Carrier-free cellular uptake and the gene-silencing activity of the lipophilic siRNAs is strongly affected by the length of the linker between siRNA and lipophilic group

Article abstract of DOI:10.1093/nar/gkr1002

The conjugation of siRNA to molecules, which can be internalized into the cell via natural transport mechanisms, can result in the enhancement of siRNA cellular uptake. Herein, the carrier-free cellular uptake of nuclease-resistant anti-MDR1 siRNA equippe

Full text of DOI:10.1093/nar/gkr1002

2330–2344 Nucleic Acids Research, 2012, Vol. 40, No. 5
doi:10.1093/nar/gkr1002
Published online 10 November 2011
Carrier-free cellular uptake and the gene-silencing
activity of the lipophilic siRNAs is strongly affected
by the length of the linker between siRNA and
lipophilic group
Natalya S. Petrova, Ivan V. Chernikov, Mariya I. Meschaninova1, IIya S. Dovydenko1,
Aliya G. Venyaminova1, Marina A. Zenkova, Valentin V. Vlassov and
Elena L. Chernolovskaya*
1
Laboratory of Nucleic Acids Biochemistry and Labotarory of RNA Chemistry, Institute of Chemical Biology and
Fundamental Medicine, SB RAS, Lavrentiev ave., 8, Novosibirsk 630090, Russia
Received August 25, 2011; Revised and Accepted October 19, 2011
ABSTRACT
INTRODUCTION
The conjugation of siRNA to molecules, which can
be internalized into the cell via natural transport
mechanisms, can result in the enhancement of
siRNA cellular uptake. Herein, the carrier-free
cellular uptake of nuclease-resistant anti-MDR1
siRNA equipped with lipophilic residues (choles-
terol, lithocholic acid, oleyl alcohol and litocholic
acid oleylamide) attached to the 50-end of the
sense strand via oligomethylene linker of various
length was investigated. A convenient combination
of H-phosphonate and phosphoramidite methods
was developed for the synthesis of 50-lipophilic
conjugates of siRNAs. It was found that lipophilic
siRNA are able to effectively penetrate into
HEK293, HepG2 and KB-8-5 cancer cells when
used in a micromolar concentration range. The effi-
ciency of the uptake is dependent upon the type of
lipophilic moiety, the length of the linker between
the moiety and the siRNA and cell type. Among all
the conjugates tested, the cholesterol-conjugated
siRNAs with linkers containing from 6 to 10 carbon
atoms demonstrate the optimal uptake and gene
silencing properties: the shortening of the linker
reduces the efficiency of the cellular uptake of
siRNA conjugates, whereas the lengthening of the
linker facilitates the uptake but retards the gene
silencing effect and decreases the efficiency of
the silencing.
Small interfering RNAs (siRNAs) (1–3) have broad appli-
cation within molecular biology and experimental
pharmacology, being widely used for the control of gene
expression (4–6). Currently, siRNAs are used successfully
for the validation of potent drug targets for anti-cancer
therapy (7,8). A factor that significantly limits their
biomedical application, are the challenges associated
with the inefficient delivery of siRNAs to target cells
and tissues. Various approaches have been developed in
an attempt to overcome this problem. These different
approaches can be assigned to one of two major groups:
viral (9,10) and non-viral (11–13) methods. Viral-based
RNAi provides an efficient and long-lasting silencing in
cultured cells and in laboratory animals systems; however,
immunogenicity, in the case of adenoviral vectors, is a
factor that limits their biomedical application (14).
Furthermore, the potential tumorogenicity as a result of
the integration into the host genome, in the case of
lenti- and retroviral vectors is an additional limiting
factor (15–17). Non-viral approaches include the follow-
ing groups of methods: firstly, high-pressure intravenous
injections (18–20); secondly, the delivery of siRNA in the
complexes with cationic lipids, polymers and different
types of particles; thirdly, the covalent conjugation
of siRNAs with different carrier molecules (11,21,22).
The first approach can be applied only to laboratory
animals, since it often results in organ damage and
immune activation. The second group of methods is a
member of a quickly developing field of science;
however, the toxicity of lipids and polymers (23) and the
*To whom correspondence should be addressed. Tel: +7 383 3635161; Fax: +7 383 3635153; Email: elena_ch@niboch.nsc.ru
ß The Author(s) 2011. Published by Oxford University Press.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/3.0), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Nucleic Acids Research, 2012, Vol. 40, No. 5 2331
insufficient transfection efficacy in vivo (11), severely limits
the application of available up-to-date formulations. The
conjugation of siRNA to the molecules, which can be
internalized into the cell by natural transport mechanisms,
is an approach that shows considerable promise in the
attempt to overcome the problem of toxicity and target
delivery (22,24). Steroids and other hydrophobic lipid
groups can be attached to siRNA, thereby extending the
siRNA circulation time and enhancing the direct cellular
uptake (25–27). The potential of cholesterol (26,27),
a-tocopherol (28), aptamers (29–31), antibodies (32–34)
and cell-penetrating peptides (35–38) in the alteration of
the bioavailability and distribution of siRNAs has been
described; however, the silencing efficacy of different
conjugates varies substantially and the optimization
of the composition and structure of the conjugates is
required.
Within this study, we investigated the carrier-free
cellular accumulation and silencing activity of various
lipophilic conjugates of the nuclease-resistant anti-
MDR1 siRNA. The following lipophilic moieties: choles-
terol, oleyl alcohol, lithocholic acid and oleylamide of
lithocholic acid, were attached to the 50-end of the sense
strand of siRNA directly or via aliphatic amino-propyl-,
-hexyl-, -octyl-, -decyl- and -dodecyl- linker. It was ascer-
tained that the efficiency of cellular accumulation is
dependent upon the type of lipophilic residues, the type
of the target cells and the length of the linker between
siRNA and lipophilic residue.
gradient was as follows: (i) 0.00 min, 0.0% buffer B;
35.00 min, 90.0% buffer B for the conjugated siRNAs;
(ii) 0.00 min, 0.0% buffer B; 35.00 min, 20.0% buffer B
for the non-conjugated siRNAs. The oligonucleotide-
containing fractions were evaporated in Speedvac concen-
trator (SVC-100 H, Savant, USA) and precipitated as Na+
salts. The preparative PAGE was performed using
denaturing 12% polyacrylamide gel (acrylamide:N,N0-
methylenebisacrylamide (30:0.5), 8 M urea, 89 mL
Tris–borate, oM 8.3, 2 mL Na2EDTA, 20 V/cm). After
electrophoretic separation, oligonucleotide material was
visualized by UV shadowing, extracted from the gel with
0.3 M NaOAc (pH 5.2) containing 0.1% sodium dodecyl
sulfate (SDS), followed by precipitation with ethanol.
LC-ESI and MALDI-TOF mass-spectra were obtained
with an ESI MS/MSD XCT (Agilent Technologies,
USA) and a autoflex III (Bruker Daltonics, Germany)
mass spectrometer.
Synthesis
Cholesterol-3-(carboxyaminopropan-3-ol) (2), cholesterol-
3-(carboxyaminohexan-6-ol) (3), cholesterol-3-(carboxy
aminooctan-8-ol) (4), cholesterol-3-(carboxyaminodecan-
10-ol) (5) and cholesterol-3-(carboxyaminododecan-12-ol)
(6) were synthesized by analogy with (39). Cholesteryl
chloroformate
(1,
0.5 g,
1.1 mmol)
and
dry
triethanolamine (TEA, 0.15 ml, 1.1 mmol) were dissolved
in dry dichloromethane (4 ml) and added to anhydrous
aminoalcohol (1.1 mmol). The mixture was stirred at
room temperature for 2 h (TLC, AcOEt/hexane 50/50),
following this dichloromethane (20 ml) was added, and
the resulting solution was then washed with saturated
aqueous (sat. aq.) NaHCO3 (20 ml ꢀ 2) and water
(20 ml), dried over Na2SO4, and then filtered and
evaporated under reduced pressure. The residue was
dissolved in AcOEt/hexane (10/90) and purified via silica
gel column chromatography (elution with AcOEt/hexane
10/90 to 50/50). The characteristics of 2 to 6 are presented
in the Supplementary Materials.
MATERIALS AND METHODS
General remarks
RNA phosphoramidites, 20-O-methylphosphoramidites
and other reagents for the oligonucleotide synthesis were
obtained from Glen Research (USA). 3-Aminopropan-
1-ol,
6-aminohexan-1-ol,
cholesterol,
cholesteryl
chloroformate and lithocholic acid were purchased from
Sigma-Aldrich (USA), oleylamine and oleyl alcohol were
supplied from Acros (Belgium) and 8-aminooctan-1-ol,
3ꢀ-(Acetoxy)-5ꢁ-cholanic acid (8). Lithocholic acid
(7, 0.5 g, 1.3 mmol) was dissolved in dry pyridine (10 ml)
under argon and cooled to 0ꢁC. 4-Dimethylaminopyridine
(0.02 g, 0.13 mmol) and acetyl chloride (1.1 ml, 16 mmol)
were added to the solution. After the mixture was stirred
at room temperature for 1 h (under TLC control), water
(3 ml) was added and the solution was evaporated
under reduced pressure. Dichloromethane (15 ml) was
used to dissolve the residue, which was subsequently
washed with sat. aq. NaCl (20 ml) and water (15 ml).
The organic phase was dried over Na2SO4, then filtered
and evaporated to dryness. The crude product was
co-evaporated with toluene (10 ml ꢀ 2), ethanol
(10 ml ꢀ 2), acetonitrile (10 ml ꢀ 2) and dichloromethane
(10 ml ꢀ 2) in order to remove the traces of pyridine and
purified by silica gel chromatography (elution with
CH3OH/CH2Cl2 0/100 to 5/95). The characteristics of
8 are presented in Supplementary Methods.
10-aminodecan-1-ol,
12-aminododecan-1-ol
were
acquired from TCI (Belgium). Other chemicals were
supplied by Merck (Germany) and Fluka (Switzerland).
Solvents were supplied from Panreac (Spain).
Column chromatography was performed with Silica gel
˚
60 A 230–400 mesh (Sigma), and thin-layer chroma-
tography (TLC) was performed on Silica gel 60 F254
aluminum sheets (Merck) in CH3OH/CH2Cl2 5/95.
1H and 31P NMR spectra were recorded on a Bruker
AV-300 spectrometer with tetramethylsilane as an
internal standard, or 85% phosphoric acid as an
external standard, respectively. RNA synthesis (0.4 mmol
scale) was performed on the automatic ASM-800 DNA/
RNA synthesizer (Biosset, Russia). Preparative reverse
phase high performance liquid chromatography
(RP-HPLC) was performed on an Alliance chromato-
graphic system (Waters, USA) equipped with XBridge
C18 column, 2.5 mm, 4.6 ꢀ 50 mm (Waters, USA) at
50ꢁC. The flow rate was 1 ml/min (buffer A, 0.05 M
NaClO4; buffer B, 0.05 M NaClO4/90% CH3CN); the
3ꢀ-(Acetoxy)-5ꢁ-cholanic acid pentafluorophenyl ester
(9) was synthesized by analogy with (40). Compound

2332 Nucleic Acids Research, 2012, Vol. 40, No. 5
8 (0.4 g, 1.0 mmol) was dissolved in dry dichloromethane
0ꢁC.
control) and washed with sat. aq. NaCl (50 ml ꢀ 2) and
water (50 ml). The organic phase was dried over Na2SO4
and filtered. In order to afford the compound 13 as a white
solid, the crude product was purified via silica gel column
chromatography (elution with CH3OH/hexane/CH2Cl2 0/
50/50 to 4/48/48) following the evaporation of solvents.
The characteristics of 13 are presented in the
Supplementary Materials.
(13 ml)
under
argon
and
cooled
to
N,N-Dicyclohexylcarbodiimide (0.25 g, 1.2 mmol) was
added to the solution. The mixture was stirred for
30 min at 0ꢁC. Following this, pentafluorophenol (0.2 g,
1.1 mmol) in dichloromethane (1 ml) was added and the
stirring was then continued at room temperature for an
additional 20 h (under TLC control). The precipitated
N,N-dicyclohexylurea was filtered off and washed with
cold dichloromethane; combined filtrates were evaporated
under reduced pressure. The oily residue obtained was
then diluted with dichloromethane (15 ml) and washed
with sat. aq. NaCl (20 ml) and water (15 ml). The
organic phase was dried over Na2SO4, filtered and
evaporated until complete dryness had been achieved.
Compound 9 (0.55 g, 98%) thus obtained was directly
used for the next step without purification. Rf (TLC,
CH3OH/CH2Cl2 5/95): 0.8.
3ꢀ-(Acetoxy)-5ꢁ-cholanic acid 3-hydroxypropylamide
(10) and 3ꢀ-(acetoxy)-5ꢁ-cholanic acid 6-hydroxy-
hexylamide (11). Aminoalcohol (1.3 mmol) was
co-evaporated with dry pyridine (3 ml ꢀ 3), dissolved in
dry dichloromethane (1 ml) and added to the mixture of
compound 6 (0.5 g, 0.9 mmol) and TEA (three equiv) in
dry dichloromethane (20 ml) cooled to 0ꢁC. The reaction
mixture was stirred at room temperature under argon for
40 min (under TLC control) and washed with sat. aq.
NaCl (50 ml ꢀ 2) and water (50 ml). The organic phase
was dried over Na2SO4. Following this, it was filtered
and evaporated to dryness. The crude product was then
purified via silica gel column chromatography (elution
with CH3OH/hexane/CH2Cl2 0/50/50 to 8/46/46) in
order to afford the compounds 10 and 11 as white
solids. The characteristics of 10 and 11 are presented
in the Supplementary Materials.
3ꢀ-(Hydroxy)-5ꢁ-cholanic acid pentafluorophenyl ester
(12) was synthesized by analogy with (41). Lithocholic
acid (7) (0.5 g, 1.35 mmol) was dissolved in dry
dichloromethane (13 ml) and then cooled to 0ꢁC.
Following this N,N-dicyclohexylcarbodiimide (0.34 g,
1.65 mmol) was added to the solution. After stirring for
30 min at 0ꢁC, pentafluorophenol (0.27 g, 1.5 mmol) in
dichloromethane (1 ml) was added; the stirring was
then continued at room temperature under argon for an
additional 20 h (under TLC control). The precipitated
N,N-dicyclohexylurea was filtered off and washed with
cold dichloromethane. Combined filtrates were then
evaporated under reduced pressure. The oily residue
obtained was then diluted with dichloromethane (15 ml)
and washed with sat. aq. NaCl (20 ml) and water (15 ml).
The organic phase was dried over Na2SO4, filtered
and evaporated to dryness. The obtained compound 12
(0.7 g, 96%), was directly used for the next step without
purification. Rf (TLC, CH3OH/CH2Cl2 5/95): 0.8.
3ꢀ-(Succinimidyloxycarbonyl)-5ꢁ-cholanic
acid
oleylamide (14) was synthesized by analogy with (40).
The amide 13 (0.45 g, 0.72 mmol) was dissolved in dry
dichloromethane (6 ml). N,N0-disuccinimidyl carbonate
(0.55 g, 2.1 mmol), dry TEA (0.5 ml) and dry acetonitrile
(3 ml) were added to the solution. The reaction mixture
was stirred at room temperature under argon for 24 h
(under TLC control) and was then evaporated until
dryness had been achieved. The residue was dissolved
in dichloromethane (20 ml), washed with sat. aq.
NaHCO3 (20 ml ꢀ 2), dried over Na2SO4, filtered and
then evaporated under reduced pressure. Compound 14
(0.54 g, 98%) was obtained as a colorless powder, which
was directly used for the next step in the absence of further
purification. Rf (TLC, CH3OH/CH2Cl2 5/95): 0.2.
3ꢀ-(Carboxyaminopropan-3-ol)-5ꢁ-cholanic
acid
oleylamide (15) and 3ꢀ-(carboxyaminohexan-6-ol)-
5ꢁ-cholanic acid oleylamide (16) were synthesized via
analogy with (40). Aminoalcohol (0.7 mmol) was dried
via co-evaporation with dry pyridine (3 ml ꢀ 3), dissolved
in dry pyridine (0.8 ml) and subsequently added to the
solution of compound 14 (0.54 g, 0.7 mmol) in dry
dichloromethane (4 ml). The resulting mixture was then
cooled to 0ꢁC. Following stirring at room temperature
under argon for 20 h (under TLC control), the reaction
mixture was evaporated to dryness, dissolved in
dichloromethane (20 ml), washed with sat. aq. NaHCO3
(20 ml ꢀ 2) and water (20 ml); dried over Na2SO4 and then
evaporated under reduced pressure. The residue was
purified via silica gel column chromatography (elution
with CH3OH/CH2Cl2 0/100 to 4/96) to afford 15 and
16. The characteristics of 15 and 16 are shown in the
Supplementary Materials.
Synthesis of lipophilic H-phosphonates (17–28).
H-Phosphonates of lipophilic compounds were
synthesized via analogy with (42). Imidazole (1 g,
14.5 mmol) was dissolved in dry acetonitrile (20 ml) and
then cooled to 0ꢁC. TEA (2 ml, 14.0 mmol) and PCl3
(0.4 ml, 4.5 mmol) were added to this solution and subse-
quently stirred for 25 min at 0ꢁC. Lipophylic compound
(1 mmol) was dissolved separately in dry dichloromethane
(10 ml) and added drop-wise into the mixture for 40 min
under argon. The reaction mixture was then stirred for
an additional 1 h at room temperature (under TLC
control) followed by the addition of water (3 ml) and
subsequent evaporation. The residue was dissolved in
dichloromethane (30 ml), washed with water (20 ml ꢀ 2),
dried over Na2SO4, filtered and then evaporated under
reduced pressure. The crude product was dissolved in
CH3OH/CH2Cl2 (10/90) and was then subjected to silica
gel chromatography (elution with CH3OH/CH2Cl2 10/90
to 70/30 with 0.1% TEA), in order to afford the
3ꢀ-(Hydroxy)-5ꢁ-cholanic acid oleylamide (13).
Compound 12 (0.7 g, 1.3 mmol) was dissolved in dry
dichloromethane (30 ml) and then cooled to 0ꢁC. A cold
mixture of oleylamine (0.65 ml, 2.0 mmol) and TEA
(0.55 ml, 4.0 mmol) in dichloromethane (2 ml) was added
to the resulting solution. The reaction mixture was stirred
at room temperature for an additional 1 h (under TLC

Nucleic Acids Research, 2012, Vol. 40, No. 5 2333
Table 1. Sequences of oligoribonucleotides
corresponding H-phosphonate. The characteristics of
H-phosphonates (17–28) are shown in the
Supplementary Materials.
Designation
Sequencea (50–30)
ON1 (sense strand of siMDR) GGCUUGACAAGUUGUAUAUGG
ON2 (antisense strand of
siMDR)
Synthesis of siRNA
AUAUACAACUUGUCAAGCCAA
Oligoribonucleotides were synthesized on an automatic
ASM-800 synthesizer at 0.4 mmol scale using solid
phase phosphoramidite synthesis protocols (43) optimized
for the instrument, with a 10 min coupling step for
20-O-TBDMS-protected phosphoramidites (0.1 M in
acetonitrile), 6 min coupling step for 20-O-methylated
ON3 (sense strand of siScr)
ON4 (antisense strand
of siScr)
CAAGUCUCGUAUGUAGUGGUU
CCACUACAUACGAGACUUGUU
a20-N-methyl-modified nucleotides are underlined.
phosphoramidites
(0.05 M
in
acetonitrile)
and
Table 2. 50-lipophilic conjugates of the sense strands of siRNAs
5-ethylthio-H-tetrazole (0.25 M in acetonitrile) as an
activating agent. A mixture of acetic anhydride with
2,6-lutidine in THF and N-methylimidazole in THF
were utilized as capping reagents. The oxidizing agent
was 0.02 M iodine in pyridine/water/THF (1/9/90).
Dichloroacetic acid (3%) in dichloromethane was used
as a detritylating reagent. The 30-end of the antisense
strand of siRNA used in the uptake assay was labeled
by fluorescein (FITC) as described in (44).
No.
Conjugate
Yielda (%)
Mass found
Mass calculated
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
Ch0-ON1
Ch3-ON1
Ch6-ON1
Ch8-ON1
Ch10-ON1
Ch12-ON1
Lt3-ON1
8/88b
9/89b
7286.3c
7386.5c
7428.7c
7456.5e
7485.3e
7513.2e
7332.8c
7374.8e
7167.2e
7524.7c
7625.7c
7667.7c
7208.5e
7308.9e
7351.2e
7380.1e
7407.8e
7436.2e
7255.1e
7297.4e
7448.4e
7549.2e
7590.5e
7285.8
7386.8
7428.8
7456.8
7484.8
7512.8
7332.7
7374.7
7167.7
7525.2
7626.2
7668.2
7208.7
7309.7
7351.7
7379.7
7407.7
7435.7
7255.6
7297.6
7448.1
7549.1
7591.1
7/87.5b
9.5/89.3d
10/89.5d
9.5/89.3d
8.5/88.4b
11/90b
Lt6-ON1
Ol-ON1
7/87.5b
7/87.5d
9/89d
Synthesis of lipophilic conjugates of oligonucleotides
OlLt0-ON1
OlLt3-ON1
OlLt6-ON1
Ch0-ON3
Ch3-ON3
Ch6-ON3
Ch8-ON3
Ch10-ON3
Ch12-ON3
Lt3-ON3
Conjugates were prepared via analogy with (42). Each
H-phosphonate of the lipophilic compound (17–28)
(4.5 mmol) was dissolved in dichloromethane (150 ml).
The 50-O-detritylated, support-bound oligonucleotide
(15 mg, 0.45 mmol) was then transferred from the synthesis
column to a 0.6 ml screw top glass vial and subse-
quently blended with a solution of the corresponding
H-phosphonate (50 ml), followed by treatment with
pivaloyl chloride (1.3 ml, 12.5 mmol in 150 ml pyridine/
acetonitrile, 2/1) for 5 min. In order to remove an
uncoupled lipophilic compound, the support-bound conju-
gate was washed with acetonitrile. In order to increase the
yield of the conjugates the condensation was repeated
twice. The conjugate-containing support was then washed
with acetonitrile, treated with I2 (0.2 ml of 0.1 M solution in
pyridine/water, 98/2) for 20 min, washed with acetonitrile,
acetone and diethyl ether, and then subsequently dried.
8.5/88.4d
11/90b
9/89b
10/89.5b
10/89.5d
11/90d
10.5/89.8d
11/90b
Lt6-ON3
11/90b
OlLt0-ON3
OlLt3-ON3
OlLt6-ON3
9/89d
9/89d
9/89d
aOverall yield/coupling yield (per support-bound starting nucleoside)
after isolation.
bOverall yield/coupling yield (per support-bound starting nucleoside)
after isolation by RP-HPLC
cLC-ESI-MS (ESI MS/MSD XCT, Agilent Technologies, USA).
dOverall yield/coupling yield (per support-bound starting nucleoside)
after isolation by PAGE.
eMALDI-TOF-MS (autoflex III, Bruker Daltonics, Germany).
Deprotection, purification and annealing of siRNAs and
lipophilic analogs
The oligoribonucleotides (Table 1) and their conjugates
(Table 2) were cleaved from the support and deprotected
by 40% methylamine in water at 65ꢁC for 15 min.
20-O-Silyl groups were removed upon treatment with a
Cell cultures
Human HEK293 and HepG2 cell lines were obtained
from the Institute of Cytology RAS, St. Petersburg,
Russia. Multiple drug resistant human cell line KB-8-5
growing in the presence of 300 nM vinblastine was
generously provided by Prof. M. Gottesman (National
Institutes of Health, USA). The cells were grown in
Dulbecco modified Eagle’s medium (DMEM) supple-
mented with 10% fetal bovine serum (FBS), 100 U/ml
penicillin, 100 mg/ml streptomycin and 0.25 mg/ml
mixture of NMP/TEA 3HF/TEA (150/100/75) at 65ꢁC
·
for 1.5 h. Deprotected oligoribonucleotides and conjugates
were isolated by RP-HPLC and precipitated with ethanol
as Na+ salts. Alternatively, they were isolated via prepara-
tive electrophoresis in 12% polyacrylamide/8 M urea gel,
followed by elution from the gel with 0.3 M NaOAc
(pH 5.2)/0.1% SDS solution and precipitated with
ethanol as Na+ salts. The purified oligoribonucleotides
were characterized by electrophoretic mobility in 12%
dPAAG, MALDI-TOF-MS and LC-ESI-MS (Table 2).
siRNA duplexes were annealed at 10 mM in 30 mM
HEPES-KOH, pH 7.4, 100 mM potassium acetate,
2 mM magnesium acetate and stored at ꢂ20ꢁC.
amphotericin at 37ꢁC in
containing 5% CO2/95% air.
a humidified atmosphere
Cellular accumulation assay
One day before the experiment KB-8-5, HepG2 and HEK
293 cells in the exponential phase of growth were plated

2334 Nucleic Acids Research, 2012, Vol. 40, No. 5
in 24-well plates at a density of 1.7 ꢀ 105 cells/well. The
growth medium was then replaced by fresh DMEM
(200 ml/well) without FBS. Each of the FITC-labeled lipo-
philic siRNAs was added to the cells in 50 ml of Opti-Mem
to give the final concentration varying from 0.2 to 5 mM.
Four hours post-transfection cells were trypsinized and
fixed in 2% formaldehyde in phosphate-buffered saline
(PBS). In the case of KB-8-5 cells, the accumulation
of conjugates was estimated 1, 2, 4, 8 and 24 h post-
transfection. Cells were analyzed using Cytomics FC 500
(Beckman Coulter, USA) flow cytometer (excitation
wave length 488 nm, emission 530 30 nm). Of cells,
10 000 from each sample were analyzed. The percentage
of FITC positive cells with green fluorescence exceeded the
level of the auto-fluorescence of untreated cells (here and
after referred to as ‘transfected cells’). The mean values
of cell fluorescence intensity normalized to this value of
untreated cells were used for data presentation.
exponential phase of growth were plated in 48-well
plates (7 ꢀ 103–104 cells/well). After 24 h had elapsed,
cholesterol-containing siRNAs (5 mM) were added to the
cells as previously described. Alternatively, the cells were
transfected with non-modified siRNA (0.2 mM) using
Lipofectamine 2000 (Invitrogene, Carlsbad, CA) (0.8 ml
per well) according to the manufacturer’s protocol.
The cells were then cultured for 3–8 days. During this
incubation period cells were re-plated after 4 and 5 days
of incubation into 48-well plates (2 ꢀ 104 cells/well) for the
time points: 6 and 8 days, respectively. The cells were lysed
in 40 ml of sample buffer (Sigma-Aldrich, USA) at the time
points 3, 4, 5, 6 and 8 days of incubation. Of each sample,
20 ml was loaded on a 10% SDS/polyacrylamide gel and
then separated at 60 mA for 1 h. The proteins were
transferred from PAAG to PVDF membrane (Millipore,
USA) using SemiPhor (Hoefer, USA) and the membrane
was then blocked overnight in 0.5% non-fat dried milk in
0.05 M Tris–HCl, 0.15 M NaCl, 0.1% Tween-20 pH 7.5.
The membranes were incubated with monoclonal anti-P-
gp and anti-b-actin antibodies (Sigma-Aldrich, USA)
at 1:3000 and 1:6000 dilutions, respectively for 1 h. After
the membranes were washed in buffer B, they were subse-
quently incubated for 30 min with secondary rabbit
anti-mouse antibodies conjugated with alkaline phosphat-
ase (Invitrogen, USA). Chromogenic detection was
then performed using Western Blue Stabilized Substrate
for alkaline phosphatase (Promega, USA). The reaction
was stopped via rinsing with water. The human b-actin
protein was used as an internal control. Data were
analyzed using GelPro 4.0. software (Media Cybernetics,
USA).
Confocal microscopy
In order to prove the intracellular localization of the lipo-
philic siRNAs, the confocal fluorescent microscopy was
utilized. KB-8-5 cells in the exponential phase of growth
were plated on the glass coverslips in 24-well plates at a
density of 1.3 ꢀ 105 cells/well one day before the experi-
ment. FITC-labeled cholesterol-containing siRNAs were
then added to the cells to final concentration 2 mM.
Following 8 h of incubation the cells were washed with
PBS, fixed in 4% formaldehyde/PBS at 37ꢁC for 20 min,
permeabilized in 0.5% saponin/PBS for 10 min and
stained with Rhodamine Phalloidin (Millipore, USA)
and dissolved in PBS for 15 min for cytoskeleton
(ß-actin) visualization. The cells on the coverslips were
then washed with PBS and mounted on the object-plate
in DAPI/Antifade solution (Millipore, USA). The analysis
of lipophilic siRNA localization was performed using
a confocal fluorescent microscope LSM 510 Meta (Carl
Zeiss, Germany) at 100ꢀ magnification using optical
filters BP 420–480 nm, BP 505–530 nm and LP 560 nm.
RESULTS
The sequence of siRNA (Table 1) targeted to 557–577 nt
of the human MDR1 mRNA (here and after siMDR) was
selected in our previous study (46). It was demonstrated
that siMDR has the ability to inhibit the MDR1 expres-
sion both at the level of mRNA and P-gp. Furtermore,
siMDR is capable of reversing the multiple drug resistance
of cancer cells. siRNA that has no significant homology to
any known mRNA sequences from mouse, rat or human
was used as a negative control (here and after referred to
as ‘siScr’, Table 1). These siRNAs contained 20-O-methyl
modifications in CpA, UpA and UpG motives, earlier
identified as the primary sites of nuclease attack (47).
50-Hydroxyl-position of the sense strands of siRNAs was
used for the introduction of the lipophilic moieties since
the modification of this position is better tolerated by
RNAi machinery than the modification of the antisense
or both strands (25,48,49).
MTT Assay
In order to determine the number of living cells a colori-
metric assay was used, based on the reduction of the dye
3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium
bromide (MTT) in mitochondria (45). Exponentially
growing KB-8-5 cells were plated in 96-well plates
(2.5 ꢀ 103 cells/well) in a vinblastine-free medium one
day before the experiment. Following this lipophilic
conjugates of siRNA (1–5 mM) were added to the cells.
After 24 h of incubation, the vinblastine was added to
the cells to the final concentration of 300 nM. After 4, 5
and 6 days of incubation the MTT assay was then
performed according to the procedure described in (45).
The relative number of living cells normalized to the
number of living cells in control was used for data
presentation.
Synthesis of lipophilic siRNAs
A combination of H-phosphonate and phosphoramidite
methods was applied to the synthesis of 50-lipophilic con-
jugates of siRNAs. The modified lipophilic synthons were
then synthesized, beginning with cholesterol, cholesteryl
chloroformate (1) and lithocholic acid (7) (Figure 1).
Lithocholic acid was selected due to the fact that both
Western blotting
The level of P-glycoprotein (P-gp) in KB-8-5 cells was
evaluated in a vinblastine-free medium. The cells in the

Nucleic Acids Research, 2012, Vol. 40, No. 5 2335
Figure 1. Synthesis of lipophilic H-phosphonates 17–28. Reagents: (i) PCl3, imidazole, TEA; (ii) H2O; (iii) aminopropanol, aminohexanol,
aminooctanol, aminodecanol or aminododecanol, TEA; (iv) acetyl chloride, DMAP; (v) DCC, pentafluorophenol; (vi) oleylamide, TEA;
(vii) N,N0-disuccinimidyl carbonate, TEA; (viii) aminopropanol or aminohexanol.
carboxylic and hydroxyl groups are presented in one
molecule and can be used for attachment to siRNAs or
esterification with fatty acids. The lipophilicity of the
lithocholic acid was enhanced via introduction of the
oleylamine residue giving compounds 13, 15 and 16.
The lipophilic compounds 1, 7 and their derivatives
bearing linkers of various lengths were transformed into
the corresponding H-phosphonates via interaction
with phosphorus triimidazolide followed by hydrolysis
(Figure 1). This reaction gives H-phosphonates 17–28

2336 Nucleic Acids Research, 2012, Vol. 40, No. 5
with high yield (41–94%). Structures of H-phosphonates
and their precursors were confirmed by NMR and MS
methods (see Supplementary Materials for details).
The sense and antisense strands of siRNAs were
synthesized according to the phosphoramidite method.
Support-bound 50-hydroxyl-containing sense strands
of siRNA were used for the condensation with
H-phosphonates 17–28 in the presence of pivaloyl
chloride. The lipophilic conjugates obtained were fully
deprotected according to the standard procedures, using
and C), whereas the TE of HEK293 with these conjugates
reached 90% at 5 mM concentration (Figure 2E). The ac-
cumulation of the siRNA conjugated with oleic alcohol in
the cells was insignificant. The comparison of mean values
of the cell fluorescence intensity revealed a substantial
preference of cholesterol-conjugated siRNA in compari-
son with other conjugates (Figure 2B, D and F). The chol-
esterol residue conjugated to siRNA via aminohexyl and
aminododecyl linkers enabled a 4–5-fold higher accumu-
lation of siRNA in KB-8-5 cells at a 5 mM concentration
of the conjugates, in comparison with that of oleylamide
of lithocholic acid conjugated to siRNA (Figure 2B).
Similar results were obtained in HepG2 cells. The differ-
ences between cellular accumulation of the conjugates in
HEK293 cells were less pronounced, but still substantial
(Figure 2).
It was discovered that the length of the linker between
the siRNA and lipophilic residue significantly influences
the cellular accumulation. The conjugates containing
linkers of 6-12 carbon atoms accumulated in all tested
cells more efficiently than conjugates in which the lipophilic
residue was attached to siRNA directly or via a shorter
linker (Figure 2). The estimation of TE at the lower
concentrations of the conjugates (0.2–1 mM) revealed that
the percentage of transfected cells increased with the
increase of the linker length (Figure 2A, C and E). TE of
HEK293 cells was 0, 20, 50 and 70% for the siRNA with
cholesterol tethered directly (without linker) or via the
aminopropyl, aminohexyl and aminododecyl linkers, re-
spectively (Figure 2E). This tendency can evidently be
observed via comparison of the mean fluorescence values
(Figure 2B, D and F). For instance, the lengthening of the
linker from 0 to 12 carbon atoms increased the mean fluor-
escence intensity from 5 to 110 RFU for KB-8-5 cells, from
10 to 117 RFU for HepG2 cells and from 20 to 90 RFU for
HEK293 cells, when the conjugates were used at concen-
tration 5 mM (Figure 2B, D and F).
methylamine and TEA 3HF (43).
·
Isolation of the oligoribonucleotides conjugated with
cholesterol (29–34, 41–46), lithocholic acid (35, 36, 47,
48) and oleyl alcohol (37) from reaction mixtures was
accomplished via reverse-phase HPLC. With regards to
the conventional oligoribonucleotides, the retention time
increased from 5 min to 15–23 min for lipophilic oligoribo-
nucleotides depending on the nature of the lipophilic
component and the linker length (Supplementary Figure
S1). Purification of the oligoribonucleotides conjugated
with the litocholic acid oleylamide (38–40, 49–51) via
RP-HPLC resulted in the loss of oligonucleotide
material because of their high lipophilicity. Preparative
PAGE was used followed by conjugates precipitation
as Na+ salts, in order to overcome these obstacles. The
overall yield of the lipophilic oligoribonucleotides purified
by HPLC or PAGE methods was 8-12% (per
support-bound starting nucleoside) (Table 2).
All purified lipophilic oligoribonucleotides were
analyzed by LC-ESI and MALDI-TOF mass spectrom-
etry. The calculated molecular weights were in agreement
with the measured values, thereby confirming the
structures of the isolated products (Table 1).
Carrier-free cellular uptake of lipophilic siRNAs
The accumulation of the FITC-labeled siRNA and its
lipophilic conjugates into KB-8-5, HepG2 and HEK 293
cells was measured using flow cytometry after 4 h of incu-
bation with the corresponding siRNA. Two parameters
reflecting the efficiency of the process were used for the
comparison: the transfection efficiency (here and after
referred to as ‘TE’) estimated as a percentage of cells
with green fluorescence exceeding the maximum level of
cell auto-fluorescence and the normalized mean value of
the intensity of the green fluorescence of the cell measured
in relative fluorescent units (here and after referred to as
‘‘RFU’’) normalized to that of untreated cells. The data
show that the efficacy of cellular accumulation is depend-
ent upon the type of cell line; however, all conjugates of
siRNA with cholesterol or with oleylamide of lithocholic
acid accumulated in all cells under study, with a higher
degree of effectiveness than other conjugates (Figure 1).
The 100% transfection of KB-8-5 cells was observed after
the incubation of the cells with these conjugates at 2 and
5 mM concentrations (Figure 2A); conversely, the same
level of transfection was achieved at the concentrations
of the conjugates 0.2 and 1 mM, respectively for HepG2
and HEK293 cells (Figure 2C and E). Non-modified
siRNA and conjugates of siRNA and lithocholic acid
did not penetrate in KB-8-5 and HepG2 cells (Figure 2A
Kinetics of accumulation of lipophilic siRNAs in
KB-8-5 cells
The time course of the accumulation of lipophilic siRNAs
in KB-8-5 cells was monitored for 1–24 h. FITC-labeled
conjugates Ch6-siMDR, Ch12-siMDR and OlLt6-siMDR
were selected for these experiments since they
demonstrated an efficient accumulation in all cell types
(Figure 2). The maximal mean fluorescence of the cells
was observed at 8 h for all tested conjugates (Figure 3).
Cellular accumulation of cholesterol-containing siRNAs
was 2.5–3-fold higher than this value for OlLt6-siMDR.
After 24 h of incubation with the lipophilic siRNAs the
mean values of the cell fluorescence was substantially
reduced (Figure 3).
The localization of FITC-labeled Ch6-siMDR and
Ch12-siMDR in KB-8-5 cells was studied by confocal
fluorescent microscopy (Figure 4) in order to prove the
accumulation of the lipophilic siRNAs inside the cells.
Non-modified siRNA did not penetrate into the cells
(Figure 4A), whereas cholesterol-containing siRNAs
accumulated inside the cells effectively after 8 h of incuba-
tion (Figure 4B and C). The green signal corresponding

Nucleic Acids Research, 2012, Vol. 40, No. 5 2337
Figure 2. Cellular accumulation of FITC-labeled lipophilic siRNAs. The percentage of FITC-positive cells in the population (%) (A, C and E) and
the normalized mean value of the cell fluorescence (RFU exp/RFU contr) (B, D and F) after incubation of KB-8-5 (A and B), HepG2 (C and D) and
HEK293 (E and F) cells in the presence of corresponding siRNAs are shown. Data were obtained via flow cytometry. Fifteen thousand events
were counted in each sample. Mean values ( SD) from three independent experiments are presented.
to FITC-labeled siRNAs is located in the cytoplasm of
the cells as small discrete granules, and the granules
are concentrated around the nuclei. Consequently,
cholesterol-conjugated siRNA do accumulate in the cell
cytoplasm.
cells. These cells are capable of growing in the presence
of 300 nM vinblastine, due to the over-expression of the
MDR1 gene. The level of the MDR1 gene product–P-gp
was estimated by western blotting after 3–8 days of
incubation of cells with 5 mM conjugates in the absence
of cytostatic in order to avoid the negative selection of
living cells. The start time point (3 days) was chosen
taking into account the half-life time of P-gp: 48–72 h
(50). The level of b-actin in the same samples was used
as an internal standard. Scrambled siRNA (siScr) and its
Kinetics of MDR1 gene silencing by cholesterol-containing
siMDR
The silencing activity of the cholesterol-conjugated
siMDR was investigated using drug resistant KB-8-5

2338 Nucleic Acids Research, 2012, Vol. 40, No. 5
Ch10-siMDRs at Day 6, the activity of Ch8-siMDR was
slightly higher (P < 0.05, Ch8-siMDR versus
Ch12-siMDR). The silencing effect decreased at days
7–8 and did not exceed 15–20% for these conjugates
(Figure 5A). Ch0-siMDR was inactive. Hence, the linker
length between cholesterol residue and siRNA is critical
for the biological activity of the conjugates.
The comparison of P-gp levels after carrier-free uptake
of the conjugates with P-gp levels observed after
Lipofectamine 2000 mediated delivery of siRNA
revealed the difference in the kinetics of the silencing
process: in the first case the level of P-gp at Day 3 of
incubation of the cells with the conjugates virtually did
not change in comparison with the controls (Figure 5A),
whereas in the second case (Lipofectamine 2000 mediated
transfection) 65% reduction of the P-gp level was
observed. At Days 5 and 6, the inhibitory effects of
conventional siMDR (200 nM) transfected with
Lipofectamine 2000 was similar to the effects of Ch3-,
Ch6-, Ch8-, Ch10- and Ch12-siMDRs (5 mM) entering
into the cells in a carrier-free mode.
Figure 3. The time course of lipophilic siRNA accumulation in KB-8-5
cells. The incubation time after carrier-free transfection of cholesterol-
conjugated siMDR with hexyl (Ch6-siMDR) or dodecyl (Ch12-siMDR)
amino-linkers and siMDR conjugated to oleylamide of lithocholic acid
moiety (OlLt6-siMDR) varied from 1 to 24 h. The efficacy of cellular
uptake was estimated as the mean value of the cell fluorescence
intensity (RFU). Data were obtained via flow cytometry, in each
sample 10 000 events were counted. Mean values ( SD) from three
independent experiments are presented.
Reversion of multiple drug resistance phenotype of
cancer cells
The ability of cholesterol-containing siMDRs to reverse
MDR phenotype of KB-8-5 cells was subjected to com-
parison. After 6 days of cell incubation in the presence
of lipophilic siRNAs (1–5 mM) and 300 nM vinblastine,
a number of living cells was assayed via an MTT-test.
siScr and its lipophilic analogs were used as controls.
The obtained results (Figure 6) demonstrate that control
siRNAs (Ch0-, Ch3-, Ch6-, Ch8-, Ch10- and Ch12-siScr)
did not affect the resistance of the cell to the cytostatic.
Incubation of the cells with non-modified siMDR or with
Ch0-siMDR also did not alter the cells viability, thereby
verifying that the cholesterol-containing siRNAs are
not toxic for the cells. Quite conversely, the number of
living cells incubated with Ch6-siMDR (5 mM) decreased
to 45% as compared to the controls, whereas Ch3-siMDR
and Ch12-siMDR (5 mM) were less active: ꢃ65–70% of
the cells survived in their presence. The results on the
number of living cells at Day 6 of incubation obtained
in these experiments correlates well with the data on
P-gp suppression levels at Day 6 of incubation (Figures
5 and 6).
lipophilic analogs were used as controls of specificity.
The levels of P-gp were normalized to the levels of
b-actin for data presentation (Figure 5A and B). It was
found that the efficiency of the MDR1 gene silencing
increased when the linker length augmented from 0 to
6-10 carbon atoms and correlated with the efficacy
of cellular accumulation of the lipophilic siRNAs. The
further increase of linker length, to aminododecyl,
resulted in a decrease of the silencing activity and retard-
ation of P-gp level reduction (Figure 5A). The 40% P-gp
suppression was observed at Day 4 after addition of
Ch6-siMDR to the cells, the action of Ch8-, Ch10- and
Ch12-siMDR was less pronounced (30, 25 and 18%
reduction of P-gp level, respectively) and was detected at
the same time point, the levels of the P-gp in the cells
incubated with Ch0- and Ch3-siMDR did not differ
from the controls. The maximum levels of P-gp silencing
were
detected
in
the
cells
incubated
with
cholesterol-containing siMDRs with linkers of 3–10
carbon atoms for 5 days (60% for Ch6-, Ch8- and
Ch10-siMDRs and 50% for Ch3-siMDR) (Figure 5).
It is noteworthy that there is no statistically relevant
difference between the silencing activities of conjugates
containing linkers with 3-10 carbon atoms; whereas
Ch3-siMDR has a tendency to be less efficient than
others. Ch12-siMDR was reliably less efficient than
Ch6-, Ch8- and Ch10-siMDRs: this conjugate induced
only 30% reduction of the P-gp level after 4 days of
incubation (P < 0.02, Ch12-siMDR versus Ch6-, Ch8- or
Ch10-siMDR). At Day 6 of incubation the silencing
activities of Ch6-, Ch8- and Ch10-siMDRs were similar
(Figure 5A). In contrast, the silencing activity of
Ch12-siMDR increased to 57% and did not differ to
a reliable degree from the activity of Ch3-, Ch6- and
DISCUSSION
MDR1 gene encodes P-gp, the transmembrane pump that
effluxes a number of various compounds including
cytostatics out of the cells (51,52). Over-expression of
this gene is one of the main origins for multiple drug
resistance of the cells impeding the chemotherapy of
oncological diseases (53). Temporal silencing of MDR1
gene expression by siRNAs decreases the P-gp level and
reverses the MDR phenotype. Efficient gene silencing can
be achieved only in the case of the efficient delivery of
siRNA into the cytoplasm of the cells. However, the
negatively charged cellular membrane organized in lipid
bilayer is the main barrier on the way of negatively

Nucleic Acids Research, 2012, Vol. 40, No. 5 2339
Figure 4. Accumulation of the cholesterol-contaning siRNAs in KB-8-5 cells. The carrier-free transfection of non-modified siMDR (A), Ch6-siMDR
(B) Ch12-siMDR (C) was analyzed by confocal fluorescent microscopy at 100ꢀ magnification after 8 h of incubation. Three-channel (RGB) pictures
were obtained using staining by Rhodamine Phalloidin (R), binding to the actin filaments; FITC (G), attached to cholesterol-modified and
non-modified siRNAs and DAPI (B), intercalating in DNA.
charged siRNA to the cellular targets. Conjugation of
siRNAs to lipophilic molecules, such as cholesterol, bile
and fatty acids, is a promising approach to solving the
problem of siRNA delivery in vivo (26,27). These modifi-
cations improved the bio-distribution of siRNAs (26,37)
and significantly increased their cellular uptake (25,27,35).
The presence of the cholesterol in siRNA did not however
guarantee efficient cellular uptake and gene silencing
without the aid of the transfection agent (54). Moreover,
the data on the efficiency of carrier-free uptake and the
biological effects of lipophilic siRNAs vary significantly
in different reports where different synthetic methods
for the introduction of lipophilic moieties resulted in the
obtaining of the conjugates with different structures
(26,37,54).
influence of the type of lipophilic residue and the length
of the aliphatic amino-linker between the lipophilic
residue and the siRNA on the efficiency of the carrier-free
cellular accumulation and the silencing activity of the con-
jugates. There exist two approaches to the synthesis of
lipophilic conjugates of oligonucleotides, namely the syn-
thesis in solution (41) and the solid phase synthesis (25,27,
39,55–58). At the time of writing, the common method for
the chemical modification of siRNA at the 50-end is the
use of lipophilic compounds as phosphoramidite synthons
in solid phase chemical synthesis by the phosphoramidite
method (25,27). The H-phosphonate method is rarely used
for these purposes (55,57,58) in spite of the fact that
H-phosphonates have the advantages of stability and
readily available compounds. The developed approach
gives high coupling yields (87.5–90%) (Table 2,
Supplementary Figure S2) in the condensation of lipophilic
In this study, we posited a new synthetic scheme for the
preparation of lipophilic siRNAs and investigated the

2340 Nucleic Acids Research, 2012, Vol. 40, No. 5
Figure 5. Silencing of P-gp expression in KB-8-5 cells by non-modified or cholesterol-containing siRNAs. (A) Kinetics of P-gp level suppression
following incubation with cholesterol-modified siRNAs or transfection of siRNA with Lipofectamine 2000. The data were obtained via western
blotting carried out after 3–8 days of incubation followed by data quantitative analysis by GelPro 4.0. program (Media Cybernetics, USA). The
human b-actin protein was used as an internal standard. Data were normalized to the ratio of the P-gp/b-actin levels in untreated cells (control).
Mean values ( SD) from three independent experiments are shown. (B) Levels of P-gp in KB-8-5 cells at Day 5 post-transfection. An untreated
sample of KB-8-5 cells was taken as a control.
Figure 6. Restoration of KB-8-5 cells sensitivity to vinblastine. The number of living cells (%) in the presence of 300 nM vinblastine was estimated
after 6 days of incubation with cholesterol-conjugated siRNAs in the absence of transfection agent. siScr containing the same type of modification
were used as controls. Untreated cells are denoted as Mock.
H-phosphonates with 50-hydroxyl of polymer-bound
oligoribonucleotide in the presence of pivaloyl chloride.
The results obtained demonstrate that the efficiency of
the carrier-free cellular accumulation of lipophilic siRNAs
is dependent upon the type of lipophilic residues, the type
of the target cells and the length of the linker connecting
the lipophilic residue and siRNA strand. The most effi-
cient accumulation of siRNAs was observed in HepG2

Nucleic Acids Research, 2012, Vol. 40, No. 5 2341
cells, while the accumulation in the drug-resistant cell line
KB-8-5 was the least efficient. Among the lipophilic
siRNAs tested, the cholesterol-containing siRNAs dis-
played the best TE in all the cells that were tested.
Incubation of the cells with cholesterol-containing
siRNAs (1–5 mM) in a serum-free medium leads to the
transfection of 100% of cells in the population, siRNAs
containing oleylamide of lithocholic acid accumulated
a slightly less acutely; whereas the two other types of
siRNA, containing both lithocholic acid and oleic
alcohol residues displayed very poor cellular accumulation
properties. Thus indicating that cholesterol is the
promising lipophilic molecule provided carrier-free
transport of modified siRNA into cells.
Cholesterol is an important biogenic molecule, which
can be internalized into and effluxed out of the cell via
natural cellular mechanisms (59,60). It is well known that
the majority of cholesterol is transported throughout
the blood stream as cholesteryl esters in the form of
lipid-protein particles known as low-density lipoproteins
(LDL) (61,62). Apolipoprotein B organizes the particle
and mediates the specific binding of LDL to cell-surface
receptor proteins (61). Hence the internalization of the
cholesterol into cells occurs via receptor-mediated
endocytosis. It was suggested that LDL receptors could
facilitate the cellular uptake of the cholesterol-contaning
siRNAs in vivo via receptor-mediated endocytosis (27).
Our data correlates well with the data reported in (27),
in which was shown that the efficiency of the interaction
of lipophilic siRNA with LDL-particles depends on
the hydrophobicity of the lipophilic residue and
cholesterol-conjugated siRNAs associate with LDL very
efficiently. This fact may explain the superior cellular
accumulation of cholesterol-conjugated siRNAs in
hepatocytes (HepG2) and embryonic kidney cells
(HEK293) expressing a high level of LDL receptors
(63–65) (Figure 1C–F). However, it does not explain the
accumulation of non-modified siRNA and conjugate of
siRNA and lithocholic acid into HEK293 cells, neither
does it explain the significantly poor accumulation of the
same siRNAs in HepG2 cells (Figure 1C and E).
Furthermore, the efficient uptake of lipophilic-siRNA in
serum-free condition and the reduction of their
accumulation in the presence of serum (data not shown)
do not support the participation of LDL receptors in this
process.
In this case, two main factors could determine the efficacy
of adsorption of the conjugates on the cell surface: the
hydrophobicity of the conjugates and the distance
between negatively charged cellular membrane and
anionic siRNA. In light of this fact, more hydrophobic
siRNAs containing oleylamide of lithocholic acid accumu-
late in the cells considerably better than less hydrophobic
siRNAs containing lithocholic acid (Figure 2).
Conversely, the long aliphatic linker in the conjugate
structure provides an optimal distance between the
cellular membrane and siRNA, along with an increase of
the hydrophobicity of the conjugates. As a result, lipophil-
ic siRNAs with amino-linkers of 6-12 carbon atoms exibit
the best cellular accumulation (Figures 1–3). The substan-
tial difference between the efficiency of the cellular
accumulation of cholesterol-conjugated siRNAs and
siRNAs equipped with the lithocholic acid suggests also
the role of specific interactions with the cellular membrane
(inherent in the binding with the proteins), since the
structure of the moieties is similar, with the exception of
the presence of the only free hydroxyl group in position 3
of lithocholic acid (Figure 1).
Another important issue coming from the obtained data
is retardation in the development of the silencing effect
induced by cholesterol-conjugated siRNA following
carrier-free cellular accumulation in comparison with
that of siRNA delivered into the cells by Lipofectamine
2000 (Figure 4A). It is known that intracellular trafficking
of siRNA begins in endocytic vesicles, which subsequently
turns into early endosomes, late endosomes (pH 5–6) and
lysosome (pH 4.5) (67). siRNA must escape from the
endosomes into the cytosol, where it can be incorporated
into RISC, since siRNA molecule is extremely unstable in
lysosomes. The endosomal escape is one of the key
rate-limiting steps in the delivery process. The problem
of endosomal trapping has been intensively discussed in
literature, with respect to the conjugates of antisense
oligonucleotides and cell-penetrating peptides (68–70),
when it was found that conjugates containing only stable
chemical bonds accumulated readily in the cells, but
displays no biological activity. Cholesterol-containing
siRNA do escape from the endosomes since high levels
of the target gene silencing are observed, but the process
of their release into the cytoplasm seems to be rather
slow and less efficient than for siRNA/Lipofestamine
complexes: maximal level of P-gp silencing was detected
at Day 5 for Ch6-, Ch8-, Ch10-siRNA and at Day 2 for
siRNA/Lipofectamine 2000 complexes (Figure 5). Hence,
the conclusion can be drawn that lipophilic siRNAs are
trapped on the endosomes for some time. The obtained
data show that the increase of the length of the aliphatic
amino-linker between the cholesterol residue and siRNA
above 10 carbon atoms impedes the endosomal release of
lipophilic siRNA, retards the development of the silencing
effect and decreased the efficiency of the silencing: the
conjugate with dodecyl amino-linker was less active than
the conjugates with the linkers of 6-10 carbon atoms
(Figure 6).
An alternative hypothesis concerning the mechanism of
carrier-free uptake of lipophilic siRNA by the cells puts
forward the transmembrane protein SID-1, which was
shown to be essential for the systemic RNAi (66) and
promotes the transport of lipophilic siRNA conjugates
into the cells (27). It is assumed, that SID-1 forms
a channel for dsRNA diffusion or mediates dsRNA
uptake indirectly. However, the participation of SID-1
also does not explain the obtained data, since the level
of SID-1 in kidney cells (HEK293) is very lower whereas
the expression of this protein in liver (HepG2) is high (27).
The adsorption of the lipophilic conjugates on the cell
surface and their subsequent transport into the cells via
the mechanism of adsorption endocytosis/pinocytosis
could be the alternative option for their cellular uptake.
The results consistent with the kinetics of P-gp suppres-
sion were obtained in the experiments on KB-8-5 cell via-
bility. This cell line is characterized by the over-expression

2342 Nucleic Acids Research, 2012, Vol. 40, No. 5
of the MDR1 gene. As a result of this, the cells have the
ability to grow in the presence of 300 nM vinblastine.
Silencing of the MDR1 gene by siRNAs brings about
the death of KB-8-5 cells, at concentrations of vinblastine
that were previously tolerated. The pronounced reduction
of the number of living cells was observed at Day 6 of cells
incubation with cholesterol-containing siMDR (Figure 6).
This effect was similar to the effect observed at Day 4 after
cell transfection with siMDR/Lipophectamine 2000 (54).
Lipofectamine 2000 contains a fusogenic lipid DOPE
(41). Funding for open access charge: Siberian Branch of
Russian Academy of Sciences (Grant number 41).
Conflict of interest statement. None declared.
REFERENCES
1. Elbashir,S.M., Harborth,J., Lendeckel,W., Yalcin,A., Weber,K.
and Tuschl,T. (2001) Duplexes of 21-nucleotide RNAs mediate
RNA interference in cultured mammalian cells. Nature, 411,
494–498.
(dioleylphosphatidyl-ethanolamine)
responsible
for
2. Hammond,S.M., Bernstein,E., Beach,D. and Hannon,G.J. (2000)
An RNA-directed nuclease mediates post-transcriptional gene
silencing in Drosophila cells. Nature, 404, 293–296.
3. Zamore,P.D., Tuschl,T., Sharp,P.A. and Bartel,D.P. (2000) RNAi:
double-stranded RNA directs the ATP-dependent cleavage of
mRNA at 21 to 23 nucleotide intervals. Cell, 101, 25–33.
4. Chen,S.H. and Zhaori,G. (2010) Potential clinical applications of
siRNA technique: benefits and limitations. Eur. J. Clin. Invest.,
41, 221–232.
5. Dorsett,Y. and Tuschl,T. (2004) siRNAs: applications in
functional genomics and potential as therapeutics.
Nat. Rev. Drug Discov., 3, 318–329.
6. Lares,M.R., Rossi,J.J. and Ouellet,D.L. (2010) RNAi and small
interfering RNAs in human disease therapeutic applications.
Trends Biotechnol., 28, 570–579.
endosomal release of siRNA by facilitating the inter-
actions between the lipoplexes and the endosomal mem-
branes (67,71), but this formulation is toxic for cells and is
not stable in the presence of blood plasma, and is subse-
quently is incompatible with regards to therapeutic usage.
Unlike Lipophectamine and other commercially available
cationic lipid formulations, the conjugates of siRNA with
cholesterol that were subjected to study are stable and
non-toxic for cells. Furthermore, unlike the conjugates
of antisense oligonucleotides, they do release from the
endosome with a moderate delay and display a substantial
level of biological activity.
Thus, the structure of lipophilic siRNA was optimized
by variation of the type of lipophilic moiety and length of
the linker between this moiety and siRNA. The designed
anti-MDR1 siRNAs (Ch6-, Ch8- and Ch10-siMDR) were
found to penetrate efficiently into the cells in a carrier-free
mode, to silence the expression of P-gp and to restore the
sensitivity of drug resistant cancer cells to vinblastine.
Designed lipoophilic siRNAs are promising agents for
in vivo applications. For this reason, it is necessary to
further investigate the optimization of their structure, in
order to facilitate their endosomal release.
7. Jankovic,R., Radulovic,S. and Brankovic-Magic,M. (2009)
siRNA and miRNA for the treatment of cancer. J. BUON, 14,
S43–S49.
8. Pirollo,K.F. and Chang,E.H. (2008) Targeted delivery of small
interfering RNA: approaching effective cancer therapies.
Cancer Res., 68, 1247–1250.
9. Couto,L.B. and High,K.A. (2010) Viral vector-mediated RNA
interference. Curr. Opin. Pharmacol., 10, 534–542.
10. Mowa,M.B., Crowther,C. and Arbuthnot,P. (2010) Therapeutic
potential of adenoviral vectors for delivery of expressed RNAi
activators. Expert Opin. Drug Deliv., 7, 1373–1385.
11. Leng,Q., Woodle,M.C., Lu,P.Y. and Mixson,A.J. (2009) Advances
in systemic siRNA delivery. Drugs Future, 34, 721.
12. Posadas,I., Guerra,F.J. and Cena,V. (2010) Nonviral vectors for
the delivery of small interfering RNAs to the CNS. Nanomedicine,
5, 1219–1236.
SUPPLEMENTARY DATA
13. Shim,M.S. and Kwon,Y.J. (2010) Efficient and targeted delivery
of siRNA in vivo. FEBS J., 277, 4814–4827.
Supplementary Data are available at NAR Online:
Supplementary Methods and Supplementary Figures S1
and S2.
14. Bessis,N., GarciaCozar,F.J. and Boissier,M.C. (2004) Immune
responses to gene therapy vectors: influence on vector function
and effector mechanisms. Gene Ther., 11, S10–S17.
15. Check,E. (2002) A tragic setback. Nature, 420, 116–118.
16. Kaiser,J. (2003) Gene therapy. Seeking the cause of induced
leukemias in X-SCID trial. Science, 299, 495.
17. Sinn,P.L., Sauter,S.L. and McCray,P.B. Jr (2005) Gene therapy
progress and prospects: development of improved lentiviral and
retroviral vectors–design, biosafety, and production. Gene Ther.,
12, 1089–1098.
18. De Souza,A.T., Dai,X., Spencer,A.G., Reppen,T., Menzie,A.,
Roesch,P.L., He,Y., Caguyong,M.J., Bloomer,S., Herweijer,H.
et al. (2006) Transcriptional and phenotypic comparisons of
Ppara knockout and siRNA knockdown mice. Nucleic Acids Res.,
34, 4486–4494.
ACKNOWLEDGEMENTS
The authors acknowledge Dr V. Koval for MS analysis,
Ms A. Iglina for her assistance in the synthesis of the
conjugates, Dr R. Serikov for RP-HPLC chromatography
of the conjugates and A.V. Vladimirova for the cell
maintenance.
19. Song,E., Lee,S.K., Wang,J., Ince,N., Ouyang,N., Min,J., Chen,J.,
Shankar,P. and Lieberman,J. (2003) RNA interference targeting
Fas protects mice from fulminant hepatitis. Nat. Med., 9,
347–351.
20. Zender,L. and Kubicka,S. (2007) Suppression of apoptosis in the
liver by systemic and local delivery of small-interfering RNAs.
Methods Mol. Biol., 361, 217–226.
21. De Paula,D., Bentley,M.V. and Mahato,R.I. (2007)
Hydrophobization and bioconjugation for enhanced siRNA
delivery and targeting. RNA, 13, 431–456.
22. Jeong,J.H., Mok,H., Oh,Y.K. and Park,T.G. (2009) siRNA
conjugate delivery systems. Bioconjug. Chem., 20, 5–14.
FUNDING
The Russian Academy of Science under the programs
‘Molecular and Cell Biology’ (21.1); ‘Science to
Medicine’ (37); President’ program for support of
leading scientific schools (SS-7101.2010.4); Russian
Foundation for Basic Research (11-04-01017-a and
11-04-12095-ofi-m-2011); Ministry of Science and
Education of the Russian Federation (14.740.11.1058)
and Siberian Branch of Russian Academy of Sciences

Nucleic Acids Research, 2012, Vol. 40, No. 5 2343
23. Lv,H., Zhang,S., Wang,B., Cui,S. and Yan,J. (2006) Toxicity of
cationic lipids and cationic polymers in gene delivery.
J. Control Release, 114, 100–109.
24. Thomas,M., Kularatne,S.A., Qi,L., Kleindl,P., Leamon,C.P.,
Hansen,M.J. and Low,P.S. (2009) Ligand-targeted delivery of
small interfering RNAs to malignant cells and tissues. Ann. NY
Acad. Sci., 1175, 32–39.
25. Lorenz,C., Hadwiger,P., John,M., Vornlocher,H.P. and
Unverzagt,C. (2004) Steroid and lipid conjugates of siRNAs to
enhance cellular uptake and gene silencing in liver cells. Bioorg.
Med. Chem. Lett., 14, 4975–4977.
42. Sergeeva,Z.A., Lokhov,S.G. and Ven’yaminova,A.G. (1996)
Oligo(20-O-methylribonucleotides) and their derivatives. II.
Synthesis and properties of oligo(2’-O-methylribonucleotides)
modified with N-(2-hydroxyethyl)phenazinium and steroid groups
at the 5’-terminus. Bioorgan. Khim., 22, 916–922.
43. Bellon,L. (2001) Oligoribonucleotides with 2’-O-
(tert-butyldimethylsilyl) groups. Curr. Protoc. Nucleic Acid Chem.,
doi: 10.1002/0471142700.nc0306s01.
44. Proudnikov,D. and Mirzabekov,A. (1996) Chemical methods of
DNA and RNA fluorescent labeling. Nucleic Acids Res., 24,
4535–4542.
45. Carmichael,J., DeGraff,W.G., Gazdar,A.F., Minna,J.D. and
Mitchell,J.B. (1987) Evaluation of a tetrazolium-based
semiautomated colorimetric assay: assessment of radiosensitivity.
Cancer Res., 47, 943–946.
46. Logashenko,E.B., Vladimirova,A.V., Repkova,M.N.,
Venyaminova,A.G., Chernolovskaya,E.L. and Vlassov,V.V. (2004)
Silencing of MDR 1 gene in cancer cells by siRNA. Nucleosides
Nucleotides Nucleic Acids., 23, 861–866.
47. Volkov,A.A., Kruglova,N.S., Meschaninova,M.I.,
Venyaminova,A.G., Zenkova,M.A., Vlassov,V.V. and
Chernolovskaya,E.L. (2009) Selective protection of nuclease-
sensitive sites in siRNA prolongs silencing effect.
26. Soutschek,J., Akinc,A., Bramlage,B., Charisse,K., Constien,R.,
Donoghue,M., Elbashir,S., Geick,A., Hadwiger,P., Harborth,J.
et al. (2004) Therapeutic silencing of an endogenous gene by
systemic administration of modified siRNAs. Nature, 432,
173–178.
27. Wolfrum,C., Shi,S., Jayaprakash,K.N., Jayaraman,M., Wang,G.,
Pandey,R.K., Rajeev,K.G., Nakayama,T., Charrise,K.,
Ndungo,E.M. et al. (2007) Mechanisms and optimization of
in vivo delivery of lipophilic siRNAs. Nat. Biotechnol., 25,
1149–1157.
28. Nishina,K., Unno,T., Uno,Y., Kubodera,T., Kanouchi,T.,
Mizusawa,H. and Yokota,T. (2008) Efficient in vivo delivery of
siRNA to the liver by conjugation of alpha-tocopherol.
Mol. Ther., 16, 734–740.
29. Chu,T.C., Twu,K.Y., Ellington,A.D. and Levy,M. (2006)
Aptamer mediated siRNA delivery. Nucleic Acids Res., 34, e73.
30. Hicke,B.J. and Stephens,A.W. (2000) Escort aptamers: a delivery
service for diagnosis and therapy. J. Clin. Invest., 106, 923–928.
31. McNamara,J.O. II, Andrechek,E.R., Wang,Y., Viles,K.D.,
Rempel,R.E., Gilboa,E., Sullenger,B.A. and Giangrande,P.H.
(2006) Cell type-specific delivery of siRNAs with aptamer-siRNA
chimeras. Nat. Biotechnol., 24, 1005–1015.
32. Dassie,J.P., Liu,X.Y., Thomas,G.S., Whitaker,R.M., Thiel,K.W.,
Stockdale,K.R., Meyerholz,D.K., McCaffrey,A.P.,
McNamara,J.O. II and Giangrande,P.H. (2009) Systemic
administration of optimized aptamer-siRNA chimeras promotes
regression of PSMA-expressing tumors. Nat. Biotechnol., 27,
839–849.
33. Song,E., Zhu,P., Lee,S.K., Chowdhury,D., Kussman,S.,
Dykxhoorn,D.M., Feng,Y., Palliser,D., Weiner,D.B., Shankar,P.
et al. (2005) Antibody mediated in vivo delivery of small
interfering RNAs via cell-surface receptors. Nat. Biotechnol., 23,
709–717.
Oligonucleotides., 19, 191–202.
48. Chiu,Y.L. and Rana,T.M. (2003) siRNA function in RNAi: a 115
chemical modification analysis. RNA, 9, 1034–1048.
49. de Fougerolles,A., Vornlocher,H.P., Maraganore,J. and
Lieberman,J. (2003) Interfering with disease: a progress report on
siRNA-based therapeutics. Nat. Rev. Drug Discov., 6, 443–453.
50. Richert,N.D., Aldwin,L., Nitecki,D., Gottesman,M.M. and
Pastan,I. (1988) Stability and covalent modification of
P-glycoprotein in multidrug-resistant KB cells. Biochemistry, 27,
7607–7613.
51. Anthony,V. and Skach,W.R. (2002) Molecular mechanism of
P-glycoprotein assembly into cellular membranes.
Curr. Protein Pept. Sci., 3, 485–501.
52. Juliano,R.L. and Ling,V. (1976) A surface glycoprotein
modulating drug permeability in Chinese hamster ovary cell
mutants. Biochim. Biophys. Acta, 455, 152–162.
53. Gottesman,M.M. and Pastan,I. (1989) Clinical trials of agents
that reverse multidrug-resistance. J. Clin. Oncol., 7, 409–411.
54. Kruglova,N.S., Meshchaninova,M.I., Ven’iaminova,A.G.,
Zenkova,M.A., Vlasov,V.V. and Chernolovskaia,E.L. (2010)
Cholesterol-modified anti-MDR1 small interfering RNA: uptake
and biological activity. Mol. Biol., 44, 284–293.
34. Xia,C.F., Boado,R.J. and Pardridge,W.M. (2009)
Antibody-mediated targeting of siRNA via the human insulin
receptor using avidin-biotin technology. Mol. Pharm., 6, 747–751.
35. Chiu,Y.L., Ali,A., Chu,C.Y., Cao,H. and Rana,T.M. (2004)
Visualizing a correlation between siRNA localization, cellular
uptake, and RNAi in living cells. Chem. Biol., 11, 1165–1175.
36. Endoh,T. and Ohtsuki,T. (2009) Cellular siRNA delivery using
cell-penetrating peptides modified for endosomal escape. Adv.
Drug Deliv. Rev., 61, 704–709.
37. Moschos,S.A., Jones,S.W., Perry,M.M., Williams,A.E.,
Erjefalt,J.S., Turner,J.J., Barnes,P.J., Sproat,B.S., Gait,M.J. and
Lindsay,M.A. (2007) Lung delivery studies using siRNA
conjugated to TAT(48-60) and penetratin reveal peptide induced
reduction in gene expression and induction of innate immunity.
Bioconjug. Chem., 18, 1450–1459.
38. Muratovska,A. and Eccles,M.R. (2004) Conjugate for efficient
delivery of short interfering RNA (siRNA) into mammalian cells.
FEBS Lett., 558, 63–68.
39. MacKellar,C., Graham,D., Will,D.W., Burgess,S. and Brown,T.
(1992) Synthesis and physical properties of anti-HIV antisense
oligonucleotides bearing terminal lipophilic groups.
Nucleic Acids Res., 20, 3411–3417.
55. Krieg,A.M., Tonkinson,J., Matson,S., Zhao,Q., Saxon,M.,
Zhang,L.M., Bhanja,U., Yakubov,L. and Stein,C.A. (1993)
Modification of antisense phosphodiester oligodeoxynucleotides by
a 50-cholesteryl moiety increases cellular association and improves
efficacy. PNAS, 90, 1048–1052.
56. Manoharan,M., Tivel,K.L. and Cook,P.D. (1995) Lipidic nucleic
acids. Tetrahedron Lett., 36, 3651–3654.
57. Stein,C.A., Pal,R., DeVico,A.L., Hoke,G., Mumbauer,S.,
Kinstler,O., Sarngadharan,M.G. and Letsinger,R.L. (1991) Mode
of action of 5 -linked cholesteryl phosphorothioate
oligodeoxynucleotides in inhibiting syncytia formation and
infection by HIV-1 and HIV-2 in vitro. Biochemistry., 30,
2439–2444.
58. Venyaminova,A.G., Sergeyeva,Z.A. and Bashirova,V.Z. (1991) H-
Phosphonates of hydroxysterols as new key compounds for the
synthesis of sterol derivatives of mono-, oligonucleotides and their
analogues. Bioorgan. Khim., 17, 1294–1296.
59. Brown,M.S. and Goldstein,J.L. (1997) The SREBP pathway:
regulation of cholesterol metabolism by proteolysis of a
membrane-bound transcription factor. Cell, 89, 331–340.
60. Plosch,T., Kosters,A., Groen,A.K. and Kuipers,F. (2005) The
ABC of hepatic and intestinal cholesterol transport.
Handb. Exp. Pharmacol., 465–482.
61. Burnett,J.R. and Barrett,P.H. (2002) Apolipoprotein B
metabolism: tracer kinetics, models, and metabolic studies. Crit.
Rev. Clin. Lab. Sci., 39, 89–137.
40. Manoharan,M., Kesavan,V. and Rajeev,K.G. (2005), US Patent
20050107325 A1.
41. Rump,E.T., de Vrueh,R.L., Sliedregt,L.A., Biessen,E.A., van
Berkel,T.J. and Bijsterbosch,M.K. (1998) Preparation of
conjugates of oligodeoxynucleotides and lipid structures and their
interaction with low-density lipoprotein. Bioconjugate Chem., 9,
341–349.
62. Deckelbaum,R.J., Shipley,G.G. and Small,D.M. (1977) Structure
and interactions of lipids in human plasma low density
lipoproteins. J. Biol. Chem., 252, 744–754.

2344 Nucleic Acids Research, 2012, Vol. 40, No. 5
63. Havekes,L.M., De Wit,E.C.M. and Princen,H.M.G. (1987)
Cellular free cholesterol in Hep G2 cells is only partially available
for down-regulation of low-density-lipoprotein receptor activity.
Biochem. J., 247, 739–746.
68. Turner,J.J., Arzumanov,A.A. and Gait,M.J. (2005) Synthesis,
cellular uptake and HIV-1 Tat-dependent trans-activation
inhibition activity of oligonucleotide analogues
disulphide-conjugated to cell-penetrating peptides.
Nucleic Acids Res., 33, 27–42.
69. Turner,J.J., Fabani,M., Arzumanov,A.A., Ivanova,G. and
Gait,M.J. (2006) Targeting the HIV-1 RNA leader sequence with
synthetic oligonucleotides and siRNA: chemistry and cell delivery.
Biochim. Biophys. Acta, 1758, 290–300.
70. Turner,J.J., Ivanova,G.D., Verbeure,B., Williams,D.,
Arzumanov,A.A., Abes,S., Lebleu,B. and Gait,M.J. (2005)
Cell-penetrating peptide conjugates of peptide nucleic acids (PNA)
as inhibitors of HIV-1 Tat-dependent trans-activation in cells.
Nucleic Acids Res., 33, 6837–6849.
64. Kambouris,A.M., Roach,P.D., Calvert,G.D. and Nestel,P.J.
(1990) Retroendocytosis of high density lipoproteins by the
human hepatoma cell line, HepG2. Arteriosclerosis, 10, 582–590.
65. Marsche,G., Frank,S., Raynes,J.G., Kozarsky,K.F., Sattler,W.
and Malle,E. (2007) The lipidation status of acute-phase protein
serum amyloid A determines cholesterol mobilization via
scavenger receptor class B, type I. Biochem. J., 402, 117–124.
66. Feinberg,E.H. and Hunter,C.P. (2003) Transport of dsRNA into
cells by the transmembrane protein SID-1. Science, 301,
1545–1547.
67. Dominska,M. and Dykxhoorn,D.M. (2010) Breaking down the
barriers: siRNA delivery and endosome escape. J. Cell Sci., 123,
1183–1189.
71. Farhood,H., Serbina,N. and Huang,L. (1995) The role of dioleoyl
phosphatidylethanolamine in cationic liposome mediated gene
transfer. Biochim. Biophys. Acta., 1235, 289–295.