Nucleosides and nucleotides. Part 206: Introduction of lipophilic groups into 4'α-C-(2-aminoethyl)thymidine-containing phosphodiester oligodeoxynucleotides and thermal stabilities of the duplexes

Article abstract of DOI:10.1016/S0040-4020(00)00705-5

Synthesis and properties of the 4'α-C-(2-aminoethyl)thymidine (1)-containing oligodeoxynucleotides (ODNs), which have lipophilic groups such as palmitic acid, oleic acid, and cholesterol at the terminal of the aminoethyl linker of the compound 1, are described. The ODNs were synthesized in a DNA synthesizer by using controlled pore glasses (CPGs) having the 4'α-C-[N-(palmitoyl), N-(oleoyl), and N-(cholesteryloxycarbonyl)aminoethyl]thymidine analogs (9a, b, and c). The stability of the duplexes formed by these ODNs and a complementary DNA 15 or RNA 16 was studied by thermal denaturation. It was found that the bulky functional group such as cholesterol thermally destabilizes the DNA/DNA duplexes, but that such thermal destabilization can be offset by the effects of the aminoethyl linker of 1. Furthermore, these lipophilic groups do not largely influence the thermal stability of the DNA/RNA duplexes. (C) 2000 Elsevier Science Ltd.

Full text of DOI:10.1016/S0040-4020(00)00705-5

TETRAHEDRON
Pergamon
Tetrahedron 56 (2000) 7903±7907
Nucleosides and Nucleotides. Part 206: Introduction of
Lipophilic Groups into 40a-C-(2-Aminoethyl)thymidine-
Containing Phosphodiester Oligodeoxynucleotides and Thermal
Stabilities of the Duplexesq
*
Yoshihito Ueno, Keisuke Tomino, Isamu Sugimoto and Akira Matsuda
Graduate School of Pharmaceutical Sciences, Hokkaido University, Kita-12, Nishi-6, Kita-ku, Sapporo 060-0812, Japan
Received 21 July 2000; accepted 14 August 2000
AbstractÐSynthesis and properties of the 40a-C-(2-aminoethyl)thymidine (1)-containing oligodeoxynucleotides (ODNs), which have
lipophilic groups such as palmitic acid, oleic acid, and cholesterol at the terminal of the aminoethyl linker of the compound 1, are described.
The ODNs were synthesized in a DNA synthesizer by using controlled pore glasses (CPGs) having the 40a-C-[N-(palmitoyl), N-(oleoyl), and
N-(cholesteryloxycarbonyl)aminoethyl]thymidine analogs (9a, b, and c). The stability of the duplexes formed by these ODNs and a
complementary DNA 15 or RNA 16 was studied by thermal denaturation. It was found that the bulky functional group such as cholesterol
thermally destabilizes the DNA/DNA duplexes, but that such thermal destabilization can be offset by the effects of the aminoethyl linker of 1.
Furthermore, these lipophilic groups do not largely in¯uence the thermal stability of the DNA/RNA duplexes. q 2000 Elsevier Science Ltd.
All rights reserved.
Introduction
ODNs and their complementary RNAs were good substrates
for E. coli and human RNase H. These results indicate that
the ODNs containing 1 are good candidates for new anti-
sense molecules.
Oligodeoxynucleotides (ODNs) that are capable of inhibit-
ing cellular processes at the translational level by pairing
with mRNA are known as antisense ODNs.1 For ODNs to be
effective as antisense molecules, they need to form stable
Watson±Crick hybrids with complementary RNAs and be
suf®ciently resistant to degradation by ubiquitous nucleases.
Since unmodi®ed ODNs with natural phosphodiester
linkages are good substrates for nucleases found in cell
culture media and inside cells, many types of backbone-
modi®ed ODNs have been synthesized and used for anti-
sense studies.2
In addition to the above-mentioned requirement for anti-
sense molecules, antisense ODNs also need to be able to
penetrate cellular membranes to reach their site of action.1,4
Recently, it has been reported that the cellular uptake of
ODNs was improved by covalent attachment of lipophilic
groups such as cholesterol,5 phospholipids,6 palmitic acid,7
and vitamin E,8 which interact speci®cally with cell
membranes.
In this paper, we wish to report the synthesis of the 40a-C-
(2-aminoethyl)thymidine-containing ODNs which have
lipophilic groups such as palmitic acid, oleic acid, and
cholesterol in order to increase the membrane permeability
of the ODNs (Fig. 1). The thermal stabilities of the duplexes
composed of these ODNs and a complementary DNA or
RNA are also reported.
However, we recently found that ODNs containing 40a-C-
(2-aminoethyl)thymidine (1; Fig. 1) were signi®cantly
resistant to both snake venom phosphodiesterase (30-exo-
nuclease) and DNase I (endonuclease), and were also very
stable in human serum, even though they have natural
phosphodiester linkages.3 These ODNs also formed
thermally stable duplexes with their complementary
RNAs. Furthermore, the duplexes composed of these
q
For Part 205 in this series, see: Kodama, T.; Shuto, S.; Nomura, M.;
Matsuda, A., submitted.
Results and Discussion
We introduced these lipophilic functional groups at the
terminal of the aminoethyl linker of 1 that is positioned at
the 30-end of the strand, since nucleoside analogs with func-
tional groups can be readily attached to the solid supports
Keywords: antisense oligodeoxynucleotides; aminoethyl linker; lipophilic
groups; melting temperature.
* Corresponding author. Tel.: 181-11-706-3228; fax: 181-11-706-4980;
e-mail: matuda@pharm.hokudai.ac.jp
0040±4020/00/$ - see front matter q 2000 Elsevier Science Ltd. All rights reserved.
PII: S0040-4020(00)00705-5

7904
Y. Ueno et al. / Tetrahedron 56 (2000) 7903±7907
Figure 1. Structures of the modi®ed nucleoside analogs.
before DNA synthesis. Furthermore, we expected that such
bulky functional groups at their 30-ends of the strands will
enhance the nuclease-resistant property of the ODNs against
30-exonuclease and in serum.1,9 40a-C-(Azidoethyl)-30-O-
(tert-butyldimethylsilyl)-50-O-(dimethoxytrityl)thymidine
(5), which was prepared by the procedure reported
previously,3 was hydrogenated to produce the 40a-C-
aminoethyl derivative 6 in 95% yield (Scheme 1). Palmitic
acid and oleic acid were introduced into 6 in the presence of
and 9c, which are reacted with controlled pore glass
(CPG) to give a solid support containing 9a (35 mmol/g),
9b (41 mmol/g), and 9c (36 mmol/g), respectively.
Three 21-mer ODNs10 having 2, 3, or 4 at their 30-ends were
synthesized in a DNA synthesizer by using the CPGs
containing 9a, 9b, or 9c (Table 1). The fully protected
ODNs (each 1 mmol scale) linked to the solid supports
were treated with concentrated NH4OH at 558C for 16 h.
Puri®cation by C-18 column chromatography followed by
detritylation with 80% CH3CO2H gave ODNs 12, 13, and 14
in 84, 36, and 64 A260 units, respectively. These ODNs were
analyzed by matrix-assisted laser desorption/ionization
time-of-¯ight mass spectrometry (MALDI-TOF/MS), and
the observed molecular weights supported their structures.
1-ethyl-3-(3-dimethylaminopropyl)carbodiimide
hydro-
chloride (WSCI) to yield the N-functionalized nucleosides
7a and 7b in 80 and 83% yield, respectively. On the other
hand, cholesterol was converted into its O-carbonylimida-
zolide, which was then reacted with 6 to give the choles-
terol-modi®ed nucleoside 7c in 70% yield. After
desilylation of 7a, 7b, and 7c by TBAF, 8a, 8b, and 8c
were modi®ed to the corresponding 30-succinates 9a, 9b,
The stability of the duplexes formed by these ODNs and a
complementary DNA 15 or RNA 16 was studied by thermal
denaturation. One transition was observed in the melting
pro®le of each duplex. Melting temperatures (Tms) are listed
in Table 2. When the DNA 15 was used as a complementary
strand, the Tm for the unmodi®ed ODN 10 was 35.68C
whereas the Tm for the ODN 11 containing the ®ve mole-
cules of 1 was 43.18C. The Tms of the ODNs 12, 13, or 14
containing the nucleoside analogs 2, 3, or 4 at their 30-ends
were lower than that for the ODN 11, but still greater than
that of the unmodi®ed ODN 10. The order of the Tm values
for the ODNs with the lipophilic groups was as follows: the
ODN 12 containing 2 (Tmˆ42.28C).the ODN 13 contain-
ing 3 (Tmˆ41.08C).the ODN 14 containing 4 (Tmˆ37.78C).
On the other hand, when the RNA 16 was used as a comple-
mentary strand, the Tms for the unmodi®ed ODN 10 and the
ODN 11 containing the ®ve molecules of 1 were 44.3 and
44.08C, respectively. Although the ODN 14 containing 4
only slightly decreased the thermal stability of the ODN/
RNA duplex as compared with the ODNs 10 and 11, the Tms
Table 1. Sequences of oligonucleotides
No.
10
11
12
13
14
15
16
50-d[TAATTCATATTTTTTTAACAT]-30
50-d[1AAT1CATATT1TTT1AACA1]-30
50-d[1AAT1CATATT1TTT1AACA2]-30
50-d[1AAT1CATATT1TTT1AACA3]-30
50-d[1AAT1CATATT1TTT1AACA4]-30
50-d[ATGTTAAAAAAATATGAATTA]-30
50-r[AUGUUAAAAAAAUAUGAAUUA]-30
Scheme 1. Conditions: (a) H2, Pd±C, MeOH, 95%; (b) palmitic acid or
oleic acid, WSCI, CH2Cl2, 80% for 7a and 83% for 7b; (c) cholesterol,
N,N0-carbonyldiimidazole, CH2Cl2, 70% for 7c; (d) TBAF, THF, 94% for
8a, 88% for 8b, and 75% for 8c; (e) succinic anhydride, DMAP, pyridine,
98% for 9a, 83% for 9b, and 97% for 9c.

Y. Ueno et al. / Tetrahedron 56 (2000) 7903±7907
7905
Table 2. Hybridization data (Experimental conditions are described in the
Experimental)
of these ODNs as antisense ODNs, especially the membrane
permeability of ODNs containing 2, 3, and 4, are currently
being studied.
Tm (8C)
ODN
ODN/DNAa
ODN/RNAb
Experimental
10
11
12
13
14
35.6
43.1
42.2
41.0
37.7
44.3
44.0
44.4
44.5
42.5
General remarks
NMR spectra were recorded at 270 or 400 MHz (1H), and
are reported in ppm down®eld from TMS. J values are given
in Hertz. Mass spectra were obtained by fast atom bombard-
ment (FAB) method. Thin-layer chromatography was done
on Merck coated plates 60F254. The silica gel used for
column chromatography was Merck silica gel 5715.
a The complementary DNA: 15.
b The complementary RNA: 16.
for the ODNs containing 2 and 3 were almost identical to
those for the ODNs 10 and 11.
40-C-(2-Aminoethyl)-30-O-(tert-butyldimethylsilyl)-50-O-
(dimethoxytrityl)thymidine (6). A mixture of 40-C-
(azidoethyl)-30-O-(tert-butyldimethylsilyl)-50-O-(dimethoxy-
trityl)thymidine (5)3 (790 mg, 1.09 mmol) and Pd±C (10%,
70 mg) in MeOH (20 mL) was stirred under atmospheric
pressure of H2 at room temperature. After 24 h, the catalyst
was ®ltered off with Celite. The ®ltrate was evaporated
under reduced pressure and dried in vacuo to give 6
(726 mg, 95% as a white foam): FAB-MS m/z 702
(MH1); 1H NMR (270 MHz, CDCl3) d 7.57 (s, 1H),
7.37±6.77 (m, 13H), 6.20 (t, Jˆ6.6 Hz, 1H), 4.60 (t,
Jˆ6.6 Hz, 1H), 3.75 (s, 6H), 3.32 (d, Jˆ9.9 Hz, 1H), 3.05
(d, Jˆ9.9 Hz, 1H), 2.72 (m, 1H), 2.58 (m, 1H), 2.29 (dt,
Jˆ6.6, 13.9 Hz, 1H), 2.46 (dt, Jˆ6.6, 13.9 Hz, 1H), 1.79 (m,
1H), 1.40 (m, 1H), 1.40 (s, 3H), 0.81 (s, 9H), 20.04 (s, 3H),
20.07 (s, 3H). HRMS (FAB) calcd for C39H52O7N3Si
(MH1): 702.3580. Found: 702.3562.
The ODNs 12 or 13 containing the nucleoside analogs 2 or 3
at their 30-ends slightly decreased the thermal stability of the
ODN/DNA duplexes as compared with the ODN 11. The
ODN 11 has the ®ve molecules of the aminoethyl linker,
which enhances the thermal stability of the ODN/DNA
duplex, whereas the ODNs 12 or 13 have the four molecules
of the aminoethyl linker. Thus, the Tm values for the ODNs
12 or 13 seemed to re¯ect the difference of the number of
the aminoethyl linker. On the other hand, the ODN 14
containing the nucleoside analog 4 largely reduced the
thermal stability of the ODN/DNA duplex as compared
with the ODN 11. The 40-position of the sugar moiety of
the nucleoside is located at the edge of the minor groove in a
DNA/DNA duplex. The minor groove of the DNA/DNA
duplex is narrower and deeper than its major groove.12
Thus, the bulky functional group such as cholesterol may
not be well accommodated in the minor groove of the
duplex. However, it is worthwhile to note that the Tm
value for the ODN 14 is still greater than that for the
unmodi®ed ODN 10. It was found that thermal destabiliza-
tion of the DNA/DNA duplex by such bulky functional
group can be adequately compensated by the effect of the
aminoethyl linker of 1.
30-O-(tert-Butyldimethylsilyl)-50-O-(dimethoxytrityl)-40-
C-[N-(palmitoyl)aminoethyl]thymidine (7a). A mixture
of
6
(100 mg, 014 mmol), palmitic acid (54 mg,
0.21 mmol), and 1-ethyl-3-(3-dimethylaminopropyl) carbo-
diimide hydrochloride (WSCI) (40 mg, 0.21 mmol) in
CH2Cl2 (2 mL) was stirred at room temperature. After 1 h,
the mixture was diluted with CHCl3. The organic layer was
washed with aqueous NaHCO3 (saturated) and brine, dried
(Na2SO4), and concentrated. The residue was puri®ed by
column chromatography (SiO2, 40±60% EtOAc in hexane)
to give 7a (106 mg, 80% as a white foam): FAB-MS m/z 962
On the other hand, when the RNA was used as a comple-
mentary strand, the ODN 14 containing 4 only slightly
decreased the thermal stability of the ODN/RNA duplex.
It is known that the minor groove of A-type duplexes
(DNA/RNA and RNA/RNA duplexes) is shallower and
¯atter than that of DNA/DNA duplexes.12 Thus, the bulky
functional group introduced at the terminal of the
aminoethyl linker of 1 may not largely in¯uence the thermal
stability of the DNA/RNA duplex.
1
(MNa1); H NMR (400 MHz, CDCl3) d 8.25 (s, 1H), 7.26
(s, 1H), 7.40±6.82 (m, 13H), 6.26 (t, Jˆ6.6 Hz, 1H), 5.78 (t,
Jˆ5.1 Hz, 1H), 4.55 (dd, Jˆ6.1, 4.6 Hz, 1H), 3.79 (s, 6H),
3.40 (m, 1H), 3.34 (d, Jˆ10.3 Hz, 1H), 3.19 (m, 1H), 3.12
(d, Jˆ10.3 Hz, 1H), 2.25 (m, 2H), 2.06 (t, Jˆ7.6 Hz, 2H),
1.90 (dt, Jˆ7.3, 14.4 Hz, 1H), 1.63 (m, 3H), 1.53 (m, 2H),
1.48 (s, 3H), 1.25 (m, 22H), 0.88 (t, Jˆ7.3 Hz, 3H), 0.85 (s,
9H), 0.04 (s, 3H), 20.03 (s, 3H). HRMS (FAB) calcd for
C55H81O8N3SiNa (MNa1): 962.5691. Found: 962.5690.
Anal. Calcd for C55H81O8N3Si´1/5H2O: C, 69.98; H, 8.69;
N, 4.45. Found: C, 69.83; H, 8.73; N, 4.37.
Conclusions
In this paper, we reported the synthesis of the 40a-C-(2-
aminoethyl)thymidine-containing phosphodiester ODNs
that have lipophilic groups at the terminal of the aminoethyl
linker of 1. It was found that the bulky functional group
introduced thermally destabilizes the DNA/DNA duplex,
but that such thermal destabilization can be offset by the
effects of the aminoethyl linker of 1. Furthermore, it was
found that the functional groups do not largely in¯uence the
thermal stability of the DNA/RNA duplexes. Applications
30-O-(tert-Butyldimethylsilyl)-50-O-(dimethoxytrityl)-40-
C-[N-(oleoyl)aminoethyl]thymidine (7b). Compound 6
(100 mg, 0.14 mmol) was oleoylated by using oleic acid
(67 mL, 0.21 mmol) as described in the preparation of 7a
to give 7b (112 mg, 83% as a white foam): FAB-MS m/z
1
988 (MNa1); H NMR (400 MHz, CDCl3) d 8.21 (s, 1H),

7906
Y. Ueno et al. / Tetrahedron 56 (2000) 7903±7907
7.49 (s, 1H), 7.36±6.79 (m, 13H), 6.22 (t, Jˆ6.6 Hz, 1H),
5.74 (m, 1H), 5.30 (m, 2H), 4.55 (dd, Jˆ6.4, 4.6 Hz, 1H),
3.76 (s, 6H), 3.35 (m, 1H), 3.30 (d, Jˆ10.3 Hz, 1H), 3.17
(m, 1H), 3.09 (d, Jˆ10.3 Hz, 1H), 2.22 (m, 2H), 2.03 (t,
Jˆ7.6 Hz, 2H), 1.96 (m, 4H), 1.84 (d, Jˆ7.3, 14.7 Hz, 1H),
1.58 (m, 3H), 1.51 (m, 2H), 1.44 (s, 3H), 1.23 (m, 18H), 0.84
(t, Jˆ7.3 Hz, 3H), 0.81 (s, 9H), 0.04 (s, 3H), 20.06 (s, 3H).
HRMS (FAB) calcd for C57H83O8N3SiNa (MNa1):
988.5847. Found: 988.5836. Anal. Calcd for
C57H83O8N3Si: C, 70.84; H, 8.66; N, 4.35. Found: C,
70.60; H, 8.74; N, 4.24.
50-O-(Dimethoxytrityl)-40-C-[N-(cholesteryloxycarbonyl)-
aminoethyl]thymidine (8c). Compound 7c (141 mg,
0.13 mmol) was de-silylated as described in the preparation
of 8a to give 8c (95 mg, 75% as a white foam): FAB-MS m/z
1
1000 (MH1); H NMR (400 MHz, CDCl3) d 8.31 (s, 1H),
7.52 (s, 1H), 7.40±6.83 (m, 13H), 6.34 (t, Jˆ6.6 Hz, 1H),
5.36 (m, 1H), 4.92 (t, Jˆ5.6 Hz, 1H), 4.51 (m, 1H), 4.45 (m,
1H), 3.79 (s, 6H), 3.24 (m, 3H), 3.11 (m, 2H), 2.39 (m, 2H),
1.93 (m, 2H), 2.24±0.67 (m, 44H). HRMS (FAB) calcd for
C61H82O9N3 (MH1): 1000.6051. Found: 1000.6060.
50-O-(Dimethoxytrityl)-40-C-[N-(palmitoyl)aminoethyl]-
30-O-(succinyl)thymidine (9a). A mixture of 8a (57 mg,
69 mmol), succinic anhydride (21 mg, 0.21 mmol), and
DMAP (3 mg, 21 mmol) in pyridine (1 mL) was stirred at
room temperature. After two days, the mixture was parti-
tioned between EtOAc and H2O. The organic layer was
washed with aqueous NaHCO3 (saturated) and brine, dried
(Na2SO4), and evaporated under reduced pressure. The resi-
due was puri®ed by column chromatography (SiO2, 2±10%
MeOH in CHCl3) to give 9a (63 mg, 98% as a white foam):
FAB-MS m/z 925 (M1); 1H NMR (400 MHz, CDCl3) d 7.86
(s, 1H), 7.38±6.80 (m, 13H), 6.27 (m, 1H), 6.17 (m, 1H),
5.48 (m, 1H), 3.76 (s, 6H), 3.23 (m, 3H), 3.11 (m, 1H), 2.60
(m, 4H), 2.48 (m, 1H), 2.41 (m, 1H), 2.10 (m, 2H), 1.91 (m,
1H), 1.79 (m, 1H), 1.53 (m, 2H), 1.43 (s, 3H), 1.24 (m,
24H), 0.88 (t, Jˆ7.1 Hz, 3H). HRMS (FAB) calcd for
C53H71O11N3 (M1): 925.5089. Found: 925.5060.
30-O-(tert-Butyldimethylsilyl)-50-O-(dimethoxytrityl)-40-
C-[N-(cholesteryloxycarbonyl)aminoethyl]thymidine (7c).
A mixture of cholesterol (165 mg, 0.43 mmol) and N,N0-
carbonyldiimidazole (69 mg, 0.43 mmol) in CH2Cl2
(3 mL) was stirred at room temperature. After 1 h, 6
(150 mg, 0.21 mmol) was added to the mixture, and the
whole was stirred at room temperature. After two days,
the mixture was concentrated in vacuo. The residue was
puri®ed by column chromatography (SiO2, 25±40%
EtOAc in hexane) to give 7c (162 mg, 70% as a white
1
foam): FAB-MS m/z 1136 (MNa1); H NMR (400 MHz,
CDCl3) d 8.09 (s, 1H), 7.57 (s, 1H), 7.42±6.82 (m, 13H),
6.23 (t, Jˆ6.6 Hz, 1H), 5.35 (m, 1H), 4.84 (m, 1H), 4.57 (dd,
Jˆ6.4, 4.4 Hz, 1H), 4.45 (m, 1H), 3.79 (s, 6H), 3.34 (d,
Jˆ10.0 Hz, 1H), 3.20 (m, 2H), 3.11 (d, Jˆ10.0 Hz, 1H),
2.30 (m, 2H), 1.88 (m, 1H), 1.65 (m, 1H), 2.24±0.67 (m,
53H), 0.04 (s, 3H), 20.03 (s, 3H). HRMS (FAB) calcd for
C67H95O9N3SiNa (MNa1): 1136.6736. Found: 1136.6750.
50-O-(Dimethoxytrityl)-40-C-[N-(oleoyl)aminoethyl]-30-
O-(succinyl)thymidine (9b). Compound 8b (64 mg;
75 mmol) was succinylated as described in the preparation
of 9a to give 9b (59 mg, 83% as a white foam): FAB-MS
m/z 951 (M1); 1H NMR (400 MHz, CDCl3) d 7.47 (s, 1H),
7.38±6.81 (m, 13H), 6.29 (m, 1H), 6.06 (m, 1H), 5.53 (m,
1H), 5.33 (m, 2H), 3.78 (s, 6H), 3.25 (m, 3H), 3.14 (m, 1H),
2.64 (m, 4H), 2.49 (m, 1H), 2.41 (m, 1H), 2.10 (m, 2H), 1.99
(m, 4H), 1.90 (m, 1H), 1.71 (m, 1H), 1.54 (m, 2H), 1.42 (s,
3H), 1.26 (m, 20H), 0.87 (t, Jˆ6.6 Hz, 3H). HRMS (FAB)
calcd for C55H73O11N3 (M1): 951.5245. Found: 951.5232.
50-O-(Dimethoxytrityl)-40-C-[N-(palmitoyl)aminoethyl]-
thymidine (8a). A mixture of 7a (88 mg, 90 mmol) and
TBAF (1 M in THF, 0.19 mL, 0.19 mmol) in THF (1 mL)
was stirred at room temperature. After 30 min, the mixture
was concentrated in vacuo. The residue was puri®ed by
column chromatography (SiO2, 60±100% EtOAc in hexane)
to give 8a (70 mg, 94% as a white foam): FAB-MS m/z 825
1
(M1); H NMR (400 MHz, CDCl3) d 8.29 (s, 1H), 7.52 (s,
1H), 7.40±6.82 (m, 13H), 6.37 (t, Jˆ6.6 Hz, 1H), 5.89 (t,
Jˆ5.4 Hz, 1H), 4.52 (m, 1H), 3.95 (d, Jˆ3.17 Hz, 1H), 3.80
(s, 6H), 3.27 (m, 1H), 3.24 (d, Jˆ10.3 Hz, 1H), 3.19 (d,
Jˆ10.3 Hz, 1H), 3.00 (m, 1H), 2.40 (m, 2H), 2.12 (t,
Jˆ7.3 Hz, 1H), 1.91 (m, 2H), 1.64 (m, 2H), 1.56 (m, 2H),
1.50 (s, 3H), 1.25 (m, 22H), 0.88 (t, Jˆ7.1 Hz, 3H). HRMS
(FAB) calcd for C49H67O8N3: 825.4928 (M1). Found:
825.4948. Anal. Calcd for C49H67O8N3: C, 71.24; H, 8.17;
N, 5.09. Found: C, 71.21; H, 8.22; N, 5.06.
50-O-(Dimethoxytrityl)-40-C-[N-(cholesteryloxycarbonyl)-
aminoethyl]-30-O-(succinyl)thymidine (9c). Compound 8c
(64 mg, 75 mmol) was succinylated as described in the
preparation of 9a to give 9c (86 mg, 97% as a white
1
foam): FAB-MS m/z 1100 (MH1); H NMR (400 MHz,
CDCl3) d 8.62 (s, 1H), 7.94 (s, 1H), 7.38±6.81 (m, 13H),
6.27 (m, 1H), 5.94 (m, 1H), 5.33 (m, 1H), 4.42 (m, 1H), 3.77
(s, 6H), 3.25 (m, 3H), 3.10 (m, 2H), 2.62 (m, 2H), 2.41 (m,
2H), 1.87 (m, 2H), 1.83 (m, 1H), 2.31±0.67 (m, 44H).
HRMS (FAB) calcd for C65H86O12N3 (MH1): 1100.6211.
Found: 1100.6230.
50-O-(Dimethoxytrityl)-40-C-[N-(oleoyl)aminoethyl]thymi-
dine (8b). Compound 7b (96 mg, 0.10 mmol) was de-silyl-
ated as described in the preparation of 8a to give 8b (75 mg,
1
88% as a white foam): FAB-MS m/z 851 (M1); H NMR
(400 MHz, CDCl3) d 8.18 (s, 1H), 7.47 (s, 1H), 7.40±6.82
(m, 13H), 6.37 (t, Jˆ6.6 Hz, 1H), 5.87 (dd, Jˆ5.9, 5.4 Hz,
1H), 5.34 (m, 2H), 4.52 (m, 1H), 3.89 (m, 1H), 3.79 (s, 6H),
3.25 (m, 1H), 3.24 (d, Jˆ10.0 Hz, 1H), 3.19 (d, Jˆ10.0 Hz,
1H), 2.99 (m, 1H), 2.40 (m, 2H), 2.12 (t, Jˆ7.3 Hz, 2H),
1.99 (m, 4H), 1.89 (m, 2H), 1.58 (m, 4H), 1.51 (s, 3H), 1.27
(m, 18H), 0.88 (t, Jˆ7.1 Hz, 3H). HRMS (FAB) calcd for
C51H69O8N3: 851.5085 (M1). Found: 851.5100. Anal. Calcd
for C51H69O8N3Si´1/4H2O: C, 71.51; H, 8.22; N, 4.84.
Found: C, 71.52; H, 8.22; N, 4.91.
Synthesis of the controlled pore glass support with 9a, 9b
or 9c
Aminopropyl controlled pore glass (158 mg, 14.2 mmol,
89.8 mmol/g, CPG Inc.) was added to a solution of 9a
(53 mg, 57 mmol) and WSCI (11 mg, 57 mmol) in DMF
(1 mL), and the mixture was kept at room temperature for
two days. After the resin was washed with pyridine, 1 mL of
a capping solution (0.1 M DMAP in pyridine/Ac2Oˆ9:1)
was added, and the whole was kept at room temperature

Y. Ueno et al. / Tetrahedron 56 (2000) 7903±7907
7907
for 14 h. The resin was washed with EtOH and acetone, and
was dried under vacuum. The amount of loaded nucleoside
9a to the solid support is 35 mmol/g from the calculation of
released dimethoxytrityl cation by a solution of 70% HClO4/
EtOH (3:2, v/v). In a similar manner, the solid supports with
9b and 9c were obtained in 41 and 36 mmol/g of loading
amounts.
Scienti®c Research on Priority Areas (08281105) from the
Ministry of Education, Science, Sports and Culture of Japan
and a Grant from the `Research for the Future' Program of
the Japan Society for the Promotion of Science (JSPS-
RFTF97I00301).
Synthesis of ODNs
References
ODNs were synthesized on a DNA/RNA synthesizer
(Applied Biosystem Model 392) by the phosphoramidite
method. The fully protected ODNs were then deblocked
and puri®ed by the same procedure as for the puri®cation
of normal ODNs.13 That is, each ODN linked to the resin
was treated with concentrated NH4OH at 558C for 16 h, and
the released ODN protected by a DMTr group at the 50-end
was chromatographed on a C-18 silica gel column
(1£10 cm, Waters) with a linear gradient of MeCN from
10 to 80% in 0.1 M TEAA buffer (pH 7.0). The fractions
were concentrated, and the residue was treated with aqueous
80% AcOH at room temperature for 20 min, then the solu-
tion was concentrated, and the residue was coevaporated
with H2O. The residue was dissolved in H2O and the solu-
tion was washed with Et2O, then the H2O layer was concen-
trated to give a deprotected ODN 12 (84), 13 (36), and 14
(64). The yields are indicated in parentheses as OD units at
260 nm starting from 1 mmol scale.
1. (a) Uhlmann, E.; Peyman, A. Chem. Rev. 1990, 90, 544±584.
(b) Milligan, J. F.; Matteucci, M. D.; Martin, J. C. J. Med. Chem.
1993, 36, 1923±1937. (c) Branch, A. D. Trends Biochem. Sci.
1998, 23, 45±50. (d) Stein, C. A. Nat. Biotechnol. 1999, 17, 209.
2. Mesmaker, A. D.; Altmann, K.-H.; Waldner, A.; Wendeborn, S.
Curr. Opin. Struct. Biol. 1995, 5, 343±355.
3. (a) Kanazaki, M.; Ueno, Y.; Shuto, S.; Matsuda, A. J. Am.
Chem. Soc. 2000, 122, 2422±2432. (b) Ueno, Y.; Kanazaki, M.;
Shuto, S.; Matsuda, A. Nucleosides Nucleotides 1999, 18,
1401±1402. (c) Ueno, Y.; Nagasawa, Y.; Sugimoto, I.; Kojima,
N.; Kanazaki, N.; Shuto, S.; Matsuda, A. J. Org. Chem. 1998, 63,
1660±1667.
4. Rojanasakul, Y. Adv. Drug Delivery Revs. 1996, 18, 115±131.
5. (a) Letsinger, R. L.; Zhang, G.; Sun, D. K.; Ikeuchi, T.; Sarin,
P. S. Proc. Natl. Acad. Sci. USA 1989, 86, 6553±6556. (b) Stein,
C. A.; Pal, R.; DeVico, A. L.; Hoke, G.; Mumbauer, S.; Kinstler,
O.; Sarngadharan, M. G.; Letsinger, R. L. Biochemistry 1991, 30,
2439±2444. (c) Mackellar, C.; Graham, D.; Will, D. W.; Burgess,
S.; Brown, T. Nucleic Acids Res. 1992, 20, 3411±3417. (d) Krieg,
A. M.; Tonkinson, J.; Matson, S.; Zhau, Q.; Saxon, M.; Zhang,
L.-M.; Bhanja, U.; Yakubov, L.; Stein, C. A. Proc. Natl. Acad. Sci.
USA 1993, 90, 1048±1052. (e) Godard, G.; Boutorine, A. S.;
Matrix-assisted laser desorption/ionization time-of-¯ight
mass spectrometry
Spectra were obtained on a Voyager Elite re¯ection time-of-
¯ight mass spectrometry (PerSeptive Biosystems, Inc.,
 Á
Saison-Behmoaras, E.; Helene, C. Eur. J. Biochem. 1995, 232,
404±410. (f) Vinogradov, S. V.; Suzdaltseva, Y. G.; Kabanov,
A. V. Bioconjugate Chem. 1996, 7, 3±6.
Framingham, MA) equipped with
a nitrogen laser
(337 nm, 3-ns pulse) in the negative ion mode. 3-Hydroxy-
picolinic acid (HPA), dissolved in 50% MeCN to give a
saturated solution at room temperature, was used as the
matrix. Time-to-mass conversion was achieved by calibra-
tion by using the peak representing the C1 cation of the
charged derivative to be analyzed. ODN 12: calculated
mass, 6808.5; observed mass, 6808.2. ODN 13: calculated
mass, 6834.5; observed mass, 6835.9. ODN 14: calculated
mass, 6982.6; observed mass, 6982.4.
6. (a) Shea, R. G.; Marsters, J. C.; Bischofberger, N. Nucleic Acids
Res. 1990, 18, 3777±3783. (b) Vinogradov, S. V.; Doan, T. L.;
 Á
Helene, C. Tetrahedron Lett. 1995, 36, 2493±2496.
7. (a) Polushin, N. N.; Cohen, J. S. Nucleic Acids Res. 1994, 22,
5492±5496. (b) Mishra, R. K.; Moreau, C.; Ramazeilles, C.;
Â
Moreau, S.; Bonnet, J.; Toulme, J.-J. Biochim. Biophys. Acta
1995, 1264, 229±237.
8. Will, D. W.; Brown, T. Tetrahedron Lett. 1992, 33, 2729±2732.
9. (a) Zendegui, J. G.; Vasquez, K. M.; Tinsley, J. H.; Kessler,
D. J.; Hogan, M. E. Nucleic Acids Res. 1992, 20, 307±314.
(b) Gamper, H. B.; Reed, M. W.; Cox, T.; Virosco, J. S.; Adams,
A. D.; Gall, A. A.; Scholler, J. K.; Meyer Jr, R. B. Nucleic Acids
Res. 1993, 21, 145±150.
Thermal denaturation
Each solution contains each ODN (3 mM) and the comple-
mentary DNA 15 (3 mM) in 0.01 M sodium cacodylate
containing 0.01 M NaCl or RNA 16 (3 mM) in 0.01 M
sodium cacodylate containing 0.1 M NaCl. The solution
containing each ODN was heated at 908C for 5 min, then
cooled gradually to an appropriate temperature, and used for
the thermal denaturation studies. Thermal-induced transi-
tions of each mixture were monitored at 260 nm on a
Perkin±Elmer Lambda2S. Sample temperature was
increased 0.58C/min.
10. The sequence of these ODNs is complementary to the region
of the translation initiation site of mRNA of the iron±sulfur (Ip)
subunit of succinate dehydrogenase in Plasmodium falciparum
mitochondria.11
11. Takeo, S.; Kokaze, A.; Ng, C. S.; Mizuchi, D.; Watanabe, J.;
Tanabe, K.; Kojima, S.; Kita, K. Mol. Biochem. Parasitol. 2000,
107, 191±205.
12. Saenger, W. Principle of Nucleic Acid Structure, Springer:
New York, 1984.
13. Oligonucleotides Synthesis: a Practical Approach, Gait, M. J.,
Ed.; IRL Press: Oxford, UK, 1984.
Acknowledgements
This work was supported in part by a grant-in-aid for