3-(1,1-dioxo-2H-(1,2,4)-benzothiadiazin-3-yl)-4-hydroxy-2(1H)-quinolinones, potent inhibitors of hepatitis C virus RNA-dependent RNA polymerase

Article abstract of DOI:10.1021/jm050855s

Recently, we disclosed a new class of HCV polymerase inhibitors discovered through high-throughput screening (HTS) of the GlaxoSmithKline proprietary compound collection. This interesting class of 3-(1,1-dioxo-2H-1,2,4- benzothiadiazin-3-yl)-4-hydroxy-2(1H)-quinolinones potently inhibits HCV polymerase enzymatic activity and inhibits the ability of the subgenomic HCV replicon to replicate in Huh-7 cells. This report will focus on the structure-activity relationships (SAR) of substituents on the quinolinone ring, culminating in the discovery of 1-(2-cyclopropylethyl)-3-(1,1-dioxo-2H-1,2,4- benzothiadiazin-3-yl)-6-fluoro-4-hydroxy-2(1H)-quinolinone (130), an inhibitor with excellent potency in biochemical and cellular assays possessing attractive molecular properties for advancement as a clinical candidate. The potential for development and safety assessment profile of compound 130 will also be discussed.

Full text of DOI:10.1021/jm050855s

J. Med. Chem. 2006, 49, 971-983
971
3-(1,1-Dioxo-2H-(1,2,4)-benzothiadiazin-3-yl)-4-hydroxy-2(1H)-quinolinones, Potent Inhibitors of
Hepatitis C Virus RNA-Dependent RNA Polymerase
Rosanna Tedesco,*,† Antony N. Shaw,† Ramesh Bambal,‡ Deping Chai,† Nestor O. Concha,§ Michael G. Darcy,†
Dashyant Dhanak,† Duke M. Fitch,† Adam Gates,| Warren G. Gerhardt,† Dina L. Halegoua,† Chao Han,‡ Glenn A. Hofmann,
Victor K. Johnston,| Arun C. Kaura,† Nannan Liu,† Richard M. Keenan,† Juili Lin-Goerke,| Robert T. Sarisky,|
Kenneth J. Wiggall,† Michael N. Zimmerman,† and Kevin J. Duffy†
Departments of Medicinal Chemistry and Drug Metabolism and Pharmacokinetics, The Musculoskeletal, Microbial and ProliferatiVe Diseases
Center of Excellence for Drug DiscoVery, Computational, Analytical and Structural Sciences (CASS), the Department of Virology,
The Metabolic and Viral Diseases Center of Excellence for Drug DiscoVery, and DiscoVery Research, GlaxoSmithKline Pharmaceuticals,
CollegeVille, PennsylVania 19426
ReceiVed August 29, 2005
Recently, we disclosed a new class of HCV polymerase inhibitors discovered through high-throughput
screening (HTS) of the GlaxoSmithKline proprietary compound collection. This interesting class of 3-(1,1-
dioxo-2H-1,2,4-benzothiadiazin-3-yl)-4-hydroxy-2(1H)-quinolinones potently inhibits HCV polymerase
enzymatic activity and inhibits the ability of the subgenomic HCV replicon to replicate in Huh-7 cells. This
report will focus on the structure-activity relationships (SAR) of substituents on the quinolinone ring,
culminating in the discovery of 1-(2-cyclopropylethyl)-3-(1,1-dioxo-2H-1,2,4-benzothiadiazin-3-yl)-6-fluoro-
4-hydroxy-2(1H)-quinolinone (130), an inhibitor with excellent potency in biochemical and cellular assays
possessing attractive molecular properties for advancement as a clinical candidate. The potential for
development and safety assessment profile of compound 130 will also be discussed.
Introduction
HCV is a single-stranded, positive-sense RNA virus of the
FlaViViridae family. Its 9,600 nucleotide genome encodes for
a single polyprotein of approximately 3,000 amino acids, which
is processed by host cell and viral proteases into three structural
proteins (C, E1 and E2) and six nonstructural proteins (NS2,
NS3, NS4A, NS4B, NS5A, and NS5B).4 Much research has
been devoted to the discovery of inhibitors of NS3,5 both
protease and helicase components, and more recently, of NS5B,
an RNA-dependent RNA polymerase (RdRp) and several classes
of potent inhibitors have now been described.6,7 The HCV
polymerase is essential for viral replication and growth,8,9 it has
been structurally characterized,10-12 and there are no known
mammalian RdRps. Thus, it represents an excellent target for
the development of anti-HCV agents.
High-Throughput Screening. In search of novel HCV
polymerase inhibitors, a robust RdRp scintillation-proximity
assay (SPA) using N-terminal-truncated ∆21-NS5B was devel-
oped as described previously.13 HTS of the GlaxoSmithKline
proprietary compound collection resulted in the identification
of 1-butyl-3-(1,1-dioxo-2H-1,2,4-benzothiadiazin-3-yl)-4-hy-
droxy-2(1H)-quinolinone (1) as a potent HCV polymerase
inhibitor. The biochemical characterization of this 4-hydroxy-
2(1H)-quinolinone was previously described,13 wherein it was
shown that compound 1 did not interact with nucleic acid, it
was noncompetitive with respect to GTP, and it reduced
subgenomic viral-RNA replication in an Huh-7 cell-based HCV
replicon system. In the same report, we also disclosed compound
2, a more potent polymerase inhibitor. In this report we will
Hepatitis C virus (HCV) was first characterized in 1989 as
the major cause of non-A and non-B hepatitis infections.1
Despite the routine screening of blood transfusion supplies since
1992, the number of new hepatitis C infections in 2001 was
estimated at 25,000-35,000 cases in the United States. Ac-
cording to WHO figures, greater than 2% of the world
population is chronically infected with HCV. The majority
(approximately 80%) of these infections will develop into
chronic hepatitis and a significant percentage (approximately
20%) will progress to cirrhosis, with many advancing to
hepatocellular carcinoma.2,3 The heterogeneity of the hepatitis
C virus has hampered the development of a vaccine, and thus
far, there is no universally effective therapy for all HCV
genotypes. The standard of care for HCV infection is combina-
tion treatment using pegylated interferon-R and ribavirin, a
nonspecific, antiviral nucleoside analogue. The rate of success
obtained with this treatment is highly dependent upon the HCV
genotype with which patients are infected, with a greater rate
[70-80% sustained viral response (SVR) after 24 weeks of
treatment] observed for those affected with genotypes 2 and 3.
However for genotype 1, which accounts for approximately 70%
of all HCV infections worldwide, the SVR is around 40-45%
after 48 weeks of therapy.4 In addition, the typical side effects
associated with the use of interferons, which include headaches,
nausea, fatigue, and other neuropsychological disorders, make
patient compliance difficult, especially considering that people
affected by the virus often proceed asymptomatically for several
decades.
* Corresponding author. Tel: (610) 917-4715. Fax: (610) 917-4206.
E-mail: Rosanna_2_Tedesco@gsk.com.
† Department of Medicinal Chemistry.
‡ Department of Drug Metabolism and Pharmacokinetics.
§ Computational, Analytical and Structural Sciences.
| Department of Virology.
Discovery Research.
10.1021/jm050855s CCC: $33.50 © 2006 American Chemical Society
Published on Web 01/10/2006

972 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3
Tedesco et al.
Scheme 1a
Scheme 3a
a Conditions: (a) ∆; (b) 10% aq KOH, reflux.
detail the structure-activity relationships (SAR) of the quinoline
portion of compound 1 and how modifications of this screening
hit led to the discovery of an inhibitor of viral replication with
potency in the low nanomolar range.
Chemistry. The synthesis of 1-alkyl-3-(1,1-dioxo-2H-1,2,4-
benzothiadiazin-3-yl)-4-hydroxy-2(1H)-quinolinones (I) was
first reported by Ukrainets et al.14 via the thermal condensation
of ethyl 1-alkyl-4-hydroxy-2-oxoquinoline-3-carboxylates 3 with
2-aminobenzenesulfonamide 4, followed by base-catalyzed
heterocyclization (Scheme 1). For the synthesis of compounds
1, 2, 10-111, 129, and 130, a more robust methodology was
developed via the base-catalyzed condensation of an ap-
propriately substituted 1-alkyl-2H-3,1-benzoxazine-2,4(1H)-
dione 7 and ethyl (1,1-dioxo-2H-1,2,4-benzothiadiazin-3-yl)-
acetate 9 (Scheme 2).15 Ester 9 was obtained by reaction of
2-aminobenzensulfonamide 4 with ethyl malonyl chloride,
followed by base-catalyzed cyclization, as previously described
by Ukrainets et al.16 In the absence of a commercial source of
the required substituted isatoic anhydrides 6, the latter were
prepared from the corresponding anthranilic acids 5, using
phosgene or a phosgene equivalent. The N-1-substituent was
installed by the reaction of 6 with an alkyl halide in the presence
of sodium hydride or with the appropriate alcohol under
Mitsunobu conditions.17 Alternatively, in some cases the N-
substituted 2H-3,1-benzoxazine-2,4(1H)-dione 7 was obtained
by first coupling the 2-bromobenzoic acid 8 with the requisite
alkylamine in the presence of Cu(II), followed by heterocy-
clization with phosgene (Scheme 2). Finally, elaboration of the
6-amino derivative 85 and 6-hydroxy derivative 86 via alkylation
or acylation afforded compounds 90-102 (not illustrated).
To probe the structural requirements for inhibition by the
heterocyclic 3-(1,1-dioxo-2H-1,2,4-benzothiadiazin-3-yl)-4-hy-
a Conditions: (a) (1) LDA, THF; (2) solid CO2; (b) 6 N HCl, reflux; (c)
concd H2SO4, MeOH; (d) NaH, i-AmBr, DMF; (e) NaOH, MeOH/H2O;
(f) SOCl2, reflux; (g) 4, Et3N, DMAP, THF/DMF; (h) (1) 10% NaOH, 1,4-
dioxane, reflux; (2) 3 N HCl.
droxy-2(1H)-quinolinone template, a series of modified ana-
logues (Figure 1) was prepared through a variety of synthetic
approaches. Thus, the 4-deshydroxy analogue 115 was prepared
(Scheme 3) from 2-chloroquinoline (112) via acyl chloride 114,
which was coupled with 2-aminobenzenesulfonamide 4, fol-
lowed by cyclization.
The synthesis of the 2-desoxy compound 119 was ac-
complished starting from aniline (116), as shown in Scheme 4.
Reductive amination with isovaleraldehyde, followed by con-
densation with diethyl ethoxymethylenemalonate and then PPA-
mediated cyclization afforded intermediate ester 117. Conversion
of 117 to acyl chloride 118, followed by coupling with
2-aminobenzenesulfonamide 4 and cyclization, gave the desired
product.
Thermal condensation of carbamate 12118 (Scheme 5) with
the substituted isatoic anhydride 7 provided quinazolinedione
122, in which the C-3 of inhibitor 2 was replaced by nitrogen.19
The 4-N-methylbenzothiadiazine derivative 125 was synthesized
from N-methylaniline (123, Scheme 6) by treatment with
chlorosulfonyl isocyanate followed by acidic hydrolysis and then
amide formation with ethyl malonyl chloride. Subsequent
heterocyclization afforded ester 124, which was condensed with
1-(3-methylbutyl)-2H-3,1-benzoxazine-2,4(1H)-dione to give
Scheme 2a,b
a Conditions: (a) COCl2, Na2CO3, toluene or (Cl3CO)2CO, K2CO3, EtOAc; (b) NaH, R1X, DMF or R1OH, Ph3P, DIAD; (c) R1NH2, CuBr2, K2CO3, THF
b
or DMF; (d) (1) ClCOCH2CO2Et, pyridine, CH2Cl2; (2) 10% aq Na2CO3; (e) NaH, THF, reflux, then AcOH, reflux or DBU, DMF. For the definition of
R1, R5, R6, R7, and R8, see Tables 1-7.

Potent Inhibitors of HCV RNA Polymerase
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3 973
Scheme 4a
Table 1. Inhibition of HCV NS5B Polymerase Activity by N-1 Alkyl
and Cycloalkyl-alkyl Derivatives of 3-(1,1-Dioxo-2H-(1,2,4)-
benzothiadiazin-3-yl)-4-hydroxy-2(1H)-quinolinones
a Conditions: (a) isovaleraldehyde, NaBH(OAc)3, CH2Cl2; (b) (CO2Et)2-
CdCHOEt; (c) PPA, ∆; (d) NaOH, EtOH/H2O; (e) SOCl2, reflux; (f) 4,
Et3N, DMAP, THF/DMF; (g) (1) 10% NaOH, 1,4-dioxane, reflux; (2) 3 N
HCl.
Scheme 5a
a Conditions: (a) toluene, reflux; (b) 7 (R1 ) -(CH2)2CH(CH3)2), sealed
tube, 250 °C.
of radioactivity at varying inhibitor concentrations generated
inhibition curves.13
Scheme 6a
The ability of NS5B to polymerize GTP under these assay
conditions proves to be very sensitive to the nature of the
quinoline N-1 substituent of the 3-(1,1-dioxo-2H-1,2,4-ben-
zothiadiazin-3-yl)-4-hydroxy-2-(1H)-quinolinones (Table 1).
Compounds containing no substitution or only a short alkyl
chain (1-3 carbon atoms, Table 1, compounds 10-13) are weak
inhibitors of NS5B. However, increasing the length of the linear
alkyl chain to four or five carbon atoms results in a significant
increase in inhibitory potency (Table 1, compounds 1 and 16).
Most promisingly, incorporation of a branched alkyl chain
containing between five and six carbons results in a further
increase in activity, as observed when comparing n-butyl
analogue 1 (IC50 ) 200 nM) with 3-methylbutyl analogue 2
a Conditions: (a) ClSO2NCO, AlCl3, EtNO2; (b) 50% H2SO4, ∆; (c) (1)
ClCOCH2CO2Et, pyridine, CHCl3; (2) POCl3, reflux; (d) 7 (R1
-(CH2)2CH(CH3)2), NaH, 1,4-dioxane, reflux, then AcOH, reflux.
)
125. Derivatization of compound 2 via treatment with tosyl
chloride, followed by aqueous ammonia, provided 4-amino-
quinoline 126. 2,4(1H,3H)-Quinazolinone 128, wherein the
sulfonyl group of the benzothiadiazine is replaced with a
carbonyl group, was synthesized in a straightforward manner
following the procedure described in Scheme 2, substituting
2-aminobenzensulfonamide 4 with 2-aminobenzamide.
(IC50 ) 32 nM) and 3,3-dimethylbutyl compound 15 (IC50
)
21 nM). Incorporation of unsaturation into the N-1 chain
provides several alkenes and alkynes (compounds 18-23),
which are generally weaker inhibitors of NS5B, whereas
cycloalkyl-substituted variants are fairly well tolerated. In
particular, within the homologous series of C3 to C6 cycloalkyl-
methyl derivatives (compounds 24 and 27-29), the cyclobu-
tylmethyl derivative 27 is the most potent (IC50 ) 49 nM), with
activity dropping off as the ring size increases. Further branching
by substitution on the cyclopropyl ring of compound 24 (IC50
) 78 nM) with a methyl group (compound 25, mixture of
isomers) results in a modest 2-fold increase in potency.
However, an even greater increase in potency (6-fold) is seen
Results and Discussion
Inhibition of HCV NS5B Polymerase Activity. The primary
testing of compounds was performed using a scintillation
proximity assay to measure the incorporation of radio-labeled
33P-GTP into a biotinylated oligo-G13 primer in the presence
of a poly-C template catalyzed by 10 nM of HCV NS5B
(genotype 1b, J4 strain, ∆21 construct). After immobilization
of the primer to streptavidin-coated Flash-plates, quantification

974 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3
Tedesco et al.
Table 3. Inhibition of HCV NS5B Polymerase Activity by N-1
Aromatic, Alkyl-aromatic, and Alkyl-heteroaromatic Derivatives of
3-(1,1-Dioxo-2H-(1,2,4)-benzothiadiazin-3-yl)-4-hydroxy-2(1H)-
quinolinones
Table 2. Inhibition of HCV NS5B Polymerase Activity by Compounds
Containing Polar Functionalities in the N-1 Alkyl Substituent of
3-(1,1-Dioxo-2H-(1,2,4)-benzothiadiazin-3-yl)-4-hydroxy-2(1H)-
quinolinones
ously alluded, incorporation of polar functionality, such as in
the homologous series of hydroxylalkyl analogues (compounds
42-44) or aminoalkyl derivative 47, is poorly tolerated.
Therefore, despite the presence of amino acid side chains
containing potential hydrogen-bonding functionality in the N-1
binding pocket (vide infra), all attempts to increase potency by
engaging hydrophilic interactions with such residues or the
peptide backbone amide functionality have been unfruitful to
date.
upon homologation to the cyclopropylethyl derivative 26 (IC50
) 13 nM), which is among the most active compounds within
this series.
Substitution of the N-1 alkyl substituent with halogens or
polar functionality generally proves to be deleterious to the
inhibitory activity of the 3-(1,1-dioxo-2H-1,2,4-benzothiadiazin-
3-yl)-4-hydroxy-2(1H)-quinolinones, even with simple isosteric
modifications (Table 2, compounds 30-53). Relative to n-butyl
analogue 1, the 1-methoxyethyl derivative 35 is much less active,
while the more lipophilic (methylthio)ethyl compound 39 is
slightly more potent. Similarly, incorporation of a basic nitrogen
into the side chain of i-amyl derivative 2 (IC50 ) 32 nM)
provides 1-(N,N-dimethylamino)ethyl derivative 45, a compound
devoid of activity. Interestingly, while the activity of methoxy-
ethyl compound 35 is reduced 4-fold relative to the n-butyl
analogue 1, branched methoxypropyl compound 36 (IC50 ) 82
nM) is nearly equipotent to its isosteric all-carbon analogue 17
(IC50 ) 65 nM). Replacement of protons by fluorine atoms is
tolerated; for example, compounds 30 and 31 have similar
activities to their parent, nonfluorinated alkyl derivatives.
Interestingly, addition of a relatively large bromine atom near
the terminus of the butyl chain (compound 32) results in an
inhibitor of equivalent potency to the unsubstituted butyl
compound 1. Cyanopropyl derivative 33 (IC50 ) 172 nM) is
equipotent with its isosteric alkyne 23 (IC50 ) 179 nM);
however, the slightly larger, homologated cyanobutyl compound
34 is somewhat less potent (IC50 ) 750 nM). The two isomeric
(tetrahydrofuranyl)methyl derivatives 37 and 38 are less active
than the corresponding cyclopentane derivative 28. As previ-
Aromatic and heteroaromatic substituents at N-1 are generally
tolerated, provided that they are separated from the heterocyclic
template by a one-carbon atom spacer (Table 3). For example,
while the N-phenyl (54), N-phenethyl (56), and the N-phenyl-
propyl (57) compounds are essentially inactive at the concentra-
tions tested, the N-benzyl compound 55 displays excellent
inhibitory activity. In general, m-substituted benzyl derivatives
are more effective inhibitors than the corresponding p- and
o-derivatives. An approximate 30-fold increase in activity is
observed when a nitro group is moved from the 4-position on
an N-1 benzyl substituent (compound 61, IC50 ) 2442 nM) to
the 3-position (compound 60, IC50 ) 81 nM). The 4-bromoben-
zyl derivative 63 (IC50 ) 95 nM) is about 2.5-fold less active
than 3-bromobenzyl derivative 64 (IC50 ) 36 nM), and overall,
bromo substitution is better tolerated than nitro substitution.
Although a relatively weak inhibitor, the 2-cyanobenzyl deriva-
tive 58 (IC50 ) 780 nM) is considerably more active than the
2-nitrobenzyl derivative 59 (IC50 >10,000 nM). Among the
isomeric series of (pyridinyl)methyl analogues (compounds 65-
67), the pyridine-4-yl compound 67 is the most active (IC50
)
61 nM). The smaller 3-(furanyl)methyl substituent (derivative
68) also appears to be well-accommodated in the N-1 binding
pocket (IC50 ) 27 nM). As in the case of the N-phenethyl
derivative 56, the two isomeric (thienyl)ethyl derivatives 69 and
70 are poor inhibitors of NS5B activity.

Potent Inhibitors of HCV RNA Polymerase
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3 975
Table 4. Inhibition of HCV NS5B Polymerase Activity by C-5
Substituted Derivatives of 3-(1,1-Dioxo-2H-(1,2,4)-benzothiadiazin-
3-yl)-4-hydroxy-2(1H)-quinolinones
Table 6. Inhibition of HCV NS5B Polymerase Activity by C-7
Substituted Derivatives of 3-(1,1-Dioxo-2H-(1,2,4)-benzothiadiazin-
3-yl)-4-hydroxy-2(1H)-quinolinones
RdRp
IC50 (nM)
RdRp
IC50 (nM)
RdRp
IC50 (nM)
RdRp
IC50 (nM)
entry
R5
compd
R5
entry
R7
entry
R7
2
72
73
74
H
F
Cl
Br
32
340
33
75
76
77
78
CH3
Ph
OH
NO2
206
144
47
2
103
104
105
H
F
Cl
Br
32
554
>10,000
>10,000
106
107
108
109
NO2
CO2Et
CO2H
>10,000
>10,000
>10,000
>10,000
105
338
CHdCHCONH2
Table 5. Inhibition of HCV NS5B Polymerase Activity by C-6
Substituted Derivatives of 3-(1,1-Dioxo-2H-(1,2,4)-benzothiadiazin-
3-yl)-4-hydroxy-2(1H)-quinolinones
Table 7. Inhibition of HCV NS5B Polymerase Activity by C-8
Substituted Derivatives of 3-(1,1-Dioxo-2H-(1,2,4)-
benzothiadiazin-3-yl)-4-hydroxy-2(1H)-quinolinones
RdRp
IC50 (nM) entry
RdRp
IC50 (nM)
RdRp
IC50 (nM)
entry
R6
R6
OCH2CN
entry
R8
2
79
80
81
82
83
84
85
86
87
88
89
90
H
F
Cl
Br
I
32
20
43
205
>10,000
47
455
91
92
93
94
95
96
34
2
110a
111
H
F
NO2
32
90
>10,000
O(CH2)3CN
4,328
1,741
24
21
115
O(CH2)2OCH3
OCH2CONH2
NHCH2CO2H
NHCH2CO2Et
a (R1 ) 2-cyclopropylethyl).
CH3
NO2
97a NH(CH2)2OH
48
Substitution at C-7 is very poorly tolerated, as illustrated by
the small set of analogues in Table 6 (compounds 103-109).
With the exception of fluorine derivative 103 (IC50 ) 554 nM),
all the other derivatives have an IC50 > 10,000 nM. Due to
unfavorable steric interactions between C-8 and N-1, substitution
at the C-8 position proved to be synthetically challenging;
however, the two synthetically accessible derivatives 110 and
111 do not show any improvement in activity (Table 7).
Speculation over the importance of the hydrogen-bonding
atoms in the pyridinone and thiadiazinedioxide portions of these
heterocyclic inhibitors led to the investigation of a series of
derivatives aimed at probing these interactions (Figure 1).
Removal of either the 4-hydroxy group (compound 115) or
2-oxo atom (compound 119) or replacement of the 4-hydroxy
group with a 4-amino group (compound 126) affords compounds
with very little inhibitory activity at the concentrations tested
(IC50s > 10,000 nM). Changing the 4-hydroxyquinolin-2-one
heterocycle to a quinazolin-2,3-dione (compound 122), which
replaces the quinoline C-3 with nitrogen in order to lock the
C-4 functionality into the keto tautomer, also affords a derivative
with lower potency against NS5B (IC50 ) 9,940 nM). Modifica-
tion of the benzothiadiazine portion of the molecule, including
excision of the sulfone completely to give a benzimidazole 127
or replacement with a carbonyl group to give a quinazolinone
128, also results in poorly active NS5B inhibitors. Similarly,
analogue 125, possessing a methyl substitution on the ben-
zothiadiazine 4-nitrogen atom, is approximately 75-fold less
active (IC50 ) 2,430 nM) than parent compound 2 (IC50 ) 32
nM). It is therefore apparent that each of these transformations
remove or change some critical binding element with the NS5B
enzyme binding pocket, either by losing the capacity to bind to
NH2
OH
OCH3
CO2Et
CO2H
62
198
23
>10,000
1,035
98
99
100
101
102
NHCOCH3
NHCOCH2CH(CH3)2 6,503
NHCOCH2N(CH3)2
NHCO-cyclopentyl
NHCOPh
>10,000
5,805
973
4,235
OCH2Ph 3,950
a (R1 ) 3,3-diMe-Bu).
The structure-activity relationships for varying the substit-
uents on the quinolinone ring are also in good agreement with
those predicted by analysis of an inhibitor-bound crystal
structure (vide infra), wherein the tight fit of the quinolinone
portion of the molecule into the binding pocket allows for
substitution to be tolerated only at positions C-5 and C-6 (Figure
2b). Small- to medium-sized groups are tolerated at C-5,
although little improvement in NS5B inhibition is observed with
these derivatives (compounds 72-78, Table 4). A wider range
of substituents is tolerated at C-6, with most of the C-6
derivatized compounds demonstrating potent NS5B inhibitory
activity (Table 5). Short linear chains bearing polar substituents
are particularly active (i.e., entries 91, 94, 95, and 97, IC50
)
34, 24, 21, and 48 nM, respectively). Smaller groups (polar or
nonpolar) are also quite potent. In addition to their outstanding
enzymatic activities, the 6-fluoro (79, IC50 ) 20 nM), 6-methyl
(83, IC50 ) 47 nM), and 6-amino (85, IC50 ) 62 nM) analogues
are also among the most active compounds with respect to their
ability to inhibit cellular replication of subgenomic HCV RNA
in Huh-7 cells (vide infra). 6-Amido substituents are poorly
tolerated, as can be seen from the relatively poor activity of
N-acyl analogues (98-102) when compared with the N-alkyl-
substituted compounds 95-97.

976 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3
Tedesco et al.
Figure 1. Core modifications.
Figure 2. (a) Close up of the NS5B-compound 2 complex binding site. (b) Gaussian-Connolly surface for the protein binding site (red, exposed
surface; green, hydrophobic; blue, hydrophilic).
water molecules present in the binding complex (vide infra) or
by losing the degree of planarity (through intramolecular
hydrogen bonding) necessary to stabilize the requisite binding
conformation.
of the unsubstituted parent compound 2, while addition of small
substituents at the C-6 position generally results in equivalent
or modestly improved potency in the Replicon assay; 6-fluoro
(compound 79), 6-methyl (compound 83), and 6-amino (com-
pound 85) substitutions all demonstrate improved activity over
unsubstituted compound 2. Interestingly, substitution at the C-6
position with a variety of polar functionalities provides a series
of generally potent cellular inhibitors, seemingly irrespective
of the functionality present (compounds 91, 94, 95, and 97).
The relatively poor correlation between enzyme inhibition and
inhibition of cellular replication for such analogues could
potentially be attributed to the relative abilities of the inhibitors
to penetrate the cellular membrane of Huh-7 cells. For example,
carboxylic acid 95 shows excellent levels of enzyme inhibition
but an unexpectedly poor cellular effect (NS5B IC50 ) 21 nM,
cellular EC50 ) 2,492 nM). This result is in contrast with that
for the corresponding ethyl ester (compound 96), which shows
a more robust inhibition of cellular replication despite possessing
Inhibition of Subgenomic Replication in Huh-7 Cells.
Since no direct antiviral cell culture system for HCV has been
developed to date,20 the ability of 3-(1,1-dioxo-2H-1,2,4-
benzothiadiazin-3-yl)-4-hydroxy-2(1H)-quinolinones to inhibit
HCV RNA replication intracellularly was evaluated in the
subgenomic replicon system.13 In this assay, carried out in Huh-7
cells, several compounds show low micromolar to low nano-
molar inhibition of viral RNA replication. In general, biochemi-
cal potency correlates well with activity in the replicon assay,
provided poor cell membrane permeability and/or decreased
solubility under the assay conditions does not preclude the
determination of an accurate cellular EC50.
A list of selected compounds and their cellular EC50s and
EC90s is shown in Table 8. Comparing EC50 values, the 1-(3-
methyl)butyl analogue 2 and the 1-butyl derivative 1 possess
very similar levels of inhibitory activity in the replicon assay,
despite the 6-fold difference in their enzyme inhibition. The
1-(2-cyclopropyl)ethyl analogue 26 is approximately 3-fold more
active than compounds 1 and 2 in the Replicon system. A small
increase in potency of less than 2-fold over compounds 1 and
2 was observed with 1-(cyclobutyl)methyl substitution (Table
8; compound 27). Substitution at the N-1 position with (aryl)-
methyl groups (compounds 54 and 68) was not as advantageous,
resulting in poor inhibitors of cellular replication. The 5-fluoro
substituted analogue 72 possesses cellular activity similar to that
a decreased ability to inhibit enzymatic activity (NS5B IC50
)
115 nM, cellular EC50 ) 265 nM). It is most important to
ascertain whether the improved potency effects of independently
optimized substituents are additive or synergistic when incor-
porated into the same inhibitor. Indeed, for the series of 3-(1,1-
dioxo-2H-1,2,4-benzothiadiazin-3-yl)-4-hydroxy-2(1H)-quino-
linones under investigation, this is the case, as can be seen from
Table 8; compound 129 and, more remarkably, compound 130,
in which the combination of a preferred C-6 substituent (fluoro)
with the N-1 (2-cyclopropyl)ethyl moiety results in an inhibitor

Potent Inhibitors of HCV RNA Polymerase
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3 977
Table 8. Huh-7 Replicon Cell Data for Selected Compounds
Table 9. Selectivity Data for 130
biochemical assay
IC50 (nM)
NS5B type 1a
NS5B type 1b
NS5B type 2a
NS5B type 3a
GBV-B
DNA pol-R
DNA pol-â
49
10
13
60% inhibn @10 µM
>50,000
>50,000
>50,000
exploration of these latter positions will be described in a future
publication) are amenable to substitution. This inhibitor binding
site is outlined by residues from the palm, finger, and thumb
domains and resides in a region distinct from other reported
non-nucleoside allosteric inhibitors that bind mainly in the thumb
domain.7 Also shown in Figure 2a are some highly conserved,
tightly bound water molecules, mediating the hydrogen-bond
interactions of the inhibitor with the protein, consistently present
in all the structures determined. Another key feature observed
in all of the structures determined is an apparent edge-to-face
π-interaction between Phe193 and the benzo portion of the
benzothiadiazine ring system. Although a small molecule X-ray
crystal structure of compound 2 had shown coplanarity between
the quinolone and benzothiadiazine rings (data not shown), due
primarily to internal hydrogen bonds, experimental electron
density indicates that the inhibitor molecule is distorted away
from planarity when bound to NS5B.
Activity against Other HCV Genotypes and Other Poly-
merases. Hepatitis C virus is a rapidly mutating virus and has
been classified into six major genotypes (1-6) with numerous
subtypes. Testing of one of our most potent inhibitors, 1-(2-
cyclopropylethyl)-3-(1,1-dioxo-1,4-dihydrobenzo[1,2,4]thiadiazin-
3-yl)-6-fluoro-4-hydroxy-1-quinolin-2-one (130), against a se-
lection of NS5B genotypes demonstrates that compound 130 is
a potent inhibitor of genotypes 1a, 1b, and 2a (Table 9), while
inhibition of NS5B from genotype 3a is greatly attenuated. The
reasons for the attenuation of activity against genotype 3a are
unclear at this time. Analysis of the sequences of several type
3a polymerases reveals no obvious mutations in close proximity
to the observed binding site for our benzothiadiazine inhibitors.
Compound 130 is also highly selective for HCV NS5B versus
other viral polymerases (e.g., the closely related GBV-B, IC50
> 50,000 nM) and against human DNA polymerases (IC50
50,000 nM) (Table 9).
>
Animal Pharmacokinetics and Safety Assessment. To
establish the suitability of our benzothiadiazine inhibitors as
potential clinical candidates, the pharmacokinetic profiles of
selected compounds were determined in Sprague-Dawley rats,
beagle dogs, and cynomolgous monkeys. The results of these
experiments are summarized in Table 10. All four benzothia-
diazine inhibitors have moderate plasma half-lives, low plasma
clearances, and very good oral bioavailabity (g35%) in all three
species. All of the benzothiadiazines tested have relatively low
volumes of distribution along with high binding to human
plasma proteins (generally >99%). These factors raise concerns
over how well the compounds will distribute into the liver
tissues, the site of action for the targeted disease. Analyses of
liver tissue drug concentrations following oral administration
in rats indicate that the compounds distribute well into hepatic
tissue, with g2-5-fold liver tissue to plasma concentration ratios
for the four compounds tested.
with excellent enzymatic and cellular potencies (NS5B IC50
10 nM, cellular EC50 ) 38 nM).
)
Crystal Structure of 2 Bound to NS5B. The cocrystal
structures of NS5B (BK strain, ∆21 construct) with a number
of inhibitors from the 3-(1,1-dioxo-2H-1,2,4-benzothiadiazin-
3-yl)-4-hydroxy-2(1H)-quinolinone class have been determined.
In general, these inhibitors fit tightly into a single, high
occupancy site in the palm/thumb domain interface.10 A close
up of the NS5B/compound 2 complex is shown in Figure 2a,b,
from which it can be appreciated how, due to the tight fit, only
certain positions on the inhibitor are open for further substitution.
Specifically, the C-5 and C-6 positions of the quinolinone ring,
consistent with the observed SAR (vide supra), along with the
C-7 and C-8 positions of the benzothiadiazine ring (the full
Due to the favorable combination of high oral bioavailability
and low intrinsic clearance, compound 130 shows high exposure
upon oral suspension dosing in rats, dogs, and monkeys [oral
DNAUC (µg‚h/mL/mg/kg) ) 5.3, 20, and 23.5, respectively].

978 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3
Tedesco et al.
Table 10. Mean Pharmacokinetic Parameter Values for Compound 2, 26, 83, and 130 Following Single Dose Administration to Rats, Dogs, and
Monkeys
dose iv/po
(mg/kg)
Cmax
(ng/mL)
T1/2
(min)
CL
Vdss
(L/kg)
oral
F (%)
entry
species
(mL/min/kg)
2
rat
dog
rat
dog
monkey
rat
dog
monkey
rat
dog
0.8/5.8
0.8/1.8
1.3/7.7
0.9/1.1
1.8/1.6
1.2/3.7
0.9/3.6
1.0/3.6
1.3/3.4
0.8/4.0
0.8/4.0
1,096 ( 484
2,230
6,460 ( 1231
5,398
36.4 ( 7.9
859
112.4 ( 9.9
289
10.1 ( 3.2
0.50
1.7 ( 0.3
0.47
0.44 ( 0.01
0.53
0.25 ( 0.05
0.15
70 ( 7
89
26
83
78 ( 19
∼100
>40
7,917
81
1.73
0.19
1,217 ( 251
1,958 ( 261
2,136 ( 471
4,141 ( 980
4,455 ( 565
5,437 ( 1568
317.5 ( 69.7
543.5 ( 290.1
49.7 ( 10.8
182.2 ( 7.5
103.5 ( 7.2
96.9 ( 0.7
1.65 ( 0.50
1.09 ( 0.30
5.32 ( 1.60
1.4 ( 0.4
0.86 ( 0.05
0.76 ( 0.2
0.81 ( 0.11
0.72 ( 0.28
0.34 ( 0.09
0.36 ( 0.10
0.15 ( 0.01
0.11 ( 0.03
∼100
>50
>53
130
44 ( 11
>35
monkey
>53
Table 11. Protein Binding Studies in Huh-7 Replicon Cell Assay for
Compound 130
low-nanomolar replicon activity. The lack of a practical animal
model for HCV infection, however, does not allow speculation
about the relevance of the replicon system as a means to discover
potent clinical HCV polymerase inhibitors, and only clinical
data will provide insight on the matter.
cellular assay
replicon (type 1b)
EC50 (nM)
38
replicon + 45 mg/mL HSA
13,000
180
>20,000
replicon + 1 mg/mL AAG
Experimental Section
replicon + 45 mg/mL HSA, 1 mg/mL AAG
Chemistry. General Methods. Starting materials were either
commercially available or prepared as reported previously in the
literature, unless otherwise noted. Solvents and reagents were used
without further purification, except THF, which was distilled from
sodium/benzophenone. Reactions were monitored by TLC, per-
formed on silica gel glass plates containing F-254 indicator
(Kieselgel 60 F254, Merck or Uniplate Silica Gel GF, Analtech).
Visualization on TLC was achieved by UV light, potassium
permanganate, or iodine indicator. Column chromatography was
performed with Merck 40-63 mesh silica gel. Reaction tempera-
tures refer to the oil bath or cold bath temperature. 1H NMR spectra
were recorded on a Bruker ARX-300 or Avance-400 instrument.
Chemical shifts (δ) are reported in ppm downfield from internal
TMS standard or from solvent references. Mass spectra were
recorded on a ScieX API 150EX electrospray LC-mass spectrom-
eter. Melting points were determined on a Melt-Temp apparatus
and are uncorrected. Elemental analyses were performed by QTI
Technologies, Inc., Whitehouse, NJ. Compound 127 was purchased
from AsInEx.
General Method for the Alkylation of Isatoic Anhydride.
Method A: 1-(3-Methylbutyl)-2H-3,1-benzoxazine-2,4(1H)-di-
one [7, R ) (CH2)2CH(CH3)2]. Sodium hydride (6.4 g of a 60%
suspension in mineral oil, 159.4 mmol) was washed with hexanes,
dried under a N2 stream, and suspended in dimethylacetamide (240
mL). Isatoic anhydride (20.0 g, 122.6 mmol) was then added
portionwise, followed by i-amyl iodide (24.0 mL, 183.9 mmol).
The reaction mixture was then stirred for 20 h at room temperature,
poured into ice/water, and stirred for 40 min. The precipitate which
formed was collected, washed with water, and dried in a vacuum
oven to give the title compound as a tan powder (25.0 g; 58%):
1H NMR (CDCl3) δ 8.17 (dd, J ) 7.9, 1.6 Hz, 1H), 7.76 (ddd, J
) 8.4, 7.4, 1.6 Hz, 1H), 7.29 (t, J ) 7.5 Hz, 1H), 7.15 (d, J ) 8.4
Hz, 1H), 4.09-4.02 (m, 2H), 1.76 (sept, J ) 6.6 Hz, 1H), 1.67-
1.61 (m, 2H), 1.03 (d, J ) 6.6 Hz, 6H).
Further profiling of compound 130 reveals that it has no major
CYP450 liabilities with the exception of modest potency at
inhibiting the 2C9 isozyme (IC50 ∼ 1 µM) and a modest
potential for 3A4 induction (PXR EC50 ) 5.3 µM).21 The
clinical relevance of these findings is not clear at this point,
but such activities do not preclude advancing compound 130
toward clinical studies. Furthermore, no macroscopic adverse
events manifested themselves in a 4-day rat toxicology study
at doses up to 300 mg/kg/day in both male and female rats.
Importantly, dose proportional increases in AUC are observed,
confirming high levels of exposure.
In the absence of a readily accessible animal model, the
effects of the high affinity for human plasma proteins on the
cellular activity of compound 130 can be tested in the replicon
assay by the addition of R-acid glycoprotein (AAG), human
serum albumin (HSA), or the combination of both. In the
presence of 1 mg/mL AAG, the EC50 for compound 130
increases by only 4-5-fold, but the presence of 45 mg/mL HSA
reduces the activity of 130 dramatically (Table 11). The
relevance of this HSA-mediated attenuation of potency in the
replicon system and the impact of protein binding on the in
vivo efficacy of compound 130 are, as yet, unknown. It is well-
known that high affinity for plasma proteins can dramatically
reduce the effectiveness of, for example, HIV antiretroviral
agents;22 however a similar correlation has not yet been
established for HCV. It is encouraging, however, as discussed
above, that compound 130 preferentially distributes into liver
tissues following repeated oral dosing in the rat, despite its high
protein binding. Nonetheless, addressing the effects of protein
binding on compound potency may be critical to the successful
discovery of clinically effective benzothiadiazine non-nucleoside
HCV NS5B inhibitors, and work toward this goal will be the
subject of future publications.
Method B: 1-(3,3-Dimethylbutyl)-2H-3,1-benzoxazine-2,4-
(1H)-dione [7, R ) (CH2)2C(CH3)3]. Diisopropyl azodicarboxylate
(0.663 mL, 3.37 mmol) was added dropwise to a solution of isatoic
anhydride (500 mg, 3.06 mmol), 3,3-dimethylbutan-1-ol (0.408 mL,
3.37 mmol), and Ph3P (883 mg, 3.37 mmol) in CH2Cl2 (10.0 mL).
The resulting mixture was stirred overnight at room temperature,
concentrated under reduced pressure, and purified by flash chro-
matography (hexanes/ethyl acetate 75:25) to give the title compound
(336 mg, 44%) as a colorless powder: 1H NMR (CDCl3) δ 8.17
(dd, J ) 7.8, 1.6 Hz, 1H), 7.77 (ddd, J ) 8.54, 7.4, 1.6 Hz, 1H),
7.32 (t, J ) 7.4 Hz, 1H), 7.15 (d, J ) 8.4 Hz, 1H), 4.13-4.05 (m,
2H), 1.68-1.621 (m, 2H), 1.07 (s, 9H).
Conclusions
A potent class of HCV NS5B polymerase inhibitors has been
discovered through high throughput screening of the GSK
compound collection. Preliminary SAR studies around this
scaffold culminated in the discovery of compound 130, which
was ultimately progressed into preclinical development. This
class of compounds represents an example of non-nucleoside
inhibitors in which excellent RdRp inhibition has translated in
Ethyl (1,1-Dioxido-2H-1,2,4-benzothiadiazin-3-yl)acetate (9).
Ester 9 was prepared according to the literature procedure reported

Potent Inhibitors of HCV RNA Polymerase
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3 979
by Kovalenko et al.16 Ethyl 3-chloro-3-oxopropanoate (22.5 mL,
175.4 mmol) was added dropwise to a solution of 2-aminoben-
zenesulfonamide (30.2 g, 175.4 mmol) and pyridine (14.2 mL, 175.4
mmol) in CH2Cl2 (200 mL) at 0 °C. The reaction mixture was stirred
overnight at room temperature, the solvent evaporated under reduced
pressure, and the residue partitioned between 1 M aqueous
hydrochloric acid and EtOAc. The separated organic layer was
washed with water and then brine and dried over Na2SO4 and the
solvent evaporated under reduced pressure. The residue was
triturated in hexane/EtOAc 1:1 to give ethyl 3-{[2-(aminosulfonyl)-
phenyl]amino}-3-oxopropanoate (31.0 g; 61%) as colorless needles.
Ethyl 3-{[2-(aminosulfonyl)phenyl]amino}-3-oxopropanoate (30.0
g, 104.8 mmol) was suspended in 10% aqueous sodium carbonate
(900 mL) and the suspension warmed to 45 °C until all solid
dissolved (Caution: maintain internal temperature below 40 °C)
and then further stirred at room temperature for 40 min. The reaction
mixture was then cooled in an ice bath, and 6 N HCl was slowly
added until pH ∼7. After cooling the suspension for 2 h the
precipitate which formed was collected by filtration, washed with
water, and dried under vacuum to give compound 9 (13.3 g; 47%)
as a colorless powder: 1H NMR (DMSO-d6) δ 12.27 (br s, 1H),
7.82 (dd, J ) 8.0, 1.3 Hz, 1H), 7.69 (td, J ) 8.1, 1.3 Hz, 1H), 7.47
(td, J ) 8.1, 1.0 Hz, 1H), 7.33 (d, J ) 7.9 Hz, 1H), 4.17 (q, J )
7.1 Hz, 2H), 3.71 (s, 2H), 1.22 (t, J ) 7.1 Hz, 3H); MS (ES+) m/e
269 [M + H]+.
General Method for the Condensation of Isatoic Anhydride
with Ester 9. Method C: 3-(1,1-Dioxo-1,4-dihydrobenzo[1,2,4]-
thiadiazin-3-yl)-4-hydroxy-1-(3-methylbutyl)-1H-quinolin-2-
one (2). Sodium hydride (687 mg of a 60% suspension, 17.2 mmol)
was added to a suspension of 1-(3-methylbutyl)-2H-3,1-benzox-
azine-2,4(1H)-dione (1.0 g, 4.29 mmol) and ester 9 (1.15 g, 4.29
mmol) in anhydrous THF (50.0 mL). The reaction mixture was
then heated under reflux for 1.5 h, cooled, treated with glacial AcOH
(1.5 mL), heated under reflux for 1 h, cooled, and then poured into
1 M aqueous hydrochloric acid. The precipitate that formed was
collected by filtration and recrystallized from ethyl acetate. The
solid was collected, washed with Et2O, and dried in a vacum oven
to give 455 mg (26%) of 2 as pale yellow crystals: 1H NMR
(CDCl3) δ 15.21 (br s, 1H), 14.58 (br s, 1H), 8.29 (dd, J ) 8.1, 1.5
Hz, 1H), 7.99 (dd, J ) 8.0, 0.7 Hz, 1H), 7.74 (ddd, J ) 8.6, 7.2,
1.5 Hz, 1H), 7.63 (td, J ) 8.2, 1.5 Hz, 1H), 7.48-7.27 (m, 4H),
4.35-4.30 (m, 2H), 1.83 (sept, J ) 6.6 Hz, 1H), 1.67-1.61 (m,
2H), 1.08 (d, J ) 6.5 Hz, 6H); MS (ES+) m/e 412 [M + H]+.
Anal. (C21H21N3O4S‚0.25 EtOAc) C, H, N.
3-(1,1-Dioxo-1,4-dihydro-benzo[1,2,4]thiadiazin-3-yl)-4-hydroxy-
1-methyl-1H-quinolin-2-one (11). Following the procedures from
methods A and C, compound 11 (319 mg, 23%) was obtained as
a colorless solid as the monosodium salt after recrystallization from
ethanol/1M aqueous sodium hydroxide: 1H NMR (DMSO-d6) δ
16.3 (s, 1H), 8.12 (dd, J ) 7.8, 1.5 Hz, 1H), 7.66 (dd, J ) 7.8, 1.3
Hz, 1H), 7.58-7.52 (m, 2H), 7.31-7.26 (m, 3H), 7.12 (td, J )
7.0, 1.0 Hz, 1H), 3.49 (s, 3H).
3-(1,1-Dioxo-1,4-dihydrobenzo[1,2,4]thiadiazin-3-yl)-1-ethyl-
4-hydroxy-1H-quinolin-2-one (12). Following the procedures from
methods A and C, except substituting iodoethane for i-amyl iodide,
compound 12 (323 mg, 67%) was obtained as a colorless solid
after recrystallization from AcOH: 1H NMR (CDCl3) δ 15.23 (br
s, 1H), 14.58 (br s, 1H), 8.31 (dd, J ) 8.1, 1.5 Hz, 1H), 8.00 (d, J
) 8.0 Hz, 1H), 7.76 (ddd, J ) 8.6, 7.1, 1.6 Hz, 1H), 7.63 (ddd, J
) 8.1, 7.5, 1.4 Hz, 1H), 7.47-7.43 (m, 2H), 7.37 (td, J ) 8.0, 0.8
Hz, 1H), 7.30 (dd, J ) 8.2, 0.5 Hz, 1H), 4.40 (q, J ) 7.1 Hz, 2H),
1.41 (t, J ) 7.1 Hz, 3H); MS (ES+) m/e 370 [M + H]+. Anal.
(C18H15N3O4S‚0.25AcOH) C, H, N.
1.5 Hz, 1H), 7.45(td, J ) 8.1, 0.9 Hz, 1H), 7.41 (d, J ) 8.6 Hz,
1H), 7.36 (td, J ) 8.1, 0.8 Hz, 1H), 7.31 (d, J ) 8.1 Hz, 1H), 4.28
(t, J ) 7.9 Hz, 2H), 1.81 (sext, J ) 7.6 Hz, 2H), 1.09 (t, J ) 7.4
Hz, 3H); MS (ES+) m/e 384 [M + H]+. Anal. Calcd for
C19H17N3O4S: C, 59.52; H, 4.47; N, 10.96. Found: C, 60.01; H,
4.09; N, 10.88.
3-(1,1-Dioxo-1,4-dihydrobenzo[1,2,4]thiadiazin-3-yl)-4-hydroxy-
1-(2-methylpropyl)-1H-quinolin-2-one (14). Following the pro-
cedures from methods A and C, except substituting 1-bromo-2-
methylpropane for i-amyl iodide, the title compound 14 (100 mg,
28%) was obtained as tan crystals after washing with water and
then hexanes and trituration with ethyl acetate: 1H NMR (CDCl3)
δ 15.28 (br s, 1H), 14.62 (br s, 1H), 8.31 (dd, J ) 8.1, 1.6 Hz,
1H), 7.99 (dd, J ) 8.0, 1.3 Hz, 1H), 7.74 (ddd, J ) 8.7, 7.1, 1.6
Hz, 1H), 7.63 (td, J ) 8.1, 1.5 Hz, 1H), 7.48-7.34 (m, 4H), 4.23-
4.20 (m, 2H), 2.26 (m, J ) 6.9 Hz, 1H), 1.02 (d, J ) 6.8 Hz, 6H);
MS (ES+) m/e 398 [M + H]+. Anal. (C20H19N3O4S) C, H, N.
1-(3,3-Dimethylbutyl)-3-(1,1-dioxo-1,4-dihydrobenzo[1,2,4]-
thiadiazin-3-yl)-4-hydroxy-1H-quinolin-2-one (15). Following the
procedures of methods B and C, the title compound 15 (211 mg,
61%) was obtained as a colorless solid after trituration with diethyl
ether: 1H NMR (DMSO-d6) δ 15.18 (br s, 1H), 14.29 (s, 1H), 8.19
(dd, J ) 8.1, 1.3 Hz, 1H), 7.94 (d, J ) 7.8 Hz, 1H), 792-7.68 (m,
4H), 7.59-7.54 (m, 1H), 7.44 (t, J ) 7.6 Hz, 1H), 4.36-4.31 (m,
2H), 1.59-1.53 (m, 2H), 1.07 (s, 9H); MS (ES+) m/e 426 [M +
H]+. Anal. (C22H23N3O4S) C, H, N.
1-(2-Cyclopropylethyl)-3-(1,1-dioxo-1,4-dihydro-1-benzo[1,2,4]-
thiadiazin-3-yl)-4-hydroxy-1H-quinolin-2-one (26). Following the
procedures of methods B and C, except substituting 2-cyclopro-
pylethanol for 3,3-dimethylbutan-1-ol, the title compound 26 (206
mg, 58%)was obtained as a colorless solid: 1H NMR (CDCl3) δ
15.24 (s, 1H), 14.60 (s, 1H), 8.31 (dd, J ) 8.1, 1.4 Hz, 1H), 8.01
(dd, J ) 8.0, 0.6 Hz, 1H), 7.75 (ddd, J ) 8.6, 7.2, 1.6 Hz, 1H),
766-7.61 (m, 1H), 7.48-7.31 (m, 4H), 4.43 (t, J ) 7.7 Hz, 2H),
1.68 (q, J ) 7.6 Hz, 2H), 0.84-0.79 (m, 1H), 0.55-0.49 (m, 2H),
0.17-0.12 (m, 2H); MS (ES+) m/e 410 [M + H]+. Anal.
(C21H19N3O4S) C, H, N.
5-Chloro-3-(1,1-dioxo-1,2-dihydrobenzo[1,2,4]thiadiazin-3-yl)-
4-hydroxy-1-(3-methylbutyl)-1H-quinolin-2-one (73). A solution
of 6-chloroanthranilic acid (1.15 g, 6.73 mmol) in tetrahydrofuran
(20.0 mL) was treated with triphosgene (1.0 g, 3.3 mmol) and stirred
at 50 °C overnight. Saturated sodium hydrogen carbonate solution
was added and the mixture extracted with ethyl acetate. Evaporation
of the organic solution gave 5-chlorobenzo[d][1,3]oxazine-2,4-dione
(1.25 g, 94%): 1H NMR (DMSO-d6) δ 11.85 (s, 1H), 7.65 (t, J )
8.0 Hz, 1H), 7.30 (d, J ) 8.0 Hz, 1H), 7.10 (d, J ) 9.0 Hz, 1H).
5-Chlorobenzo[d][1,3]oxazine-2,4-dione (517 mg, 2.6 mmol),
triphenylphosphine (688 mg, 2.6 mmol), and 3-methylbutanol (0.3
mL, 2.75 mmol) were stirred together in dichloromethane and
treated with diethyl azodicarboxylate (0.42 mL, 2.6 mmol). The
reaction was stirred under a nitrogen atmosphere overnight,
evaporated onto silica, and purified by chromatography (silica gel,
ethyl acetate/hexanes) to give 1-(3-methylbutyl)-5-chlorobenzo[d]-
[1,3]oxazine-2,4-dione (440 mg, 63%): 1H NMR (CDCl3) δ 7.62
(t, J ) 8.0 Hz, 1H), 7.33 (d, J ) 8.0 Hz, 1H), 7.08 (d, J ) 9.0 Hz,
1H), 4.06 (m, 2H), 1.78 (m, 1H), 1.61 (m, 2H) 1.02 (d, J ) 6.5
Hz, 6H).
Sodium hydride (263 mg of a 60% suspension in mineral oil,
6.56 mmol) was added to a mixture of 1-(3-methylbutyl)-5-
chlorobenzo[d][1,3]oxazine-2,4-dione (440 mg, 1.64 mmol) and
ester 9 (440 mg, 1.64 mmol) in tetrahydrofuran (20.0 mL). The
mixture was heated under reflux for 1.5 h, cooled, and acidified
with acetic acid. The mixture was then heated under reflux for an
additional 1.5 h and cooled and water was added. The product was
collected and washed with water, diethyl ether, and hexanes to give
the title compound 73 (520 mg, 71%): 1H NMR (DMSO-d6) δ
16.10 (br s, 1H), 14.43 (s, 1H), 7.94 (d, J ) 8.0 Hz, 1H), 7.57-
7.82 (m, 5H), 7.48 (d, J ) 8.0 Hz, 1H), 4.33 (m, 2H), 1.80 (m,
1H), 1.53 (m, 2H) 1.00 (d, J ) 7 Hz, 6H). Anal. (C21H20ClN3O4S)
C, H, N.
3-(1,1-Dioxo-1,4-dihydrobenzo[1,2,4]thiadiazin-3-yl)-4-hydroxy-
1-propyl-1H-quinolin-2-one (13). Following the procedures from
methods A and C, except substituting n-propyl iodide for i-amyl
iodide, compound 13 (225 mg, 60%) was obtained as a pale yellow
powder after washing with water, diethyl ether, and hexanes,
sequentially: 1H NMR (CDCl3) δ 15.23 (br s, 1H), 14.58 (br s,
1H), 8.30 (dd, J ) 8.1, 1.5 Hz, 1H), 7.99 (dd, J ) 7.8, 1.3 Hz,
1H), 7.74 (ddd, J ) 8.5, 7.2, 1.5 Hz, 1H), 7.63 (ddd, J ) 8.1, 7.5,

980 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3
Tedesco et al.
5-Bromo-3-(1,1-dioxo-1,2-dihydrobenzo[1,2,4]thiadiazin-3-yl)-
4-hydroxy-1-(3-methylbutyl)-1H-quinolin-2-one (74). A solution
of a 1:1 mixture of 4-bromoindole-2,3-dione and 6-bromoindole-
2,3-dione (prepared by the method of Katsifis and McPhee24) (3.7
g; 0.016 mol.) in glacial acetic acid (25.0 mL) was treated with
30% aqueous hydrogen peroxide solution (5.0 mL). The suspension
was then stirred at 50 °C for 5 h. The mixture was concentrated
and the residue was washed with diethyl ether to give a mixture of
7-bromo-2H-3,1-benzoxazine-2,4(1H)-dione (∼17% measured by
1H NMR) and 5-bromo-2H-3,1-benzoxazine-2,4(1H)-dione (∼83%
measured by 1H NMR) (4.0 g, yield 100%) as a yellow solid: MS
(ES+) m/e 244, 242 [M + H]+.
A solution of triphenylphosphine (1.24 g, 4.7 mmol) and
3-methylbutanol (0.47 mL, 4.3 mmol) was treated with the mixture
obtained in the previous step (1.1 g; 4.5 mmol) and then treated
dropwise with diisopropyl azodicarboxylate (1.0 mL, 4.8 mmol).
The solution was stirred at room temperature and then concentrated
to give a gum. The gum was purified by chromatography (silica
gel, 10% ethyl acetate/hexanes) to give 5-bromo-2H-3,1-benzox-
azine-1-(3-methylbutyl)-2,4-dione (0.57 g; 41%) {1H NMR (CDCl3)
δ 7.6 (dd, 1H), 7.5 (t, 1H), 7.1 (dd, 1H), 4.1 (m, 2H), 1.8 (m, 1H),
1.7 (m, 2H), 1.0 (d, 6H); MS (ES+) m/e 314, 312 [M + H]+}
followed by 7-bromo-2H-3,1-benzoxazine-1-(3-methylbutyl)-2,4-
dione (0.10 g; 7%) {1H NMR (300 MHz, CDCl3) δ 8.0 (d, 1H),
7.4 (dd, 1H), 7.3 (d, 1H), 4.6 (m, 2H), 1.8 (m, 3H), 1.0 (d, 6H);
MS (ES+) m/e 314, 312 [M + H]+}.
A solution of 1-(3-methylbutyl)-5-bromobenzo[d][1,3] oxazine-
2,4-dione (200 mg, 0.6 mmol) and ethyl (1,1-dioxo-1,2-dihydrobenzo-
[1,2,4]thiadiazin-3-yl)acetate (172 mg, 0.6 mmol) in tetrahydrofuran
(15.0 mL) was treated with sodium hydride (60% dispersion in
mineral oil) (100 mg; 2.6 mmol) and heated under reflux for 1.5 h.
The mixture was then cooled to room temperature and acidified
with excess glacial acetic acid. The mixture was then heated under
reflux for an additional 1.5 h, cooled, and quenched with water.
The product was collected and washed with water, ether, and then
hexanes to give 74 (180 mg; 60%) as colorless powder: 1H NMR
(DMSO-d6) δ 8.0 (d, J ) 7.5 Hz, 1H), 7.8 (t, J ) 8.0 Hz, 1H), 7.7
(m, 4H), 7.6 (t, J ) 8.0 Hz, 1H), 4.4 (m, 2H), 1.8 (m, 1H), 1.5 (m,
2H), 1.0 (d, J ) 7.0 Hz, 6H).
3-(1,1-Dioxo-1,2-dihydrobenzo[1,2,4]thiadiazin-3-yl)-6-fluoro-
4-hydroxy-1-(3-methylbutyl)-1H-quinolin-2-one (79). A solution
of 5-fluoroanthranilic acid (1.0 g, 6.44 mmol) in tetrahydrofuran
(20.0 mL) was treated with a 20% solution of phosgene in toluene
(4.0 mL) and stirred overnight. Saturated sodium hydrogen carbon-
ate solution was added and the mixture extracted with ethyl acetate.
The organic layer was evaporated and the residue crystallized from
diethyl ether to afford 6-fluorobenzo[d][1,3]oxazine-2,4-dione (960
mg, 82%): 1H NMR (CDCl3) δ 11.81 (s, NH), 7.70 (m, 2H), 7.67
(m, 1H).
6-Fluorobenzo[d][1,3]oxazine-2,4-dione (940 mg, 5.2 mmol) was
added portionwise to a suspension of sodium hydride (60%
suspension in mineral oil) (240 mg, 6.0 mmol) in anhydrous N,N-
dimethylformamide. After 30 min, 1-bromo-3-methylbutane (0.9
mL, 7.1 mmol) was added and the mixture was stirred at 80 °C for
16 h. The mixture was poured onto ice, acidified with glacial acetic
acid, and extracted with ethyl acetate. The organic layer was
evaporated and the residue crystallized from hexanes to afford 1-(3-
methylbutyl)-6-fluorobenzo[d][1,3]oxazine-2,4-dione (380 mg,
23%): 1H NMR (DMSO-d6) δ 7.72-7.81 (m, 2H), 7.47-7.51 (m,
1H), 4.02 (m, 2H) 1.73 (m, 1H), 1.54 (m, 2H) 0.96 (d, J ) 6.5 Hz,
6H).
Sodium hydride (130 mg of a 60% suspension in mineral oil,
3.25 mmol) was added to a mixture of 1-(3-methylbutyl)-6-
fluorobenzo[d][1,3]oxazine-2,4-dione (250 mg, 0.8 mmol) and ethyl
1,1-dioxo-2H-benzo-1,2,4-thiadiazinyl-3-acetate (215 mg, 0.8 mmol)
in tetrahydrofuran (15.0 mL). The mixture was heated under reflux
for 1.5 h, cooled, and acidified with glacial acetic acid. The mixture
was then heated under reflux for an additional 1.5 h and cooled
and water was added. The product was collected and washed with
water, diethyl ether, and hexanes to give compound 79 (220 mg,
64%): 1H NMR (DMSO-d6) δ 15.10 (br s, 1H), 14.21 (s, 1H),
7.93 (d, J ) 7 Hz, 1H), 7.59-7.54 (m, 5H) 7.55 (dd, 1H), 4.29
(m, 2H),1.78 (m, 1H), 1.52 (m, 2H), 0.99 (d, J ) 6.5 Hz, 6H).
Anal. (C21H20FN3O4S) C, H, N.
6-Chloro-3-(1,1-dioxo-1,2-dihydrobenzo[1,2,4]thiadiazin-3-yl)-
4-hydroxy-1-(3-methylbutyl)-1H-quinolin-2-one (80). 6-Chloro-
1H-benzo[d][1,3]oxazine-2,4-dione (1.27 g, 6.43 mmol) was added
portionwise to a suspension of sodium hydride (60% suspension
in mineral oil) (284 mg, 7.1 mmol) in anhydrous N,N-dimethyl-
formamide. After 15 min, 1-bromo-3-methylbutane (0.9 mL, 7.1
mmol) was added and the mixture was stirred at 80 °C for 16 h.
The mixture was poured onto ice, acidified with glacial acetic acid,
and extracted with ethyl acetate. Purification using flash chroma-
tography (20% ethyl acetate in hexanes) gave 6-chloro-1-(3-
1
methylbutyl)benzo[d][1,3]oxazine-2,4-dione (1.0 g, 58%): H NMR
(CDCl3) δ 8.35 (d, 1H), 7.85 (dd, 1H), 7.04 (d, 1H), 4.04 (m, 2H),
1.72 (m, 1H), 1.60 (m, 2H), 1.02 (d, J ) 6.5 Hz, 6H).
Sodium hydride (165 mg of a 60% suspension in mineral oil,
4.0 mmol) was added to a mixture of 6-chloro-1-(3-methylbutyl)-
benzo[d][1,3]oxazine-2,4-dione (267 mg, 1.0 mmol) and ethyl 1,1-
dioxo-2H-benzo-1,2,4-thiadiazinyl-3-acetate (270 mg, 1.0 mmol)
in tetrahydrofuran (15.0 mL). The mixture was heated under reflux
for 1.5 h, cooled, and acidified with glacial acetic acid. The mixture
was then heated under reflux for an additional 1.5 h and cooled
and water was added. The product was collected and washed with
water, diethyl ether, and hexanes to give compound 80 (180 mg,
41%): 1H NMR (DMSO-d6) δ 15.94 (s, 1H), 8.06 (d, J ) 3.0 Hz,
1H), 7.68 (dd, J ) 8.0, 1.0 Hz, 1H), 7.54-7.59 (m, 2H), 7.26-
7.32 (m, 3H), 4.01 (m, 2H), 1.7 (m, 1H), 1.45 (m, 2H), 0.98 (d, J
) 6.5 Hz, 6H). Anal. (C21H20ClN3O4S) C, H, N.
6-Bromo-3-(1,1-dioxo-1,2-dihydrobenzo[1,2,4]thiadiazin-3-yl)-
4-hydroxy-1-(3-methylbutyl)-1H-quinolin-2-one (81). 6-Bromo-
1H-benzo[d][1,3]oxazine-2,4-dione (1.62 g, 6.69 mmol) was added
portionwise to a suspension of sodium hydride (60% suspension
in mineral oil) (296 mg, 7.4 mmol) in anhydrous N,N-dimethyl-
formamide. After 15 min, 1-bromo-3-methylbutane (0.9 mL, 7.1
mmol) was added and the mixture was stirred at 80 °C for 16 h.
The mixture was poured onto ice, acidified with glacial acetic acid,
and extracted into ethyl acetate. Purification using flash chroma-
tography (20% ethyl acetate in hexanes) gave 6-bromo-1-(3-
methylbutyl)-benzo[d][1,3] oxazine-2,4-dione (1.0 g, 48%): 1H
NMR (CDCl3) δ 8.11 (d, J ) 3.0 Hz, 1H), 7.70 (dd, J ) 9.0, 3.0
Hz, 1H), 7.10 (d, J ) 9.0 Hz, 1H), 4.04 (m, 2H), 1.62 (m, 1H)
1.60 (m, 2H), 1.02 (d, J ) 6.5 Hz, 6H).
Sodium hydride (160 mg of a 60% suspension in mineral oil,
4.0 mmol) was added to a mixture of 6-bromo-1-(3-methylbutyl)-
benzo[d][1,3]oxazine-2,4-dione (312 mg, 1.0 mmol) and ethyl 1,1-
dioxo-2H-benzo-1,2,4-thiadiazinyl-3-acetate (270 mg, 1.0 mmol)
in tetrahydrofuran (15.0 mL). The mixture was heated under reflux
for 1.5 h, cooled, and acidified with glacial acetic acid. The mixture
was then heated under reflux for an additional 1.5 h and cooled
and water was added. The product was collected and washed with
water, diethyl ether, and hexanes to give compound 81 (400 mg,
81%): 1H NMR (DMSO-d6) δ 15.93 (s, 1H), 8.20 (d, J ) 2.5 Hz,
1H), 7.67 (m, 2H), 7.59 (m, 1H), 7.30 (m, 3H), 4.10 (m, 2H), 1.75
(m, 1H), 1.45 (m, 2H), 1.0 (d, J ) 6.5 Hz, 6H). Anal. (C21H20-
BrN3O4S) C, H, Br, N.
3-(1,1-Dioxo-1,4-dihydrobenzo[1,2,4]thiadiazin-3-yl)-4-hydroxy-
6-iodo-1-(3-methylbutyl)-1H-quinolin-2-one (82). Triphosgene
(5.64 g, 19 mmol) was added portionwise to a stirred solution of
2-amino-5-iodobenzoic acid (10.0 g, 38 mmol) in tetrahydrofuran
(60.0 mL). The mixture was stirred for 1 h and then a mixture of
water/ice/sodium hydrogen carbonate solution was added in portions
to the mixture. The solid was collected, washed with water then
diethyl ether, and dried to give 6-iodo-1H-benzo[d][1,3]oxazine-
2,4-dione (9.68 g, 88%): 1H NMR (DMSO-d6) δ 11.83 (s, 1H),
8.12 (d, 1H), 8.00 (dd, 1H), 6.95 (d, 1H).
A solution of diethyl azodicarboxylate (3.76 mL, 23.88 mmol)
in chloroform (50.0 mL) was added dropwise to a stirred suspension
of 6-iodo-1H-benzo[d][1,3]oxazine-2,4-dione (6.90 g, 23.88 mmol),
triphenylphosphine (6.26 g, 23.88 mmol), and isoamyl alcohol (2.5
mL, 23.88 mmol) in chloroform (150 mL). The mixture was stirred

Potent Inhibitors of HCV RNA Polymerase
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3 981
overnight and evaporated onto silica gel. Purification using flash
chromatography (silica gel, gradient, hexanes/ethyl acetate 0-15%)
gave 6-iodo-1-(3-methylbutyl)-1H-benzo[d][1,3]oxazine-2,4-dione
as a colorless solid (5.45 g, 53%): 1H NMR (CDCl3) δ 8.42 (d,
1H), 8.00 (dd, 1H), 6.92 (d, 1H), 4.02 (m, 2H), 1.60 (m, 1H), 1.57
(m, 2H), 1.01 (d, 6H).
Sodium hydride (2.4 g of a 60% suspension in mineral oil, 60
mmol) was added to a mixture of 6-iodo-1-(3-methylbutyl)-1H-
benzo[d][1,3]oxazine-2,4-dione (5.39 g, 15 mmol) and ester 9 (4.02
g, 15 mmol) in tetrahydrofuran (100 mL). The mixture was heated
under reflux for 1.5 h, cooled, and acidified with glacial acetic acid.
The mixture was then heated under reflux for an additional 1.5 h
and cooled and water was added. The precipitate was collected and
washed with water, diethyl ether, and hexanes to give compound
82 (5.5 g, 68%): 1H NMR (pyridine-d5) δ 15.24 (br s, 1H), 14.50
(br s, 1H), 8.59 (d, 1H), 8.25 (m, 1H), 8.05 (m, 1H), 7.89 (m, 1H),
7.79 (m, 1H), 7.69 (m, 1H), 7.59 (m, 1H), 4.44 (m, 2H), 1.94 (m,
1H), 1.70 (m, 2H), 1.16 (d, 6H); MS (ES+) m/e 438 [M + H]+.
Anal. Calcd for C21H20IN3O4S: C, 46.94; H, 3.75; N, 7.82.
Found: C, 46.42; H, 3.41; N, 7.62.
6-Amino-3-(1,1-dioxo-1,2-dihydrobenzo[1,2,4]thiadiazin-3-yl)-
4-hydroxy-1-(3-methylbutyl)-1H-quinolin-2-one (85). A solution
of compound 84 (78 mg, 0.17 mmol) in N,N-dimethylformamide
(20.0 mL) and glacial acetic acid (2.0 mL) was hydrogenated over
10% palladium-on-charcoal at 50 psi for 2 h. The mixture was
filtered through Celite, washed through with methanol, and
evaporated to a solid. The residual compound was crystallized from
ethanol/4 M hydrogen chloride in dioxane to give the title compound
85 (35 mg, 48% as the hydrochloride salt): 1H NMR (DMSO-d6)
δ 14.49 (s, 1H), 7.94 (d, J ) 8.0 Hz, 1H), 7.54-7.80 (m, 6H),
4.29 (m, 2H), 1.77 (m, 1H), 1.53 (m, 2H) 1.01 (d, J ) 6.5 Hz,
6H). Anal. Calcd for C21H22N4O4S·1.4HCl: C, 52.82; H, 4.94; N,
11.73. Found: C, 53.04; H, 4.89; N, 11.45.
3-(1,1-Dioxo-1,4-dihydrobenzo[1,2,4]thiadiazin-3-yl)-4,6-dihy-
droxy-1-(3-methylbutyl)-1H-quinolin-2-one (86). tert-Butyldi-
methylsilyl chloride (5.05 g, 33.5 mmol) was added to a solution
of 6-hydroxy-1H-benzo[d]oxazine-2,4-dione (6.0 g, 33.5 mmol) and
imidazole (2.28 g, 33.5 mmol) in chloroform. The mixture was
stirred overnight and then evaporated onto silica gel. Purification
using flash chromatography (silica gel, 0-40% ethyl acetate/
hexanes) gave 6-(tert-butyldimethylsilanyloxy)-1H-benzo[d]ox-
azine-2,4-dione (5.5 g, 56%) as a colorless solid: 1H NMR (CDCl3)
δ 9.29 (s, NH), 7.27 (d, J ) 2.0 Hz, 1H), 6.99 (dd, J ) 2.0, 8.0
Hz, 1H), 6.80 (d, J ) 8.0 Hz, 1H), 0.77 (s, 9H), 0.00 (s, 6H).
6-(tert-Butyldimethylsilanyloxy)-1H-benzo[d]oxazine-2,4-di-
one (324 mg, 1.1 mmol), triphenylphosphine (289 mg, 1.1 mmol),
and isoamyl alcohol (0.18 mL, 1.1 mmol) were stirred together in
chloroform and treated with diethyl azodicarboxylate (0.12 mL,
1.1 mmol). The reaction was stirred under a nitrogen atmosphere
overnight, evaporated onto silica, and purified by flash chroma-
tography (silica gel, ethyl acetate-hexanes) to give 6-(tert-
butyldimethylsilanyloxy)-1-(3-methylbutyl)-1H-benzo[d]oxazine-
2,4-dione (175 mg, 44%): 1H NMR (CDCl3) δ 7.53 (d, J ) 3.0
Hz, 1H), 7.23 (dd, J ) 3.0, 8.0 Hz, 1H), 7.03 (d, J ) 8.0 Hz, 1H),
4.01 (m, 2H), 1.63 (m, 1H), 1.60 (m, 2H), 1.00 (d, J ) 6.0 Hz,
6H), 0.97 (s, 9H), 0.20 (s, 6H), 0.50 (m, 2H), 0.22 (s, 6H).
Sodium hydride (75.0 mg of a 60% suspension in mineral oil,
1.88 mmol) was added to a mixture of 6-(tert-butyl-dimethylsila-
nyloxy)-1-(3-methylbutyl)-1H-benzo[d]oxazine-2,4-dione (170 mg,
0.46 mmol) and ester 9 (125 mg, 0.46 mmol) in tetrahydrofuran
(20.0 mL). The mixture was heated under reflux for 1.5 h, cooled,
and acidified with glacial acetic acid. The mixture was then heated
under reflux for an additional 1.5 h and cooled and water was added.
The product was collected; washed with water, diethyl ether, and
hexanes; dried; and suspended in tetrahydrofuran (5.0 mL). Tet-
rabutylammonium fluoride (1.0 M solution in tetrahydrofuran; 0.50
mL) was then added and the mixture was stirred until a clear yellow
solution was obtained. After 10 min, 3 M aqueous hydrochloric
acid (10.0 mL) was added, followed by water until a precipitate
was obtained. The solid was collected and washed with water,
diethyl ether, and hexanes to give compound 86 (53 mg, 96%) as
a yellow solid: 1H NMR (DMSO-d6) δ 15.12 (br s, 1H), 14.63 (br
s, 1H), 10.00 (br s, OH), 7.93 (d, J ) 8.0 Hz, 1H), 7.77 (dd, J )
8.0 Hz, 1H), 7.66 (d, J ) 8.0 Hz, 1H), 7.54 (m, 3H), 7.36 (dd, J
) 3.0, 8.0 Hz, 1H), 4.29 (m, 2H), 1.80 (m, 1H), 1.54 (m, 2H),
1.00 (d, J ) 3.0 Hz, 12H). Anal. (C21H21N3O5S 0.2H2O) C, H, N.
3-(1,1-Dioxo-1,2-dihydrobenzo[1,2,4]thiadiazin-3-yl)-7-fluoro-
4-hydroxy-1-(3-methylbutyl)-1H-quinolin-2-one (103). A solution
of 4-fluoroanthranilic acid (1.2 g, 7.7 mmol) in tetrahydrofuran (20.0
mL) was treated with triphosgene (2.3 g, 7.7 mmol) and stirred at
50 °C overnight. Saturated sodium hydrogen carbonate solution was
added and the mixture extracted with ethyl acetate. Evaporation of
the organic solution gave 7-fluorobenzo[d][1,3]oxazine-2,4-dione
(1.09 g, 78%): 1H NMR (300 MHz, DMSO-d6) δ 11.88 (s, 1H),
8.00 (m, 1H), 7.11 (m, 1H), 6.88 (m, 1H).
7-Fluorobenzo[d][1,3]oxazine-2,4-dione (500 mg, 2.75 mmol),
triphenylphosphine (721 mg, 2.75 mmol), and 3-methylbutanol (0.3
mL, 2.75 mmol) were stirred together in dichloromethane and
treated with diisopropyl azodicarboxylate (0.54 mL, 2.75 mmol).
The reaction was stirred under a nitrogen atmosphere overnight,
evaporated onto silica, and purified by chromatography (silica gel,
ethyl acetate/hexanes) to give 1-(3-methylbutyl)-7-fluorobenzo[d]-
[1,3]oxazine-2,4-dione (448 mg, 65%): 1H NMR (300 MHz,
DMSO-d6) δ 8.09 (m, 1H), 7.37 (m, 1H), 7.20 (m, 1H), 4.00 (m,
2H), 1.71 (m, 1H), 1.52 (m, 2H) 0.96 (d, J ) 6.5 Hz, 6H).
Sodium hydride (130 mg of a 60% suspension in mineral oil,
3.25 mmol) was added to a mixture of 1-(3-methylbutyl)-7-
fluorobenzo[d][1,3]oxazine-2,4-dione (200 mg, 0.8 mmol) and ester
9 (215 mg, 0.8 mmol) in tetrahydrofuran (15.0 mL). The mixture
was heated under reflux for 1.5 h, cooled, and acidified with glacial
acetic acid. The mixture was then heated under reflux for an
additional 1.5 h and cooled and water was added. The product was
collected and washed with water, diethyl ether, and hexanes to give
compound 103 (46 mg, 15%): 1H NMR (DMSO-d6) δ 15.22 (br
s, 1H), 14.11 (s, 1H), 8.13 (dd, J ) 6.5 and 9 Hz, 1H), 7.78 (m,
1H), 7.69 (d, J ) 8 Hz, 1H), 7.56 (m, 2H), 7.30 (m, 1H), 4.29 (m,
2H), 1.80 (m, 1H), 1.54 (m, 2H), 1.00 (d, J ) 6.5 Hz, 6H). Anal.
(C21H20FN3O4S) C, H, N.
7-Chloro-3-(1,1-dioxo-1,2-dihydrobenzo[1,2,4]thiadiazin-3-yl)-
4-hydroxy-1-(3-methylbutyl)-1H-quinolin-2-one (104). Com-
pound 104 was obtained by the alkylation of commercially available
4-chloroisatoic anhydride with 1-bromo-3-methylbutane under the
conditions of method A, followed by the coupling of the resulting
7-chloro-1-(3-methylbutyl)-2H-3,1-benzoxazine-2,4(1H)-dione with
ester 9 under the conditions of method C: 1H NMR (DMSO-d6) δ
15.0 (br s, 1H), 14.07 (br s, 1H), 8.15 (d, J ) 8.5 Hz, 1H), 7.93 (d,
J ) 7.4 Hz, 1H), 7.53-7.80 (m, 3H), 7.47 (t, J ) 1.3 Hz, 1H),
7.44 (d, J ) 1.4 Hz, 1H), 4.31 (m, 2H), 1.76 (m, 1H), 1.54 (m,
2H), 0.99 (d, J ) 6.6 Hz, 6H); MS (ES+) m/e 446 [M + H]+.
Anal. (C21H20ClN3O4S) C, H, N.
1-(2-Cyclopropylethyl)-3-(1,1-dioxo-1,4-dihydrobenzo[1,2,4]-
thiadiazin-3-yl) -6-fluoro-4-hydroxy-1-quinolin-2-one (130). A
solution of 6-fluorobenzo[d][1,3]oxazine-2,4-dione (1.0 g, 5.58
mmol) (obtained as described for compound 79), triphenylphosphine
(1.44 g, 5.58 mmol), and 2-cyclopropylethanol (1.0 g, 11.6 mmol)
in chloroform was treated with diethyl azodicarboxylate (0.875 mL,
5.58 mmol). The reaction was stirred under a nitrogen atmosphere
overnight, evaporated onto silica, and purified by chromatography
(silica gel, ethyl acetate-hexanes) to give 1-(2-cyclopropylethyl)-
6-fluorobenzo[d][1,3]oxazine-2,4-dione (722 mg, 51%): 1H NMR
(CDCl3) δ 7.80 (dd, J ) 3 and 7 Hz, 1H), 7.48 (m, 1H), 7.08 (dd,
J ) 4 and 9 Hz, 1H), 4.15 (m, 2H), 1.65 (m, 2H) 0.74 (m, 1H),
0.51 (m, 2H), 0.09 (m, 2H).
Sodium hydride (463 mg of a 60% suspension in mineral oil,
6.56 mmol) was added to a mixture of 1-(2-cyclopropylethyl)-6-
fluorobenzo[d][1,3]oxazine-2,4-dione (722 mg, 2.90 mmol) and
ester 9 (777 mg, 2.90 mmol) in tetrahydrofuran (30.0 mL). The
mixture was heated under reflux for 1.5 h, cooled, and acidified
with glacial acetic acid. The mixture was then heated under reflux
for an additional 1.5 h and cooled and water was added. The product
was collected and washed with water, diethyl ether, and hexanes
to give compound 130 (800 mg, 65%): 1H NMR (DMSO-d6) δ

982 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3
Tedesco et al.
15.19 (br. s, 1H), 14.31 (s, 1H), 7.57-7.96 (m, 7H), 4.43 (m, 2H),
1.60 (m, 2H), 0.86 (m, 1H), 0.43 (m, 2H), 0.08 (m, 2H). A portion
was converted to the sodium salt: Anal. (C21H17FNaN3O4S‚0.5H2O)
C, H, N, Na.
5′FAM-ACA TCG CAT CGA GCG AGC ACG TAC-TAMRA3′
(SEQ ID NO 3). Samples were mixed briefly and placed in an
ABI7700 (Applied Biosystems) at 50 °C for 2 min, 95 °C for 10
min, with cycling parameters set to 94 °C for 15 s, 55 °C for 1
min for 40 cycles. The negative strand copy number in each reaction
was determined using linear regression analysis based on the slope
and intercept generated with a negative strand copy standard curve.
The negative strand copies per cell were determined by dividing
the total negative strand copies per reaction by the total cells per
reaction.
Biology. Inhibition of HCV NS5B Polymerization Activity.13
The high-throughput polymerization assay was carried out in 384-
well plates using 50 or 10 nM NS5B, [R-33P]GTP, GTP, 5′-
biotinylated oligo(rG13)/poly(rC) in 20 mM Tris-Cl, pH7.5, MgCl2,
KCl, DTT, and 0.05% bovine serum albumine as previously
described. After 2 h at 25 °C, the reaction was terminated upon
addition of an equal volume of 100 mM EDTA and transferred to
a streptavidin-coated FlashPlate. After incubation for 30 min, the
plate was washed and counted using a Packard TopCount microplate
reader (n ) 4).
Supporting Information Available: Experimental procedures
and spectral data for compounds 16-25, 27-72, 75-78, 83, 84,
87-102, and 105-129. This material is available free of charge
via the Internet at http://pubs.acs.org.
Method for Positive Strand Replicon HCV-RNA Detection
in Replicon Cells.13 Replicon cells were plated at 3 × 103 cells
per well in a 96-well plate plates at 37° and 5% CO2 in DMEM
(Dulbecco’s minimal essential medium) containing 10% FCS (fetal
calf serum), 1% NEAA (nonessential amino acids), and 1 mg/mL
Geneticin (G418 neomycin). After allowing 4 h for cell attachment,
1 µL of a solution of candidate antiviral agent was added to the
medium (n ) 8 wells per dilution). Briefly, 11 2.5-fold dilutions
of 1 mM stock test compound in dimethyl sulfoxide were prepared
with final concentration ranging from 10,000 to 1.0 nM. Plates were
incubated for 40 h, until reaching 80% confluence. After removal
of medium, 150 µL of buffer RLT (Qiagen, Valencia, CA) was
added to each well, and RNA purified according to manufacturer’s
recommendations (Qiagen RNAeasy) was eluted twice in 45 µL
of distilled H2O prior to RT-PCR. Approximately 40 µL of TaqMan
EZ RT-PCR (Applied Biosystems, Foster City, CA) master mix
(1× TaqMan EZ Buffer, 3 mM Mn(OAc)2, 0.3 mM dATP, 0.3
mM dCTP, 0.3 mM dGTP, 0.6 mM dUTP, 0.2 mM neo-forward,
0.2 mM neo-reverse, 0.1 mM neo-probe, 1× cyclophilin mix, 0.1
unit/µL rTth DNA polymerase, 0.01 unit/µL AmpErase UNG, and
H2O to 40 µL) was added to each tube of 96-tube optical plate
along with 10 µL of RNA elution. Primers and probes specific for
the positive strand RNA detection of the neomycin gene were as
follows: neo-forward, 5′CCGGCTACCTGCCCATTC3′ (SEQ ID
NO 1); neo-reverse, 5′CCAGATCATCCTGATCGACAAG3′ (SEQ
ID NO 2); neo-probe, 5′FAM-ACATCGCATCGAGCGAGCACG-
TAC-TAMRA3′ (SEQ ID NO 3). For negative strand RNA
detection, the cDNA primer used was 5′ACA TGC GCG GCA TCT
AGA CCG GCT ACC TGC CCA TTC3′ (SEQ ID NO 4), wherein
the first 18 bases represent SEQ ID NO 5 linked to neo sequences:
neo-forward tag, 5′ACA TGC GCG GCA TCT AGA3′ (SEQ ID
NO 5); neo reverse, 5′CCAGATCATCCTGATCGACAAG3′ (SEQ
ID NO 6); neo probe, 5′FAM-ACA TCG CAT CGA GCG AGC
ACG TAC-TAMRA3′ (SEQ ID NO 3). Additionally, the PDAR
control reagent human cyclophilin was used for normalization.
Samples were mixed briefly and placed in an ABI7700 (Applied
Biosystems) at 50 °C for 2 min; 60 °C for 30 min; and 95 °C for
5 min, with cycling parameters set to 94 °C and 20 s, 55 °C for 1
min for 40 cycles. The relative cDNA levels for neo and cyclophilin
were determined compared to DMSO-only treated controls and the
ratio of neo:cyclophilin was used for IC50 calculation (n ) 8).
Method for Negative Strand Replicon HCV-RNA Detection
in Replicon Cells.13 To achieve strand-specific detection, a primer
containing HCV RNA (or replicon RNA sequences such as
neomycin gene) and an 18 base tag of nonrelated sequence at the
5′ end was for the reverse transcription (RT) reaction: 5′ACAT-
GCGCGGCATCTAGACCGGCTACCTGCCCATTC3′ (SEQ ID
NO 4). A Thermoscript-RT-PCR system (Invitrogen) was used for
the room-temperature reaction according to the manufacturer’s
protocol, with approximately 9 µL of the cell-harvested RNA and
1 µL of primer (10 µM) incubated with room temperature at 60 °C
for 1 h. Following that incubation, 2 µL of cDNA product
containing the 5′ tag was amplified for TaqMan quantification using
48 µL of TaqMan Universal Master Mix (Applied Biosystems) as
well as the following primers: neo-forward tag, 5′ACA TGC GCG
GCA TCT AGA3′ (SEQ ID NO 5); neo reverse, 5′CCAGAT-
CATCCTGATCGACAAG3′ (SEQ ID NO 6); and neo probe,
References
(1) Choo, Q. L.; Kuo, G.; Weiner, A. J.; Overby, L. R.; Bradley, D. W.;
Houghton, M. Isolation of a cDNA clone derived from a blood-borne
non-A, non-B viral hepatitis genome. Science 1989, 244, 359-362.
(2) CDC Hepatitis C Fact Sheet 2003 http://www.cdc.gov/ncidod/
diseases/hepatitis/c/cfact.pdf.
(3) Saito, I.; Miyamura, T.; Ohbayashi, A.; Harada, H.; Katayama, T.;
Kikuchi, S.; Watanabe, Y.; Koi, S.; Onji, M. Hepatitis C virus
infection is associated with the development of hepatocellular
carcinoma. Proc. Natl. Acad. Sci. U.S.A. 1990, 87, 6547-6549.
(4) Hugle, T.; Cerny, A. Current therapy and new molecular approaches
to antiviral treatment and prevention of hepatitis C. ReV. Med. Virol.
2003, 13, 361-371.
(5) Clough, J. A ‘C’ change for hepatitis treatment. Drug Discuss. Today
2002, 7, 335-336.
(6) Harper, S.; Avolio, S.; Pacini, B.; Di Filippo, M.; Altamura, S.;
Tomei, L.; Paonessa, G.; Di Marco, S.; Carfi, A.; Giuliano, C.;
Padron, J.; Bonelli, F.; Migliaccio, G.; De Francesco, R.; Laufer,
M.; Rowley, M.; Narjes, F. Potent inhibitors of subgenomic hepatatis
C virus RNA replication through optimization of indole-N-acetamide
allosteric inhibitors of the viral NS5B polymerase. J. Med. Chem.
2005, 48, 4547-4557 and references therein.
(7) Condon, S. M.; LaPorte, M. G.; Herbertz, T. Allosteric inhibitors of
Hepatitis C NS5B RNA-dependent RNA polymerase. Curr. Med.
Chem.-Anti-InfectiVe Agents 2005, 4, 99-110 and references therein.
(8) Behrens, S. E.; Tomei, L.; de Francesco, R. Identification and
properties of the RNA-dependent RNA polymerase of hepatitis C
virus. EMBO J 1996, 15, 12-22.
(9) de Francesco, R.; Behrens, S. E.; Tomei, L.; Altamura, S.; Jiricny,
J. RNA-dependent RNA polymerase of hepatitis C virus. Methods
Enzymol. 1996, 275, 58-67.
(10) Ago, H.; Adachi, T.; Yoshida, A.; Yamamoto, M.; Habuka, N.;
Yatsunami, K.; Miyano, M. Crystal structure of the RNA-dependent
RNA polymerase of hepatitis C virus. Structure Fold. Des. 1999, 7,
1417-1426.
(11) Bressanelli, S.; Tomei, L.; Roussel, A.; Incitti, I.; Vitale, R. L.;
Mathieu, M.; de Francesco, R.; Rey, F. A. Crystal structure of the
RNA-dependent RNA polymerase of hepatitis C virus. Proc Natl.
Acad. Sci. U.S.A. 1999, 96, 13034-13039.
(12) Lesburg, C. A.; Cable, M. B.; Ferrari, E.; Hong, Z.; Mannarino, A.
F.; Weber, P. C. Crystal structure of the RNA-dependent RNA
polymerase from hepatitis C virus reveals a fully encircled active
site. Nat. Struct. Biol 1999, 6, 937-943.
(13) Dhanak, D.; Duffy, K. J.; Johnston, V. K.; Lin-Goerke, J.; Darcy,
M.; Shaw, A. N.; Gu, B.; Silverman, C.; Gates, A. T.; Nonnemacher,
M. R.; Earnshaw, D. L.; Casper, D. J.; Kaura, A.; Baker, A.;
Greenwood, C.; Gutshall, L. L.; Maley, D.; DelVecchio, A.;
Macarron, R.; Hofmann, G. A.; Alnoah, Z.; Cheng, H. Y.; Chan,
G.; Khandekar, S.; Keenan, R. M.; Sarisky, R. T. Identification and
biological characterization of heterocyclic inhibitors of the hepatitis
C virus RNA-dependent RNA polymerase. J. Biol. Chem. 2002, 277,
38322-38327.
(14) Ukrainets, I. V.; Taran, E. A.; Gorokhova, O. V.; Jaradat, N. A.;
Voronina, L. N.; Porokhnyak, I. V. 4-Hydroxy-2-quinolones. Part
42. Synthesis and biological activity of 1-substituted 2-oxo-3-(2H-
1,2,4-benzothiadiazine-1,1-dioxid-3-yl)-4-hydroxyquinolines. Chem.
Heterocycl. Compd. (Engl. Transl.) 2000, 36, 346-350.
(15) For a related reaction employing malonate nucleophiles see: Coppola,
G. M.; Damon, R. E.; Hardtmann, G. E. 4-Hydroxy-2-quinolinone-
3-carboxylic Acids. Synthesis 1981 391-392.

Potent Inhibitors of HCV RNA Polymerase
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 3 983
(16) Kovalenko, S. N.; Chernykh, V. P.; Shkarlat, A. E.; Ukrainets, I.
V.; Gridasov, V. I.; Rudnev, S. A. Recyclization of 2-imino-2H-1-
benzopyrans under the influence of nucleophilic reagents. 2. Reaction
of 2-iminocoumarin-3-carboxamides with o-aminobenzenesulfon-
amide. Chem. Heterocycl. Compd. (Engl. Transl.) 1999, 34, 791-
795.
(17) Hughes, D. L. The Mitsunobu reaction. Org. React. (New York) 1992,
42, 335-656.
(18) For the synthesis of a related 1,4-dihydro-2-quinazolinyl carbamate,
see: Rastogi, R.; Sharma, S. Synthesis of 2-substituted quinazolines
and quinazolones as potential anthelmintics. Indian J. Chem., Sect.
B 1982, 21B, 744-746.
(19) For the thermal condensation of isatoic anhydrides with aryl
isocyanate to form quinazolinediones, see: Reddy, C. K.; Reddy, P.
S. N.; Ratnam, C. V. Synthesis of 3-aryl-1H,3H-quinazolin-2,4-diones
and their 2-thio analogs. Indian J. Chem., Sect. B 1987, 26B, 882-
883.
(20) For recent developments see: Wakita, T.; Pietschmann, T.; Kato,
T.; Date, T.; Miyamoto, M.; Zhao, Z.; Murthy, K.; Habermann, A.;
Krausslich, H.-G.; Mizokami, M.; Bartenschlager, R.; Liang, T. J.
Production of infectious hepatitis C virus in tissue culture from a
cloned viral genome. Nat. Med. 2005, 11, 791-796.
(21) Luo, G.; Cunningham, M.; Kim, S.; Burn, T.; Lin, J.; Sinz, M.;
Hamilton, G.; Rizzo, C.; Jolley, S.; Gilbert, D.; Downey, A.; Mudra,
D.; Graham, R.; Carrol, K.; Xie, J.; Madan, A.; Parkinson, A.; Christ,
D.; Selling, B.; Lecluyse, E.; Gan, L.-S. CYP3A4 induction by
drugs: Correlation between a pregnane X receptor reporter gene assay
and CYP3A4 expression in human hepatocytes. Drug Metab. Dispos.
2002, 30, 795-804.
(22) Boffito, M.; Back, D. J.; Blaschke, T. F.; Rowland, M.; Bertz, R. J.;
Gerber, J. G.; Miller, V. Protein binding in antiretroviral therapies.
AIDS Res. Hum. RetroViruses 2003, 19, 825-835.
(23) Andrisano, M. G.; Di Bella, M.; Ferrari, P.; Raffa, L.; Baggio, G. G.
Heteroarylalkanoic acids with possible antiinflammatory action. II.
Farmaco Ed. Sci. 1981, 36, 905-915.
(24) Katsifis, A. G.; McPhee, M. E.; Mattner, F.; Ridley, D. D. Synthesis
of 123I-labeled analogues of imidazobenzodiazepine receptor ligands.
Aust. J. Chem. 1999, 52, 1061-1069.
JM050855S