3×100 mL), organic fractions were combined,
washed with distilled water (5×100 mL) and dried over Na2SO4.
After the evaporation of the solvent in vacuum, residue was
chromatographed on silica gel (0 to 2% gradient of EtOH in
CHCl3). Slightly yellowish liquid product 7 was obtained as an
oil; yield 3.40 g (7.2 mmol, 90%). 1H NMR (500 MHz; CDCl3) δ
3.47 (t, 8H; J 5.9 Hz), 3.39–3.35 (m, 16H), 1.83 (q, 8H, J 6.3
Hz); 13C NMR (500 MHz; CDCl3) δ 69.81, 68.0, 48.63, 45.52,
29.18. IR (neat) νmax 3334, 2928, 2871, 2802, 2097, 1486, 1460,
1372, 1301, 1263, 1112, 923 cm-1. ESI HRMS m/z 469.2734
1
liquid. H NMR (500 MHz; DMSO-d6) δ 4.37 (t, 4H, J 5.1 Hz),
3.40–3.46 (m, 8H), 3.35–3.40 (m; 8H), 3.25 (s, 8H), 1.61 (q, 8H,
J 6.4 Hz); 13C NMR (500 MHz; DMSO-d6) δ 69.19, 67.93, 57.95,
45.00, 32.63. IR (neat) νmax 3356, 2944, 2871, 1672, 1485, 1422,
1372, 1300, 1110, 644 cm-1. ESI HRMS m/z 369.2477 [M+H]+,
+
391.2295 [M+Na]+ (calcd for C17H37O8 , 369.2483; C17H36O8Na+,
391.2302).
[M+H]+, 491.2551 [M+Na]+ (calcd for C17H35N6O6 , 469.2742;
+
4.2.4. 6,6-Bis(5-azido-2-oxapentyl)-4,8-dioxa-
undecane-1,11-diol (5) and 6,6-bis(5-azido-2-
oxapentyl)-4,8-dioxa-11-azidoundecane-1-ol (6)
C17H34N6O6Na+, 491.2562).
4.3. Synthesis of branched oligonucleotide conjugates
Mesyl chloride (3.73 g, 32.7 mmol) was added dropwise to a
mixture of 6,6-bis(5-hydroxy-2-oxapentyl)-4,8-dioxaundecane-
1,11-diol 6 (4.00 g, 10.9 mmol) and triethylamine (5.31 mL, 38.2
mmol, d 0.726 g/mL) in dry DCM (50 mL). The reaction was
controlled by TLC (10% EtOH in CHCl3, starting alcohol Rf
0.33). After the con-sumption of all starting material reaction
mixture was washed with distilled water (2×50 mL) and dried
over Na2SO4. Evaporation of the solvent in vacuum gave
yellowish oily liquid. It was dissolved in dry DMSO (30 mL) and
sodium azide (7.00 g; 108 mmol) was added under magnetic
stirring. Two days later TLC (50% EtOAc in hexane; triazide Rf
0.5) showed that reaction was complete. Water (30 mL) was
added and the mixture of products was extracted from water with
EtOAc (3×100 mL); organic fractions were combined, washed
with distilled water (5×100 mL) and dried over Na2SO4. After the
evaporation of the solvent in vacuum, the residue was
chromatographed on silica gel (EtOAc in hexane, gradient of
EtOAc from 20 to 45%). The desired compound 6 was obtained
4.3.1. Conjugation of oligonucleotides on
branching points
Three- and four-fold building blocks were synthesized starting
from triazide
6 and tetraazide 7 branching points and
oligonucleotides with alkyne modifications using copper-
catalyzed click chemistry. The structure of alkyne modification is
given in the Supporting Information. The full functionalization of
branching points with three and four oligonucleotide strands was
achieved by mixing 5-fold molar oligonucleotide excess with
triazide 6 and 7-fold excess for tetraazide 7. The aqueous solution
of oligonucleotide and DMSO solution of the corresponding
azide in ratio chosen were mixed with the addition of
triethylammonium acetate buffer (pH 7) till the final
concentration 0.2 M, 0.5 mM ascorbic acid and 0.5 mM Cu-
TBTA solution in 55% DMSO. The total volume of reaction
mixture in 50% DMSO was adjusted to 0.3 mL. The solution was
saturated with argon before and after addition of copper complex
and left overnight. The products were precipitated with 4-fold
excess of acetone with addition of LiClO4 solution till 0.2 M final
concentration. Analysis and separation of products were
performed using HPLC and polyacrylamide gel electrophoresis
(19% for T10-based products and 15% for D11 containing
products). The composition and stoichiometry of building blocks
was confirmed by electrospray mass-spectrometry.
1
as a colorless liquid, yield 1.38 g (3.1 mmol, 28.6%). H NMR
(500 MHz; CDCl3) δ 3.73–3.81 (m, 2H), 3.59 (t, 2H, J 5.5 Hz),
3.46 (t, 6H; J 5.9 Hz), 3.32–3.43 (m, 14H), 2.58 (br. s, 1H), 1.77–
1.89 (m, 8H); 13C NMR (500 MHz; CDCl3) δ 71.46, 71.00,
70.18, 68.09, 62.55, 48.61, 45.27, 31.93, 29.11. IR (neat) νmax
3449, 2929, 2871, 2097, 1718, 1459, 1300, 1263, 1111, 944 cm-1.
ESI HRMS m/z 444.2673 [M+H]+, 466.2423 [M+Na]+ (calcd for
+
C17H34N9O5 , 444.2677; C17H33N9O5Na+, 466.2497). Byproducts
4.3.2. Conjugation of Cy3, Cy5 and D11 on residual
azide group of building blocks
tetraazide 7 (1.318 g; 2.8 mmol; 25.8% yield) and diazide 5 (0.36
g; 0.9 mmol; 8% yield) were also isolated as colorless liquids.
(CAUTION! Azides are potentially explosive upon heating and
impact,17 especially compounds having (C+O)/N ratio <3; thus
compounds 6 and 7 should be treated carefully). NMR data for
A building block with residual azide group(s) (1 nmol) was
mixed with 1.5-fold excess of dye alkyne (or 3-fold excess of
D11 oligonucleotide) derivative in the same conditions as
described above for building blocks synthesis. The reaction was
left overnight and precipitated with addition of 2M LiClO4
solution (200 ꢀL) and 4-fold excess of acetone. The product was
dissolved in 40 ꢀL of MilliQ water and analyzed/isolated with
reverse phase HPLC (for Cy derivatives) or PAGE (for D11
ODN derivatives). For structures of Cy3 and Cy5 dyes see
Supporting Information.
1
diazide 5: H NMR (500 MHz; CDCl3) δ 3.74 (t, 4H, J 5.3 Hz),
3.58 (t, 4H, J 5.5 Hz), 3.46 (t, 4H, J 5.9 Hz), 3.31–3.42 (m, 12H),
3.05 (s, 2H), 1.74–1.89 (m, 8H); 13C NMR (500 MHz; CDCl3) δ
71.10, 70.87, 70.35, 68.17, 61.94, 48.64, 45.11, 31.89, 29.11. IR
(neat) νmax 3419, 2929, 2871, 2097, 1372, 1301, 1263, 1111, 942
cm-1. ESI HRMS m/z 419.2604 [M+H]+, 441.2423 [M+Na]+
+
(calcd for C17H35N6O6 , 419.2613; C17H34N6O6Na+, 441.2432).
Acknowledgements
4.2.5. 6,6-Bis(5-azido-2-oxapentyl)-4,8-dioxa-1,11-
diazidoundecane (7)
The research was supported by the Russian Foundation for
Basic Research (project 16-04-01170) and by the Molecular and
Cellular Biology Program of the Russian Academy of Sciences
(to V.A.K.). The preparation of polyazide branchers 5–7 was
Mesyl chloride (4.23 g, 37 mmol) was added dropwise to the
mixture of 6,6-bis(5-hydroxy-2-oxapentyl)-4,8-dioxaundecane-
1,11-diol 4 (3.00 g, 8 mmol) and triethylamine (5.29 mL, 38

6
Tetrahedron
9. (a) Vargas-Baca, I.; Mitra, D.; Zulyniak, H. A.; Banerjee, J.;
supported by Russian Science Foundation (grant no. 15-15-
ACCEPTED MANUSCRIPT
Sleiman, H. F. Angew. Chem. Int. Ed. 2001, 40, 4629–4632; (b)
00053 to A.I.P., V.A.B., A.V.U., and V.A.K.).
Aldaye, F. A.; Sleiman, H. F. J. Am. Chem. Soc. 2007, 129, 10070–10071.
10. (a) Singh, A.; Tolev, M.; Schilling, C. I.; Bräse, S.; Griesser, H.;
Richert, C. J. Org. Chem. 2012, 77, 2718–2728; (b) Schwenger, A.;
Gerlach, C.; Griesser, H.; Richert, C. J. Org. Chem. 2014, 79, 11558–11566.
11. Reviews on click chemistry on oligonucleotides: (a)
Gramlich, P. M. E.; Wirges, C. T.; Manetto, A.; Carell, T. Angew. Chem. Int.
Ed. 2008, 47, 8350–8358; (b) El-Sagheer, A. H.; Brown, T. Chem. Soc. Rev.
Supplementary data
Supplementary data associated with this article (HRMS, IR,
and NMR spectra of all new compounds, LC/MS data of
oligonucleotide conjugates) can be found, in the online version,
at
2010,
39,
1388–1405;
(c)
Ustinov, A. V.;
Stepanova, I. A.;
Dubnyakova, V. V.; Zatsepin, T. S.; Nozhevnikova, E. V.; Korshun, V. A.
Russ. J. Bioorg. Chem. 2010, 36, 401–445; (d) El-Sagheer, A. H.; Brown, T.
Acc. Chem. Res. 2012, 45, 1258–1267; (e) Efthymiou, T.; Gong, W.;
Desaulniers, J.-P. Molecules 2012, 17, 12665–12703; (f) Kore, A. R.;
Charles, I. Curr. Org. Chem. 2013, 17, 2164–2191; (g) Haque, M. M.;
Peng, X. Sci. China, Chem. 2014, 57, 215–231; (h) Kath-Schorr, S. Top.
Curr. Chem. (Z) 2016, 374, 4.
12. (a) Kumar, R.; El-Sagheer, A.; Tumpane, J.; Lincoln, P.;
Wilhelmsson, L. M.; Brown, T. J. Am. Chem. Soc. 2007, 129, 6859–6864; (b)
Lietard, J.; Meyer, A.; Vasseur, J.-J.; Morvan, F. J. Org. Chem. 2008, 73,
191–200; (c) Xu, Y.; Suzuki, Y.; Komiyama, M. Angew. Chem. Int. Ed. 2009,
48, 3281–3284; (d) Lundberg, E. P.; El-Sagheer, A. H.; Kocalka, P.;
Wilhelmsson, L. M.; Brown, T.; Nordén, B. Chem. Commun. 2010, 46, 3714–
3716; (e) Pujari, S. S.; Xiong, H.; Seela, F. J. Org. Chem. 2010, 75, 8693–
8696; (f) Jacobsen, M. F.; Ravnsbæk, J. B.; Gothelf, K. V. Org. Biomol.
Chem. 2010, 8, 50–52; (g) Saccà, B.; Niemeyer, C. M. Small 2011, 7, 2887–
2898; (h) Xiong, H.; Leonard, P.; Seela, F. Bioconjugate Chem. 2012, 23,
856–870; (i) Xiong, H.; Seela, F. Bioconjugate Chem. 2012, 23, 1230–1243;
(j) Astakhova, I. K.; Kumar, T. S.; Campbell, M. A.; Ustinov, A. V.;
Korshun, V. A.; Wengel, J. Chem. Commun. 2013, 49, 511–513; (k)
Ingale, S. A.; Seela, F. J. Org. Chem. 2013, 78, 3394–3399; (l) Latorre, A.;
Lorca, R.; Zamora, F.; Somoza, Á. Chem. Commun. 2013, 49, 4950–4952;
5. References and notes
1. (a) LaBoda, C.; Duschl, H.; Dwyer, C. L. Acc. Chem. Res. 2014, 47,
1816–1824; (b) Wang, D; Fu, Y.; Yan, J.; Zhao, B.; Dai, B.; Chao, J.; Liu, H.;
He, D.; Zhang, Y.; Fan, C.; Song, S. Anal. Chem. 2014, 86, 1932–1936; (c)
Li, T.; Lohmann, F.; Famulok, M. Nat. Commun. 2014, 5, 4940; (d)
Ponomarenko, A. I.; Brylev, V. A.; Nozhevnikova, E. V.; Korshun, V. A.
Curr. Top. Med. Chem. 2015, 15, 1162–1178; (e) Yang, Y. R.; Liu, Y.;
Yan, H. Bioconjugate Chem. 2015, 26, 1381–1395.
2. (a) Cho, Y.; Lee, J. B.; Hong, J. Sci. Rep. 2014, 4, 4078; (b) Hu, R.;
Zhang, X.; Zhao, Z.; Zhu, G.; Chen, T.; Fu, T.; Tan, W. Angew. Chem. Int.
Ed. 2014, 53, 5821–5826; (c) Chao, J.; Liu, H.; Su, S.; Wang, L.; Huang, W.;
Fan, C. Small 2014, 10, 4626–4635; (d) Zhan, P.; Jiang, Q.; Wang, Z.; Li, N.;
Yu, H.; Ding, B. ChemMedChem 2014, 9, 2013–2020.
3. (a) Seeman, N. C. J. Theor. Biol. 1982, 99, 237–247; (b)
Kallenbach, N. R.; Ma, R.-I.; Seeman, N. C. Nature 1983, 305, 829–831.
4. (a) Shchepinov, M. S.; Udalova, I. A.; Bridgman, A. J.; Southern, E. M.
Nucl. Acids Res. 1997, 25, 4447–4454; (b) Scheffler, M.; Dorenbeck, A.;
Jordan, S.; Wüstefeld, M.; von Kiedrowski, G. Angew. Chem. Int. Ed. 1999,
38, 3311–3315; (c) Gothelf, K. V.; Thomsen, A.; Nielsen, M.; Cló, E.;
Brown, R. S. J. Am. Chem. Soc. 2004, 126, 1044–1046; (d) Nielsen, M.;
Thomsen, A. H.; Cló, E.; Kirpekar, F.; Gothelf, K. V. J. Org. Chem. 2004,
69, 2240–2250; (e) Katajisto, J.; Heinonen, P.; Lönnberg, H. J. Org. Chem.
2004, 69, 7609–7615; (f) Tumpane, J.; Sandin, P.; Kumar, R.;
Powers, V. E. C.; Lundberg, E. P.; Gale, N.; Baglioni, P.; Lehn, J.-M.;
Albinsson, B.; Lincoln, P.; Wilhelmsson, L.M.; Brown, T.; Nordén, B. Chem.
Phys. Lett. 2007, 440, 125–129; (g) Utagawa, E.; Ohkubo, A.; Sekine, M.;
Seio, K. J. Org. Chem. 2007, 72, 8259–8266; (h) Hannestad, J. K.;
Gerrard, S. R.; Brown, T.; Albinsson, B. Small 2011, 7, 3178–3185; (i)
Lundberg, E. P.; Plesa, C.; Wilhelmsson, L.M.; Lincoln, P.; Brown, T.;
Nordén, B. ACS Nano 2011, 5, 7565–7575; (j) Ferreira, R.; Alvira, M.;
Aviñó, A.; Gómez-Pinto, I.; González, C.; Gabelica, V.; Eritja, R.
ChemistryOpen 2012, 1, 106–114; (k) Eryazici, I.; Yildirim, I.; Schatz, G. C.;
Nguyen, S. T. J. Am. Chem. Soc. 2012, 134, 7450–7458; (l) Hong, B. J.;
Cho, V. Y.; Bleher, R.; Schatz, G. C.; Nguyen, S. T. J. Am. Chem. Soc. 2015,
137, 13381–13388.
5. (a) Hudson, R. H. E.; Robidoux, S.; Damha, M. J. Tetrahedron Lett.
1998, 39, 1299–1299; (b) Damha, M. J.; Braich, R. S.; Tetrahedron Lett.
1998, 39, 3907–3910; (c) Ivanov, S. A.; Volkov, E. M.; Oretskaya, T. S.;
Müller, S. Tetrahedron 2004, 60, 9273–9281; (d) Chandra, M.; Keller, S.;
Gloeckner, C.; Bornemann, B.; Marx, A. Chem. Eur. J. 2007, 13, 3558–3564;
(e) Paredes, E.; Zhang, X.; Ghodke, H.; Yadavalli, V. K.; Das, S. R. ACS
Nano 2013, 7, 3953–3961; (f) Katolik, A.; Johnsson, R.; Montemayor, E.;
Lackey, J. G.; Hart, P. J.; Damha, M. J. J. Org. Chem. 2014, 79, 963–975; (g)
Ghosh, S.; Greenberg, M. M. J. Org. Chem. 2014, 79, 5948–5957.
(m)
Fomich, M. A.;
Kvach, M. V.;
Navakouski, M. J.;
Weise, C.;
Baranovsky, A. V.; Korshun, V. A.; Shmanai, V. V. Org. Lett. 2014, 16,
4590–4593; (n) Clavé, G.; Chatelain, G.; Filoramo, A.; Gasparutto, D.; Saint-
Pierre, C.; Le Cam, E.; Piétrement, O.; Guérineau, V.; Campidelli, S. Org.
Biomol. Chem. 2014, 12, 2778–2783; (o) Thaner, R. V.; Eryazici, I.;
Farha, O. K.; Mirkin, C. A.; Nguyen, S. T. Chem. Sci. 2014, 5, 1091–1096;
(p) Hong, B. J.; Eryazici, I.; Bleher, R.; Thaner, R. V.; Mirkin, C. A.;
Nguyen, S. T. J. Am. Chem. Soc. 2015, 137, 8184–8191.
13. (a) Newkome, G. R.; Weis, C. D. Org. Prep. Proced. Int. 1996, 28,
242–244; (b) Newkome, G. R.; Mishra, A.; Moorefield, C. N. J. Org. Chem.
2002, 67, 3957–3960.
14. All attempts to reproduce procedures13 for 1→→4 sequence gave in
our hands unsatisfactory results. Therefore, some reaction conditions and
isolation procedures were altered.
15. The reaction performed without isolation of the intermediate
tetramesylate gave better results.
16. (a) Sambrook, J.; Russel, D.W. CSH Protocols 2006, 67, 3957; (b)
Zhang, C., Papakonstantinou, T. In: Handbook of Nucleic Acid Purification.
Ed. by D. Liu. CRC Press, 2009, chapter 23.
17. Keicher, T., Löbbecke, S. In: Organic Azides: Syntheses and
Allications. Ed. by S. Bräse and K. Banert. Wiley, 2010, 3–27.
6. (a) Pathak, R.; Marx, A. Chem. Asian J. 2011, 6, 1450–1455; (b)
Bußkamp, H.; Keller, S.; Robotta, M.; Drescher, M.; Marx, A. Beilstein J.
Org. Chem. 2014, 10, 1037–1046.
7. (a) Shi, J.; Bergstrom, D. E. Angew. Chem. Int. Ed. 1997, 36, 111–113;
(b) Grøtli, M.; Eritja, R.; Sproat, B. Tetrahedron 1997, 53, 11317–11346; (c)
Ueno, Y.; Shibata, A.; Matsuda, A.; Kitade, Y. Bioconjugate Chem. 2003, 14,
684–689; (d) Grimau, M. G.; Iacopino, D.; Aviñó, A.; de la Torre, B. G.;
Ongaro, A.; Fitzmaurice, D.; Wessels, J.; Eritja, R. Helv. Chim. Acta 2003,
86, 2814–2826; (e) Aviñó, A.; Grimau, M. G.; Frieden, M.; Eritja, R. Helv.
Chim. Acta 2004, 87, 303–316; (f) Oliviero, G.; Amato, J.; Borbone, N.;
Galeone, A.; Petraccone, L.; Varra, M.; Piccialli, G.; Mayol, L. Bioconjugate
Chem. 2006, 17, 889–898; (g) Meng, M.; Ahlborn, C.; Bauer, M.;
Plietzsch, O.; Soomro, S. A.; Singh, A.; Muller, T.; Wenzel, W.; Bräse, S.;
Richert, C. ChemBioChem 2009, 10, 1335–1339; (h) Singh, A.; Tolev, M.;
Meng, M.; Klenin, K.; Plietzsch, O.; Schilling, C. I.; Muller, T.; Nieger, M.;
Bräse, S.; Wenzel, W.; Richert, C. Angew. Chem. Int. Ed. 2011, 50, 3227–
3231; (i) Griesser, H.; Tolev, M.; Singh, A.; Sabirov, T.; Gerlach, C.;
Richert, C. J. Org. Chem. 2012, 77, 2703–2717.
8. (a) Damha, M. J.; Zabarylo, S.; Tetrahedron Lett. 1989, 30, 6295–6298;
(b) Damha, M. J.; Ganeshan, K.; Hudson, R. H. E.; Zabarylo, S. V. Nucl.
Acids Res. 1992, 20, 6565–6573; (c) Hudson, R. H. E.; Damha, M. J. J. Am.
Chem. Soc. 1993, 115, 2119–2124.