Structure elucidation of the O-antigen of Salmonella enterica O51 and its structural and genetic relation to the O-antigen of Escherichia coli O23

Article abstract of DOI:10.1134/S0006297911070078

The O-polysaccharide (O-antigen) of Salmonella enterica O51 was isolated by mild acid degradation of the lipopolysaccharide and its structure was established using sugar analysis and NMR spectroscopy. The O-antigen of Escherichia coli O23, whose structure was elucidated earlier, possesses a similar structure and differs only in the presence of an additional lateral α-D-Glcp residue at position 6 of the GlcNAc residue in the main chain. Sequencing of the O-antigen gene clusters of S. enterica O51 and E. coli O23 revealed the same genes with a high-level similarity. By comparison with opened gene databases, all genes expected for the synthesis of the common structure of the two O-antigens were assigned functions. It is suggested that the gene clusters of both bacteria originated from a common ancestor, whereas the O-antigen modification in E. coli O23, which, most probably, is induced by prophage genes outside the gene cluster, could be introduced after the species divergence.

Full text of DOI:10.1134/S0006297911070078

ISSN 0006ꢀ2979, Biochemistry (Moscow), 2011, Vol. 76, No. 7, pp. 774ꢀ779. © Pleiades Publishing, Ltd., 2011.
Published in Russian in Biokhimiya, 2011, Vol. 76, No. 7, pp. 948ꢀ955.
Structure Elucidation of the OꢀAntigen of Salmonella enterica
O51 and Its Structural and Genetic Relation
to the OꢀAntigen of Escherichia coli O23*
A. V. Perepelov1#**, Bin Liu2,3#, Dan Guo2,3, S. N. Senchenkova1,
A. S. Shahskov1, Lu Feng2,3, Lei Wang2,3, and Y. A. Knirel1
1Zelinsky Institute of Organic Chemistry, Russian Academy of Sciences, Leninsky pr. 47,
119991 Moscow, Russia; fax: (499) 137ꢀ6148; Eꢀmail: perepel@ioc.ac.ru
2TEDA School of Biological Sciences and Biotechnology, Nankai University, TEDA, Tianjin 300457, P. R. China
3Tianjin Key Laboratory for Microbial Functional Genomics, TEDA College, Nankai University,
TEDA, Tianjin 300457, P. R. China; Eꢀmail: striker198126@yahoo.com.cn
Received December 24, 2010
Revision received February 3, 2011
Abstract—The Oꢀpolysaccharide (Oꢀantigen) of Salmonella enterica O51 was isolated by mild acid degradation of the
lipopolysaccharide and its structure was established using sugar analysis and NMR spectroscopy. The Oꢀantigen of
Escherichia coli O23, whose structure was elucidated earlier, possesses a similar structure and differs only in the presence of
an additional lateral αꢀDꢀGlcp residue at position 6 of the GlcNAc residue in the main chain. Sequencing of the Oꢀantigen
gene clusters of S. enterica O51 and E. coli O23 revealed the same genes with a highꢀlevel similarity. By comparison with
opened gene databases, all genes expected for the synthesis of the common structure of the two Oꢀantigens were assigned
functions. It is suggested that the gene clusters of both bacteria originated from a common ancestor, whereas the Oꢀantigen
modification in E. coli O23, which, most probably, is induced by prophage genes outside the gene cluster, could be introꢀ
duced after the species divergence.
DOI: 10.1134/S0006297911070078
Key words: Salmonella enterica, Escherichia coli, lipopolysaccharide, bacterial polysaccharide, structure, gene cluster, Oꢀ
antigen
Clones of Escherichia coli include both commensal
The Oꢀantigen (Oꢀpolysaccharide, OPS) is a part of
and pathogenic strains. Salmonella enterica is recognized the lipopolysaccharide of Gramꢀnegative bacteria. It conꢀ
as one of the important pathogens of animals and sists of oligosaccharide repeats (Oꢀunits), usually conꢀ
humans. Serotyping of these bacteria is based on their taining two to eight sugar residues. The OPS is one of the
surface antigens, including Oꢀantigens, and about 174 Oꢀ most variable constituents on the cell surface due to variꢀ
serogroups in E. coli and 46 Oꢀserogroups in S. enterica ations in the types of sugars present, their arrangement
are recognized [1, 2].
and linkages, and is subject to intense selection by the
host immune system and bacteriophages. The OPS is also
an important virulence factor, and its loss makes many
pathogens serum sensitive or otherwise seriously impaired
in virulence [3ꢀ5].
In E. coli, S. enterica, and Shigella spp., genes for the
Oꢀantigen biosynthesis are normally clustered between
galF and gnd and belong to three different groups: i) genes
for synthesis of nucleotide precursors of sugars used as
specific Oꢀantigen constituents; ii) genes encoding glycoꢀ
syl transferases; iii) Oꢀunit processing genes, including
genes for Oꢀunit flippase (wzx) and Oꢀantigen polymerase
(wzy) in the Wzyꢀdependent synthesis pathway [6]. The
Abbreviations: COSY, correlation spectroscopy; DEPT, distorꢀ
tionless enhancement by polarization transfer; HMBC, hetꢀ
eronuclear multiple bond correlation spectroscopy; HSQC,
heteronuclear singleꢀquantum coherence spectroscopy; OPS,
Oꢀpolysaccharide; ROESY, rotatingꢀframe nuclear Overhauser
effect spectroscopy; TOCSY, total correlation spectroscopy;
TSP, sodium trimethylsilyltetradeuteropropionate.
* This paper is based on a presentation made at the 4th Baltic
Conference on Microbial Carbohydrates, Hyytiälä Forestry
Field Station, Finland, September 19ꢀ22, 2010.
# These authors contributed equally to this work.
** To whom correspondence should be addressed.
774

OꢀANTIGENS OF S. enterica O51 AND E. coli O23
775
genes in the last two groups are specific to a unique Oꢀ Chromosomal DNA was prepared as described [12].
antigen structure [7]. Genetic variations in the Oꢀantigen Primers WL_1098 (5′ꢀATTGGTAGCTGTAAGCCAAꢀ
gene clusters contribute major differences between the GGGCGGTAGCGTꢀ3′) and WL_2211 (5′ꢀCACTGCꢀ
diverse Oꢀantigen forms.
CATACCGACGACGCCGATCTGTTGCTTGGꢀ3′)
In this study, the structure of the Oꢀantigen of S. based on JUMPStart and gnd genes, respectively, were
enterica O51 was determined and found to be closely used to amplify the DNA of S. enterica O51 and E. coli
related to that of E. coli O23 reported earlier [8]. The Oꢀ O23 Oꢀantigen gene clusters, using the Expand Long
antigen gene clusters of S. enterica O51 and E. coli O23 Template PCR system (Roche, USA). The PCR cycles
were sequenced and found to possess a highꢀlevel similarꢀ used were as follows: denaturation at 94°C for 10 sec,
ity to each other. An evolutionary relationship between annealing at 60°C for 30 sec, and extension at 68°C for
the two bacteria studied is discussed.
15 min. The PCR products were digested with DNase I
(11284932001; Roche Diagnostics, USA), and the resultꢀ
ing DNA fragments were cloned into a pGEMꢀT Easy
vector system to produce a gene bank. Sequencing was
carried out by the Tianjin Biochip Corporation (China),
MATERIALS AND METHODS
Salmonella enterica O51 and E. coli O23 strains were using an ABI 3730 automated DNA sequencer (Applied
obtained from the Institute of Medical and Veterinary Biosystems, USA). Sequences of the Oꢀantigen gene
Sciences (Adelaide, Australia). Salmonella enterica O51 clusters were analyzed as described [13].
type strain G1456 was grown to late log phase in 8 liters of
Luria–Bertani broth (1% tryptone, 0.5% yeast extract,
1% NaCl) using a 10ꢀliter fermentor (BIOSTAT Cꢀ10; B.
Braun Biotech International, Germany) under constant
aeration at 37°C and pH 7.0. Bacterial cells were washed
RESULTS AND DISCUSSION
Structure elucidation of the Oꢀantigen of S. enterica
and dried as described [9]. The lipopolysaccharide O51. The lipopolysaccharide was isolated from dried bacꢀ
(250 mg) was isolated from dried cells (7 g) by the pheꢀ terial cells of S. enterica O51 by the Westphal procedure
nol–water method [10] and purified by precipitation of [10] and degraded with mild acid. A polysaccharide fracꢀ
nucleic acids and proteins with aqueous 50% tion was isolated by gelꢀpermeation chromatography on
trichloroacetic acid at 4°C followed by dialysis.
Sephadex Gꢀ50. Sugar analysis by GLC of the alditol
The lipopolysaccharide of S. enterica O51 (~90 mg) acetates derived after full acid hydrolysis of the polysacꢀ
were delipidated with aqueous 2% acetic acid (6 ml) at charide revealed Glc, Gal, GlcNAc, and GalNAc in the
100°C until lipid precipitation (~1 h). The precipitate was ratio of ~1 : 1 : 2 : 1. GLC of the acetylated (S)ꢀ2ꢀ
removed by centrifugation (13,000g, 20 min) and the octyl glycosides showed that all monosaccharides have
supernatant fractionated on a column (56 × 2.6 cm) of the D configuration.
Sephadex Gꢀ50 Superfine (Amersham Biosciences,
The 13C NMR spectrum of the Oꢀpolysaccharide
Sweden) in 0.05 M pyridinium acetate buffer, pH 4.5, (Fig. 1) showed signals for five anomeric carbons at δ
with monitoring using a differential refractometer 98.7ꢀ106.4, three nitrogenꢀbearing carbons (C2 of amino
(Knauer, Germany). The OPS was isolated in a yield 30% sugars) at δ 49.9ꢀ57.1, five CH2O groups (C6 of hexoses)
of the lipopolysaccharide mass.
at δ 61.1ꢀ62.4 (nonꢀsubstituted) and 69.1 (C6 of a glycoꢀ
The OPS of S. enterica O51 was hydrolyzed with 2 M sylated hexose residue; data of DEPT test), other sugar
trifluoroacetic acid (120°C, 2 h), and the monosaccharides ring carbons in the region δ 70.0ꢀ82.4, and three Nꢀacetyl
1
were analyzed by GLC of the alditol acetates on a Hewlettꢀ groups at δ 23.6ꢀ23.9 (CH3), 175.9ꢀ176.0 (CO). The H
Packard 5890 chromatograph (USA) equipped with an NMR spectrum of the Oꢀpolysaccharide contained, inter
Ultraꢀ2 column (Supelco, USA) using a temperature graꢀ alia, signals for five anomeric protons at δ 4.48ꢀ5.45 and
dient of 160 to 290°C at 3°C/min. The absolute configuraꢀ three Nꢀacetyl groups at δ 2.01ꢀ2.08.
tions of the monosaccharides were determined by GLC of
the acetylated (S)ꢀ2ꢀoctyl glycosides as described [11].
The 1H and 13C NMR spectra of the OPS were
assigned (Table 1) using twoꢀdimensional correlation
Prior to NMR measurements, samples were deuteriꢀ spectroscopy, including 1H,1H COSY, TOCSY, 1H,13C
umꢀexchanged by freezeꢀdrying from D2O and then HSQC, and HMBC experiments. Five sugar spin systems
examined as solutions in 99.96% D2O at 30°C. Spectra were revealed, which, based on characteristic coupling
were recorded on a Bruker Avance 600 spectrometer constants, were assigned to Glc (A), Gal (B), GalNAc
(Germany) using TSP (δH 0) and acetone (δC 31.45) as (C), GlcNAcI (D), and GlcNAcII (E). The J1,2 coupling
internal reference. 2D NMR spectra were obtained using constant values of ~3 Hz indicated that units A and C are
standard Bruker software, and the Bruker TopSpin proꢀ αꢀlinked, whereas a relatively large J1,2 value of 7ꢀ8 Hz
gram was used to acquire and process the NMR data. showed that units B, D, and E are βꢀlinked.
Mixing times of 100 and 150 msec were used in TOCSY
and ROESY experiments, respectively.
The signals for C6 of unit A, C3 and C4 of unit B, C3
of units C and D were shifted significantly downfield to δ
BIOCHEMISTRY (Moscow) Vol. 76 No. 7 2011

776
PEREPELOV et al.
Fig. 1. 13C NMR spectrum of the Oꢀpolysaccharide of S. enterica O51. Numerals refer to carbons in sugar residues denoted by letters as shown
in Table 1.
69.1, 82.4, 76.9, 78.3, and 79.2, respectively, as compared linkage carbons: A H1/B C4, B H1/C C3, C H1/D C3, D
with their positions in the corresponding nonꢀsubstituted H1/A C6, and E H1/B C3 at δ 4.88/76.9, 4.48/78.3,
monosaccharides [14, 15]. These displacements are due 5.45/79.2, 4.57/69.1, and 4.64/82.4, respectively.
to αꢀglycosylation effects and define the glycosylation
Therefore, the Oꢀpolysaccharide of S. enterica O51
pattern of the monosaccharides in the repeating unit of has the structure 1 showed in Fig. 2.
the Oꢀpolysaccharide.
Characterization of the Oꢀantigen gene cluster of S.
The sequence of the monosaccharide residues was enterica O51. A sequence of 9091 base pairs (bp) between
determined by a twoꢀdimensional ROESY experiment. JUMPStart and gnd was examined, and seven open readꢀ
The spectrum showed crossꢀpeaks at δ 4.88/4.22, ing frames (orfs) having the same transcriptional direction
4.48/3.91, 5.45/3.73, 4.57/3.95, and 4.64/3.74, which were identified (Fig. 3). All orfs were assigned functions
were assigned to interresidue correlations between the based on sequence similarity to previously described gene
following anomeric protons and protons at the linkage sequences available from the GenBank database (Table
carbons: A H1/B H4; B H1/C H3; C H1/D H3, D H1/A 2).
H6a, and E H1/B H3, respectively. These data were conꢀ
Genes for synthesis of the nucleotide precursors of
1
firmed by a H,13C HMBC experiment, which showed common sugars (Glc, Gal, and GlcNAc in case of S.
crossꢀpeaks between the following anomeric protons and enterica O51) are located outside of the Oꢀantigen gene
Table 1. 1H and 13C NMR chemical shifts of the Oꢀpolysaccharide of S. enterica O51 (δ, ppm)
Sugar residue
H1
C1
H2
C2
H3
C3
H4
C4
H5
C5
H6 (6a, 6b)
C6
→6)ꢀαꢀDꢀGlcpꢀ(1→
A
4.88
100.7
3.43
73.8
3.71
74.1
3.42
70.6
4.33
71.6
3.95, 4.19
69.1
→3,4)ꢀβꢀDꢀGalpꢀ(1→
B
4.48
106.4
3.59
71.7
3.74
82.4
4.22
76.9
3.73
76.8
3.75, 3.79
61.1
→3)ꢀαꢀDꢀGalpNAcꢀ(1→
С
5.45
98.7
4.37
49.9
3.91
78.3
4.17
70.0
3.89
72.2
3.75, 3.75
61.9
→3)ꢀβꢀDꢀGlcpNAcꢀ(1→
D
4.57
102.7
3.84
55.6
3.73
79.2
3.74
72.4
3.44
76.9
3.78, 3.89
61.8
βꢀDꢀGlcpNAcꢀ(1→
E
4.64
105.1
3.59
57.1
3.53
75.6
3.41
71.7
3.41
77.1
3.75, 3.93
62.4
Note: Signals for the Nꢀacetyl groups are at δH 2.01ꢀ2.08; δC 23.6ꢀ23.9 (Me), and 175.9ꢀ176.0 (CO).
BIOCHEMISTRY (Moscow) Vol. 76 No. 7 2011

OꢀANTIGENS OF S. enterica O51 AND E. coli O23
777
Fig. 2. Structures of the Oꢀpolysaccharides of S. enterica O51 (1) and E. coli O23 (2).
Hꢀrepeat element
Identity by DNA, %
Identity by protein, %
Fig. 3. Comparison of the Oꢀantigen gene clusters of S. enterica O51 and E. coli O23.
cluster [16]. Therefore, a gene for synthesis of UDPꢀ
Transfer of GlcNAcꢀ1ꢀP or GalNAcꢀ1ꢀP to an
GalNAc only was expected in the S. enterica O51 gene undecaprenol phosphate carrier catalyzed by WecA initiꢀ
cluster. Orf7 shares 61% identity with UDPꢀGlcNAc C4ꢀ ates the repeating unit synthesis in many E. coli, S. enterꢀ
epimerase (Gne) of Yersinia enterocolitica 0:8, which conꢀ ica, and Shigella spp. strains. Gene wecA is located outꢀ
verts UDPꢀGlcNAc to UDPꢀGalNAc. It was suggested side of the Oꢀantigen gene cluster [17], and, therefore,
that Orf7 has the same function, and orf7 was named only four glycosyl transferase genes were expected in the
accordingly.
Orf1 and Orf3 are the only two proteins with predictꢀ
Oꢀantigen gene cluster of S. enterica O51.
Orf5 shares 46% identity with glycosyltransferase
ed transmembrane segments. Orf1 has nine wellꢀproporꢀ WbnJ of E. coli O86, which is responsible for the syntheꢀ
tioned transmembrane segments. It shares 46% similarity sis of the βꢀGalꢀ(1→3)ꢀGalNAc linkage [18]. It was proꢀ
to the putative Wzy protein (Oꢀantigen polymerase) of S. posed that Orf5 has the same function as WbnJ. Orf6
enterica group C1. Orf3 has 10 predicted transmembrane shares 66% identity with glycosyltransferase WfbG of S.
segments. It shares 46% similarity to the putative Wzx enterica O55 [19], and it was proposed that Orf6 catalyzes
protein (Oꢀunit flippase) of Shigella boydii type 9. the formation of the αꢀGalNAcꢀ(1→3)ꢀGlcNAc linkage
Therefore, orf1 and orf3 were proposed to be the genes for as this is the only linkage shared by the Oꢀantigens of S.
Oꢀantigen polymerase (wzy) and Oꢀunit flippase (wzx), enterica O51 and O55. It can be suggested also that Dꢀ
respectively.
GlcNAc D rather than DꢀGalNAc C is the first sugar of
BIOCHEMISTRY (Moscow) Vol. 76 No. 7 2011

778
PEREPELOV et al.
Table 2. Characteristics of the ORFs in the Oꢀantigen gene cluster of S. enterica O51
No. orf Gene
Position
of gene
G + C
(%)
Conserved
domain(s)
Similar protein(s), strain(s)
(GenBank accession No.)
% identical/%
similar (number
of a.a. overlap)
Putative
function
of protein
1
2
wzy
196..1221
26.9
28.6
Oꢀantigen polymerase,
S. enterica group C1
(AAB49386)
24/46 (327)
32/48 (285)
Oꢀantigenꢀ
polymerase
wdbK 1218..2084
glycosyl transꢀ
ferase group 2
(PF00535),
glycosyltransferase,
Streptococcus thermophilus
(CAI34545)
glycosylꢀ
transferase
Evalue = 8.8 e–31
3
4
wzx
2057..3259
27.3
30.0
Oꢀantigen flippase,
S. boydii type 9 (AAL27353)
27/46 (156)
38/58 (226)
Oꢀantigenꢀ
flippase
wdbL 3256..3912
glycosyltransꢀ
ferase sugarꢀ
binding region
(PF04488),
glycosyltransferase,
Prevotella oris C735
(EFI49643)
glycosylꢀ
transferase
Evalue = 4.8 e–18
5
6
7
wbnJ 3939..4673
31.2
32.7
34.9
glycosyl transꢀ
ferase group 2
(PF00535),
WbnJ, E. coli O86
(AAV80758)
46/66 (242)
66/83 (372)
61/76 (336)
ꢀꢀ"ꢀꢀ
ꢀꢀ"ꢀꢀ
Evalue =1.3 e–24
wfbG
gne
4900..6027
6054..7082
glycosyl transꢀ
ferase group 1
(PF00534),
WfbG, S. enterica O55
(ADI39346)
Evalue = 6 e–36
epimerase
Gne, Y. enterocolitica
(type 0:8) (AAC60777)
UDPꢀ
(PF01370),
GlcNAc
C4ꢀepiꢀ
merase
Evalue = 5.9 e–54
the repeating unit of S. enterica O51. Orf2 and Orf4 closely related Oꢀantigens have been found between the
belong to the glycosyl transferase group 2 family two species, including O71/O28, O85/O17, O103/O55,
(PF00535, E value = 8.8×e–31) and glycosyl transferase O123/O58, O145/O48, and O166/O66 pairs [23ꢀ27], as
sugarꢀbinding region family (PF04488, E value = well as O17, O44, O73, O77/O6,14 and O118, O151/O47
4.8×e–18), respectively. Therefore, orf2, orf4, orf5, and orf6 groups [28, 29].
were proposed to be putative glycosyl transferase genes,
and were named wdbK, wdbL, wbnJ, and wfbG, respecꢀ antigen of S. enterica O51 is closely related to the strucꢀ
tively. ture 2 of the Oꢀantigen of E. coli O23 (Fig. 2), which has
The structure 1 established in this work for the Oꢀ
Downstream of gne, an Hꢀrepeat element (positions been elucidated earlier [8]. The latter differs only in the
7329 to 8621) was found, which shares 78% DNA presence of a lateral αꢀDꢀGlcp residue attached at posiꢀ
sequence identity with the Hꢀrepeat element of E. coli tion 6 of the 3ꢀsubstituted GlcNAc residue. Therefore, a
K12 [20] (Fig. 3). Hꢀrepeats have been suggested to new pair, S. enterica O51/E. coli O23, is added to the list
mediate gene transfers and to play a role in formation of of related Oꢀserogroups of the two bacteria.
new Oꢀantigen gene clusters [21]. However, current
To substantiate genetically the structural similarity
information is not enough to speculate on a role of the Hꢀ between the Oꢀantigens of S. enterica O51 and E. coli
repeat in the formation of the S. enterica O51 Oꢀantigen O23, the Oꢀantigen gene cluster of the latter was
gene cluster.
sequenced too. As expected, the O23 cluster was found to
Relatedness of the Oꢀantigen structures and gene contain the same set of genes in the same order as in S.
clusters of S. enterica O51 and E. coli O23. For a long enterica O51 (Fig. 3). Therefore, the genes were assigned
time, only three common Oꢀantigens have been known in the same functions and given the same names. The correꢀ
E. coli and S. enterica (O55/O50, O111/O35, and sponding genes from the two gene clusters share DNA
O157/O30, respectively) [22]. Recently, more identical or identity from 69 to 74% and protein identity from 57 to
BIOCHEMISTRY (Moscow) Vol. 76 No. 7 2011

OꢀANTIGENS OF S. enterica O51 AND E. coli O23
779
10. Westphal, O., and Jann, K. (1965) Methods Carbohydr.
Chem., 5, 83ꢀ91.
11. Leontein, K., and Lönngren, J. (1993) Methods Carbohydr.
Chem., 9, 87ꢀ89.
72% (Fig. 3). The only major difference between the two
Oꢀantigen gene clusters is that the Hꢀrepeat element is
absent from the cluster of E. coli O23.
The similarity of the Oꢀantigen gene clusters is conꢀ
sistent with the structural similarity of the Oꢀantigens of
S. enterica O51 and E. coli O23. As for the additional latꢀ
eral glucosylation in E. coli O23, this is presumably
encoded by prophage genes located elsewhere in the
chromosome, as, e.g. serotypeꢀconverting genes involved
in the synthesis of S. flexneri Oꢀantigens [30]. It can be
suggested that the Oꢀantigen gene clusters of S. enterica
O51 and E. coli O23 diverged from a common ancestor, as
found in the other related E. coli/S. enterica gene clusters
encoding the same or similar Oꢀantigen structures. The
prophageꢀinduced Oꢀantigen modification in E. coli O23
could be introduced after the species divergence.
12. Bastin, D. A., and Reeves, P. R. (1995) Gene, 164, 17ꢀ23.
13. Feng, L., Senchenkova, S. N., Yang, J., Shashkov, A. S.,
Tao, J., Guo, H., Zhao, G., Knirel, Y. A., Reeves, P., and
Wang, L. (2004) J. Bacteriol., 182, 383ꢀ392.
14. Bock, K., and Pedersen, C. (1983) Adv. Carbohydr. Chem.
Biochem., 41, 27ꢀ66.
15. Lipkind, G. M., Shashkov, A. S., Knirel, Y. A., Vinogradov,
E. V., and Kochetkov, N. K. (1988) Carbohydr. Res., 175,
59ꢀ75.
16. Samuel, G., and Reeves, P. (2003) Carbohydr. Res., 338,
2503ꢀ2519.
17. Alexander, D. C., and Valvano, M. A. (1994) J. Bacteriol.,
176, 7079ꢀ7084.
18. Yi, W., Shao, J., Zhu, L., Li, M., Singh, M., Lu, Y., Lin, S.,
Li, H., Ryu, K., Shen, J., Guo, H., Yao, Q., Bush, C. A.,
and Wang, P. G. (2005) J. Am. Chem. Soc., 127, 2040ꢀ2041.
19. Liu, B., Perepelov, A. V., Svensson, M. V., Shevelev, S. D.,
Guo, D., Senchenkova, S. N., Shashkov, A. S., Weintraub,
A., Feng, L., Widmalm, G., Knirel, Y. A., and Wang, L.
(2010) Glycobiology, 20, 679ꢀ688.
20. Zhao, S., Sandt, C. H., Feulner, G., Vlazny, D. A., Gray, J.
A., and Hill, C. W. (1993) J. Bacteriol., 175, 2799ꢀ2808.
21. Xiang, S. H., Hobbs, M., and Reeves, P. R. (1994) J.
Bacteriol., 176, 4357ꢀ4365.
22. Samuel, G., Hogbin, J. P., Wang, L., and Reeves, P. R.
(2004) J. Bacteriol., 186, 6536ꢀ6543.
23. Feng, L., Senchenkova, S. N., Tao, J., Shashkov, A. S., Liu,
B., Shevelev, S. D., Reeves, P., Xu, J., Knirel, Y. A., and
Wang, L. (2005) J. Bacteriol., 187, 758ꢀ764.
This work was supported by the Russian Foundation
for Basic Research (project 08ꢀ04ꢀ92225ꢀNNSF), the
Chinese National Science Fund for Distinguished Young
Scholars (30788001), NSFC General Program Grant
30670038, 30870070, 30870078, 30771175, and
30900041, Tianjin Research Program of Application
Foundation and Advanced Technology (10JCYBꢀ
JC10000), the National 863 program of China grants
2006AA020703 and 2006AA06Z409, the National 973
program of China grant 2009CB522603, the National
Key Program for Infectious Diseases of China
2009ZX10004ꢀ108.
24. Hu, B., Perepelov, A. V., Liu, B., Shevelev, S. D., Guo, D.,
Senchenkova, S. N., Shashkov, A. S., Feng, L., Knirel, Y.
A., and Wang, L. (2010) FEMS Immunol. Med. Microbiol.,
59, 161ꢀ169.
REFERENCES
1. Fitzgerald, C., Collins, M., van Duyne, S., Mikoleit, M.,
Brown, T., and Fields, P. (2007) J Clin. Microbiol., 45,
3323ꢀ3334.
25. Liu, B., Perepelov, A. V., Li, D., Senchenkova, S. N., Han,
Y., Shashkov, A. S., Feng, L., Knirel, Y. A., and Wang, L.
(2010) Microbiology, 156, 1642ꢀ1649.
2. Kauffmann, F. (1966) in The Bacteriology of
Enterobacteriaceae (Williams and Wilkins, eds.) Baltimore.
3. Gemski, P. J., Sheahan, D. G., Washington, O., and
Formal, S. B. (1972) Infect. Immun., 6, 104ꢀ111.
4. Pluschke, G., Mayden, J., Achtman, M., and Levine, R. P.
(1983) J. Bacteriol., 42, 907ꢀ913.
26. Perepelov, A. V., Li, D., Liu, B., Senchenkova, S. N., Guo,
D., Shashkov, A. S., Feng, L., Knirel, Y. A., and Wang, L.
(2011) Innate Immun., DOI: 10.1177/1753425910369270.
27. Perepelov, A. V., Liu, B., Shevelev, S. D., Senchenkova, S.
N., Shashkov, A. S., Feng, L., Knirel, Y. A., and Wang, L.
(2010) Carbohydr. Res., 345, 825ꢀ829.
5. Achtman, M., and Pluschke, G. (1986) Annu. Rev.
Microbiol., 40, 185ꢀ210.
6. Raetz, C. R. H., and Whitfield, C. (2002) Annu. Rev.
Biochem., 71, 635ꢀ700.
28. Wang, W., Perepelov, A. V., Feng, L., Shevelev, S. D., Wang,
Q., Senchenkova, S. N., Han, W., Li, Y., Shashkov, A. S.,
Knirel, Y. A., Reeves, P. R., and Wang, L. (2007)
Microbiology, 153, 2159ꢀ2167.
7. Wang, L., and Reeves, P. R. (1998) Infect. Immun., 66,
3545ꢀ3551.
8. Bartelt, M., Shashkov, A. S., Kochanowski, H., Jann, B.,
and Jann, K. (1993) Carbohydr. Res., 248, 233ꢀ240.
9. Robbins, P. W., and Uchida, T. (1962) Biochemistry, 1, 323ꢀ
335.
29. Perepelov, A. V., Li, D., Liu, B., Senchenkova, S. N., Guo,
D., Shevelev, S. D., Shashkov, A. S., Feng, L., Knirel, Y. A.,
and Wang, L. (2010) FEMS Immunol. Med. Microbiol., 60,
199ꢀ207.
30. Allison, G. E., and Verma, N. K. (2000) Trends Microbiol.,
8, 17ꢀ23.
BIOCHEMISTRY (Moscow) Vol. 76 No. 7 2011