Reliable chemical synthesis of oligoribonucleotides (RNA) with 2′-O-[(triisopropylsilyl)oxy]methyl(2′-O-tom)-protected phosphoramidites

Article abstract of DOI:10.1002/1522-2675(20011219)84:12<3773::AID-HLCA3773>3.0.CO;2-E

A method for the introduction of the 2′-O-[(triisopropylsilyl)oxy]methyl (=tom) group into N-acetylated, 5′-O-dimethoxytritylated ribonucleosides is presented. The corresponding 2′-O-tom-protected phosphoramidite building blocks were obtained in pure form and were successfully employed for the routine synthesis of oligoribonucleotides on DNA synthesizers. Under DNA coupling conditions (2.5 min coupling time for a 1.5-μmol synthesis scale) and with 5-(benzylthio)-1H-tetrazole (BTT) as activator, 2′-O-tom-protected phosphoramidites exhibited average coupling yields >99.4%. The combination of N-acetyl and 2′-O-tom protecting groups allowed a reliable and complete two-step deprotection, first with MeNH₂ in EtOH/H₂O and then with Bu₄NF in THF, without concomitant destruction of the product RNA sequences.

Full text of DOI:10.1002/1522-2675(20011219)84:12<3773::AID-HLCA3773>3.0.CO;2-E

Helvetica Chimica Acta Vol. 84 (2001)
3773
Reliable Chemical Synthesis of Oligoribonucleotides (RNA) with
2'-O-[(Triisopropylsilyl)oxy]methyl(2'-O-tom)-Protected Phosphoramidites
by Stefan Pitsch*a)1), Patrick A. Weissb), Luzi Jennyb), Alfred Stutza)1), and Xiaolin Wua)
a) Laboratorium f¸r Organische Chemie, ETHZ, Universit‰tstr. 16, CH-8092 Z¸rich
b) Xeragon AG, Technoparkstr. 1, CH-8005 Z¸rich
A method for the introduction of the 2'-O-[(triisopropylsilyl)oxy]methyl (ˆtom) group into N-acetylated,
5'-O-dimethoxytritylated ribonucleosides is presented. The corresponding 2'-O-tom-protected phosphoramidite
building blocks were obtained in pure form and were successfully employed for the routine synthesis of
oligoribonucleotides on DNA synthesizers. Under DNA coupling conditions (2.5 min coupling time for a 1.5-
mmol synthesis scale) and with 5-(benzylthio)-1H-tetrazole (BTT) as activator, 2'-O-tom-protected phosphor-
amidites exhibited average coupling yields > 99.4%. The combination of N-acetyl and 2'-O-tom protecting
groups allowed a reliable and complete two-step deprotection, first with MeNH2 in EtOH/H2O and then with
Bu4NF in THF, without concomitant destruction of the product RNA sequences.
1. Introduction. The chemical synthesis of nucleic acids has been automated and is
carried out on a solid phase by stepwise addition of appropriately activated and
protected nucleotide building blocks until the desired sequence has been obtained.
Subsequently, all protecting groups required during the assembly procedure are
removed and the product is cleaved from the solid support. Length and uniformity of
the product are limited by the coupling and deprotection efficiencies.
During the last decades, many research groups have successfully contributed to the
development of a reliable chemical synthesis of nucleic acids. As a consequence, the
synthesis of DNA oligonucleotides is probably the most evolved chemical process
known so far and has almost reached perfection in terms of efficiency and automation.
More than 107 DNA couplings/year are performed worldwide, and defined DNA
sequences are now available commercially, at low cost and within a very short time.
Currently, so-called phosphoramidite chemistry is carried out almost exclusively. It is
based on nucleoside 3'-(2-cyanoethyldiisopropylphosphoramidite) building blocks,
which are activated in situ by N-acids (usually 1H-tetrazoles); their coupling to the 5'-
OH group of the growing oligonucleotide chains results in phosphorous acid triesters
which are subsequently oxidized to the corresponding phosphoric acid triesters. This
concept was introduced 1975 by Letsinger et al. [1] and subsequently improved by
Caruthers et al. [2], Adams et al. [3], McBride and Caruthers [4], and Sinha et al. [5].
The 5'-O-positions of the phosphoramidite building blocks are usually protected by the
acid-labile 4,4'-dimethoxytrityl ((MeO)2Tr) group, which was introduced 1962 by
Khorana and co-workers [6], and which allows a convenient optical in-line monitoring
of the coupling efficiencies. The nucleophilic NH2 groups of the adenine, guanine and
cytosine nucleosides are typically masked by acylation. These nucleobase-protecting
1
¬
¬ ¬
)
Present address: Laboratoire de chimie des acides nucleiques, Ecole Polytechnique Federale de Lausanne
(EPFL), EPFL-BCH, CH-1015 Lausanne (e-mail: stefan.pitsch@epfl.ch).

3774
Helvetica Chimica Acta Vol. 84 (2001)
groups are removed after the assembly of the oligonucleotide, usually by treatment
with aqueous NH3 solution; simultaneously, the 2-cyanoethyl groups are removed by b-
elimination and the sequence is detached from the support.
This extremely powerful methodology can, in principle, also be applied to the
synthesis of the structurally very similar RNA oligonucleotides. Compared to DNA,
however, each nucleotide unit within an RNA strand contains an additional 2'-OH
group, which is responsible for the instability of RNA under basic conditions (pH > 12,
258) and which has to be protected during the assembly. Since the RNA products are
base-labile, the removal of these supplementary protecting groups is carried out
separately, after removing the 2-cyanoethyl groups, the nucleobase-protecting groups,
and the cleavage from the support under basic, nucleophilic conditions. As a
consequence, the choice of these additional 2'-O-protecting groups has to meet several
stringent requirements: their removal at the end of the synthesis must occur
quantitatively without partial destruction of the base-labile RNA sequence; they have
to be completely stable under all reaction conditions, specifically under acidic
conditions (removal of the (MeO)2Tr group within each coupling step) and under
the basic, nucleophilic deprotection conditions; they should be compatible and not
interfere with the phosphoramidite coupling reactions; their introduction into
monomers should be straightforward.
The large number of reported 2'-O-ribonucleoside protecting groups can essentially
be divided into acid- [7 9], photo- [10 13], and fluoride-labile groups [14 16].
Among them, the fluoride-labile (tert-butyl)dimethylsilyl (ˆtbdms) group, introduced
in 1973 by Ogilvie et al. [14], has found the widest application. However, several factors,
including the relatively low coupling yields of typically ꢀ 98.0% obtained with
corresponding building blocks (despite rather long coupling times of ca. 15 min), as
compared to > 99.5% with DNA phosphoramidites (coupling times of ca. 2 min only),
limited the length of routinely synthesized RNA sequences. A very attractive
alternative was the photolabile [(2-nitrobenzyl)oxy]methyl (ˆ nbm) group, introduced
in 1992 by Gough and co-workers [11], which led to coupling yields of ꢁ 99% under
DNA coupling conditions. The superior coupling behavior of nbm-protected building
blocks is presumably the result of the minimal steric demand of the nbm group,
achieved by connecting the photocleavable 2-nitrobenzyl protecting group via a
sterically nondemanding formaldehyde acetal linker to the 2'-O-position of the
ribonucleosides [11][16]. In 1997, we published a convenient method for the
introduction of the nbm group into 5'-O-dimethoxytritylated, base-protected ribonu-
cleosides [12]. Subsequently, we applied our synthetic method also to the introduction
of structurally related 2'-O-protecting groups yielding as a common feature a
formaldehyde acetal moiety.
We now describe in detail the preparation of 2'-O-{[(triisopropylsilyl)oxy]methyl}-
protected (ˆ2'-O-tom-protected) phosphoramidites of the four canonical ribonucleo-
sides and summarize all necessary information required for their application in the
routine synthesis of oligoribonucleotides. Preliminary results obtained with these novel
RNA building blocks were published previously [13][17 21].
2. Results. 2.1. 2'-O-tom-Protected Phosphoramidites. The preparation of the
phosphoramidite building blocks from the four ribonucleosides was carried out by

Helvetica Chimica Acta Vol. 84 (2001)
3775
stepwise introduction of the base-protecting acetyl group, the 5'-O-(MeO)2Tr group,
the tom group, and finally the 3'-(2-cyanoethyl diisopropylphosphoramidite) moiety
(Scheme 1).
Scheme 1
BASE
Yield [%]
BASE Yield [%]
HO
BASE
(MeO)2TrO
BASE
a)
b)
c)
CAc
AAc
GAc
1
2
3
70 (2 steps)
O
O
CAc
AAc
GAc
U
C
A
G
U
(not isol.)
80
75
4
5
6
7
d)
75
80
80
HO OH
HO OH
e)
(MeO)2TrO
BASE
(MeO)2TrO
BASE
O
O
iPr3SiO
O
OH
HO
O
OSiiPr3
g)
g)
(12)
14,15,17
f) (10-13)
(MeO)2TrO
iPr3SiO
BASE
(MeO)2TrO
GAc
O
(MeO)2TrO
BASE
O
O
O
O
O
O
OSiiPr3
O
O
O
OSiiPr3
BASE Yield [%]
NC
P
O
(CH2)5
O
O
22
23
24
CAc
65
NiPr2
(CH2)5
25 (60%)
AAc
60
O
70
U
BASE Yield [%]
X
X
18
19
20
21
CAc
94
AAc
93
X =
X =
CPG
GAc
h)
90
500Å: 30 µmol/g
1000Å: 20 µmol/g
O2N
O-
NH-
92
U
a) Ac2O, DMF, 258. b) 1. Me3SiCl, Py, 4 258; 2. Ac2O, Py, 48; 3. AcOH, MeOH, À208. c) 1. Ac2O, Py, DMF,
reflux; 2. NaOH, THF, MeOH, H2O, 258. d) (MeO)2TrCl, Py, 258. e) See Scheme 2. f) 2-Cyanoethyl
diisopropylphosphoramidochloridite, iPr2NEt, CH2Cl2, 258. g) Bis(4-nitrophenyl) heptanedioate, Py, N,N-
dimethylpyridin-4-amine (DMAP), 258. h) 1. Long-chain-alkylamino CPG, iPr2NEt, DMF, 258; 2. Ac2O, Py, 258.
The synthesis of N4-acetylcytidine (1) was carried out by selective N-acetylation of
cytidine with Ac2O in DMF as described in [22], but in much less solvent. After partial
removal of the DMF, the crude product was directly transformed into its 5'-O-
dimethoxytritylated derivative 4 with (MeO)2TrCl/pyridine. N6-Acetyladenosine (2)
was synthesized by modification of an established procedure [23], involving first
trimethylsilylation of the OH groups with Me3SiCl/pyridine, followed by acetylation of
the NH2 group with Ac2O, extractive workup, and cleavage of the trimethylsilyl ethers
with AcOH in MeOH. A convenient synthesis of N2-acetylguanosine (3) was achieved
by peracetylation of guanosine with Ac2O in DMF/pyridine, followed by cleavage of
the O-bound Ac groups with NaOH in THF/MeOH/H2O. The introduction of the 5'-O-
(MeO)2Tr group into the nucleobase-protected nucleosides 1 3 and into uridine was
carried out under standard conditions with (MeO)2TrCl pyridine and gave the 5'-O-
protected nucleosides 4 7 in good yields. DMF was used as a cosolvent in the reactions
with the cytidine and guanosine derivatives 1 and 3 (Scheme 1).

3776
Helvetica Chimica Acta Vol. 84 (2001)
The tom group was introduced into the protected ribonucleosides 4 7 under the
conditions we had earlier developed for the introduction of the nbm group [12]
(Scheme 2). The reagent [(triisopropylsilyl)oxy]methyl chloride (tom-Cl; 9) was
synthesized by modifying the general procedure for the synthesis of [(trialkylsilyl)-
oxy]methyl chlorides by Benneche and co-workers: silylation of (ethylthio)methanol
[24][25] with triisopropylsilyl chloride/1H-imidazole in CH2Cl2 gave, after extraction
and distillation, the silylated derivative 8 in good yield. This intermediate was
transformed with SO2Cl2 in CH2Cl2 into tom-Cl (9) according to [26]. By distillation
below 708, 9 was isolated in an excellent yield.
Scheme 2. Preparation of tom-Cl (9) and Introduction of the tom Group into Protected Ribonucleosides
SO2Cl2,
NaOH (cat.)
iPr3SiCl, imidazole
CH2Cl2
S
OH
S
O
Cl
O
(CH2O)x
+ EtSH
Si
Si
40°, 1 h
CH2Cl2, 25°, 14 h
25°, 1 h
8 (85%)
(9) tom-Cl (95%)
(not isolated)
(MeO)2TrO
BASE
(MeO)2TrO
BASE
O
O
1) Bu2SnCl2, iPr2NEt
ClCH2CH2Cl, 25°, 1 h
O
O
HO OH
4 - 7
Sn Cl HNiPr2Et
H9C4 C4H9
(not isolated)
2) tom-Cl (9), 80°, 15 min
3) Aqueous work-up
Yield*)
[%]
Yield*)
[%]
(MeO)2TrO
BASE
(MeO)2TrO
BASE
BASE
O
O
CAc
45
40
60
40
30
25
5
14
15
16
17
10
11
12
13
AAc
GAc
U
O
O
OH
HO
O
O
Si
Si
25
*) 15% 4, 25% 5, 20% 6, 25% 7 recovered
Alkylation of the diol moieties of the ribonucleosides 4 7 was achieved by first
forming their cyclic 2',3'-O-dibutylstannylidene derivatives under basic conditions with
Bu2SnCl2/iPr2NEt in 1,2-dichloroethane for 1 h at 258. These activated intermediates
were subsequently treated with 1.1 1.3 equiv. of tom-Cl (9) at 808 for 20 min. After
aqueous workup, the 2'-O- and 3'-O-alkylated nucleosides 10 13 and 14 17,
respectively, were isolated both in pure form by chromatography on silica gel
(unreacted starting materials 4 7 could also be recovered). Under these optimized
reaction conditions, side reactions (alkylation of the base moieties) were observed only
to a very small extent (< 5%). Fair to good yields of the desired 2'-O-alkylated products
10 13 besides various amounts of the 3'-O-alkylated isomers 14 17 were obtained. In
all cases, the predominant, first eluting isomer was the 2'-O-alkylated compound. The
1
unambiguous identification of the products was carried out by H-NMR spectroscopy
and irradiation experiments according to [12].

Helvetica Chimica Acta Vol. 84 (2001)
3777
Alkylation of the dialkylstannylated derivatives of nucleosides 4 7 with tom-Cl (9) occurred under a
variety of reaction conditions. Performing the reaction at 808 in 1,2-dichloroethane as solvent favored the
formation of the 2'-O-alkylated products 10 13, whereas, at lower temperatures and with other solvents (THF,
MeCN, C6H6), formation of the 3'-O-alkylated products 14 17 predominated. Slightly higher yields (5 10%)
t
of the nucleosides 10 13 were obtained by forming the stannylated nucleosides with Bu2SnCl2 instead of
Bu2SnCl2. However, since tBu2SnCl2 is very expensive, we used it only for the alkylation of precious nucleosides.
Under our preferred reaction conditions, with only 1.1 1.3 equiv. of tom-Cl (9), a significant portion of starting
material was recovered. Still, employing a larger excess of 9 did not result in better product yields, but only in
the formation of more nucleobase-alkylated by-products.
The 2'-O-tom-protected intermediates 10 13 were converted with 2-cyanoethyl
diisopropylphosphoramidochloridite/iPr2NEt into the corresponding phosphoramidite
building blocks 18 21 (Scheme 1). In Fig. 1, the 31P-NMR spectrum of the regular
Fig. 1. 31P-NMR Spectrum a) of the regular phosphoramidite 20 (prepared from the 2'-O-tom-protected
nucleoside 12) and b) of its regioisomer (prepared from the 3'-O-tom-protected nucleoside 16), demonstrating
the purity of the RNA building block 20

3778
Helvetica Chimica Acta Vol. 84 (2001)
guanosine 3'-phosphoramidite 20 is shown together with that of its 2'-regioisomer
(prepared from the 3'-O-tom-substituted guanine nucleoside 16 for comparison).
Analogous analyses were also carried out with the three other phosphoramidites 18, 19,
and 21. They all established the absence of regioisomeric phosphoramidites that, upon
incorporation into oligonucleotides, would lead to the formation of undesired 2' ! 5'
phosphodiester linkages.
The solid supports were synthesized by first preparing the 2'-(nitrophenyl
heptanedioates) 22 24 from the 3'-O-alkylated nucleosides 14, 15, and 17, respectively,
and the 3'-(nitrophenyl heptanedioate) 25 from the 2'-O-alkylated guanosine
derivative 12, and then immobilizing these activated esters on (aminoalkyl)-function-
alized controlled-pore glass (CPG) (Scheme 1). With 500-ä and 1000-ä CPG
materials, typical loadings of 30 and 20 mmol/g, respectively, were obtained.
The compounds 2 25 were fully characterized by TLC, [a]D, IR, UV, 1H-, 13C-, and
31P-NMR, and FAB-MS (see Exper. Part).
For protection of the exocyclic NH2 functions of the nucleobases, we have chosen
the Ac group, which, as a protecting group for cytosine nucleosides, is already used in
combination with a convenient deprotection scheme involving a mixture of aqueous
NH3 solution and MeNH2 [22]. Prior to the synthesis of oligonucleotides, we
established the conditions required for the removal of the base-protecting Ac groups
with MeNH2 (10m in H2O/EtOH 1:1, 258). By UV measurements and reversed-phase
HPLC, we determined half-lives of < 2 min for the 2'-O-tom-protected N4-acetyl-
cytidine and N6-acetyladenosine derivatives, and a half-life of 4 min for the 2'-O-tom-
protected N2-acetylguanosine, respectively (Scheme 3). These values indicated that
complete base-deprotection of oligonucleotide sequences can be achieved within 1 h
(equal to 15 half-lives for the acetylated guanosine residues) and demonstrated that the
Ac group, in combination with MeNH2, is indeed suited for a labile universal
nucleobase protection. Under the deprotection conditions with MeNH2, the 2'-O-tom
group was completely stable for a period of at least 48 h. Analogous model experiments
for the removal of the 2'-O-tom protecting group were then carried out and the
products analyzed by TLC, reversed-phase HPLC, and 1H-NMR. With an excess of 1m
Bu4NF ¥ 3 H2O in THFat 258, the four deacetylated 2'-O-tom-protected ribonucleosides
were deprotected completely and cleanly within < 5 min (Scheme 3).
Scheme 3. Stepwise Deprotection of Nucleobase- and 2'-O-tom-Protected Ribonucleosides. The reactions were
1
followed by TLC, reversed-phase HPLC, and H-NMR.
10M MeNH2
H2O/EtOH 1:1, 25°
1M TBu4NF.3H2O
BASE
Ac, AAc
GAc
BASE
C, A
G
HO
BASE
HO
BASE
O
O
THF, 25°
C
t1/2 < 2 min
t1/2 = 4 min
completed in < 5 min
HO
O
OSiiPr3
HO OH
U
2.2. Oligoribonucleotides. Fortunately, already our first RNA syntheses with 2'-O-
tom-protected phosphoramidites showed very good coupling yields and indicated a
very clean and reliable deprotection process. Subsequently, we optimized all feasible
reaction and deprotection parameters, to identify the scope of our new building blocks
for RNA synthesis. First, we tested a variety of different known activators for the
phosphoramidite coupling reaction; we found (by detritylation assay) the following

Helvetica Chimica Acta Vol. 84 (2001)
3779
coupling-efficiency order: 5-(ethylthio)-1H-tetrazole ꢁ 5-(methylthio)-1H-tetrazole >
5-(4-nitrophenyl)-1H-tetrazole > DCI (1H-imidazole-4,5-dicarbonitrile) > 1H-tetra-
zole. The two (alkylthio)tetrazoles clearly showed the best results (coupling yields ꢁ
99%). Even better results were obtained with 5-(benzylthio)-1H-tetrazole (BTT)
(synthesized according to [27]) as activator. This compound is slightly more acidic
(pKa ˆ 4.1 [27]) than 5-(ethylthio)- and 5-(methylthio)-1H-tetrazole (pKa ˆ 4.3 [27]),
crystallizes readily from MeCN/toluene, and allows the preparation of up to 0.4m
solutions in MeCN.
Next, the amounts of phosphoramidites and the coupling times were optimized. We
found that a minimal amount of 6 equiv. of phosphoramidites/1.5 min coupling time or
of 2.5 equiv. of phosphoramidites/7 min coupling time on a 1.5-mmol or 10-mmol scale,
respectively, were required to obtain reproducible coupling yields of > 99%; fewer
equivalents or shorter coupling times resulted in lower yields, whereas more
equivalents and/or longer coupling times did not enhance the coupling yields
significantly. Finally, we established our coupling conditions for the routine assembly
of RNA sequences with 2'-O-tom phosphoramidites, which are presented in Scheme 4.
Additionally, we found that, with conventional CPG supports (containing succinate-
linked nucleosides), the coupling yields within the first ten coupling reactions increased
steadily from ꢁ 95% to the average yields of > 99%. With our supports (containing
heptanedioate-linked nucleosides, see Scheme 1), however, coupling yields > 99%
were obtained from the beginning and independent of the sequence length.
Scheme 4. Reagents and Conditions for the Assembly of RNA Sequences on a DNA Synthesizer
(MeO)2TrO
BASE*
Otom
(MeO)2TrO
BASE*
O
O
O
P
O
Otom
O
NC
NC
O
O
P
(MeO)2TrO
BASE*
HO
BASE*
O
BASE*
O
BASE*
O
a) Detritylation
O
b) Coupling
O
c) Capping
d) Oxidation
O
tomO
O
tomO
O
tomO
O
tomO O
O
O
O
O
O
O
O
O
(CH2)5
HN
CPG
(CH2)5
HN
CPG
(CH2)5
HN
CPG
(CH2)5
HN
CPG
a) Detritylation with 4% dichloroacetic acid in ClCH2CH2Cl (1.5-mmol scale: 1.5 min; 10-mmol scale: 4 min). b)
Coupling with 0.1m phosphoramidite in MeCN, promoted by 0.25m BTT in MeCN (1.5-mmol scale: 0.1 ml ‡
0.4 ml, 2.5 min; 10-mmol scale: 0.4 ml ‡ 0.6 ml, 7 min). c) Capping with Ac2O/2,6-lutidine (ˆ2,6-dimethylpyr-
idine)/THF 1:1:8 and 16% (v/v) 1-methyl-1H-imidazole/THF in a 1:1 ratio (1.5-mmol scale: 1 min; 10-mmol
scale: 3 min). d) Oxidation with I2/H2O/Py/THF 3 :2 :20 :75 (1.5-mmol scale: 0.7 min; 10-mmol scale: 2.5 min).
Under the conditions shown in Scheme 4, stable and reproducible individual
coupling yields between 99.0 and 99.9% (1.5- and 10-mmol scale, resp.) were obtained;
the average value (determined from a number of meanwhile > 50000 couplings) was
99.4%. Under identical conditions, commercially available 2'-O-methyl-RNA and
DNA phosphoramidites exhibited similar average coupling yields of ꢁ 99.5 and ꢁ
99.7%, respectively. In Fig. 2, the anion-exchange (ˆAE) HPLC of a crude 47mer

3780
Helvetica Chimica Acta Vol. 84 (2001)
Fig. 2. AE-HPLC Traces a) of the oligoribonucleotide r(CAGXAGXXCCAAXCGACCXGXCGACGGX-
CGGXCGCCGAGGXGCGXAA) and b) of the corresponding oligodeoxyribonucleotide (47mers), assembled
under identical conditions (see Scheme 4). The DNA sequence (X ˆ T) was prepared from commercial DNA
phosphoramidites, and the RNA sequence (X ˆ U) was prepared from the 2'-O-tom-protected phosphor-
amidites 18 21. For AE-HPLC conditions, see Exper. Part (A ! A/B 1:4 within 60 min); UV detection at
260 nm.
RNA oligonucleotide (prepared under the conditions of Scheme 4) is shown, together
with the trace of a crude 47mer DNA oligonucleotide of the same sequence and
prepared under identical coupling conditions. The similarity of the two traces indicates
a similar reaction course and, specifically, comparable coupling efficiencies achieved
with DNA and 2'-O-tom-protected RNA phosphoramidites.
To establish the deprotection conditions, model experiments similar to those
described for the nucleosides in Scheme 3 were carried out with oligoribonucleotides
(see Scheme 5). In Fig. 3, reversed-phase HPLC traces from a crude 18mer RNA
sequence, obtained under different deprotection conditions are presented. The
synthesis of this oligonucleotide was carried out on a 10-mmol scale according to
Scheme 4. Aliquots of the solid support (ꢁ1 mmol each) were then treated with 10m
MeNH2 in H2O/EtOH 1:1 (0.5 ml) at 258, the supernatants evaporated, and the
residues treated with 1m Bu4NF ¥ 3 H2O in THF (0.5 ml) at 258. After quenching with 1m
Tris ¥ HCl buffer (pH 7.4; 0.5 ml) and desalting (see Exper. Part), the crude samples
were analyzed by reversed-phase HPLC. Already under short-time deprotection
conditions, i.e. 1 h MeNH2/1 h Bu4NF, quantitative removal of all protecting groups and
formation of a uniform product was observed (Fig. 3, center); importantly, identical
results were obtained after prolonged treatment with MeNH2 for 24 h (Fig. 3, left) or
with Bu4NF for 50 h (Fig. 3, right), respectively.
The proposed mechanism of the fluoride-induced removal of a tom protecting
group is shown in Scheme 5. Attack of FÀ at the Si-atom results in cleavage of the SiÀO
bond and formation of a formaldehyde hemiacetal anion. During the deprotection
reaction or upon addition of aqueous buffer solution, this intermediate then undergoes
fragmentation to the ribonucleoside moiety and formaldehyde.
We later found that some 2'-O-tom-protected oligonucleotides, specifically
adenosine-rich sequences and DNA/RNA hybrid sequences, were only slightly soluble
in THF. Still, they could be deprotected with 1m Bu4NF ¥ 3 H2O or Et4NF ¥ 2 H2O in

Helvetica Chimica Acta Vol. 84 (2001)
3781
Scheme 5. Stepwise Deprotection of the RNA Sequence r(GUAUCGAGCCUACG) with Variation of the
Reaction Times. The reactions were followed by reversed-phase HPLC (see Fig. 3)
1M TBu4NF.3H2O
THF
O
BASEAc
O
BASE
O
BASE
10M MeNH2
EtOH/H2O 1:1
O
O
O
1-24 h, 25°
1-50 h, 25°
O
Otom
O
O
Otom
O
O OH
NC
O
P
O
P
O
P
O
then 1M Tris·HCl,
H2O, pH 7.4
n
n
n
O
BASEAc
O
BASE
O
BASE
O
O
O
tomO
O
tomO OH
OSiiPr3
HO OH
O
O
(CH2)5
HN
CPG
H2O
F
O
2'
OH
2'
O
2'
O
RNH3
H
Fig. 3. Reversed-phase HPLC traces of the crude RNA sequence r(GUAUCGAGCCUACG) (18mer),
assembled under standard conditions (see Scheme 4; 10-mmol scale) and deprotected according to the conditions
given in the Table, but with different deprotection times. For reversed-phase HPLC conditions, see Exper. Part
(A ! A/B 7 :3 within 30 min); UV detection at 260 nm.
DMSO, DMF, and NMP (1-methylpyrrolidin-2-one), or mixtures of these solvents with
THF (often the addition of a few drops of one of the above-mentioned polar solvents to
the THF deprotection solution was sufficient to solubilize the oligonucleotide). Even
the addition of up to 20% H2O to the Bu4NF/THF deprotection solution still led to a
quantitative removal of the 2'-O-tom groups within a few hours. As an illustration, the
almost identical capillary-electrophoresis (CE) traces of a crude 69mer RNA sequence
(containing one DNA nucleoside), deprotected under standard conditions (1m Bu4NF ¥
3 H2O, 258, 14 h) in THF or THF/H2O 4 :1 are presented in Fig. 4.
Meanwhile, we have developed robust deprotection conditions, which are listed in
the Table. Depending on the synthesis scale and the length of the product sequence, the
minimal amount of deprotection solution, the reaction temperature, and the reaction
time were varied. Following these empirically determined conditions, we never

3782
Helvetica Chimica Acta Vol. 84 (2001)
Fig. 4. Capillary electrophoresis of the crude sequence r(GCGC)dAr(GUACUGUUUCUCAAACAGC-
GAAGCGCGCCAGGGAAACACACCAUGUGUGGUAUAUUAUCUGGCA) (69mer), assembled under
standard conditions (see Scheme 4) and deprotected first with 10m MeNH2 (H2O/EtOH 1:1, 258, 6 h), followed
by 1m Bu4NF ¥ 3 H2O (258, 14 h) a) in THF and b) in THF/H2O 4 :1. For CE conditions, see Exper. Part; UV
detection at 260 nm.
Table. Minimal Deprotection Conditions Depending on the Synthesis Scale and on the Sequence Length, for RNA
Sequences Prepared from N-Acetylated, 2'-O-tom-Protected Building Blocks. For further details, see Exper. Part.
Deprotection
conditions
1.5-mmol Scale
< 20mer
10-mmol Scale
< 20mer
< 50mer
> 50mer
< 50mer
> 50mer
1) 10m MeNH2
0.5 ml, 258, 3 h 1 ml, 358, 4 h 1.5 ml, 358, 6 h 4 ml, 258, 4 h 4 ml, 358, 5 h 5 ml, 358, 6 h
(EtOH/H2O 1 : 1)
2) 1m Bu4NF ¥ 3 H2O 0.5 ml, 258, 5 h 1 ml, 258, 10 h 1.5 ml, 308, 14 h 3 ml, 258, 5 h 4 ml, 258, 10 h 5 ml, 308, 14 h
(THF)
observed indications of incomplete deprotection and/or for concomitant strand
scission.
After the second deprotection process with Bu4NF, the reactions were quenched by
addition of an equal volume of 1m Tris ¥ HCl buffer (pH 7.4). Subsequently, the excess
Bu4NF was removed by chromatography on Sephadex G-10 or on NAP cartridges
(Pharmacia). The thus obtained crude products were isolated either by evaporation, by
precipitation with aqueous NaOAc solution/EtOH or by purification by HPLC
polyacrylamide-gel electrophoresis (PAGE). In Fig. 5, the CE trace of a crude 84mer
sequence and, in Fig. 6, the PAGE analysis of five crude products with sequence lengths
between 81 and 40 are presented (all products were synthesized on a 1.5-mmol scale).
Depending on the sequence length, overall coupling yields of 60 80% were obtained
in these syntheses (trityl assay). The amounts of crude products ranged from 250 to
600 OD260 (8 19 mg). In all examples, the main product corresponded to the

Helvetica Chimica Acta Vol. 84 (2001)
3783
Fig. 5. Capillary electrophoresis of the crude RNA sequence r(GGCCGGCAUGGUCCCAGCCUCCUCG-
CUGGCGCCGGCUGGGCAACAUUCCGAGGGGACCGUCCCCUCGGUAAUGGGCGAAUGGAC)
(84mer), assembled and deprotected under standard conditions (see Scheme 4 and Table). For CE conditions,
see Exper. Part; UV detection at 260 nm.
completely deprotected full-length sequence. After purification of these crude products
by prep. gel electrophoresis or anion-exchange HPLC, 50 120 OD260 (2 4 mg) of
purified product sequences were obtained, which is equivalent to an overall yield of
20 40%.
The identity of the product RNA sequences was determined by various methods.
Purified products (up to a sequence length of 40) were routinely characterized by
MALDI-TOF mass spectrometry. In all such analyses, the products exhibited the
correct mass, indicating the correct sequence composition and the absence of
protecting groups. Several MS data of RNA sequences prepared from 2'-O-tom
phosphoramidites are published [13][18 21][28]. In Fig. 7, the MALDI-TOF mass
spectrum (positive mode) of a 35mer RNA sequence is presented. The sharp signals at
m/z 11254 and 5628 amu agree very well with the calculated mass of 11255 amu for
‡
[M ‡ H] and 5627 amu for [M ‡ 2 H]2‡, respectively.
We routinely carried out enzymatic digestion experiments of crude and purified
RNA sequences according to [30]. The phosphodiesters were cleaved with nuclease P1
(which cleaves only natural 3' ! 5' phosphodiester bonds [30][31]), and the resulting
nucleotides were subsequently dephosphorylated with alkaline phosphatase. In Fig. 8,
the reversed-phase HPLC traces of the products of such experiments, performed with
the five crude RNA sequences from Fig. 6, are presented. In all examples, only the
peaks corresponding to the four ribonucleosides are visible. This result indicates first
the complete absence of any unnatural connections, such as 2' ! 5' phosphodiester
linkages and branched sequences, second the complete removal of all sugar and
nucleobase protecting groups, and third the full integrity of the nucleosides during the
phosphoramidite synthesis, the sequence assembly, and the two deprotection reactions.
Additionally, some functional and biologically active RNA sequences prepared
from 2'-O-tom-protected phosphoramidites have been reported in the literature. The
synthesis and pairing properties of RNA analogues containing flexible linkers was

3784
Helvetica Chimica Acta Vol. 84 (2001)
Fig. 6. PAGE (ethidium-bromide staining) of five crude products, assembled and deproteced under standard
conditions (see Scheme 4 and Table): r(CCAAUCAACCUAAAACUUACACACUACAGACAUUG-
CACGGCGCUGUCUGGGACGUACUAAAACAGCAUCAACGUGACACUU) (81mer), r(GCUCCUAUA-
GUGUAGCGGUUAUCACCUCGGACUCUGAAUCCGAAACCCUGGUUCGAGUCCAGGUAGGAGUG-
CCA) (75mer), r(CCAAAAUCAACCUAAAACUUACACACCGUACAGACAUUGCACCUGGCGCUGU-
CUGGG) (57mer), r(CUACUUAGUGGUUCAGCUACAAUUCUUCUCCUUAACUACACCACAAUGC-
AAGCCC) (55mer), and r(GUAAUGAUGGCAGGGCGUACCGAUAUACGAACAACAUUAA) (40mer).
PAGE conditions: see Exper. Part.
reported by Micura and co-workers [32 35], ribozyme activity was demonstrated by us
[13], binding studies and NMR experiments of a RNA-protein complex were carried
out by Huenges et al. [36], RNase P mediated cleavage of a hairpin-loop structure was
investigated by Br‰nnvall et al. [37], and investigations concerning the aminoacylation
activity and specificity were carried out by Nagan et al. [38].
3. Discussion. The tom group displays some unique properties, which render it a
very valuable 2'-O-protecting group for the chemical synthesis of oligoribonucleotides.
It is completely stable under all reaction conditions required for the assembly and the
deprotection of RNA sequences. The excellent stability of the tom group, towards both
strongly acidic conditions (employed during the detritylation reactions) and strongly
basic conditions (employed for the deprotection of the nucleobase-protecting groups)
is a consequence of the sterically very hindered triisopropylsilyl moiety. To the contrary,

Helvetica Chimica Acta Vol. 84 (2001)
3785
Fig. 7. MALDI-TOF-MS (positive mode) of the sequence r(GGUCGCCGAGGUGCGUAAAUGCUAUG-
‡
GUAUCCGUU) (35mer), after purification by AE-HPLC. [M ‡ H] , calc. at m/z 11255 amu; [M ‡ 2 H]2‡, calc.
at m/z 5628 amu. MS measured according to [29].
Fig. 8. Reversed-phase HPLC of the products obtained by digestion of the five crude RNA sequences from Fig. 6
with nuclease P1/bacterial alkaline phosphatase (according to [30]). A ˆ adenosine, C ˆ cytidine, G ˆ guano-
sine, U ˆ uridine. For reversed-phase HPLC conditions, see Exper. Part (A/C 96 :4 ! A/C 93 :7 within 6 min,
then ! A/B/C 87:6 :7 within 4 min, then ! A/B/C 81:12 :7 within 20 min)
the tom group is very labile towards Bu4NF and is completely removed, even in the
presence of up to 20% H2O. Complete removal of the tbdms group, in contrast, occurs
only in the absence of H2O, and requires drying of the Bu4NF solution with molecular
sieves [39]. This difference in the reactivity of the two protecting groups can be
attributed to the nature of the leaving groups. The deprotonated formaldehyde
hemiacetals, which are formed upon cleaving the tom groups (see Scheme 5), have pKa

3786
Helvetica Chimica Acta Vol. 84 (2001)
values of ca. 10.5 and are, therefore, much better leaving groups then the alcoholates,
formed upon cleaving the tbdms groups. We have indications that, during the
deprotection of the 2'-O-tom groups with Bu4NF, some formaldehyde hemiacetal
groups remain attached to the 2'-O positions; during the aqueous workup with Tris
buffer, however, they are removed immediately and completely.
Many interesting RNA sequences, such as t-RNAs, ribozymes, and aptamers consist
of 60 to 80 nucleotides. To obtain a reasonable overall coupling yield of ꢁ 50%, an
individual coupling yield of ꢁ 99.3% must be achieved during their assembly. Lower
yields result not only in small product quantities, but also in complex crude products,
which are often very difficult to purify to homogeneity. The average coupling yields
obtained with 2'-O-tom phosphoramidites are in the range of ꢁ 99.5%, and, therefore,
even relatively long RNA sequences can be prepared routinely. These excellent
coupling yields are most probably the consequence of the minimal steric demand of the
tom protecting group, obtained by connecting the fluoride-labile triisopropylsilyl group
and the nucleoside by a small formaldehyde acetal linker.
In addition to hgh coupling yields, a reliable deprotection scheme is crucial for the
efficient synthesis of longer sequences. Our combination of protecting groups allows,
for both required deprotection processes, reaction times that correspond to more than
100 individual half-lives (with respect to the removal of one protecting group) without
destruction of the oligonucleotide product. Therefore, it is possible to carry out the
deprotection reactions even for extremely prolonged periods of time, assuring
complete deprotection without risking concomitant destruction of the product.
The separation of the two regioisomeric tom-substituted ribonucleosides, formed
during the dibutyltin-mediated alkylation reaction, is straightforward and leads to
uniform products. In contrast to the tbdms protecting group, the tom group does not
migrate from the 2'-O to the 3'-O position, even under strongly basic conditions. These
factors allow the routine preparation of very pure phosphoramidites, which hence
result in the exclusive formation of 3' ! 5' phosphodiester moieties. Furthermore, due
to the stability of the 2'-O-tom group, a variety of nucleobase and sugar manipulations
can be carried out after its introduction. Therefore, we were able to carry out short and
convergent syntheses of ribonucleoside analogues [18][19] and of building blocks with
different nucleobase-protecting groups [21].
The chemical synthesis of oligonucleotides allows the more or less unrestricted
incorporation of nucleobase, sugar, and backbone modifications, the preparation of
hybrid sequences, and the labeling with specific reporter groups. By having adapted our
RNA chemistry to the established DNA chemistry, the 2'-O-tom-protected building
blocks can be combined with all of these modifications and even with 2'-O-tbdms-
protected RNA phosphoramidites [28].
This work was supported by the ETH Z¸rich.
Experimental Part
General. Reagents and solvents (Py ˆ pyridine) from Fluka, enzymes from Sigma, unless otherwise stated;
DNA phosphoramidites and supports from Glen Research; 5-(benzylthio)-1H-tetrazole (BTT) was synthesized
according to [27]. Workup implies partitioning of the reaction mixture between CH2Cl2 and sat. aq. NaHCO3
soln., drying of the org. layer (MgSO4), and evaporation. TLC: precoated silica gel plates from Merck, stained

Helvetica Chimica Acta Vol. 84 (2001)
3787
by dipping into a soln. of anisaldehyde (10 ml), conc. H2SO4 soln. (10 ml), and AcOH (2 ml) in EtOH (180 ml)
and subsequent heating with a heat gun. CC (column chromatography): silica gel 60 (230 400 mesh) from
Fluka. Reversed-phase HPLC: LiChrosphere 100 RP-18 (4.0 Â 250 mm; Merck), flow 1 ml/min, elution at 408;
eluent A 0.1m (Et3NH)OAc in H2O (pH 7), eluent B MeCN, eluent C MeOH; detection at 260 nm. Anion-
exchange (AE) HPLC: DNAPAC PA-100 (4 Â 250 nm; Dionex), flow 0.75 ml/min; eluent A: 2 mm Tris ¥ HCl
(pH 7.4), 10 mm NaClO4, 6m urea; eluent B: 2 mm Tris ¥ HCl (pH 7.4), 0.55m NaClO4, 6m urea; detection at
260 nm, elution at 808. Capillary electrophoresis (CE): BioFocus 3000 (Biorad) with coated BioCap-XL column
(75 mm  40 cm), −run buffer× (No. 184-5026) ‡ 6m urea, injection with pressure, elution with 15 kV at 408,
detection at 260 nm. Polyacrylamide-gel electrophoresis (PAGE): 15% acrylamide (acrylamide/bisacrylamide
29 :1), 0.75 Â 100 mm, 90 mm Tris ¥ borate (pH 8.3), 7m urea, 2 mm EDTA, elution at 200 V, stained with
ethidium bromide. Optical rotation ([a]2D5 ): Jasco DIP-370, c in g/100 ml. UV Spectra: Uvikon 931; lmax in nm, e
in dm3/mol/cm; all measurements at 258. IR Spectra: nÄ in cmÀ1. NMR: chemical shift d in ppm, coupling
constants J in Hz. MS: VG-ZAB2-SEQ; FAB pos. mode; 3-nitrobenzyl alcohol as matrix; m/z (rel. %).
Oligonucleotide Synthesis and Deprotection. The oligonucleotides were assembled on a Pharmacia Gene
Assembler Plus under the conditions given in Scheme 4. HPLC-Grade MeCN was dried by refluxing in the
presence of CaH2 (24 h). Prior to the assembly, the phosphoramidite solns. (0.1m in MeCN), the BTT soln.
(0.25m in MeCN), and the MeCN were stored over 4-ä molecular sieves for 14 h. CPG Supports with a pore size
of 500 and 1000 ä were used for the synthesis of ꢀ 47mers and > 47mers, respectively. All syntheses were
carried out in the −trityl-off× mode.
After the assembly, the solid supports were removed from the cartridges and treated with an equal volume
of 12m MeNH2 in H2O and 8m MeNH2 in EtOH according to the conditions given in the Table. By
centrifugation, the supernatant solns. were separated from the solid supports, evaporated and treated with 1m
Bu4NF ¥ 3 H2O in THF according to the conditions given in the Table. Upon vortexing, the 2'-O-tom-protected
oligonucleotide intermediates dissolved immediately. The reactions were quenched by addition of an equal
volume of 1m Tris ¥ HCl buffer (pH 7.4), and the products were desalted by chromatography (Sephadex G-10,
1.5 Â 25 cm, H2O, 1 ml/min) or on NAP columns (Pharmacia) according to the manufacturer×s instructions. The
UV-absorbing fractions were pooled, evaporated, and precipitated with 0.3m aq. NaOAc/EtOH 1:8.
N6-Acetyladenosine (2). At 48, Me3SiCl (473 ml, 3.7 mol) was added dropwise to a suspension of adenosine
(100 g, 0.37 mol) in Py (750 ml). The suspension was stirred for 14 h at r.t., diluted with MeCN (1.1 l), cooled to
48, and treated with AcCl (40 ml, 0.56 mol). After 1 h, the mixture was diluted with CH2Cl2 (2.2 l) and added
under stirring to H2O (1.5 l, 48). The org. phase was washed with H2O (2 l, 48), dried (MgSO4), evaporated, and
co-evaporated with toluene until all Py was removed. The residue was dissolved in MeOH (750 ml) and treated
with AcOH (225 ml). Filtration after 2 d at À208 gave 2 (91 g, 80%). Off-white powder. TLC (CH2Cl2/MeOH
7:3): Rf 0.50. M.p. 173 1758. [a]2D5 ˆ À53.7 (c ˆ 0.98, H2O/MeOH 1:1). UV (H2O): 273 (16700), 232 (3600),
209 (21700). IR (KBr): 3270m, 2935w, 1720m, 1685s, 1620s, 1590m, 1535w, 1465s, 1415w, 1375m, 1360m, 1310s,
1
1250m, 1225m, 1190w, 1130w, 1100m, 1085m, 1040m, 1010w, 990w, 895w, 820w. H-NMR (300 MHz, CD3OD/
D2O 1:1): 2.36 (s, MeCO); 3.80 (dd, J ˆ 3.3, 12.6, HÀC(5')); 3.92 (dd, J ˆ 2.8, 12.6, H'ÀC(5')); 4.23 (br. q, J ꢁ 3,
HÀC(4')); 4.39 (dd, J ˆ 3.4, 5.5, HÀC(3')); 4.77 (t, J ˆ 5.6, HÀC(2')); 6.10 (d, J ˆ 5.9, HÀC(1')); 8.58, 8.65 (2s,
HÀC(2), HÀC(8)). 13C-NMR (75 MHz, CD3OD/D2O 1 :1): 24.9 (q, MeCO); 63.2 (t, C(5')); 72.4, 75.7, 87.8
(3d, C(2'), C(3'), C(4')); 90.8 (d, C(1')); 125.1 (s, C(5)); 145.3 (d, C(8)); 150.9 (s, C(4)); 153.0 (s, C(6)); 153.5
‡
(d, C(2)); 173.4 (s, CO). FAB-MS: 310 (100, [M ‡ H] ), 178 (55), 120 (24), 107 (40). Anal. calc. for
C12H15N5O5 ¥ 0.25 H2O: C45.93, H 4.98, N 22.31; found: C 46.00, H 4.87, N 22.23.
N2-Acetylguanosine (3). A mixture of guanosine (56.6 g, 0.2 mol) in DMF/Py/Ac2O (250 ml each) was
heated under reflux for 3 h. All liquids were removed by distillation (1008/30 mbar), and the residue was
dissolved in CH2Cl2 (400 ml). After extraction (1m HCl, then sat. NaHCO3 soln.) and drying (MgSO4), the
intermediate (N2, 2'-O,3'-O,5'-O-tetraacetylguanosine) was adsorbed on SiO2 (150 g). After CC (150 g of SiO2,
CH2Cl2 ! CH2Cl2/MeOH 9 :1), the intermediate was dissolved in THF/MeOH/H2O 10 :8 :7 and treated with
10m aq. NaOH (20 ml). After 20 min at r.t., AcOH (25 ml) was added and the soln. concentrated to 400 ml and
cooled to 48. Filtration gave 3 (50.5 g, 77%). Off-white powder. TLC (CH2Cl2/MeOH 7:3): Rf 0.30. M.p. 224
2268. [a]2D5 ˆ À19.0 (c ˆ 0.94, H2O). UV (H2O): 280 (sh, 11200), 259 (16300), 228 (3800). IR (KBr): 3465m,
3190m, 2120m, 2930m, 1690s, 1610s, 1565s, 1480m, 1445w, 1405s, 1370m, 1315w, 1265m, 1235s, 1205w, 1155w,
1
1120w, 1100s, 1065m, 1050m, 1035m, 1025m, 1000w, 945w, 890w, 875w, 800m. H-NMR (300 MHz, D2O): 2.28
(s, MeCO); 3.83 (dd, J ˆ 4.0, 12.6, HÀC(5')); 3.92 (dd, J ˆ 1.0, 12.6, H'ÀC(5')); 4.21 (m,HÀC(4')); 4.45 (t, J ˆ
4.7, HÀC(3')); 4.72 (t, J ˆ 4.6, HÀC(2')); 5.97 (d, J ˆ 4.4, HÀC(1')); 8.18 (s, HÀC(8)). 13C-NMR (75 MHz,
D2O): 26.2 (q, MeCO); 64.0 (t, C(5')); 72.9, 76.8, 87.8 (3d, C(2'), C(3'), C(4')); 90.9 (d, C(1')); 122.9 (s, C(5));

3788
Helvetica Chimica Acta Vol. 84 (2001)
‡
142.5 (d, C(8)); 150.6 (s, C(4)); 152.1 (s, C(2)); 160.2 (s, C(6)); 178.3 (s, CO). FAB-MS: 326 (100, [M ‡ H] ).
Anal. calc. for C12H15N5O6 ¥ 0.33 H2O: C 43.51, H 4.77, N 21.14; found: C 43.65, H 5.14, N 21.16.
N4-Acetyl-5'-O-(4,4'-dimethoxytrityl)cytidine (4). A suspension of cytidine (121.6 g, 0.5 mol) in DMF (1 l)
was treated with Ac2O (52 ml, 0.55 mol) and stirred for 14 h at r.t. The soln. was concentrated (458/1 mbar) to
100 ml, diluted with Py (900 ml), treated in 4 portions with (MeO)2TrCl (187 g, 0.55 mol), and stirred for 1 h at
r.t. After workup and evaporation (first at 30 mbar, then at 1 mbar), the residue was crystallized from MeOH: 4
(205 g, 70%). White powder. TLC (CH2Cl2/MeOH 9 :1): Rf 0.50. [a]2D5 ˆ ‡26.1 (c ˆ 0.88, CHCl3). UV
(MeOH): 299 (14800), 272 (8000), 247 (30200), 227 (12000), 212 (42600). IR (CHCl3): 3510w, 3390m, 3000m,
2940w, 2820w, 1740m, 1640s, 1600s, 1550m, 1500s, 1480s, 1180m, 1100m, 1100s, 1030s. 1H-NMR (300 MHz,
CDCl3): 2.24 (s, MeCO); 3.42 (dd, J ˆ 2.8, 10.9, HÀC(5')); 3.48 (dd, J ˆ 2.5, 10.9, H'ÀC(5')); 3.54 (br. s, OH);
3.79 (s, 2 MeO); 4.39 4.43 (m, HÀC(2'), HÀC(3'), HÀC(4')); 5.67 (br. s, OH); 5.87 (d, J ˆ 3.7, HÀC(1'));
6.80 6.86 (m, 4 arom. H); 7.20 7.62 (m, 10 H, arom. H, HÀC(5)); 8.18 (d, J ˆ 7.5, HÀC(6)); 8.80 (br. s,
NHÀC(4)). 13C-NMR (75 MHz, CDCl3): 25.0 (q, MeCO); 55.3 (q, MeO); 62.6 (t, C(5')); 71.1, 76.9, 85.3
(3d, C(2'), C(3'),C(4')); 87.2 (s, (MeO)2Tr); 93.0 (d, C(1')); 97.0 (d, C(5)); 113.5 (d, arom. C); 127.3, 128.2, 128.3,
130.2, 130.3 (5d, arom. C); 135.4 (d, arom. C); 135.7 (s, arom. C); 145.0 (d, C(6)); 156.9 (s, C(2)); 159.0
‡
‡
(s, arom. C); 162.9 (s, C(4)); 170.7 (s, CO). FAB-MS: 588 (25, [M ‡ H] ), 303 (100, [(MeO)2Tr] ).
N6-Acetyl-5'-O-(4,4'-dimethoxytrityl)adenosine (5). A soln. of 2 (77 g, 0.25 mol) in Py (800 ml) was treated
in 4 portions with (MeO)2TrCl (102 g, 0.30 mol) and kept for 1 h at r.t. Workup and CC (400 g of SiO2,
CH2Cl2 ! CH2Cl2/MeOH 9 :1 (‡1% Et3N)) gave 5 (114 g, 75%). Yellow, solid foam. TLC (CH2Cl2/MeOH
9 :1): Rf 0.50. [a]2D5 ˆ À7.4 (c ˆ 0.87, CHCl3). UV (MeOH): 272 (18700), 252 (13000), 234 (22700), 228 (22100).
IR (CHCl3): 3700w, 3540w, 3405w, 3380w, 3000m, 2940w, 2840w, 1740w, 1710m, 1620s, 1590m, 1520s, 1470m,
1460m, 1410w, 1380m, 1300m, 1130m, 1040m, 910m. 1H-NMR (300 MHz, CDCl3): 2.58 (s, MeCO); 3.31 (dd, J ˆ
3.4, 10.6, HÀC(5')); 3.44 (dd, J ˆ 3.1, 10.6, H'ÀC(5')); 3.53 (br. s, OH); 3.75 (s, 2 MeO); 4.43 (br. q, J ꢁ 2.5,
HÀC(4')); 4.49 (dd, J ˆ 2.5, 5.3, HÀC(3')); 4.88 (t, J ˆ 5.3, HÀC(2')); 5.74 (br. s, OH); 6.05 (d, J ˆ 5.6,
HÀC(1')); 6.72 6.75 (m, 4 arom. H); 7.16 7.29 (m, 9 arom. H); 8.23 (s, HÀC(2)); 8.60 (s, HÀC(8)); 8.94 (br. s,
NHÀC(6)). 13C-NMR (75 MHz, CDCl3): 25.7 (q, MeCO); 55.3 (q, MeO); 63.7 (t, C(5')); 72.7, 76.0, 86.1
(3d, C(2'), C(3'), C(4')); 86.8 (s, arom. C); 90.7 (d, C(1')); 113.4 (d, arom. C); 122.2 (s, C(5)); 127.2, 128.1, 128.2,
130.1, 130.2 (5 arom. C); 135.7 (s, arom. C); 141.7 (d, C(8)); 144.6 (s, arom. C); 149.6 (s, C(4)); 150.8 (s, C(6));
‡
‡
152.2 (d, C(2)); 158.9 (s, arom. C); 170.7 (s, CO). FAB-MS: 612 (17, [M ‡ H] ), 303 (100, [(MeO)2Tr] ), 136
(26), 102 (83).
N2-Acetyl-5'-O-(4,4'-dimethoxytrityl)guanosine (6). A suspension of 3 (42.3 g, 0.13 mol) in Py (390 ml),
DMF (130 ml), and 4-ä molecular sieves (50 g) was stirred for 1 h at r.t. Then (MeO)2TrCl (49 g, 0.15 mol) was
added in 4 portions, and the mixture was stirred for 1 h at r.t. After workup and evaporation (first at 30 mbar,
then at 1 mbar), the residue was crystallized from CH2Cl2: 6 (65.7 g, 81%). Yellow powder. TLC (CH2Cl2/
MeOH 9 :1): Rf 0.35. M.p. 170 1748 (dec.). [a]2D5 ˆ ‡15.5 (c ˆ 0.93, MeOH). UV (MeOH): 282 (sh, 13700),
274 (14600), 271 (14300), 260 (sh, 18300), 251 (sh, 19600), 235 (25800), 226 (22400). IR (KBr): 3430m, 3155m,
3060m, 2935m, 2835w, 1675s, 1610s, 1560s, 1510s, 1475m, 1445m, 1405w, 1375m, 1300w, 1250s, 1175m, 1155m,
1120m, 1085m, 1035m, 905w, 830m. 1H-NMR (300 MHz, CDCl3/CD3OD 3 :1): 2.02 (s, MeCO); 3.20 (dd, J ˆ 4.3,
10.5, HÀC(5')); 3.26 (dd, J ˆ 2.8, 10.5, HÀC(5')); 3.62 (s, 2 MeO); 3.69 (br. s, HÀC(4')); 4.22 (t, J ˆ 4.9,
HÀC(3')); 4.45 (t, J ˆ 4.9, HÀC(2')); 5.76 (d, J ˆ 4.8, HÀC(1')); 6.64 (m, 4 arom. H); 7.03 7.26 (m, 9 arom. H);
7.74 (s, HÀC(8)). 13C-NMR (75 MHz, CDCl3/CD3OD 3 :1): 23.4 (q, MeCO); 55.1 (q, MeO); 63.6 (t, C(5'));
71.0, 74.8, 84.2 (3d, C(2'), C(3'), C(4')); 86.6 (d, C(1')); 88.6 (s, arom. C); 113.2 (d, arom. C); 120.8 (s, C(5));
127.0, 127.9, 128.2, 130.1 (4 arom. C); 135.8 (s, arom. C); 137.8 (d, C(8)); 144.6 (s, arom. C); 147.9 (s, C(4)); 148.8
‡
(s, C(2)); 156.2 (s, C(6)); 158.7 (s, arom. C); 173.3 (s, CO). FAB-MS: 628 (74, [M ‡ H] ), 303 (100,
‡
[(MeO)2Tr] ), 242 (20). Anal. calc. for C32H35N4O8: C 63.15, H 5.30, N 11.16; found: C 63.08, H 5.35, N 10.91.
5'-O-(4,4'-Dimethoxytrityl)uridine (7). A soln. of uridine (61 g, 0.25 mol) in Py (800 ml) was treated in 4
portions with (MeO)2TrCl (102 g, 0.3 mol) and kept for 1 h at r.t. Workup and CC (400 g of SiO2, CH2Cl2 !
CH2Cl2/MeOH 9 :1 (‡1% Et3N)) gave 7 (109 g, 80%). Yellow, solid foam. TLC (CH2Cl2/MeOH 9 :1): Rf 0.50.
[a]2D5 ˆ ‡2.4 (c ˆ 0.92, CHCl3). UV (MeOH): 265 (11900), 255 (11400), 233 (23100), 227 (12800). IR (CHCl3):
3700w, 3610w, 3540w, 3400m, 3320w, 3040w, 2930w, 2340w, 1705s, 1690s, 1610m, 1510m, 1470m, 1400w, 1300w,
1
1110m, 1070w, 1040m, 910m. H-NMR (300 MHz, CDCl3): 3.48 (dd, J ˆ 2.5, 10.9, HÀC(5')); 3.53 (dd, J ˆ 2.2,
10.9, H'ÀC(5')); 3.78 (s, 2 MeO); 4.19 (td, J ˆ 2.3, 5.5, HÀC(4')); 4.33 (dd, J ˆ 2.8, 5.3, HÀC(2')); 4.42 (t, J ˆ 5.5,
HÀC(3')); 5.37 (d, J ˆ 8.1, HÀC(5)); 5.88 (d, J ˆ 2.5, HÀC(1')); 6.82 6.87 (m, 4 arom. H); 7.23 7.40
(m, 9 arom. H); 8.00 (d, J ˆ 8.1, HÀC(6)). 13C-NMR (75 MHz, CDCl3): 55.3 (q, MeO); 62.2 (t, C(5')); 70.1,
75.7, 84.0 (3d, C(2'), C(3'), C(4')); 87.2 (s, arom. C); 90.5 (d, C(1')); 102.4 (d, C(5)); 113.5 (d, arom. C); 128.2,
128.4, 128.6, 130.3, 130.4 (5d, arom. C); 135.5, 135.6 (2s, arom. C); 140.7 (d, C(6)); 144.7 (s, arom. C); 151.4

Helvetica Chimica Acta Vol. 84 (2001)
3789
‡
‡
(s, C(2)); 159.0 (s, arom. C); 164.0 (s, C(4)). FAB-MS: 547 (25, [M ‡ H] ), 546 (24, M ), 303 (100,
‡
[(MeO)2Tr] ).
Triisopropylsilyl (Ethylthio)methyl Ether (ˆ [(Ethylthio)methoxy]tris(1-methylethyl)silane; 8). At 48, a
suspension of paraformaldehyde (30.6 g, 1.02 mol) in EtSH (75 ml, 1.02 mol) was treated with 10m aq. NaOH
(1 drop) and slowly allowed to warm up. At ca. 158, a violent exothermic reaction occurred. The resulting soln.
was stirred for 1 h at 408, cooled to r.t., and treated with CH2Cl2 (1 l), 1H-imidazole (138.6 g, 2.04 mol), and
iPr3SiCl (205 ml, 0.97 mol). The suspension was stirred for 14 h at r.t., diluted with hexane (2 l), and extracted
with 10% aq. NaH2PO4 soln. (1 l). The org. layer was dried (MgSO4) and evaporated. Distillation at 0.05 Torr
gave 8 (206 g, 85%). Colorless liquid. B.p. 728/0.05 Torr. 1H-NMR (300 MHz, CDCl3): 1.08 1.18 (m, iPr3Si);
1.31 (t, J ˆ 7.4, MeCH2); 2.71 (q, J ˆ 7.4, MeCH2); 4.88 (s, SCH2O). 13C-NMR (75 MHz, CDCl3): 12.0
(d, Me2CH); 15.0 (q, Me2CH); 17.9 (q, MeCH2); 24.7 (t, MeCH2); 66.1 (t, SCH2O).
[(Triisopropylsilyl)oxy]methyl Chloride (ˆ(Chloromethoxy)tris(1-methylethyl)silane; tom-Cl; 9). At 48, a
soln. of 8 (176 g, 0.7 mol) in CH2Cl2 (500 ml) was treated slowly with SO2Cl2 (57.4 ml, 0.7 mol). After the
addition, the yellow soln. was stirred for 1 h at r.t. and then evaporated. Distillation at 0.01 Torr gave 9 (148 g,
95%). Colorless liquid. B.p. 408/0.01 Torr. 1H-NMR (300 MHz, CDCl3): 1.08 1.10 (m, iPr3Si); 5.66 (s, SCH2O).
13C-NMR (75 MHz, CDCl3): 11.8 (d, Me2CH); 17.7 (q, Me2CH); 76.6 (t, SCH2O).
N4-Acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O- and N4-Acetyl-5'-O-(4,4'-dimethoxytrityl-3'-O-{[(triisopropyl-
i
silyl)oxy]methyl}cytidine (10 and 14, resp.). A soln. of 4 (147 g, 0.25 mol) and Pr2NEt (146 ml, 0.88 mol) in
ClCH2CH2 Cl (1 l) was treated with Bu2SnCl2 (94 g, 0.28 mmol), stirred for 1 h at r.t., heated to 808, treated with
9 (72 g, 0.33 mol), and stirred for 20 min at 808. Workup and CC (2 kg of SiO2, hexane/AcOEt 7 :3 ! 3 :7 (‡1%
Et3N)) afforded 10 (87 g, 45%) and 14 (58 g, 30%) as pale yellow, solid foams. By continuing the CC with
CH2Cl2 ! CH2Cl2/MeOH 9 :1 (‡1% Et3N), 4 (22 g, 15%) was recovered.
Data of 10: TLC (hexane/AcOEt 3 :7): Rf 0.50. [a]2D5 ˆ ‡46.8 (c ˆ 0.94, CHCl3). UV (MeOH): 300 (6800),
290 (6400), 283 (6800), 278 (6400), 236 (27200), 225 (24500). IR (CHCl3): 3520w, 3400w, 3000m, 2940m, 2860m,
1740m, 1660s, 1610m, 1550m, 1510s, 1480s, 1380m, 1300m, 1100m, 1040m, 990m, 910w, 880m. 1H-NMR
(300 MHz, CDCl3): 1.04 1.15 (m, iPr3Si); 2.21 (s, MeCO); 3.34 (d, J ˆ 8.4, OHÀC(3')); 3.53 (dd, J ˆ 2.5, 10.9,
HÀC(5')); 3.62 (dd, J ˆ 1.8, 10.9, H'ÀC(5')); 3.81, 3.82 (2s, 2 MeO); 4.09 (br. dt, J ꢁ 9, 2, HÀC(4')); 4.23 (d, J ˆ
5.0, HÀC(2')); 4.37 (m, HÀC(3')); 5.15, 5.28 (2d, J ˆ 4.6, OCH2O); 5.97 (s, HÀC(1')); 6.84 6.88 (m, 4 ar-
om. H); 7.04 (d, J ˆ 7.1, H ÀC(5)); 7.24 7.44 (m, 9 arom. H); 8.48 (d, J ˆ 7.4, HÀC(6)); 8.62 (br. s, NHÀC(4)).
13C-NMR (75 MHz, CDCl3): 11.9 (d, Me2CH); 17.8 (q, Me2CH); 24.9 (q, MeCO); 55.3 (q, MeO); 61.4 (t, C(5'));
67.9, 83.50, 83.55 (3d, C(2'), C(3'), C(4')); 87.2 (s, arom. C); 90.2 (d, C(1')); 90.9 (t, OCH2O); 96.8 (d, C(5));
113.5 (d, arom. C); 127.4, 128.3, 128.4, 128.5, 130.4 (5d, arom. C); 135.6, 135.8, 144.6 (3s, arom. C); 145.1
‡
(d, C(6)); 155.3 (s, C(2)); 159.0 (s, arom. C); 163.1 (s, C(4)); 170.6 (s, CO). FAB-MS: 774 (23, [M ‡ H] ), 730
‡
(27), 303 (100, [(MeO)2Tr ] ). Anal. calc. for C42H55N3O9Si: C 65.18, H 7.16, N 5.43; found: C 64.89, H 7.18,
N 5.42.
Data of 14: TLC (AcOEt): Rf 0.40. [a]2D5 ˆ ‡16.7 (c ˆ 0.87, CHCl3). UV (MeOH): 299 (7500), 290 (6700),
283 (7500), 272 (6700), 235 (29000), 25 (24800). IR (CHCl3): 3540w, 3400m, 3000m, 2940m, 2860m, 1740m,
1670s, 1620m, 1550m, 1510s, 1480s, 1370m, 1300m, 1110m, 1040s, 880w. 1H-NMR (300 MHz, CDCl3): 1.02 1.06
(m, iPr3Si); 2.25 (s, MeCO); 3.39 (dd, J ˆ 3.1, 10.9, HÀC(5')); 3.58 (br. s, OHÀC(2')); 3.60 (dd, J ˆ 2.2, 10.9,
H'ÀC(5')); 3.81 (s, MeO); 4.27 4.38 (m, HÀC(2'), HÀC(3'), HÀC(4')); 4.90, 5.02 (2d, J ˆ 5.0, OCH2O); 5.99
(d, J ˆ 2.5, HÀC(1')); 6.83 6.87 (m, 4 arom. H); 7.18 (d, J ˆ 7.5, HÀC(5)); 7.5 7.40 (m, 9 arom. H); 8.29
(d, J ˆ 7.5, HÀC(6)); 9.67 (br. s, NHÀC(4)). 13C-NMR (75 MHz, CDCl3): 11.9 (d, Me2CH); 17.8 (q, Me2CH);
24.9 (q, MeCO); 55.3 (q, MeO); 62.1 (t, C(5')); 75.8, 76.9, 82.5 (3d, C(2'), C(3'), C(4')); 87.2 (s, arom. C); 92.6
(d, C(1')); 90.4 (t, OCH2O); 96.9 (d, C(5)); 113.5 (d, arom. C); 127.4, 128.2, 128.4, 130.3 (4d, arom. C); 135.6,
135.7 (2s, arom. C); 144.5 (d, C(6)); 145.0 (s, arom. C); 155.8 (s, C(2)); 159.0 (s, arom. C); 163.3 (s, C(4)); 171.1
‡
‡
(s, CO). FAB-MS: 774 (47, [M ‡ H] ), 303 (100, [(MeO)2Tr ] ). Anal. calc. for C42H55N3O9Si: C 65.18, H 7.16,
N 5.43; found: C 64.98, H 7.29, N 5.45.
N6-Acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O- and N6-Acetyl-5'-O-(4,4'-dimethoxytrityl)-3'-O-{[(triisopropyl-
silyl)oxy]methyl}adenosine (11 and 15, resp.). As described for 10 and 14, with 5 (122 g, 0.2 mol), Pr2NEt
i
(117 ml, 0.7 mol), ClCH2CH2Cl (800 ml), Bu2SnCl2 (67 g, 0.22 mol), and 9 (49 g, 0.22 mol). Workup and CC
(2 kg of SiO2, hexane/AcOEt 4 :1 ! 1:4 (‡1% Et3N)] afforded 11 (64 g, 40%) and 15 (40 g, 25%) as colorless,
solid foams. With CH2Cl2 ! CH2Cl2/MeOH 9 :1 (‡1% Et3N), 5 (30 g, 25%) was recovered.
Data of 11: TLC (hexane/AcOEt 3 :7): Rf 0.45. [a]2D5 ˆ ‡11.5 (c ˆ 1.36, CHCl3). UV (MeOH): 280
(sh, 15500), 272 (20500), 253 (14200), 234 (24700), 220 (23800). IR (CHCl3): 3540w, 3400w, 3380w, 3000m,
2940m, 2880m, 1730w, 1700m, 1610s, 1590m, 1510m, 1470m, 1380m, 1300m, 1040s, 1010w, 1000w, 910w, 890w,
830w. 1H-NMR (300 MHz, CDCl3): 0.99 1.08 (m, iPr3Si); 2.61 (s, MeCO); 3.07 (br. d, J ꢁ 3, OHÀC(3')); 3.40

3790
Helvetica Chimica Acta Vol. 84 (2001)
(dd, J ˆ 3.9, 10.6, HÀC(5')); 3.53 (dd, J ˆ 3.5, 10.6, H'ÀC(5')); 3.78 (s, 2 MeO); 4.30 (q, J ˆ 3.7, HÀC(4')); 4.57
(br. q, J ꢁ 3, HÀC(3')); 4.96 (t, J ˆ 5.3, HÀC(2')); 4.98, 5.14 (2d, J ˆ 5.0, OCH2O); 6.21 (d, J ˆ 5.3, HÀC(1'));
6.78 6.81 (m, 4 arom. H); 7.23 7.44 (m, 9 arom. H); 8.16 (s, HÀC(2)); 8.60 (s, HÀC(8)); 8.65 (br. s,
NHÀC(6)). 13C-NMR (75 MHz, CDCl3): 11.8 (d, Me2CH); 17.8 (q, Me2CH); 25.9 (q, MeCO); 55.3 (q, MeO);
63.4 (t, C(5')); 71.0, 82.2, 84.6 (3d, C(2'), C(3'), C(4')); 86.8 (s, arom. C); 87.4 (d, C(1')); 91.0 (t, OCH2O); 113.4
(d, arom. C); 122.5 (s, C(5)); 127.2, 128.1, 128.4, 130.3 (4d, arom. C); 135.9 (s, arom. C); 142.1 (d, C(8)); 144.8
(s, arom. C); 149.4 (s, C(4)); 151.4 (s, C(6)); 152.7 (d, C(2)); 158.9 (s, arom. C); 170.7 (s, CO). FAB-MS: 798 (29,
‡
‡
[M ‡ H] ), 303 (100, [(MeO)2Tr ] ). Anal. calc. for C43H55N5O8Si: C 64.72, H 6.95, N 8.78; found: C 64.64,
H 7.06, N 8.74.
Data of 15: TLC (hexane/AcOEt 1:9): R 0.45. [a]2D5 ˆ À19.0 (c ˆ 0.78, CHCl3). UV (MeOH): 282 (sh,
f
13600), 272 (19500), 253 (14300), 234 (25700), 220 (25000). IR (CHCl3): 3520w, 3400w, 3380w, 3000m, 2950m,
2860m, 1730w, 1700m, 1610s, 1590m, 1510m, 1470m, 1380m, 1300m, 1040s, 880w. 1H-NMR (300 MHz, CDCl3):
1.04 1.07 (m, iPr3Si); 2.62 (s, MeCO); 3.34 (dd, J ˆ 4.0, 10.2, HÀC(5')); 3.49 (dd, J ˆ 3.4, 10.2, H'ÀC(5')); 3.78
(s, 2 MeO); 3.78 (br. s, OHÀC(2')); 4.38 (br. q, J ꢁ 4, HÀC(4')); 4.52 (t, J ˆ 4.8, HÀC(3')); 4.91 (br. t, J ꢁ 5,
HÀC(2')); 4.96, 5.11 (2d, J ˆ 4.7, OCH2O); 6.04 (d, J ˆ 5.0, HÀC(1')); 6.77 (d, J ˆ 8.7, 4 arom. H); 7.19 7.39
(m, 9 arom. H); 8.15 (s, HÀC(2)); 8.51 (br. s, NHÀC(6)); 8.62 (s, HÀC(8)). 13C-NMR (75 MHz, CDCl3): 11.9
(d, Me2CH); 17.8 (q, Me2CH); 25.7 (q, MeCO); 55.3 (q, MeO); 63.1 (t, C(5')); 74.3, 79.4, 83.1 (3d, C(2'), C(3'),
C(4')); 86.7 (s, arom. C); 89.5 (d, C(1')); 90.9 (t, OCH2O); 113.3 (d, arom. C); 122.5 (s, C(5)); 127.1, 128.1, 128.3,
130.3 (4d, arom. C); 135.9 (s, arom. C); 142.1 (d, C(8)); 144.8 (s, arom. C); 149.5 (s, C(4)); 151.3 (s, C(6)); 152.6
‡
‡
(d, C(2)); 158.9 (s, arom. C); 170.7 (s, CO). FAB-MS: 798 (66, [M ‡ H] ), 303 (100, [(MeO)2Tr] ). Anal. calc.
for C43H55N5O8Si ¥ 0.5 H2O: C 64.00, H 7.00, N 8.68; found: C 64.05, H 6.95, N 8.49.
N2-Acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O- and N2-Acetyl-5'-O-(4,4'-dimethoxytrityl)-3'-O-{[(triisopropyl-
i
silyl)oxy]methyl}guanosine (12 and 16, resp.). As described for 10 and 14, with 6 (100 g, 0.16 mol), Pr2NEt
(96 ml, 0.56 mol), ClCH2CH2Cl (640 ml), Bu2SnCl2 (54 g, 0.17 mol), and 9 (36 g, 0.16 mol). Workup and CC
(1.5 kg of SiO2, CH2Cl2 ! CH2Cl2/MeOH 97 :3 (‡ 5% Et3N)) afforded 12 (78 g, 60%) and impure 16 (7 g, ꢁ5%)
as yellow, solid foams. With CH2Cl2/MeOH 19 :1 ! 9 :1 (‡1% Et3N), 6 (20 g, 20%) was recovered.
Data of 12: TLC (CH2Cl2/MeOH 19 :1): Rf 0.55. [a]2D5 ˆ ‡7.7 (c ˆ 0.85, CHCl3). UV (MeOH): 282 (sh,
13500), 275 (14300), 271 (13900), 260 (sh, 17500), 251 (19200), 235 (26500), 223 (22800). IR (CHCl3): 3370w,
3225w, 3010w, 2945m, 2870w, 1700s, 1605s, 1560m, 1510m, 1465w, 1410m, 1300w, 1255m, 1090m, 1040m, 995m,
920w, 880w, 830w. 1H-NMR (300 MHz, CDCl3): 0.94 1.12 (m, iPr3Si); 1.46 (s, MeCO); 3.03 (br. d, J ꢁ 3,
OHÀC(3')); 3.13 (dd, J ˆ 2.8, 10.6, HÀC(5')); 3.53 (dd, J ˆ 2.0, 10.6, H'ÀC(5')); 3.76, 3.78 (2s, 2 MeO); 4.24
(q, J ˆ 2.0, HÀC(4')); 4.57 (ddd, J ˆ 1.5, 5.0, 3.0, HÀC(3')); 4.95, 5.14 (2d, J ˆ 4.7, OCH2O); 5.09 (dd, J ˆ 5.3, 7.5,
HÀC(2')); 5.90 (d, J ˆ 7.5, H ÀC(1')); 6.78 6.83 (m, 4 arom. H); 7.18 7.57 (m, 9 arom. H); 7.75 (br. s,
NHÀC(2)); 7.81 (s, HÀC(8)); 11.82 (br. s, HÀN(1)). 13C-NMR (75 MHz, CDCl3): 11.8 (d, Me2CH); 17.8
(q, Me2CH); 23.7 (q, MeCO); 55.4 (q, MeO); 63.9 (t, C(5')); 70.8, 81.5, 84.5 (3d, C(2'), C(3'), C(4')); 86.5
(d, C(1')); 86.9 (s, arom. C); 91.1 (t, OCH2O); 113.5 (d, arom. C); 122.4 (s, C(5)); 127.3, 128.2, 128.3, 130.3
(4d, arom. C); 135.9, 136.3 (2s, arom. C); 139.1 (d, C(8)); 145.3 (s, arom. C); 147.4 (s, C(4)); 148.7 (s, C(2));
‡
‡
156.3 (s, C(6)); 159.0 (s, arom. C); 171.8 (s, CO). FAB-MS: 814 (17, [M ‡ H] ), 303 (100, [(MeO)2Tr ] ). Anal.
calc. for C43H55N5O9Si: C 63.45, H 6.81, N 8.60; found: C 63.34, H 6.84, N 8.35.
Data of 16: Additional purification by prep. TLC. TLC (CH2Cl2/MeOH 19 :1): Rf 0.50. [a]2D5 ˆ À23.6 (c ˆ
1.00, CHCl3). UV (MeOH): 282 (sh, 13000), 275 (14500), 271 (14000), 260 (sh, 17500), 251 (19500), 235
(26500), 223 (23000). IR (CHCl3): 3370w, 3220w, 3010w, 2945m, 2870w, 1700s, 1610s, 1560m, 1510m, 1465w,
1410m, 1300w, 1250m, 1040m, 995m, 915w, 880w, 830w. 1H-NMR (300 MHz, CDCl3): 0.99 1.13 (m, iPr3Si); 1.47
(s, MeCO); 3.13 (dd, J ˆ 3.1, 10.6, HÀC(5')); 3.53 (dd, J ˆ 2.0, 10.6, H'ÀC(5')); 3.76 3.78 (m, 2 MeO,
OHÀC(2')); 4.32 (br. q, J ꢁ 2, HÀC(4')); 4.45 (dd, J ˆ 2.8, 5.6, HÀC(3')); 4.99, 5.10 (2d, J ˆ 5.0, OCH2O);
5.17 (br. t, J ꢁ 6, HÀC(2')); 5.73 (d, J ˆ 6.8, HÀC(1')); 6.78 6.83 (m, 4 arom. H); 7.18 7.55 (m, 9 arom. H);
7.60 (br. s, NHÀC(2)); 7.77 (s, HÀC(8)); 11.85 (br. s, HÀN(1)). 13C-NMR (75 MHz, CDCl3): 11.8 (d, Me2CH);
17.8 (q, Me2CH); 23.4 (q, MeCO); 55.4 (q, MeO); 63.4 (t, C(5')); 72.8, 78.0, 83.9 (3d, C(2'), C(3'), C(4')); 86.3
(d, C(1')); 89.8 (s, arom. C); 90.8 (t, OCH2O); 113.4, 113.5 (2d, arom. C); 122.3 (s, C(5)); 127.3, 128.3, 130.2,
130.4 (4d, arom. C); 136.0, 136.7 (2s, arom. C); 139.6 (d, C(8)); 145.3 (s, arom. C); 146.7 (s, C(4)); 148.2
‡
(s, C(2)); 155.6 (s, C(6)); 159.0 (s, arom. C); 171.9 (s, CO). FAB-MS: 814 (27, [M ‡ H] ), 303 (100,
‡
[(MeO)2Tr] ).
5'-O-(4,4'-Dimethoxytrityl)-2'-O- and 5'-O-(4,4'-Dimethoxytrityl)-3'-O-{[(triisopropylsilyl)oxy]methyl}uri-
dine (13 and 17, resp.). As described for 10 and 14, with 7 (109 g, 0.2 mol), iPr2NEt (117 ml, 0.7 mol),
ClCH2CH2Cl (800 ml), Bu2SnCl2 (67 g, 0.22 mol), and 9 (53 g, 0.24 mol). Workup and CC (2 kg of SiO2; hexane/

Helvetica Chimica Acta Vol. 84 (2001)
3791
AcOEt 4 :1 ! 1:4 (‡1% Et3N)) afforded 13 (59 g, 40%) and 17 (37 g, 25%) as colorless, solid foams. With
CH2Cl2 ! CH2Cl2/MeOH 9 :1 (‡1% Et3N), 7 (27 g, 25%) was recovered.
Data of 13: TLC (hexane/AcOEt 3 :7): Rf 0.55. [a]2D5 ˆ ‡42.9 (c ˆ 1.00, CHCl3). UV (MeOH): 267
(13100), 233 (25900), 226 (28600). IR (CHCl3): 3680w, 3520w, 3400w, 3000m, 2940m, 2880m, 1710m, 1690s,
1610m, 1510m, 1460m, 1390w, 1300w, 1100m, 1040m, 910w, 880w. 1H-NMR (300 MHz, CDCl3): 1.05 1.15
(m, iPr3Si); 3.17 (br. d, J ꢁ 3, OHÀC(3')); 3.52 (br. d, J ꢁ 11, HÀC(5')); 3.55 (br. d, J ꢁ 11, H'ÀC(5')); 3.80
(s, 2 MeO); 4.11 (m, HÀC(4')); 4.26 (dd, J ˆ 3.5, 5.0, HÀC(2')); 4.55 (br. t, J ꢁ 3, HÀC(3')); 5.03, 5.23 (2d, J ˆ
5.0, OCH2O); 5.29 (d, J ˆ 8.1, HÀC(5)); 6.03 (d, J ˆ 3.1, HÀC(1')); 6.83 6.87 (m, 4 arom. H); 7.24 7.40
(m, 9 arom. H); 7.94 (d, J ˆ 8.1, HÀC(6)); 8.38 (br. s, HÀN(3)). 13C-NMR (75 MHz, CDCl3): 11.9 (d, Me2CH);
17.8 (q, Me2CH); 55.3 (q, MeO); 62.3 (t, C(5')); 69.5, 83.0, 83.8 (3d, C(2'), C(3'), C(4')); 87.3 (s, arom. C); 88.0
(d, C(1')); 90.8 (t, OCH2O); 102.4 (d, C(5)); 113.5 (d, arom. C); 127.4, 128.2, 128.4, 130.4 (4d, arom. C); 135.4,
135.6 (2s, arom. C); 140.4 (d, C(6)); 144.6 (s, arom. C); 150.4 (s, C(2)); 159.0, 159.1 (2s, arom. C); 163.3 (s, C(4)).
‡
‡
FAB-MS: 732 (21, M ), 303 (100, [(MeO)2Tr ] ). Anal. calc. for C40H52N2O9Si: C 65.55, H 7.15, N 3.82; found:
C 65.29, H 7.08, N 4.02.
Data of 17: TLC (hexane/AcOEt 1:4): Rf 0.60. [a]2D5 ˆ À9.5 (c ˆ 0.98, CHCl3). UV (MeOH): 263 (11500),
234 (25300), 224 (21600). IR (CHCl3): 3540w, 3400m, 2950m, 2880m, 1710s, 1700s, 1610w, 1510m, 1460m, 1390w,
1300w, 1120m, 1040s, 1000w, 890w. H-NMR (300 MHz, CDCl3): 1.02 1.15 (m, iPr3Si); 3.39 (dd, J ˆ 2.5, 10.9,
1
HÀC(5')); 3.43 (br. s, OHÀC(2')); 3.55 (dd, J ˆ 2.5, 10.9, H'ÀC(5')); 3.80 (s, 2 MeO); 4.26 4.34 (m, HÀC(2'),
HÀC(3'), HÀC(4')); 4.90, 5.06 (2d, J ˆ 5.0, OCH2O); 5.39 (d, J ˆ 8.1, HÀC(5)); 5.97 (d, J ˆ 4.0, HÀC(1')); 6.83
(d, J ˆ 8.4, 4 arom. H); 7.24 7.39 (m, 9 arom. H); 7.77 (d, J ˆ 8.1, HÀC(6)); 8.42 (br. s, HÀN(3)). 13C-NMR
(75 MHz, CDCl3): 11.9 (d, Me2CH); 17.8 (q, Me2CH); 55.3 (q, MeO); 62.6 (t, C(5')); 74.7, 78.3, 82.3
(3d, C(2'),C(3'),C(4')); 87.2 (s, arom. C); 89.5 (d, C(1')); 90.7 (t, OCH2O); 102.5 (d, C(5)); 113.5 (d, arom. C);
127.4, 128.2, 128.4, 130.4 (4d, arom. C); 135.5, 135.6 (2s, arom. C); 140.6 (d, C(6)); 144.6 (s, arom. C); 150.6
‡
‡
(s, C(2)); 159.0 (s, arom. C); 163.2 (s, C(4)). FAB-MS: 732 (39, [M ‡ H] ), 303 (100, [(MeO)2Tr] ). Anal. calc.
for C40H52N2O9Si: C 65.55, H 7.15, N 3.82; found: C 65.47, H 7.06, N 3.96.
N4-Acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-{[(triisopropyl)silyloxy]methyl}cytidine 3'-(2-Cyanoethyl Diiso-
propylphosphoramidite) (18). A soln. of 10 (77 g, 0.1 mol) in CH2Cl2 (220 ml) was treated consecutively with
iPr2NEt (43 ml, 0.25 mol) and 2-cyanoethyl diisopropylphosphoramidochloridite (28 g, 0.12 mol). After stirring
for 14 h at r.t., the mixture was subjected to CC (1.5 kg of SiO2, hexane/AcOEt 9 :1 ! 3 :7 (‡ 3% Et3N)): 18
(91 g, 94%; 1:1 mixture of diastereoisomers). Colorless foam. TLC (hexane/AcOEt 3 :7): Rf 0.75. UV
(MeCN): 305 (6700), 290 (5700), 279 (6200), 237 (29000), 226 (23800). IR (CHCl3): 3400w, 3000m, 2980m,
2860m, 1720m, 1670s, 1610s, 1560m, 1500s, 1480s, 1460m, 1380m, 1360m, 1300m, 1100m, 1040s, 990m, 880w.
1H-NMR (500 MHz, CDCl3): 0.87 1.11 (m, iPr3Si); 1.13, 1.16 (2d, J ˆ 6.8, (Me2CH)2N); 2.22, 2.33 (2s, MeCO);
2.38, 2.59 (2t, J ˆ 6.5, CH2CN); 3.42 3.68 (m, 1 H of POCH2, (Me2CH)2N, HÀC(5')); 3.806, 3.807, 3.814, 3.817
(4s, 2 MeO); 3.91 (m, 1 H, POCH2); 4.28 4.41 (m, HÀC(2'), HÀC(4')); 4.50 (ddd, J ˆ 4.8, 8.0, 9.9, HÀC(3'));
5.15 5.22 (m, OCH2O); 6.15 (d, J ˆ 1.8, 0.5 H, HÀC(1')); 6.16 (d, J ˆ 2.4, 0.5 H, HÀC(1')); 6.82 6.88
(m, 4 arom. H); 6.96, 7.03 (2d, J ˆ 7.4, HÀC(5)); 7.24 7.47 (m, 9 arom. H); 8.36, 8.45 (2d, J ˆ 7.4, HÀC(6));
9.52, 9.60 (2 br. s, NHÀC(4)). 13C-NMR (125 MHz, CDCl3): 12.0 (d, (Me2CH)3Si); 17.8, 17.9 (2q, (Me2CH)3Si);
20.2, 20.3 (2t, J(C,P) ˆ 7, CH2CN); 24.48, 24.54, 24.58, 24.61, 24.64 (5q, (Me2CH)2N); 24.7, 24.9 (2q, MeCO);
43.2, 43.3 (2d, J(C,P) ˆ 7, ( Me2CH)2N); 55.2, 55.3 (2q, MeO); 58.2, 58.7 (2t, J(C,P) ˆ 20, POCH2); 60.9, 61.6
(2t, C(5')); 69.4, 69.7 (2d, J(C,P) ˆ 14), 78.7 (d, J(C,P) ˆ 3), 78.9 (d), 82.3 (d, J(C,P) ˆ 3), 82.5 (d, J(C,P) ˆ 5),
(C(2'),C(3'),C(4')); 87.0, 87.2 (2s, arom. C); 89.6, 89.7 (2d, C(1')); 89.8 (t, OCH2O); 96.5 (br. d, C(5)); 113.2,
113.3 (2d, arom. C); 117.4, 117.7 (2s, CN); 127.2, 128.0, 128.2, 128.4, 130.1, 130.2, 130.3, 130.4 (8d, arom. C);
135.2, 135.3, 135.4, 135.5, 144.1, 144.3 (6s, arom. C); 145.0, 145.1 (2d, C(6)); 154.9 (s, C(2)); 158.7 (s, arom. C);
‡
162.6, 162.7 (2s, C(4)); 170.5 (s, CO). 31P-NMR (150 MHz, CDCl3): 150.6, 150.9. FAB-MS: 974 (21, [M ‡ H] ),
‡
303 (100, [(MeO)2Tr] ). Anal. calc. for C51H72N5O10PSi: C 62.88, H 7.45, N 7.19; found: C 62.74, H 7.56, N 7.00.
N6-Acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-{[(triisopropylsilyl)oxy]methyl}adenosine 3'-(2-Cyanoethyl Di-
isopropylphosphoramidite) (19). As described for 18, with 11 (80 g, 0.1 mol), CH2Cl2 (220 ml), iPr2NEt (43 ml,
0.25 mol), and 2-cyanoethyl diisopropylphosphoramidochloridite (28 g, 0.12 mmol). CC (1.5 kg of SiO2,
hexane/AcOEt 9 :1 ! 3 :7 (‡ 3% Et3N)): 19 (93 g, 93%; 1:1 mixture of diastereoisomers). Colorless foam. TLC
(hexane/AcOEt 3 :7): Rf 0.75. UV (MeCN): 278 (sh, 17100), 270 (21800), 253 (16600), 235 (25400), 228
(23800). IR (CHCl3): 3400w, 3390w, 3000m, 2980m, 2860m, 1740m, 1700m, 1610s, 1590m, 1510s, 1460m, 1380m,
1300m, 1080m, 1050s, 1000m, 900w. 1H-NMR (500 MHz, CDCl3): 0.88 0.90 (m, iPr3Si); 1.09, 1.18, 1.19 (3d, J ˆ
6.8, (Me2CH)2N); 2.38 (t, J ˆ 6.4, 1 H, CH2CN); 2.62 (s, MeCO); 2.65 (dt, J ˆ 3.3, 6.6, 1 H, CH2CN); 3.35
(ddd, J ˆ 4.6, 7.5, 11.7, 1 H, POCH2); 3.51 3.75 (m, 1 H of POCH2, (Me2CH)2N, HÀC(5')); 3.77, 3.78 (2s,
2 MeO); 3.85 3.97 (m, 1 H, POCH2); 4.36, 4.41 (2q, J ˆ 4.0, HÀC(4')); 4.68 (m, HÀC(3')); 4.92, 4.95, 4.99

3792
Helvetica Chimica Acta Vol. 84 (2001)
(3d, J ˆ 5.0, OCH2O); 5.17, 5.20 (2t, J ˆ 5.5, HÀC(2')); 6.17, 6.20 (2d, J ˆ 5.8, HÀC(1')); 6.76 6.80 (m, 4 ar-
om. H); 7.18 7.42 (m, 9 arom. H); 8.12, 8.15 (2s, HÀC(2)); 8.53 (br. s, NHÀC(6)); 8.54, 8.56 (2s, HÀC(8)).
13C-NMR (125 MHz, CDCl3): 11.8 (d, (Me2CH)3Si); 17.5, 17.6, 17.7 (3q, (Me2CH)3Si); 20.1, 20.3 (2t, J(C,P) ˆ 7,
CH2CN); 24.52, 24.56, 24.58, 24.62 (4q, (Me2CH)2N); 25.6 (q, MeCO); 43.2, 43.4 (2d, J(C,P) ˆ 13,
(Me2CH)2N); 55.1, 55.2 (2q, MeO); 58.0, 58.9 (2t, J(C,P) ˆ 18, POCH2); 62.8, 63.2 (2t, C(5')); 71.2, 71.8
(2d, J(C,P) ˆ 16), 77.0, 77.6 (2d, J(C,P) ˆ 4), 84.1, 84.2 (2d) (C(2'), C(3'), C(4')); 86.5, 86.6 (2s, arom. C); 87.4,
87.5 (2d, C(1')); 89.2, 89.5 (2t, OCH2O); 113.0, 113.1 (2d, arom. C); 117.3, 117.6 (2s, CN); 122.2 (s, C(5)); 126.8,
126.9, 127.8, 128.1, 128.2, 128.3, 130.0, 130.1, 130.2 (9d, arom. C); 135.6, 135.7, 135.8 (3s, arom. C); 142.1, 142.2
(2d, C(8)); 144.4, 144.5 (2s, arom. C); 149.0, 149.1 (2s, C(4)); 151.0, 151.1 (2s, C(6)); 152.2 (d, C(2)); 158.5, 158.6
‡
(2s, arom. C); 170.3 (s, CO). 31P-NMR (150 MHz, CDCl3): 150.8, 151.5. FAB-MS: 998 (30, [M ‡ H] ), 821 (63),
‡
303 (100, [(MeO)2Tr ] ). Anal. calc. for C52H72N7O9PSi: C 62.57, H 7.27, N 9.82; found: C 62.62, H 7.25, N 9.72.
N2-Acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-{[(triisopropylsilyl)oxy]methyl}guanosine 3'-(2-Cyanoethyl Di-
isopropylphosphoramidite) (20). As described for 18, with 12 (81 g, 0.1 mol), CH2Cl2 (220 ml), iPr2NEt (43 ml,
0.25 mol) and 2-cyanoethyl diisopropylphosphoramidochloridite (28 g, 0.12 mmol). CC (1.5 kg of SiO2, hexane/
AcOEt 1 :1 ! AcOEt, then AcOEt ! AcOEt/MeOH 9 :1 (‡ 3% Et3N)): 20 (91 g, 90%; 1:1 mixture of
diastereoisomers). Colorless foam. TLC (hexane/AcOEt 3 :7): Rf 0.55. UV (MeCN): 276 (13500), 269 (12800),
259 (sh, 17700), 250 (sh, 19700), 237 (24600), 225 (21200). IR (CHCl3): 3360w, 3230w, 3220w, 3000w, 2960m,
2860m, 1700s, 1600s, 1570m, 1510m, 1980m, 1910w, 1860w, 1800w, 1140w, 1100m, 1050m, 1000m, 910w, 880w.
1H-NMR (500 MHz, CDCl3): 0.91 0.94 (m, iPr3Si); 1.02 1.19 (5d, J ˆ 7, ( Me2CH)2N); 1.73, 1.82 (2s, MeCO);
2.25, 2.75 (2m, CH2CN); 3.22 (dd, J ˆ 3.7, 10.7, 0.5 H, HÀC(5')); 3.28 (dd, J ˆ 5.3, 10.6, 0.5 H, HÀC(5')); 3.47
3.62 (m, 3.5 H, (Me2CH)2N, HÀC(5'), POCH2); 3.68 (m, 0.5 H, POCH2); 3.757, 3.760, 3.768, 3.776 (4s, 2 MeO);
3.92, 4.04 (2m, 1.5 H, POCH2); 4.23 (br. q, J ꢁ 2.5, 0.5 H, HÀC(4')); 4.32 (br. dt, J ꢁ 5, 2, 0.5 H, HÀC(4')); 4.52
(ddd, J ˆ 2.0, 4.8, 12.1, 0.5 H, HÀC(3')); 4.62 (ddd, J ˆ 4.8, 5.8, 10.6, 0.5 H, HÀC(3')); 4.91 (s, 1 H, OCH2O);
4.90, 5.00 (2d, J ˆ 5.2, 1 H, OCH2O); 5.02 (dd, J ˆ 4.8, 7.4, 0.5 H, HÀC(2')); 5.05 (t, J ˆ 5.8, 0.5 H, HÀC(2'));
5.87 (d, J ˆ 5.7, 0.5 H, HÀC(1')); 5.97 (d, J ˆ 7.4, 0.5 H, HÀC(1')); 6.76 6.82 (m, 4 arom. C); 7.14 7.52
(m, 9 arom. H); 7.74, 7.80 (2s, HÀC(8)); 8.29, 8.57 (2 br. s, NHÀC(2)); 11.89 (br. s, HÀN(1)). 13C-NMR
(125 MHz, CDCl3): 11.8 (d, (Me2CH)3Si); 17.6, 17.7, 17.8 (3q, (Me2CH)3Si); 20.1 (t, J(C,P) ˆ 3, CH2CN); 20.2
(t, CH2CN); 23.5, 23.6 (2q, MeCO); 24.5, 24.6, 24.7 (3q, (Me2CH)2N); 43.1, 43.3 (2d, J(C,P) ˆ 13, (Me2CH)2N);
55.2, 55.3 (2q, MeO); 56.9 (t, J(C,P) ˆ 19, POCH2); 58.8 (t, J(C,P) ˆ 13, POCH2); 63.5, 63.9 (2t, C(5')); 70.7
(d, J(C,P) ˆ 17), 71.7 (d, J(C,P) ˆ 14), 76.9 (d), 78.3 (d), 84.2 (d), 84.3 (d, J(C,P) ˆ 4), (C(2'), C(3'), C(4')); 86.2
(d, C(1')); 86.3, 86.7 (2s, arom. C); 88.9 (d, C(1')); 89.4, 89.5 (2t, OCH2O); 113.1, 113.2 (2d, arom. C); 117.5,
118.1 (2s, CN); 122.0, 122.7 (2s, C(5)); 127.0, 127.1, 127.9, 128.0, 128.1, 130.0, 130.1, 130.2 (8d, arom. C); 135.6,
135.8, 136.0, 136.3 (4s, arom. C); 137.7, 139.1 (2d, C(8)); 144.6, 145.0 (2s, arom. C); 146.8, 147.1 (2s, C(4)); 148.0,
148.5 (2s, C(2)); 155.6 (s, C(6)); 158.6, 158.7 (2s, arom. C); 171.5, 171.6 (2s, CO). 31P-NMR (150 MHz, CDCl3):
‡
‡
149.9, 150.5. FAB-MS: 1014 (62, [M ‡ H] ), 303 (100, [(MeO)2Tr ] ). Anal. calc. for C52H72N7O10PSi: C 61.58,
H 7.15, N 9.67; found: C 61.22, H 7.19, N 9.55.
5'-O-(4,4'-Dimethoxytrityl)-2'-O-{[(triisopropylsilyl)oxy]methyl}uridine 3'-(2-Cyanoethyl Diisopropylphos-
phoramidite) (21). As described for 18, with 13 (73 g, 0.1 mol), CH2Cl2 (220 ml), iPr2NEt (43 ml, 0.25 mol), and
2-cyanoethyl diisopropylphosphoramidochloridite (28 g, 0.12 mmol). CC (1.5 kg of SiO2, hexane/AcOEt 9 :1 !
3 :7 (‡ 3% Et3N)): 21 (86 g, 92%); 1:1 mixture of diastereoisomers). Colorless foam. TLC (hexane/AcOEt
1:1): Rf 0.65. UV (MeCN): 264 (12100), 236 (23700), 225 (20500). IR (CHCl3): 3380w, 3000w, 2960m, 2860m,
1730s, 1700s, 1600w, 1500m, 1450m, 1350w, 1100w, 1050m, 980w, 890w. 1H-NMR (500 MHz, CDCl3): 1.02 1.05
(m, iPr3Si); 1.06, 1.17 (m, (Me2CH)2N); 2.39, 2.63 (2t, J ˆ 6.7, CH2CN); 3.39 (m, HÀC(5')); 3.53 3.70 (m, 4 H,
(Me2CH)2N, H'ÀC(5'), POCH2); 3.79, 3.80 (2s, 2 MeO); 3.81 3.96 (m, 1 H, POCH2); 4.19, 4.27 (2br. dt, J ꢁ 5,
2, HÀC(4')); 4.40 4.55 (m, HÀC(2'), HÀC(3')); 4.96 5.06 (m, OCH2O); 5.32, 5.36 (2d, J ˆ 8.1, HÀC(5));
6.12 (d, J ˆ 5.1, 0.5 H, HÀC(1')); 6.14 (d, J ˆ 4.9, 0.5 H, HÀC(1')); 6.82 6.85 (m, 4 arom. H); 7.05 7.47
(m, 9 arom. H); 7.80, 7.86 (2d, J ˆ 8.1, HÀC(6)); 8.33 (br. s, HÀN(3)). 13C-NMR (125 MHz, CDCl3): 11.9, 12.0
(2d, (Me2CH)3Si); 17.7, 17.8, 17.9 (3q, (Me2CH)3Si); 20.2, 20.4 (2t, J(C,P) ˆ 7, CH2CN); 24.52, 24.55, 24.58, 24.62
(4q, (Me2CH)2N); 43.2, 43.4 (2d, J(C,P) ˆ 12, (Me2CH)2N); 55.2, 55.3 (2q, MeO); 57.8, 58.9 (2t, J(C,P) ˆ 18,
POCH2); 62.1, 62.5 (2t, C(5')); 70.4, 70.9 (2d, J(C,P) ˆ 15), 77.4, 78.1 (2d, J(C,P) ˆ 4), 83.3 (d, J(C,P) ˆ 4, 83.5
(d) (C(2'), C(3'), C(4')); 87.1, 87.2 (2s, arom. C); 87.4, 89.0 (2d, C(1')); 89.3, 89.4 (2t, OCH2O); 102.3, 102.4
(2d, C(5)); 113.1, 113.2, 113.3 (3d, arom. C); 117.3, 117.7 (2s, CN); 127.2, 127.9, 128.0, 128.2, 128.3, 130.2, 130.3,
130.4 (8d, arom. C); 135.1, 135.3, 135.4, 135.5 (4s, arom. C); 140.3, 140.4 (2d, C(6)); 144.2, 144.3 (2s, arom. C);
150.1 (s, C(2)); 158.7 (s, arom. C); 162.8, 162.9 (2s, C(4)). 31P-NMR (150 MHz, CDCl3): 150.9, 151.3. FAB-MS:
‡
‡
933 (57, [M ‡ H] ), 303 (100, [(MeO)2Tr] ). Anal. calc. for C49H69N4O10PSi: C 63.07, H 7.45, N 6.00; found:
C 62.84, H 7.49, N 5.98.

Helvetica Chimica Acta Vol. 84 (2001)
3793
N4-Acetyl-5'-O-(4,4'-dimethoxytrityl)-3'-O-{[(triisopropylsilyl)oxy]methyl}cytidine 2'-(4-Nitrophenyl Hep-
tanedioate) (22). A soln. of 14 (7.7 g, 10 mmol) in Py (50 ml) was added during 3 h to a soln. of bis(4-
nitrophenyl) heptanedioate (20 g, 50 mmol) and DMAP (1.6 g, 10 mmol) in Py (100 ml). After stirring for 14 h
at r.t., the mixture was evaporated and co-evaporated twice with toluene (200 ml). CC (150 g of SiO2, hexane/
AcOEt 1:1 ! 1:4) gave 22 (6.7 g, 65%). Colorless foam. TLC (hexane/AcOEt 3 :7): Rf 0.50. IR (CHCl3):
3440w, 3000m, 2990m, 2880m, 1740s, 1670s, 1610s, 1600m, 1550m, 1520s, 1510s, 1490s, 1350s, 1300m, 1190s,
1
1080m, 1040m, 1000m, 920w, 900w, 880w. H-NMR (300 MHz, CDCl3): 0.96 1.01 (m, iPr3Si); 1.47 (m, CH2);
1.66 1.80 (m, 2 CH2); 2.21 (s, MeCO); 2.44 (td, J ˆ 7.8, 1.8, 2 CH2); 2.60 (t, J ˆ 7.4, CH2); 3.47 (dd, J ˆ 3.4, 10.9,
HÀC(5')); 3.67 (dd, J ˆ 2.2, 10.9, H'ÀC(5')); 3.80 (s, 2 MeO); 4.33 (br. dt, J ꢁ 6, 3, HÀC(4')); 4.49 (dd, J ˆ 4.7,
6.5, HÀC(3')); 4.80, 4.86 (2d, J ˆ 5.0, OCH2O); 5.45 (dd, J ˆ 3.1, 4.7, HÀC(2')); 6.16 (d, J ˆ 3.1, HÀC(1')); 6.85
(d, J ˆ 8.1, 4 arom. H); 7.03 (d, J ˆ 7.6, HÀC(5)); 7.26 7.42 (m, 11 arom. H); 8.20 (d, J ˆ 7.8, HÀC(6)); 8.23
8.28 (m, 2 arom. H); 9.09 (br. s, NHÀC(4)). 13C-NMR (75 MHz, CDCl3): 11.9 (d, Me2CH); 17.8 (q, Me2CH),
24.3, 24.4, 28.4, 33.8, 34.1 (5t, CH2); 25.0 (q, MeCO); 55.3 (q, MeO); 62.2 (t, C(5')); 72.7, 74.6, 82.4 (3d, C(2'),
C(3'), C(4')); 87.3 (s, arom. C); 89.0 (d, C(1')); 89.5 (t, OCH2O); 96.8 (d, C(5)); 113.5, 116.0 (2d, arom. C);
122.7, 125.4, 126.3, 127.5, 128.2, 128.6, 130.5 (7d, arom. C); 135.4 (s, arom. C); 135.5 (d, C(6)); 144.4, 144.8, 145.5
(3s, arom. C); 155.3 (s, C(2)); 155.8 (s, arom. C); 159.0 (s, arom. C); 162.8 (s, C(4)); 170.4, 172.2 (2s, CO). FAB-
‡
‡
MS: 1038 (25, [M ‡ H] ), 303 (100, [(MeO)2Tr] ).
N6-Acetyl-5'-O-(4,4'-dimethoxytrityl)-3'-O-{[(triisopropylsilyl)oxy]methyl}adenosine 2'-(4-Nitrophenyl
Heptanedioate) (23). As described for 22, with 15 (8.0 g, 10 mmol), Py (50 ml), bis(4-nitrophenyl)
heptanedioate (20 g, 50 mmol), and DMAP (1.6 g, 10 mmol) in Py (100 ml). CC (150 g of SiO2, hexane/
AcOEt 1:1 ! 1:5) gave 23 (6.4 g, 60%). Colorless foam. TLC (hexane/AcOEt 3 :7): Rf 0.50. IR (CHCl3):
3390w, 3380w, 3000m, 2930m, 2900w, 1750m, 1700m, 1610s, 1600s, 1510m, 1500m, 1490w, 1450m, 1400s, 1300m,
1130m, 1040m, 1040w, 990w, 900w, 890w, 880w. 1H-NMR (300 MHz, CDCl3): 0.98 1.05 (m, iPr3Si); 1.41
(m, CH2); 1.61 1.76 (m, 2 CH2); 2.41 (t, J ˆ 7.5, CH2); 2.57 (t, J ˆ 7.5, CH2); 2.21 (s, MeCO); 3.42 (dd, J ˆ 4.3,
10.2, HÀC(5')); 3.53 (dd, J ˆ 2.8, 10.2, H'ÀC(5')); 3.77 (s, 2 MeO); 4.46 (br. q, J ꢁ 4, HÀC(4')); 4.80 (t, J ˆ 4.9,
HÀC(3')); 4.84, 4.97 (2dd, J ˆ 5.0, OCH2O); 5.91 (t, J ˆ 5.2, HÀC(2')); 6.27 (d, J ˆ 5.2, HÀC(1')); 6.77 (d, J ˆ
8.4, 4 arom. H); 7.22 7.42 (m, 11 arom. H); 8.11 (s, HÀC(2)); 8.23 8.26 (m, 2 arom. H); 8.60 (s, HÀC(8));
8.65 (br. s, NHÀC(6)). 13C-NMR (75 MHz, CDCl3): 11.9 (d, Me2CH); 17.8 (q, Me2CH); 24.3, 24.4, 28.4, 33.6,
34.0 (5t, CH2); 25.6 (q, MeCO); 55.3 (q, MeO); 63.4 (t, C(5')); 74.7, 74.8, 83.7 (3d, C(2'), C(3'), C(4')); 86.5
(s, arom. C); 86.9 (d, C(1')); 89.9 (t, OCH2O); 113.4 (d, arom. C); 122.6 (s, C(5)); 125.4, 126.4, 127.2, 128.1,
128.5, 130.3 (6d, arom. C); 135.8 (s, arom. C); 141.7 (d, C(8)); 144.6, 145.6 (2s, arom. C); 149.4 (s, C(4)); 151.4
(s, C(6)); 152.8 (d, C(2)); 155.7 (s, arom. C); 158.9 (s, arom. C); 170.6, 171.3, 172.6 (3s, CO). FAB-MS: 1061
‡
‡
(10, [M ‡ H] ), 303 (100, [(MeO)2Tr ] ).
5'-O-(4,4'-Dimethoxytrityl)-3'-O-{[(triisopropylsilyl)oxy]methyl}uridine 2'-(4-Nitrophenyl Heptanedioate)
(24). As described for 22, with 17 (7.3 g, 10 mmol), Py (50 ml), bis(4-nitrophenyl) heptanedioate (20 g,
50 mmol), and DMAP (1.6 g, 10 mmol) in Py (100 ml). CC (150 g of SiO2, hexane/AcOEt 4 :1 ! 2 :3) gave 24
(6.9 g, 70%). Colorless foam. TLC (hexane/AcOEt 1 :1): Rf 0.45. IR (CHCl3): 3380w, 3000w, 2960w, 2880w,
1750m, 1720s, 1690s, 1610w, 1600w, 1460m, 1350m, 1120m, 1080w, 1040m, 1000w, 930w, 1390w, 1360w. 1H-NMR
(300 MHz, CDCl3): 1.00 (m, iPr3Si); 1.46 (m, CH2); 1.66 1.83 (m, 2 CH2); 2.44 (t, J ˆ 7.8, CH2); 2.61 (t, J ˆ 7.5,
CH2); 3.46 (dd, J ˆ 2.8, 10.9, HÀC(5')); 3.56 (dd, J ˆ 2.1, 10.9, H'ÀC(5')); 3.79 (s, 2 MeO); 4.32 (br. td, J ꢁ 2, 5,
HÀC(4')); 4.58 (t, J ˆ 4.7, HÀC(3')); 4.83, 4.95 (2d, J ˆ 5.0, OCH2O); 5.30 (d, J ˆ 8.1, HÀC(5)); 5.42 (t, J ˆ 5.3,
HÀC(2')); 6.19 (d, J ˆ 5.6, HÀC(1')); 6.81 6.85 (m, 4 arom. H); 7.26 7.40 (m, 11 arom. H); 7.75 (d, J ˆ 8.1,
HÀC(6)); 8.24 8.27 (m, 2 arom. H); 8.50 (br. s, HÀN(3)). 13C-NMR (75 MHz, CDCl3): 11.9 (d, Me2CH); 17.8
(q, Me2CH); 24.3, 24.4, 28.4, 33.7, 34.1 (5t, CH2); 55.3 (q, MeO); 62.8 (t, C(5')); 74.1, 74.5, 83.3 (3d, C(2'), C(3'),
C(4')); 86.6 (s, arom. C); 87.5 (d, C(1')); 89.7 (t, OCH2O); 102.8 (d, C(5)); 113.5 (d, arom. C); 122.6, 125.4, 127.5,
128.3, 128.5, 130.4, 130.5 (7d, arom. C); 135.2, 135.4, (2s, arom. C); 140.2 (d, C(6)); 144.3, 145.6 (2s, arom. C);
150.4 (s, C(2)); 155.7 (s, arom. C); 159.1 (s, arom. C); 163.0 (s, C(4)); 171.3, 172.6 (2s, CO). FAB-MS: 995 (18,
‡
‡
[M ‡ H] ), 303 (100, [(MeO)2Tr ] ).
N2-Acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-{[(triisopropylsilyl)oxy]methyl}guanosine 3'-(4-Nitrophenyl
Heptanedioate) (25). A soln. of 13 (8.1 g, 10 mmol) in Py (50 ml) was added during 3 h to a soln. of bis(4-
nitrophenyl) heptanedioate (20 g, 50 mmol) and DMAP (1.6 g, 10 mmol) in Py (100 ml). After stirring for 72 h
at 358, the mixture was evaporated and co-evaporated twice with toluene (200 ml). CC (150 g of SiO2, hexane/
AcOEt 1:1 ! AcOEt, then AcOEt ! AcOEt/EtOH 9 :1) gave 25 (6.5 g, 65%). Colorless foam. TLC (hexane/
AcOEt 1:9): Rf 25. IR (CHCl3): 3370w, 3005w, 2945w, 2870w, 1700s, 1680s, 1560m, 1525m, 1510m, 1490w, 1465w,
1415w, 1350m, 1300m, 1120m, 1035m, 885w, 830w. 1H-NMR (300 MHz, CDCl3): 0.91 1.00 (m, iPr3Si); 1.41
(s, MeCO); 1.48 (m, CH2); 1.71 (m, CH2); 1.79 (m, CH2); 2.42 (m, CH2); 2.62 (t, J ˆ 7.5, CH2); 3.17 (dd, J ˆ 2.8,

3794
Helvetica Chimica Acta Vol. 84 (2001)
10.6, HÀC(5')); 3.55 (dd, J ˆ 2.2, 10.6, H'ÀC(5')); 3.78, 3.75 (2s, 2 MeO); 4.22 (br. q, J ꢁ 2, HÀC(4')); 4.85, 4.89
(2d, J ˆ 5.3, OCH2O); 5.47 (dd, J ˆ 5.3, 7.8, HÀC(2')); 5.61 (dd, J ˆ 1.8, 5.3, HÀC(3')); 5.85 (d, J ˆ 7.8,
HÀC(1')); 6.76 6.80 (m, 4 arom. H); 7.24 7.57 (m, 11 arom. H, NHÀC(2)); 7.78 (s, HÀC(8)); 8.23 8.28
(m, 2 arom. H); 11.77 (br. s, HÀN(1)). 13C-NMR (75 MHz, CDCl3): 11.8 (d, Me2CH); 17.6 (q, Me2CH); 23.4
(q, MeCO), 24.3, 24.4, 28.4, 33.9, 34.1 (5t, CH2); 55.4 (q, arom. H); 63.6 (t, C(5')); 71.8, 76.3, 82.8 (3d, C(2'),
C(3'), C(4')); 86.6 (d, C(1')); 86.9 (s, arom. C); 90.0 (t, OCH2O); 113.5, 113.6 (2d, arom. C); 122.8 (s, C(5));
122.6, 125.5, 126.3, 127.5, 128.3, 128.4, 128.6, 130.2, 130.3 (9d, arom. C); 135.7, 136.3 (2s, arom. C); 139.5
(d, C(8)); 145.2, 145.6 (2s, arom. C); 146.9 (s, C(4)); 148.5 (s, C(2)); 155.6 (s, C(6)); 155.7 (s, arom. C); 159.1
‡
‡
(s, arom. C); 171.4, 171.5, 172.9 (3s, CO). FAB-MS: 1077 (20, [M ‡ H] ), 303 (100, [(MeO)2Tr] ).
Preparation of Solid Supports. To a soln. of the active esters 22 25 (0.25 mmol) in DMF (8 ml) was added
long-chain-alkylamino CPG (2 g) and then Pr2NEt (0.8 ml). The mixtures were shaken for 20 h at r.t. After
i
filtration, the solids were washed with DMF and CH2Cl2, dried, suspended in Py (5 ml) and Ac2O (3 ml), and
shaken for 2 h at r.t. After filtration, the solids were washed with DMF and CH2Cl2 and dried under high
vacuum. Typical loadings of the solid supports were 30 and 20 mmol/g with 500-ä and 1000-ä CPG,
respectively.
REFERENCES
[1] R. L. Letsinger, J. L. Finnan, G. A. Heavner, W. B. Lunsford, J. Am. Chem. Soc. 1975, 97, 3278.
[2] M. H. Caruthers, A. D. Barone, S. L. Beaucage, D. R. Dodds, E. F. Fisher, L. J. McBride, M. Matteucci, Z.
Stabinsky, J. Y. Tang, Methods Enzymol. 1987, 154, 287.
[3] S. P. Adams, K. S. Kavka, E. J. Wykes, S. B. Holder, G. R. Galluppi, J. Am. Chem. Soc. 1983, 105, 661.
[4] L. J. McBride, M. H. Caruthers, Tetrahedron Lett. 1983, 24, 245.
[5] N. D. Sinha, J. Biernat, J. McManus, H. Kˆster, Nucleic Acids Res. 1984, 12, 4539.
[6] M. Smith, D. H. Rammler, I. H. Goldberg, H. G. Khorana, J. Am. Chem. Soc. 1962, 84, 430.
[7] B. E. Griffin, C. B. Reese, Tetrahedron Lett. 1964, 5, 2925.
[8] C. B. Reese, M. V. Rao, H. T. Serafinowska, E. A. Thompson, P. S. Yu, Nucleosides Nucleotides 1991, 10, 81.
[9] S. A. Scaringe, F. E. Wincott, M. H. Caruthers, J. Am. Chem. Soc. 1998, 120, 11820.
[10] E. Ohtsuka, S. Tanaka, M. Ikehara, Nucleic Acids Res. 1974, 1, 1351.
[11] M. E. Schwartz, R. R. Breaker, G. T. Asteriadis, J. S. deBear, G. R. Gough, Bioorg. Med. Chem. Lett. 1992,
2, 1019.
[12] S. Pitsch, Helv. Chim. Acta 1997, 80, 2286.
[13] S. Pitsch, P. A. Weiss, X. Wu, D. Ackermann, T. Honegger, Helv. Chim. Acta 1999, 82, 1753.
[14] K. K. Ogilvie, K. L. Sadana, E. A. Thompson, M. A. Quilliam, J. B. Westmore, Tetrahedron Lett. 1974, 15,
2861.
[15] N. Usman, R. T. Pon, K. K. Ogilvie, Tetrahedron Lett. 1985, 26, 4567.
[16] S. L. Beaucage, M. H. Caruthers, in −Bioorganic Chemistry: Nucleic Acids×, Ed. S. M. Hecht, Oxford
University Press, Oxford, 1996, p. 36.
[17] S. Pitsch, P. A. Weiss, L. Jenny, Ribonucleoside-derivative and method for preparing the same, US Patent
5,986,084, Nov. 16, 1999.
[18] X. Wu, S. Pitsch, Nucleic Acids Res. 1998, 26, 4315.
[19] X. Wu, S. Pitsch, Bioconjugate Chem. 1999, 10, 921.
[20] X. Wu, S. Pitsch, Helv. Chim. Acta 2000, 83, 1127.
[21] A. Stutz, S. Pitsch, Helv. Chim. Acta 2000, 83, 2477.
[22] M. P. Reddy, N. B. Hanna, F. Farooqui, Nucleosides Nucleotides 1997, 16, 1589.
[23] G. S. Ti, B. L. Gaffney, R. A. Jones, J. Am. Chem. Soc. 1982, 104, 1316.
[24] T. Benneche, L. L. Gundersen, K. A. Undheim, Acta Chem. Scand. 1988, 42, 384.
[25] L. L. Gundersen, T. Benneche, K. A. Undheim, Acta Chem. Scand. 1989, 43, 706.
[26] T. Benneche, P. Strande, K. A. Undheim, Synthesis 1983, 9, 762.
[27] E. Lieber, T. Enkoji, J. Org. Chem. 1961, 26, 4472.
[28] V. Boudou, J. Langridge, A. Van Aerschot, C. Hendrix, A. Millar, P. Weiss, P. Herdewijn, Helv. Chim. Acta
2000, 83, 152.
[29] U. Pieles, W. Z¸rcher, H. Moser, Nucleic Acids Res. 1993, 21, 3191.
[30] C. W. Gehrke, K. C. T. Kuo, in −Chromatography and Modification of Nucleosides×, Eds. K. C. T. Kuo and
C. W. Gehrke, Elsevier, Amsterdam, The Netherlands, 1990, Vol. 45A, p. A3.

Helvetica Chimica Acta Vol. 84 (2001)
[31] F. Wohlrab, Methods Enzymol. 1992, 212, 294.
3795
[32] R. Micura, Chem. Eur. J. 1999, 5, 2077.
[33] W. Pils, R. Micura, Nucleic Acids Res. 2000, 28, 1859.
[34] R. Micura, W. Pils, K. Grubmayr, Angew. Chem., Int. Ed. 2000, 39, 922.
[35] M. O. Ebert, B. Jaun, W. Pils, R. Micura, Helv. Chim. Acta 2000, 83, 2336.
[36] M. Huenges, C. Rolz, R. Gschwind, R. Peteranderl, F. Berglechner, G. Richter, A. Bacher, H. Kessler, G.
Gemmecker, EMBO J. 1998, 17, 4092.
[37] M. Br‰nnvall, N. E. Mikkelsen, L. A. Kirsebom, Nucleic Acids Res. 2001, 29, 1426.
[38] M. C. Nagan, P. Beuning, K. Musier-Forsyth, C. J. Cramer, Nucleic Acids Res. 2000, 28, 2527.
[39] R. I. Hogrefe, A. P. McCaffrey, L. U. Borozdine, E. S. McCampbell, M. M. Vaghefi, Nucleic Acids Res.
1993, 21, 4739.
Received June 26, 2001